Table S1: The function and clinical relevance of select ... · Table S1: The function and clinical relevance of select ... ... Neuron The

Development 142: doi:10.1242/dev.117978: Supplementary Material

Neuropeptidergic cell type

Neuron localization

Principal projection targets of

hypothalamic

neurons

Principal physiological

function

Principal gain-of-function phenotype

Principal loss-of-function phenotype

Principal relevant human diseases

Therapeutic potential

MCH Melanin concentrating

hormone

LHA (Bittencourt et al., 1992; Nahon et

al., 1989; Qu et al., 1996)

Widespread in brain and spinal cord

(Bittencourt et al.,

1992; Nahon et al., 1989; Qu et al.,

1996)

Increased feeding behavior, decreased

energy expenditure (Qu et al., 1996)

Hyperphagia, weight gain (Della-Zuana et al., 2002; Ito et al.,

2003; Ludwig et al., 2001; Qu et al., 1996)

Hypophagia, increased metabolic rate, resistance to

obesity (Shimada et al., 1998)

Diet-induced obesity, familial

obesity (Hinney et

al., 1999; Sina et al., 1999)

In vitro models of

obesity, drugs to modulate feeding

behavior and energy expenditure

(Johansson, 2011)

AVP

Arginine vasopressin

SON, PVN (Sukhov et al., 1993;

Vandesande and

Dierickx, 1975; Vandesande et al.,

1975)

adenohypophysis, hypothalamus,

amygdala, BNST

(Caldwell et al., 2008)

Regulation of blood pressure, heart rate,

and aggression

(Caldwell et al., 2008)

Natriuresis and diluting hyponatremia

(Bittencourt et al., 1992; Chan and Sawyer, 1962;

Nagasaki et al., 2002; Nahon et al., 1989;

Nashold et al., 1963;

Zamir et al., 1986)

diabetes insipidus due to dehydration

(Bohus and de Wied, 1998; Qu et al., 1996)

Hypertension, diabetes,

aggression, social

disorders (Caldwell et al., 2008; Della-Zuana et al., 2002;

Ito et al., 2003; Ludwig et al., 2001;

Qu et al., 1996;

Vokes and Robertson, 1988)

Drugs to modulate

blood pressure, social and mood

disorders (Manning

et al., 2008; Shimada et al.,

1998)

TRH Thyrotropin releasing

hormone

PVN, scattered cells in other brain regions

(Hinney et al., 1999; Hökfelt et al., 1989;

Segerson et al., 1987;

Sina et al., 1999)

ME, also hypothalamic and

other central targets (Johansson, 2011;

Segerson et al.,

1987; Wittmann et al., 2009)

Energy homeostasis via stimulation the

thyroid gland

(Lechan and Fekete, 2006; Sukhov et al., 1993; Vandesande

and Dierickx, 1975; Vandesande et al.,

1975),

Enhanced basal metabolic rate, wakefulness,

Hypophagia (Boschi and Rips, 1981;

Caldwell et al., 2008;

Suzuki et al., 1982; Vijayan and McCann,

1977)

Hypothyroidism and

decreased growth (Caldwell et al., 2008;

Jackson, 1976;

Rabeler et al., 2004)

Hypothyroidism,

obesity, depression (Fliers et al., 2006;

Jackson, 1982;

Prange et al., 1972)

Drugs to treat

hypothyroidism, obesity, and mood disorders (Jackson,

1982)

HCRT Hypocretin/orexin

LHA (de Lecea et al., 1998; Sakurai, 2007;

Sakurai et al., 1998)

Widespread in brain and spinal cord

(Peyron et al., 1998;

van den Pol, 1999)

Stabilization of sleep and wakefulness

(Sakurai, 2007)

Increased

wakefulness and locomotor activity

(Adamantidis et al.,

2007; Hagan et al., 1999; Mieda et al.,

2004)

Narcolepsy (Chemelli

et al., 1999; Hara et al., 2001; Lin et al., 1999; Peyron et al.,

2000; Thannickal et al., 2000)

Narcolepsy when HCRT neurons are lost (Peyron et al.,


Cell transplantation, in vitro models of

narcolepsy, drugs to modulate

wakefulness (Arias-

Carrion et al., 2012; Gotter et al., 2012; Mieda et al., 2004;

Qu et al., 1996)

Table S1: The function and clinical relevance of select neuropeptidergic hypothalamic neuron types.

Development | Supplementary Material


ARC: arcuate nucleus of the hypothalamus, BNST: bed nucleus of the stria terminalis, PVN: paraventricular nucleus of the hypothalamus, LHA: lateral hypothalamic area, DMH: dorsomedial hypothalamus, MC4-R: melanocortin receptor 4, MCH-R1: melanin concentrating hormone receptor 1, SCN = suprachiasmatic nucleus of the hypothalamus, SON: supraoptic nucleus of the hypothalamus, ME: median

eminence, ACTH: adrenocorticotropic hormone, *effect of -MSH, one of the post-translational cleavage products of the POMC gene.

CRH Corticotropin

releasing hormone

PVN, scattered cells

in other brain regions (Chan and Sawyer,

1962; Nagasaki et al.,

2002; Nashold et al., 1963; Pelletier et al., 1983; Swanson et al.,

1983)

ME, hypothalamus and midbrain (Bohus

and de Wied, 1998; Pelletier et al., 1983)

Orchestrates stress response (Caldwell et al., 2008; Spiess

et al., 1981; Vale et al., 1981; Vokes and

Robertson, 1988)

Cushing’s disease, aberrant stress

response (Manning et

al., 2008; Stenzel-Poore et al., 1992)

Impaired adrenal

function, decreased stress response, reduced anxiety

(Hökfelt et al., 1989; Muglia et al., 1995;

Segerson et al., 1987;

Timpl et al., 1998)

Cushing’s disease, stress disorders,

depression (Kasckow et al., 2001; Keck and

Holsboer, 2001; Laryea et al., 2012;

Segerson et al.,

1987; Wittmann et al., 2009)

In vitro models of

stress response,

drugs to modulate stress and related

disorders (Keck and

Holsboer, 2001; Lechan and Fekete, 2006; Zoumakis and

Chrousos, 2010)

OXT

Oxytocin

SON, PVN (Boschi and Rips, 1981;

