TGF-� Induces Cell Death in theOligodendroglial Cell Line OLI-neu

NORBERT SCHUSTER,1 HERDIS BENDER,1,2 ANJA PHILIPPI,1SRINIVASA SUBRAMANIAM,3 JENS STRELAU,3 ZIYUAN WANG,2

AND KERSTIN KRIEGLSTEIN2*1Department of Anatomy and Cell Biology, Medical Faculty, University of Saarland,

Homburg/Saar, Germany2Department of Neuroanatomy, Center of Anatomy, Medical Faculty, University of Goettingen,

Goettingen, Germany3Department of Neuroanatomy, University Heidelberg, Heidelberg, Germany

KEY WORDS O-2A progenitors; apoptosis; proliferation; bcl-XL; p27; Smad

ABSTRACT We have shown that TGF-� plays an important role during the periodof developmental cell death in the nervous system. Immunoneutralization of TGF-�prevents ontogenetic neuron death in vivo. Like neurons, oligodendrocytes are generatedin excess and eliminated by apoptosis. It has been shown that oligodendrocyte progen-itors and newly formed oligodendrocytes are especially susceptible to apoptosis. Wechoose the oligodendrocyte precursor cell line OLI-neu to address the question if TGF-�could play a role for the control of oligodendrocyte proliferation and cell death. Flowcytometric analysis revealed that OLI-neu cells arrested in the G1 phase of the cell cycleunderwent apoptosis in response to TGF-�. TUNEL assays, apoptosis ELISA, andcaspase assays substantiated the finding that OLI-neu cells died after TGF-� treatment.Cell death could be inhibited by application of pan-caspase or caspase 8 and 9 inhibitors,whereas the inhibition of calpain was unaffected. Furthermore, we found a reduction ofbcl-XL at the protein as well as at the mRNA level, while p27 was upregulated. TheSmad cascade was activated while TGF-� reduced the activity of the p42/p44 MAPkinase pathway. Together, these data show that TGF-� induced apoptotic cell death incells of oligodendroglial origin, whereby the signaling cascade involved the downregu-lation of antiapoptotic signaling such as bcl-XL leading to the activation of caspases. GLIA40:95–108, 2002. © 2002 Wiley-Liss, Inc.

INTRODUCTION

TGF-� is a pleiotrophic and multifunctional growthfactor, influencing many cellular and developmentalprocesses like cell proliferation, apoptosis, extracellu-lar matrix formation, cell differentiation, and morpho-genesis. The role for TGF-�-induced apoptosis has beenestablished especially for the maintenance of B- andT-cell homeostasis in cell culture experiments and invivo (Weller et al., 1994; Chaouchi et al., 1995; Cazacand Roes, 2000; Schuster and Krieglstein, 2000). Re-cently, it was discovered that TGF-� plays an impor-tant role for developmental cell death in the nervoussystem as the cell numbers of specific neuron popula-tions were increased after TGF-� neutralization(Krieglstein et al., 2000). This increase could be corre-

lated with a decrease of caspase activation and apopto-sis. Similar results were found in the chick retina,where in ovo application of TGF-�-neutralizing anti-bodies resulted in a reduced apoptosis within the cen-tral retina (Dunker et al., 2001). In the oligodendrocytelineage, cell death occurs also as a normal processduring development (Casaccia-Bonnefil, 2000). This

Norbert Schuster’s present address is Ludwig Institute for Cancer Research,Box 595, 75124 Uppsala, Sweden.

*Correspondence to: Kerstin Krieglstein, Department of Neuroanatomy, Uni-versity of Goettingen, Kreuzbergring 36, 37075 Goettingen, Germany.E-mail: kkriegl@gwdg.de

Received 29 June 2001; Accepted 30 April 2002

DOI 10.1002/glia.10110

Published online 00 Month 2001. in Wiley InterScience (www.interscience.wiley.com).

GLIA 40:95–108 (2002)

© 2002 Wiley-Liss, Inc.

process has been understood as a mechanism to adjustthe number of myelinating cells to the number of axonsformed by neuronal cells (Barres et al., 1992). Likeneurons, oligodendrocytes are generated in excess andeliminated by apoptosis. In the developing optic nerveof the rat, nearly 50% of newly generated oligodendro-cytes die. A similar situation can be found in the de-veloping neocortex, where about 40% of the originallygenerated oligodendrocytes are lost (Barres et al.,1992; Trapp et al., 1997). It has been shown that oli-godendrocyte progenitors and newly formed oligoden-drocytes are very susceptible to apoptosis (Barres et al.,1992; Scurlock and Dawson, 1999). The proliferation ofoligodendrocyte progenitors can be inhibited by TGF-�,while the differentiation into mature oligodendrocytesispromoted(McKinnonetal.,1993).Therefore,oligoden-droglial cells seem to be a suitable system to studysignaling processes that may be of importance for oli-godendrocyte maturation and cell death in vitro. Theoligodendroglial cell line OLI-neu was established fromO2A progenitor cells (Jung et al., 1995). We choose thiscell line as the model system to investigate the role ofTGF-� for oligodendroglial cell death and proliferation.