Sukhov et al., 1993; Suzuki et al., 1982; Vandesande and

Dierickx, 1975; Vandesande et al., 1975; Vijayan and

McCann, 1977)

adenohypophysis,

hypothalamus and surrounding brain areas (Jackson,

1976; Lee et al., 2009; Rabeler et al.,

2004)

Milk release, uterine

contraction, social recognition, and pair bonding (Fliers et al.,

2006; Jackson, 1982; Lee et al.,

2009; Prange et al.,

1972)

Increased parental behavior and social

recognition (Jackson,

1982; Ross and Young, 2009)

impaired social and

reproductive behavior (Garrison et al., 2012; Nishimori et al., 1996;

Young et al., 1996) anxiety, aggression

(de Lecea et al.,

1998; Ferguson et al., 2000; Sakurai, 2007; Sakurai et al., 1998;

Takayanagi et al., 2005; Winslow et al.,

2000)

Anxiety,

schizophrenia, autism, mood

disorders (Lee et al.,

2009; Peyron et al., 1998; van den Pol,

1999)

Drugs to induce labor, aid in milk

production (Hayes

and Weinstein, 2008; Sakurai,

2007), treat social

and mood disorders (Adamantidis et al., 2007; Hagan et al.,

1999; Manning et al., 2008; Mieda et al.,

2004)

AGRP Agouti-related peptide

ARC (Broberger et al., 1998; Chemelli et

al., 1999; Hahn et al., 1998; Hara et al.,

2001; Lin et al., 1999;

Peyron et al., 2000; Shutter et al., 1997;

Thannickal et al.,

2000)

PVN, LHA (Elias et al., 1998; Peyron et al., 2000; Thannickal

et al., 2009)

Increased feeding behavior (Lu et al.,

1994; Ollmann et al.,

1997; Shutter et al., 1997)

Hyperphagia and obesity (Graham et

al., 1997)

Hypophagia and

starvation when neurons are ablated in adults (Gropp et

al., 2005; Luquet et al., 2005)

Obesity (Mizuno and Mobbs, 1999)

In vitro models of

obesity, drugs to modulate feeding

behavior and energy

expenditure (Crowley et al.,

2002)

POMC/ -MSH

Proopio-melanocortin/

alpha melanin stimulating hormone

ARC (Della-Zuana et

al., 2002; Gee et al., 1983; Ito et al., 2003; Ludwig et al., 2001;

Qu et al., 1996)

PVN, DMH, LHA, other brain targets

(Alon, 2006; Elias et al., 1998; Elmquist

et al., 1999;

Khachaturian et al., 1984; Shimada et

al., 1998)

Inhibition of feeding behavior (Fan et al.,

1997; Hinney et al., 1999; Huszar et al.,

1997; Lu et al.,

1994; Sina et al., 1999)

Hypophagia, reduced

body weight (Johansson, 2011;

Poggioli et al., 1986;

Tsujii and Bray, 1989)

Hyperphagia, obesity, defective adrenal

development (Sukhov

et al., 1993; Vandesande and Dierickx, 1975;

Vandesande et al., 1975; Yaswen et al.,

1999)

Familial and acquired obesity

(Bouret et al., 2008; Caldwell et al., 2008; Cowley et al., 2001;

Enriori et al., 2007; Krude et al., 1998;

Yaswen et al., 1999)

In vitro models of

obesity, drugs to

modulate feeding behavior and energy

expenditure

(Caldwell et al., 2008; Mineur et al.,

2011)


Development 142: doi:10.1242/dev.117978: Supplementary Material Table S2. Primary antibodies

Antigen Supplier Catalog # or clone Species Dilution

AGRP Neuromics GT15023 goat 1:250

aPKC Santa Cruz Biotechnology SC-216 rabbit 1:1000

AVP Millipore AB1565 rabbit 1:2500

CHAT Millipore AB144P goat 1:200

CRH Gift from Wylie Vale (Salk Institute, La Jolla CA)

Antiserum #PRL rC68 (7/12/83)

rabbit 1:10000

DYNA Abcam AB82509 rabbit 1:100

FOXG1 Santa Cruz Biotechnology SC-18583 goat 1:200

GABA Sigma A2052 rabbit 1:1000

GFAP Sigma G3893 mouse 1:1000

GFAP DAKO Z0334 rabbit 1:1000

HCRTA Chemicon AB3704 rabbit 1:500

HCRTA R&D Systems MAB763 mouse 1:500

Human cytoplasmic antigen StemCells AB-121 (SC121) mouse 1:1000

Human nuclear antigen Millipore MAB1281, clone 235-1 mouse 1:1000

MAP2 Abcam ab5392 chicken 1:10000

MAP2 Chemicon AB5622 rabbit 1:1000

MCH Sigma M8440 rabbit 1:1000

NEUN Millipore MAB377 mouse 1:100

NKX2.1 Zymed 18-0221 mouse 1:500

NPTX2 Proteintech PTG-10889 rabbit 1:100

OTP Abcam AB50897 rabbit 1:1000

OXT Millipore MAB5296 mouse 1:100

pHH3 Millipore 06-570 rabbit 1:1000

POMC ( MSH) Millipore AB5087 sheep 1:1000

RAX Gift from Yoshiki Sasai (RIKEN) rabbit 1:500

SIM1 Santa Cruz Biotechnology SC-8714 goat 1:100

SOX1 Millipore AB15766 rabbit 1:200

Synapsin Millipore AB1543 rabbit 1:500

Trosine hydroxylase Millipore AB152 rabbit 1:1000

TRH Gift from Valer Csernus (Univ. Med. School, Pecs, Hungary)

RTH-46 rabbit 1:10000

TUJ1 Covance MMS-435P mouse 1:1000

TUJ1 Covance MRB-435P rabbit 1:1000


Development 142: doi:10.1242/dev.117978: Supplementary Material Table S3. Primers used for quantitative RT-PCR

Gene NCBI Reference Sequence ID

Forward Primer Reverse Primer

EMX1 NM_004097.2 cgccttcgagaagaaccact ggagcccttcttcttctgct

EN2 NM_001427.3 aagacgctctcgctgcac gttttcgagacctgggacct

FOXG1 NM_005249.3 gtcaatgacttcgcagagca cagacagtcccccagacagt

NKX2.1 NM_003317.3 aggacaccatgaggaacagc gccatgttcttgctcacgtc

RAX NM_013435.2 cacttagcccgtcggttct gcgttcgagaagtcccacta

OTP NM_032109.2 gagcttcgccaagactcact tttttgcgcttcttccactt

SIM1 NM_005068.2 tttctgtgtgaaatcccgaa ctataccagcagctccaccc



Neuron type human hypothalamus Rodent hypothalamus

% neuropept.

neurons in human

hypothalamus

% neuropept.

neurons in human brain

% neuropept.

neurons from hPSC self-patterning

% neuropept.

neurons from hPSC directed differentiation

MCH 1.1x105 [8.8-104 - 1.3x105] (Aziz et al.,


Rat: 8.0x103 - 1.3x104

(Bittencourt et al., 1992; Kessler et al., 2011; Modirrousta et al., 2005)

4.2x10-2 [3.4x10-2 – 5.0x10-2]

1.2x10-4 [1.0x10-4 – 1.5x10-4]

2.9x10-2 (1.1x10-2) 2.5x10-1 (3.6x10-2)

HCRT 7.0x104 {Thannickal:2007kb,

Thannickal:2000ws}

Rat: 4.0x103

(Kessler et al., 2011) Mouse: 1.1x103

(de Lecea et al., 1998; Peyron et al.,

1998)

2.7x10-2 8.1x10-5 2.4x10-2 (9.4x10-3) 2.2x10-1 (2.5x10-2)

AVP 5.4x104 (Fliers et al., 1985; Morton,

1969; Van der Woude et al., 1995)

Mouse: 4.0x103

(Bult et al., 1992; Ison et al., 1993) 5.0x10-2 6.3x10-5 2.2x10-2 (1.1 x10-2) 0

OXT

3.2x104

(Fliers et al., 1985; Morton, 1969; Vogels et al., 1990; Wierda et al., 1991)

1.2x10-2 3.7x10-5 1.9x10-2 (8.6x10-3) 0

CRH

1.0x104

(Bao, 2005; Erkut et al., 1995; Meynen et al., 2007)

3.9x10-3 1.2x10-5 1.3x10-1 (3.3x10-2) 1.1x10-1 (1.5x10-2)

TRH 9.7x104 [5.4x104 – 1.4x105] Rat: 8.0x103

(Fliers et al., 1994; Hökfelt et al., 1989; Hökfelt et al., 1975; Tsuruo et al., 1988)

3.7x10-2 [2.0x10-2 – 5.4x10-2]

1.1x10-4 [6.3x10-5 – 1.6x10-4] 8.3x10-2 (3.5 x10-2) 2.8x10-2 (9.9x10-3)

POMC 1.4x105 [4.1x104 - 2.3x105] Mouse: 3.0x103 - 3.65x103

(Cowley et al., 2001; Huo, 2006)

5.4x10-2 [1.6x10-2 – 8.8x10-2]

1.6x10-4 [4.8x10-5 – 2.7x10-4]

2.7x10-2 (9.0x10-3) 2.9x19-1 (3.8x10-2)

AGRP 1.4x105 [5.0x104 - 2.4x105] Mouse: 3.7x103

(Leibowitz and Wortley, 2004; Wu et al., 2012)

5.4x10-2 [1.9x10-2 – 9.2x10-2]

1.6x10-4 [5.8x10-5 – 2.8x10-4]

2.7x10-2 (1.2x10-2) 8.3x10-2 (1.4x10-2)

Scored neuropept.

neurons

6.4x105 [4.0x105 – 9.1x105] 2.8x10-1 [1.8x10-1 -

3.8x10-1]

7.4x10-4 [4.6x10-4

– 1.1x10-3] 3.6x10-1 (7.9x10-1) 9.8x10-1 (3.9x10-1)

Table S4. Incidence of neuropeptidergic neurons in the human brain. Neuron counts are taken from stereological studies as indicated. Human neuron number for TRH, POMC, and AGRP (in italics) were calculated from rodent data and are presented as the mean and range of the estimated values. To estimate human neuropeptidergic neuron number, the measured number of rodent neuropeptidergic neurons was multiplied by the ratio of human to rodent neuropeptidergic neurons taken from primary data for rodent and human MCH, HCRT, and AVP neurons. For human to rat comparisons, these ratios ranged from 6.8:1 (MCH) to 17.5:1 (HCRT). For human to mouse comparisons, ratios ranged from 13.5:1 (AVP) to 64:1 (HCRT). Reported or estimated neuron counts were converted to percent hypothalamic or brain abundance by dividing them by the total number of neurons in these structures. The number of neurons in the adult human hypothalamus (2.6x108) was estimated from its fractional volume (0.3%) (Swaab, 1992) and the total number of neurons in the adult human brain (8.6x1010) (Azevedo et al., 2009; Herculano-Houzel, 2012; Williams and Herrup, 1988). Numbers in brackets correspond to the range of reported or estimated values. Numbers in parentheses correspond to measured standard error of the mean for each cell type and the average standard error of the mean for the sum of scored cell types.



Supplementary References Adamantidis, A. R., Zhang, F., Aravanis, A. M., Deisseroth, K. and de Lecea, L. (2007). Neural

substrates of awakening probed with optogenetic control of hypocretin neurons. Nature 450, 420–

424.

Alon, T. (2006). Late-Onset Leanness in Mice with Targeted Ablation of Melanin Concentrating Hormone Neurons. Journal of Neuroscience 26, 389–397.

Arias-Carrion, O., Drucker-Colin, R. and Murillo-Rodríguez, E. (2012). Hypocretin (orexin) cell transplantation diminishes narcoleptic-like sleep behavior in rats. CNS Neurol Disord Drug Targets.

Azevedo, F. A., Carvalho, L. R., Grinberg, L. T., Farfel, J. M., Ferretti, R. E., Leite, R. E., Jacob Filho, W., Lent, R. and Herculano-Houzel, S. (2009). Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain. J. Comp. Neurol. 513, 532–541.

Aziz, A., Fronczek, R., Maat-Schieman, M., Unmehopa, U., Roelandse, F., Overeem, S., van Duinen, S., Lammers, G. J., Swaab, D. and Roos, R. (2008). Hypocretin and melanin-concentrating hormone in patients with Huntington disease. Brain Pathol. 18, 474–483.

Bao, A. M. (2005). Colocalization of corticotropin-releasing hormone and oestrogen receptor- in the paraventricular nucleus of the hypothalamus in mood disorders. Brain 128, 1301–1313.