We report here that OLI-neu cells undergo in re-sponse to TGF-� a G1 arrest and apoptosis. TGF-�-mediated cell death is accompanied by caspase 3 acti-vation and activation of the Smad pathway. Cell deathcould be blocked by a pan-caspase inhibitor as well asby inhibitors of caspase 8 and 9. We found a downregu-lation of antiapoptotic bcl-XL both at the protein andthe RNA level. The level of proapoptotic bax remainedunchanged while the cell cycle regulator p27 was up-regulated. The investigation of pro- and antiapoptoticsignaling pathways showed a downregulation of thep42/p44 MAPK pathway, which normally contributesto cellular survival and differentiation. Together, thesedata show that TGF-� can induce apoptotic cell deathin cells of oligodendroglial origin involving the down-regulation of antiapoptotic stimuli.

MATERIALS AND METHODSAntibodies and Reagents

Recombinant TGF-�1 was purchased from R&D Sys-tems (Minneapolis, MN). Pan-caspase inhibitor V(ZVAD-FMK), caspase 8 inhibitor (Z-IETD-FMK),caspase 9 inhibitor (Z-LEHD-FMK), and calpain inhib-itor II were purchased from Calbiochem (Bad Soden,Germany). Purified calpain I from human erythrocytesand fluorogenic calpain substrate II were purchasedfrom Calbiochem. All used antibodies were from SantaCruz (Heidelberg, Germany): actin (sc-1616), bcl-2 (sc-7382), bcl-XL (sc-8392), bax (sc-7480), p27 (sc-527),phospho-ERK (sc-7383), p42/p44 (sc-93), tubulin (sc-9104), except O4 antibody (MAB345), which waspurchased from Chemicon (Hofheim, Germany).Propidium-iodide and RNase I were from Sigma(Deisenhofen, Germany). Secondary antimouse, anti-

goat, and antirabbit antibodies were obtained fromZymed.

Plasmid constructs were as follows: pSBE (Jonk etal., 1998), c-jun reporter (�1600/�170) construct (An-gel et al., 1988), GAL4-c-Elk-1 and pFR-Luc-reporterconstruct (Stratagene, La Jolla, CA), pGL3-HIV-1 LTR(NF-kB response element) (Recio and Aranda, 2000),and pRL-TK (Promega, Mannheim, Germany).

Cell Culture

OLI-neu, an immortalized oligodendrocyte precursorcell line (Jung et al., 1995), was cultured in DMEM(Gibco, Karlsruhe, Germany) with 10% fetal calf serum(FCS; Gibco), N2 supplement (Gibco), and insulin(Sigma). For each experiment, cells were cultured inOptiMEM medium containing 1% FCS, N1 supple-ment, and insulin. When TGF-�1 was added, 5 ng/mlmedium were applied.

The following technique for oligodendrocyte precur-sor isolation was modified from that of McCarthy andde Vellis (1980). Briefly, brains from P0 mice wereminced with scissors, successively incubated with 0.5%trypsin (Gibco), 0.025% trypsin inhibitor (Roche,Mannheim, Germany), and 0.004% DNAse I (Gibco),each dissolved in Dulbecco’s modified Eagle medium(DMEM; Gibco). After repeated trituration throughglass pipettes and hypodermic needles, the resultingcell suspension was gravity-filtered through a 70 �mnylon mesh. The filtrate was centrifuged for 5 min at1200 rpm and the pellet was resuspended in DMEMsupplemented with 10% HS, penicillin (50 �g/ml), andstreptomycin (50 �g/ml). Cells were then plated out on75 cm2 culture flasks and placed in a humid, 37°Cincubator with 5% C02. The medium was changed after3 days and every 2 days thereafter up to a total of 12days. Cultures were shaken for 3 h on a rotatory shakerat 180 rpm to remove any loosely attached cells. Oligo-dendrocyte progenitors were removed from the astro-cyte monolayer by shaking for 18 h at 250 rpm. Purifiedcells were plated out at a density of 1.5 � 104 cells/cm2

on poly-D-lysine–coated glass coverslips and grownovernight in medium. Six hours prior to TGF-�1 ad-ministration, the medium was changed to serum-freemedium containing N2 supplement (Gibco). Cells werethen treated for 18 h with TGF-�1 (10 ng/ml) andprocessed for immunocytochemistry and the TUNELassay.