Bittencourt, J. C., Presse, F., Arias, C., Peto, C., Vaughan, J., Nahon, J. L., Vale, W. and Sawchenko, P. E. (1992). The melanin-concentrating hormone system of the rat brain: an immuno- and hybridization histochemical characterization. J. Comp. Neurol. 319, 218–245.

Bohus, B. and de Wied, D. (1998). The vasopressin deficient Brattleboro rats: a natural knockout model used in the search for CNS effects of vasopressin. Prog. Brain Res. 119, 555–573.

Boschi, G. and Rips, R. (1981). Effects of thyrotropin releasing hormone injections into different loci of rat brain on core temperature. Neuroscience Letters 23, 93–98.

Bouret, S. G., Gorski, J. N., Patterson, C. M., Chen, S., Levin, B. E. and Simerly, R. B. (2008). Hypothalamic neural projections are permanently disrupted in diet-induced obese rats. Cell Metabolism 7, 179–185.

Broberger, C., de Lecea, L., Sutcliffe, J. G. and HOKFELT, T. (1998). Hypocretin/orexin- and melanin-concentrating hormone-expressing cells form distinct populations in the rodent lateral hypothalamus: relationship to the neuropeptide Y and agouti gene-related protein systems. J. Comp. Neurol. 402, 460–474.

Bult, A., van der Zee, E. A., Compaan, J. C. and Lynch, C. B. (1992). Differences in the number of arginine-vasopressin-immunoreactive neurons exist in the suprachiasmatic nuclei of house mice selected for differences in nest-building behavior. Brain Research 578, 335–338.

Caldwell, H. K., Lee, H.-J., Macbeth, A. H. and Young, W. S. (2008). Vasopressin: behavioral roles of an “original” neuropeptide. Progress in Neurobiology 84, 1–24.

Chan, W. Y. and Sawyer, W. H. (1962). Natriuresis in conscious dogs during arginine vasopressin infusion and after oxytocin injection. Proc. Soc. Exp. Biol. Med. 110, 697–699.

Chemelli, R. M., Willie, J. T., Sinton, C. M., Elmquist, J. K., Scammell, T., Lee, C., Richardson, J.



A., Williams, S. C., Xiong, Y., Kisanuki, Y., et al. (1999). Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell 98, 437–451.

Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdán, M. G., Diano, S., Horvath, T. L., Cone, R. D. and Low, M. J. (2001). Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 411, 480–484.

Crowley, V. E. F., Yeo, G. S. H. and O’Rahilly, S. (2002). Obesity therapy: altering the energy intake-and-expenditure balance sheet. Nat Rev Drug Discov 1, 276–286.

de Lecea, L., Kilduff, T. S., Peyron, C., Gao, X., Foye, P. E., Danielson, P. E., Fukuhara, C., Battenberg, E. L., Gautvik, V. T., Bartlett, F. S. 2., et al. (1998). The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc. Natl. Acad. Sci. U.S.A. 95, 322–327.

Della-Zuana, O., Presse, F., Ortola, C., Duhault, J., Nahon, J. L. and Levens, N. (2002). Acute and

chronic administration of melanin-concentrating hormone enhances food intake and body weight in Wistar and Sprague-Dawley rats. Int. J. Obes. Relat. Metab. Disord. 26, 1289–1295.

Elias, C. F., Saper, C. B., Maratos-Flier, E., Tritos, N. A., Lee, C., Kelly, J., Tatro, J. B., Hoffman, G. E., Ollmann, M. M., Barsh, G. S., et al. (1998). Chemically defined projections linking the mediobasal hypothalamus and the lateral hypothalamic area. The Journal of comparative neurology 402, 442–459.

Elmquist, J. K., Elias, C. F. and Saper, C. B. (1999). From lesions to leptin: hypothalamic control of food intake and body weight. Neuron 22, 221–232.

Enriori, P. J., Evans, A. E., Sinnayah, P., Jobst, E. E., Tonelli-Lemos, L., Billes, S. K., Glavas, M. M., Grayson, B. E., Perello, M., Nillni, E. A., et al. (2007). Diet-induced obesity causes severe but reversible leptin resistance in arcuate melanocortin neurons. Cell Metabolism 5, 181–194.

Erkut, Z. A., Hofman, M. A., Ravid, R. and Swaab, D. F. (1995). Increased activity of hypothalamic corticotropin-releasing hormone neurons in multiple sclerosis. Journal of Neuroimmunology 62, 27–

33.

Fan, W., Boston, B. A., Kesterson, R. A., Hruby, V. J. and Cone, R. D. (1997). Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature 385, 165–168.

Ferguson, J. N., Young, L. J., Hearn, E. F., Matzuk, M. M., Insel, T. R. and Winslow, J. T. (2000). Social amnesia in mice lacking the oxytocin gene. Nature Genetics 25, 284–288.

Fliers, E., Alkemade, A., Wiersinga, W. M. and Swaab, D. F. (2006). Hypothalamic thyroid hormone feedback in health and disease. Prog. Brain Res. 153, 189–207.

Fliers, E., Noppen, N. W., Wiersinga, W. M., Visser, T. J. and Swaab, D. F. (1994). Distribution of thyrotropin-releasing hormone (TRH)-containing cells and fibers in the human hypothalamus. The Journal of comparative neurology 350, 311–323.

Fliers, E., Swaab, D. F., Pool, C. W. and Verwer, R. W. (1985). The vasopressin and oxytocin

neurons in the human supraoptic and paraventricular nucleus; changes with aging and in senile dementia. Brain Research 342, 45–53.

Garrison, J. L., Macosko, E. Z., Bernstein, S., Pokala, N., Albrecht, D. R. and Bargmann, C. I.

(2012). Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior. Science 338, 540–543.



Gee, C. E., Chen, C. L., Roberts, J. L., Thompson, R. and Watson, S. J. (1983). Identification of proopiomelanocortin neurones in rat hypothalamus by in situ cDNA-mRNA hybridization. Nature 306, 374–376.

Gotter, A. L., Roecker, A. J., Hargreaves, R., Coleman, P. J., Winrow, C. J. and Renger, J. J. (2012). Orexin receptors as therapeutic drug targets. Prog. Brain Res. 198, 163–188.

Graham, M., Shutter, J. R., Sarmiento, U., Sarosi, I. and Stark, K. L. (1997). Overexpression of Agrt leads to obesity in transgenic mice. Nature Genetics 17, 273–274.

Gropp, E., Shanabrough, M., Borok, E., Xu, A. W., Janoschek, R., Buch, T., Plum, L., Balthasar, N., Hampel, B., Waisman, A., et al. (2005). Agouti-related peptide-expressing neurons are mandatory for feeding. Nature Neuroscience 8, 1289–1291.

Hagan, J. J., Leslie, R. A., Patel, S., Evans, M. L., Wattam, T. A., Holmes, S., Benham, C. D., Taylor, S. G., Routledge, C., Hemmati, P., et al. (1999). Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc. Natl. Acad. Sci. U.S.A. 96, 10911–10916.

Hahn, T. M., Breininger, J. F., Baskin, D. G. and Schwartz, M. W. (1998). Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nature Neuroscience 1, 271–272.

Hara, J., Beuckmann, C. T., Nambu, T., Willie, J. T., Chemelli, R. M., Sinton, C. M., Sugiyama, F., Yagami, K., Goto, K., Yanagisawa, M., et al. (2001). Genetic ablation of orexin neurons in mice results in narcolepsy, hypophagia, and obesity. Neuron 30, 345–354.

Hayes, E. J. and Weinstein, L. (2008). Improving patient safety and uniformity of care by a standardized regimen for the use of oxytocin. Am. J. Obstet. Gynecol. 198, 622.e1–7.

Herculano-Houzel, S. (2012). The remarkable, yet not extraordinary, human brain as a scaled-up primate brain and its associated cost. Proceedings of the National Academy of Sciences 109 Suppl 1, 10661–10668.

Hinney, A., Schmidt, A., Nottebom, K., Heibült, O., Becker, I., Ziegler, A., Gerber, G., Sina, M., Görg, T., Mayer, H., et al. (1999). Several mutations in the melanocortin-4 receptor gene including

a nonsense and a frameshift mutation associated with dominantly inherited obesity in humans. Journal of Clinical Endocrinology & Metabolism 84, 1483–1486.

Hökfelt, T., Fuxe, K., Johanssen, O., Jeffcoate, S. and White, N. (1975). Distribution of thyroptropin-

releasing hormone (TRH) in the central nervous system as revealed with immunohistochemistry. European Journal of Pharmacology 34, 389–392.

Hökfelt, T., Tsuruo, Y., Ulfhake, B., Cullheim, S., Arvidsson, U., Foster, G. A., Schultzberg, M., Schalling, M., Arborelius, L. and Freedman, J. (1989). Distribution of TRH-like immunoreactivity with special reference to coexistence with other neuroactive compounds. Annals of the New York Academy of Sciences 553, 76–105.

Huo, L. (2006). Divergent Regulation of Proopiomelanocortin Neurons by Leptin in the Nucleus of the Solitary Tract and in the Arcuate Hypothalamic Nucleus. Diabetes 55, 567–573.

Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D., et al. (1997). Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88, 131–141.

Ison, A., Yuri, K., Ueta, Y., Leng, G., Koizumi, K., Yamashita, H. and Kawata, M. (1993).



Vasopressin- and oxytocin-immunoreactive hypothalamic neurones of inbred polydipsic mice. Brain Research Bulletin 31, 405–414.

Ito, M., Gomori, A., Ishihara, A., Oda, Z., Mashiko, S., Matsushita, H., Yumoto, M., Ito, M., Sano, H., Tokita, S., et al. (2003). Characterization of MCH-mediated obesity in mice. Am. J. Physiol. Endocrinol. Metab. 284, E940–5.

Jackson, I. M. (1976). Inherited hypothyroidism. Clin Perinatol 3, 221–230.

Jackson, I. M. (1982). Thyrotropin-releasing hormone. N. Engl. J. Med. 306, 145–155.

Johansson, A. (2011). Recent progress in the discovery of melanin-concentrating hormone 1-receptor antagonists. Expert Opin Ther Pat 21, 905–925.

Kasckow, J. W., Baker, D. and Geracioti, T. D. (2001). Corticotropin-releasing hormone in depression and post-traumatic stress disorder. Peptides 22, 845–851.

Keck, M. E. and Holsboer, F. (2001). Hyperactivity of CRH neuronal circuits as a target for therapeutic interventions in affective disorders. Peptides 22, 835–844.

Kessler, B. A., Stanley, E. M., Frederick-Duus, D. and Fadel, J. (2011). Age-related loss of orexin/hypocretin neurons. Neuroscience 178, 82–88.

Khachaturian, H., Lewis, M. E., Haber, S. N., Akil, H. and Watson, S. J. (1984). Proopiomelanocortin peptide immunocytochemistry in rhesus monkey brain. Brain Research Bulletin 13, 785–800.

Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G. and Grüters, A. (1998). Severe early-

onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nature Genetics 19, 155–157.

Laryea, G., Arnett, M. G. and Muglia, L. J. (2012). Behavioral Studies and Genetic Alterations in

Corticotropin-Releasing Hormone (CRH) Neurocircuitry: Insights into Human Psychiatric Disorders. Behav Sci (Basel) 2, 135–171.

Lechan, R. M. and Fekete, C. (2006). The TRH neuron: a hypothalamic integrator of energy metabolism. Prog. Brain Res. 153, 209–235.

Lee, H.-J., Macbeth, A. H., Pagani, J. H. and Young, W. S. (2009). Oxytocin: the great facilitator of life. Progress in Neurobiology 88, 127–151.

Leibowitz, S. F. and Wortley, K. E. (2004). Hypothalamic control of energy balance: different peptides, different functions. Peptides 25, 473–504.

Lin, L., Faraco, J., Li, R., Kadotani, H., Rogers, W., Lin, X., Qiu, X., de Jong, P. J., Nishino, S. and MIGNOT, E. (1999). The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98, 365–376.

Lu, D., Willard, D., Patel, I. R., Kadwell, S., Overton, L., Kost, T., Luther, M., CHEN, W., Woychik, R. P. and Wilkison, W. O. (1994). Agouti protein is an antagonist of the melanocyte-stimulating-hormone receptor. Nature 371, 799–802.

Ludwig, D. S., Tritos, N. A., Mastaitis, J. W., Kulkarni, R., Kokkotou, E., Elmquist, J., Lowell, B., Flier, J. S. and Maratos-Flier, E. (2001). Melanin-concentrating hormone overexpression in transgenic mice leads to obesity and insulin resistance. J. Clin. Invest. 107, 379–386.



Luquet, S., Perez, F. A., Hnasko, T. S. and Palmiter, R. D. (2005). NPY/AgRP neurons are essential for feeding in adult mice but can be ablated in neonates. Science 310, 683–685.

Manning, M., Stoev, S., Chini, B., Durroux, T., Mouillac, B. and Guillon, G. (2008). Peptide and

non-peptide agonists and antagonists for the vasopressin and oxytocin V1a, V1b, V2 and OT receptors: research tools and potential therapeutic agents. Prog. Brain Res. 170, 473–512.

Meynen, G., Unmehopa, U. A., Hofman, M. A., Swaab, D. F. and Hoogendijk, W. J. G. (2007). Relation between corticotropin-releasing hormone neuron number in the hypothalamic paraventricular nucleus and depressive state in Alzheimer's disease. Neuroendocrinology 85, 37–

44.

Mieda, M., Willie, J. T., Hara, J., Sinton, C. M., Sakurai, T. and Yanagisawa, M. (2004). Orexin

peptides prevent cataplexy and improve wakefulness in an orexin neuron-ablated model of narcolepsy in mice. Proc. Natl. Acad. Sci. U.S.A. 101, 4649–4654.

Mineur, Y. S., Abizaid, A., Rao, Y., Salas, R., DiLeone, R. J., Gundisch, D., Diano, S., De Biasi, M., Horvath, T. L., Gao, X. B., et al. (2011). Nicotine Decreases Food Intake Through Activation of POMC Neurons. Science 332, 1330–1332.

Mizuno, T. M. and Mobbs, C. V. (1999). Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140, 814–817.

Modirrousta, M., Mainville, L. and Jones, B. E. (2005). Orexin and MCH neurons express c-Fos differently after sleep deprivation vs. recovery and bear different adrenergic receptors. Eur J Neurosci 21, 2807–2816.

Morton, A. (1969). A quantitative analysis of the normal neuron population of the hypothalamic magnocellular nuclei in man and of their projections to the neurohypophysis. The Journal of comparative neurology 136, 143–157.

Muglia, L., Jacobson, L., Dikkes, P. and Majzoub, J. A. (1995). Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373, 427–432.

Nagasaki, H., Yokoi, H., Arima, H., Hirabayashi, M., Ishizaki, S., Tachikawa, K., Murase, T., Miura, Y. and Oiso, Y. (2002). Overexpression of vasopressin in the rat transgenic for the metallothionein-vasopressin fusion gene. J. Endocrinol. 173, 35–44.

Nahon, J. L., Presse, F., Bittencourt, J. C., Sawchenko, P. E. and Vale, W. (1989). The rat melanin-concentrating hormone messenger ribonucleic acid encodes multiple putative neuropeptides coexpressed in the dorsolateral hypothalamus. Endocrinology 125, 2056–2065.

Nashold, B. S., Mannarino, E. M. and Robinson, R. R. (1963). Effect of posterior pituitary polypeptides on the flow of urine after injection in lateral ventricle of the brain of a cat. Nature 197, 293.

Nishimori, K., Young, L. J., Guo, Q., Wang, Z., Insel, T. R. and Matzuk, M. M. (1996). Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc. Natl. Acad. Sci. U.S.A. 93, 11699–11704.

Ollmann, M. M., Wilson, B. D., Yang, Y. K., Kerns, J. A., Chen, Y., Gantz, I. and Barsh, G. S.

(1997). Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278, 135–138.



Pelletier, G., Désy, L., Côté, J. and Vaudry, H. (1983). Immunocytochemical localization of corticotropin-releasing factor-like immunoreactivity in the human hypothalamus. Neuroscience Letters 41, 259–263.

Peyron, C., Faraco, J., Rogers, W., Ripley, B., OVEREEM, S., Charnay, Y., Nevsimalova, S., Aldrich, M., Reynolds, D., Albin, R., et al. (2000). A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nature Medicine 6, 991–997.

Peyron, C., Tighe, D. K., van den Pol, A. N., de Lecea, L., Heller, H. C., Sutcliffe, J. G. and Kilduff, T. S. (1998). Neurons containing hypocretin (orexin) project to multiple neuronal systems. J. Neurosci. 18, 9996–10015.

Poggioli, R., Vergoni, A. V. and Bertolini, A. (1986). ACTH-(1-24) and alpha-MSH antagonize feeding behavior stimulated by kappa opiate agonists. Peptides 7, 843–848.

Prange, A. J., Lara, P. P., Wilson, I. C., Alltop, L. B. and Breese, G. R. (1972). Effects of thyrotropin-releasing hormone in depression. Lancet 2, 999–1002.

Qu, D., Ludwig, D. S., Gammeltoft, S., Piper, M., Pelleymounter, M. A., Cullen, M. J., Mathes, W. F., Przypek, R., Kanarek, R. and Maratos-Flier, E. (1996). A role for melanin-concentrating hormone in the central regulation of feeding behaviour. Nature 380, 243–247.

Rabeler, R., Mittag, J., Geffers, L., Rüther, U., Leitges, M., Parlow, A. F., Visser, T. J. and Bauer, K. (2004). Generation of thyrotropin-releasing hormone receptor 1-deficient mice as an animal model of central hypothyroidism. Molecular Endocrinology 18, 1450–1460.

Ross, H. E. and Young, L. J. (2009). Oxytocin and the neural mechanisms regulating social cognition and affiliative behavior. Frontiers in Neuroendocrinology 30, 534–547.

Sakurai, T. (2007). The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nature Reviews Neuroscience 8, 171–181.

Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R. M., Tanaka, H., Williams, S. C., Richardson, J. A., Kozlowski, G. P., Wilson, S., et al. (1998). Orexins and orexin receptors: A family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior (vol 92, pg 573, 1998). Cell 92, 573–585.

Segerson, T. P., Hoefler, H., Childers, H., Wolfe, H. J., Wu, P., Jackson, I. M. and Lechan, R. M. (1987). Localization of thyrotropin-releasing hormone prohormone messenger ribonucleic acid in rat brain in situ hybridization. Endocrinology 121, 98–107.

Shimada, M., Tritos, N. A., Lowell, B. B., Flier, J. S. and Maratos-Flier, E. (1998). Mice lacking melanin-concentrating hormone are hypophagic and lean. Nature 396, 670–674.

Shutter, J. R., Graham, M., Kinsey, A. C., Scully, S., Lüthy, R. and Stark, K. L. (1997).

Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice. Genes Dev. 11, 593–602.

Sina, M., Hinney, A., Ziegler, A., Neupert, T., Mayer, H., Siegfried, W., Blum, W. F., Remschmidt, H. and Hebebrand, J. (1999). Phenotypes in three pedigrees with autosomal dominant obesity caused by haploinsufficiency mutations in the melanocortin-4 receptor gene. Am. J. Hum. Genet. 65, 1501–1507.



Spiess, J., Rivier, J., Rivier, C. and Vale, W. (1981). Primary structure of corticotropin-releasing factor from ovine hypothalamus. Proc. Natl. Acad. Sci. U.S.A. 78, 6517–6521.

Stenzel-Poore, M. P., Cameron, V. A., Vaughan, J., Sawchenko, P. E. and Vale, W. (1992).

Development of Cushing's syndrome in corticotropin-releasing factor transgenic mice. Endocrinology 130, 3378–3386.

Sukhov, R. R., Walker, L. C., Rance, N. E., Price, D. L. and Young, W. S. (1993). Vasopressin and oxytocin gene expression in the human hypothalamus. The Journal of comparative neurology 337,

295–306.

Suzuki, T., Kohno, H., Sakurada, T., Tadano, T. and Kisara, K. (1982). Intracranial injection of thyrotropin releasing hormone (TRH) suppresses starvation-induced feeding and drinking in rats. Pharmacol. Biochem. Behav. 17, 249–253.

Swaab, D. F. (1992). The human hypothalamus in health and disease.

Swanson, L. W., Sawchenko, P. E., Rivier, J. and Vale, W. W. (1983). Organization of ovine

corticotropin-releasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical study. Neuroendocrinology 36, 165–186.

Takayanagi, Y., Yoshida, M., Bielsky, I. F., Ross, H. E., Kawamata, M., Onaka, T., Yanagisawa, T., Kimura, T., Matzuk, M. M., Young, L. J., et al. (2005). Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc. Natl. Acad. Sci. U.S.A. 102, 16096–16101.

Thannickal, T. C., Lai, Y.-Y. and Siegel, J. M. (2007). Hypocretin (orexin) cell loss in Parkinson's disease. Brain 130, 1586–1595.

Thannickal, T. C., Moore, R. Y., Nienhuis, R., Ramanathan, L., Gulyani, S., Aldrich, M., Cornford, M. and Siegel, J. M. (2000). Reduced number of hypocretin neurons in human narcolepsy. Neuron 27, 469–474.

Thannickal, T. C., Nienhuis, R. and Siegel, J. M. (2009). Localized loss of hypocretin (orexin) cells in narcolepsy without cataplexy. Sleep 32, 993–998.

Timpl, P., Spanagel, R., Sillaber, I., Kresse, A., Reul, J. M., Stalla, G. K., Blanquet, V., Steckler, T., Holsboer, F. and Wurst, W. (1998). Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nature Genetics 19, 162–166.

Tsujii, S. and Bray, G. A. (1989). Acetylation alters the feeding response to MSH and beta-endorphin. Brain Research Bulletin 23, 165–169.

Tsuruo, Y., Hökfelt, T. and Visser, T. J. (1988). Thyrotropin-releasing hormone (TRH)-immunoreactive neuron population in the rat olfactory bulb. Brain Research.

Vale, W., Spiess, J., Rivier, C. and Rivier, J. (1981). Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213,

1394–1397.

van den Pol, A. N. (1999). Hypothalamic hypocretin (orexin): robust innervation of the spinal cord. J. Neurosci. 19, 3171–3182.

Van der Woude, P. F., Goudsmit, E., Wierda, M., Purba, J. S., Hofman, M. A., Bogte, H. and Swaab, D. F. (1995). No vasopressin cell loss in the human hypothalamus in aging and



Alzheimer's disease. NBA 16, 11–18.

Vandesande, F. and Dierickx, K. (1975). Identification of the vasopressin producing and of the oxytocin producing neurons in the hypothalamic magnocellular neurosecretroy system of the rat. Cell Tissue Res 164, 153–162.

Vandesande, F., Dierickx, K. and DeMey, J. (1975). Identification of the vasopressin-neurophysin II and the oxytocin-neurophysin I producing neurons in the bovine hypothalamus. Cell Tissue Res 156, 189–200.

Vijayan, E. and McCann, S. M. (1977). Suppression of feeding and drinking activity in rats following intraventricular injection of thyrotropin releasing hormone (TRH). Endocrinology 100, 1727–1730.

Vogels, O. J., Broere, C. A. and Nieuwenhuys, R. (1990). Neuronal hypertrophy in the human supraoptic and paraventricular nucleus in aging and Alzheimer's disease. Neuroscience Letters 109, 62–67.

Vokes, T. J. and Robertson, G. L. (1988). Disorders of antidiuretic hormone. Endocrinol. Metab. Clin. North Am. 17, 281–299.

Wataya, T., Ando, S., Muguruma, K., Ikeda, H., Watanabe, K., Eiraku, M., Kawada, M., Takahashi, J., Hashimoto, N. and Sasai, Y. (2008). Minimization of exogenous signals in ES cell culture induces rostral hypothalamic differentiation. Proceedings of the National Academy of Sciences 105,

11796–11801.

Wierda, M., Goudsmit, E., Van der Woude, P. F., Purba, J. S., Hofman, M. A., Bogte, H. and Swaab, D. F. (1991). Oxytocin cell number in the human paraventricular nucleus remains constant with aging and in Alzheimer's disease. NBA 12, 511–516.

Williams, R. W. and Herrup, K. (1988). The control of neuron number. Annu. Rev. Neurosci. 11, 423–453.

Winslow, J. T., Hearn, E. F., Ferguson, J., Young, L. J., Matzuk, M. M. and Insel, T. R. (2000). Infant vocalization, adult aggression, and fear behavior of an oxytocin null mutant mouse. Horm Behav 37, 145–155.

Wittmann, G., Füzesi, T., Singru, P. S., Liposits, Z., Lechan, R. M. and Fekete, C. (2009). Efferent

projections of thyrotropin-releasing hormone-synthesizing neurons residing in the anterior parvocellular subdivision of the hypothalamic paraventricular nucleus. J. Comp. Neurol. 515, 313–330.

Wu, Q., Whiddon, B. B. and Palmiter, R. D. (2012). Ablation of neurons expressing agouti-related

protein, but not melanin concentrating hormone, in leptin-deficient mice restores metabolic functions and fertility. Proceedings of the National Academy of Sciences 109, 3155–3160.

Yaswen, L., Diehl, N., Brennan, M. B. and Hochgeschwender, U. (1999). Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat. Med. 5, 1066–

1070.

Young, W. S., Shepard, E., Amico, J., Hennighausen, L., Wagner, K. U., LaMarca, M. E., McKinney, C. and Ginns, E. I. (1996). Deficiency in mouse oxytocin prevents milk ejection, but not fertility or parturition. Journal of Neuroendocrinology 8, 847–853.

Zamir, N., Skofitsch, G., Bannon, M. J. and Jacobowitz, D. M. (1986). Melanin-concentrating



hormone: unique peptide neuronal system in the rat brain and pituitary gland. Proc. Natl. Acad. Sci. U.S.A. 83, 1528–1531.

Zoumakis, E. and Chrousos, G. P. (2010). Corticotropin-releasing hormone receptor antagonists: an update. Endocr Dev 17, 36–43.



Supplementary Figures

Figure S1. Self-patterning of mESCs to hypothalamic neurons. a) mESC colonies in feeder-free culture. b,c) To confirm hypothalamic differentiation, a Rax::GFP knock-in reporter mES cell line (Wataya et al., 2008), was analyzed 7 days after the start of differentiation. Cell aggregates contained many GFP-expressing cells and adopted three-dimensional neuroepithelial-like structures in vitro, shown in cross-section in (c). d) mESC-derived cell aggregates plated under adherent conditions extended neurites after D21. e) Immunostaining of self-patterned

mouse aggregates (D21) revealed cell types expressing neuropeptides such as hypocretin (HCRT) that are exclusively produced in the hypothalamus. Scale bar is identical for a,b and d,e.



Figure S2. Absence of hypothalamic neuropeptidergic cells in caudalized control cultures. In

control cultures treated with retinoic acid, no cells were observed to be immunopositive for hypothalamic neuropeptides (D90), whereas cells expressing a reporter for motor neurons (HB9::GFP) were observed.



Figure S3. Self-patterned neuropeptidergic cells express the neuronal marker MAP2.

Photomicrographs of cryosectioned D90 self-patterned cell aggregates immunostained for the stringent neuronal marker microtubule associated protein 2 (MAP2). MAP2 immunoreactivity was widespread, tended to be weaker in cell bodies (arrowheads) than in processes (arrows), and overlapped with neuropeptidergic cells. The co-localization of these markers is more easily appreciated in monolayer cultures (Fig. S5) which do not suffer from the crowded three-dimensional nature of the cell aggregates or from the severing of processes by cryosectioning.



Figure S4. Absence of neuropeptide expression in primary mouse cortical glial cultures. Human

stem-cell derived hypothalamic neurons were matured on monolayers of mouse glia derived from the neocortex of neonatal mice. Cultures were immunostained for glial fibrillary acidic protein (GFAP) and for hypothalamic neuropeptides to test whether glial cultures might harbor neuropeptide immunopositive cells. We observed robust staining for GFAP, but not for neuropeptides.



Figure S5. Hypothalamic gene induction by small molecule SHH agonists. To identify conditions

that reliably generated cells expressing genes indicative of hypothalamic identity (NKX2.1 and RAX) but not forebrain identity (FOXG1), we exposed cultures on D2-8 to different concentrations of smoothened agonist (SAG) or purmorphamine (Pur). We then quantified the expression of these genes by immunostaining on D12. We found efficient ventralization with both SAG and Pur, but noticed that RAX was more efficiently induced by Pur and that the smallest numbers of FOXG1 immunopositive cells

were seen when SAG and Pur were used in combination. We therefore treated cultures with both 1 M

SAG and 1 M Pur from D2-8 in all subsequent experiments.



Figure S6. Subregional identity of hypothalamic progenitors. a-c) Photomicrographs of a NKX2.1::GFP reporter cell line that was differentiated to hypothalamic progenitors and immunostained

for RAX (a), OTP (b) and SIM1 (c). Immunopositive cells contain both GFP negative (arrows) and GFP positive (arrowheads) populations. d-g) Photomicrographs of in situ hybridizations from the E13.5 mouse brain (Allen Brain Institute) show the regional localization of Nkx2.1 (d) Rax (e), Otp (f), and Sim1 (g). The plane of section is near the midline for the top row of images and slightly more lateral for the bottom row of images. Note that Rax, Otp, or Sim1 are expressed in hypothalamic domains that lack Nkx2.1 expression (arrows) as well as in regions where Nkx2.1 is expressed (arrowheads).



Figure S7. Neuropeptidergic cells derived by directed differentiation express the neuronal marker MAP2. Cultures immunostained at D40 for neuropeptides and for microtubule associated

protein 2 (MAP2) reveal that neuropeptidergic cells expressed MAP2 in their cell bodies (arrowheads) and more strongly in their processes (arrows).



Figure S8. Transplantation of human cells into the mouse brain. a,b) Low magnification

photomicrograph of a coronal section of a transplanted mouse brain showing immunostaining for



human nuclei (a) and HCRT expressing cells (b) in the transplanted region shown schematically in Figure 7b. c,d) Boxed region from panel (b) shown at higher magnification, indicating the expression of HCRT peptide in neurons containing human nuclei. These images are unmodified, whereas images in Figure 7 were colorized and adjusted for brightness and contrast. e,f) Unmodified images of MCH expressing transplanted cells shown in Figure 7. g) Cells expressing MAB1281 (human nuclear

antigen) were quantified 15 days after injection into the neonatal (P2) mouse brain. Human cell number was estimated by taking the product of the density and volume that MAB1281-expressing cells occupied in the brains of four transplanted mice.



Figure S9. Efficiency of neuropeptidergic neuron production from hPSCs. a) The human hypothalamus comprises only a small fraction of the adult human brain (0.3%). b) The measured or estimated frequency of different neuropeptidergic cell types is given for neurons derived in vitro or in vivo. c) Analysis in (b) for all analyzed neuropeptidergic cell types. d) The directed differentiation

approach (grey bars) generates hypothalamic neurons more reliably than self-patterning (clear bars), as indicated by a significantly (P < 0.05) lower variance. Hyp.: hypothalamus, Dir. diff. directed differentiation, Self-patt.: self-patterning, Cereb. cortex: cerebral cortex


Documents

Table S1: The function and clinical relevance of select ... · Table S1: The function and clinical relevance of select ... ... Neuron The