Immunocytochemistry

Oligodendroglial precursor cells were washed oncewith PBS and fixed in 4% paraformaldehyde for 20min. After washing, the cells were incubated with 1%BSA in PBS for 10 min. For binding to oligodendrocyteprecursor surface ganglioside GD3, the monoclonal an-tibody LB1 (Levi et al., 1986; Curtis et al., 1988) wasincubated for 30 min. The cells were washed in PBS

96 SCHUSTER ET AL.

and incubated with antimouse Cy2 antibody (1:150dilution, Dianova, Germany) for 20 min. LB1-stainedcells were again fixed in 4% paraformaldehyde andpermeabilized with 0.2% TritonX-100 for 20 min. Apo-ptotic cell death was determined by using the TUNELassay according to the manufacturers manual (Roche)and visualized by fluorescence microscope.

MTT Assay

Twenty thousand cells were seeded in 96-well plates.Medium was changed after 24 h to experimental con-ditions as described above. After 24 and 48 h, 10 �lMTT substrate was added to each well containing 100�l medium. After 30 min, medium was removed andcells were lysed in 100 �l lysis-buffer/well. The bluereaction product was measured at 570 nm in an ELISAreader (BioRad, Munchen, Germany).

Apoptosis ELISA

Cells were lysed in lysis buffer (Tris-HCl, pH 8, 100mM NaCl, 0.5% Tween 20) and incubated on ice for 15min. Extracts were centrifuged for 30 min with 13,000rpm (Biofuge Primo, Heraeus, Germany); 20 �l of thesupernatant was used to perform the assay accordingto the manufacturer’s instructions (Roche). The exper-imental values were normalized with the protein con-tent of each sample.

TUNEL Assay

Cells were cultured on coated glass coverslips andtreated for 24 h with TGF-�1. Cells were fixed for 10min with 3.7% formaldehyde in phosphate-buffered sa-line (PBS; 137 mM NaCl, 2.7 mM KCl, 1.4 mMKH2PO4, 4.3 mM NaHPO4 � H2O, pH 7.4). After wash-ing, cells were processes according to the manufactur-er’s instructions (Roche) and visualized by fluorescencemicroscopy.

SDS-Polyacrylamidgel Electrophoresis andWestern Blot Analysis

Cells were lysed in lysis buffer supplemented withcomplete protease inhibitor cocktail (Roche). Proteinswere analyzed by SDS gel electrophoresis according tothe procedure of Laemmli (1970). For Western blotanalysis, proteins were transferred to a PVDF mem-brane by tank blotting with 20 mM Tris/HCl, pH 8.7,150 mM glycine as transfer buffer. Membranes wereblocked in PBS with 0.1% Tween20 and 5% dry milk for1 h at room temperature. The membrane was incu-bated overnight with the primary antibody (1:100) inPBS-Tween20 with 1% dry milk. The membrane wasthen washed with PBS-Tween20 three times before

incubating with the peroxidase-coupled secondary an-tibody in a dilution of 1:10,000 in PBS-Tween20 with1% dry milk. Signals were developed by the Renais-sance enhanced luminol reagent of NEN-Kodak (Bos-ton, MA) and visualized in a chemiluminescence im-ager (Raytest, Straubenhardt, Germany).

RT-PCR

Total RNA was isolated from OLI-neu cells withRNeasy midi columns (Qiagen, Hilden, Germany) ac-cording to the manufacturer’s instructions. To removetraces of genomic DNA, an on-column DNase digestionwas performed. Equal amounts of RNA were used forreverse transcriptase reaction (Omniscript, Qiagen)with hexamer primers (Gibco). RT reaction was per-formed according to the manufacturer’s instructions(Qiagen). Bcl-XL and actin were amplified by specificprimers (23 cycles). Semiquantitative expression anal-ysis was performed with quantum (Ambion, Austin,TX). Amplimers and bcl-XL–specific primers were for-ward, GTAGTGAATGAACTCTTTCGG; reverse, CCT-GGATCCAAGGCTCTA. Beta actin was amplified with25 cycles with actin specific primers (forward, TA-AAACGCAGCTCAGTAACAGTCCG; reverse, TGGAA-TCCTGTGGCATCCATGAAC). Quantification of bandintensity was performed using AIDA-Biopackage (Ray-test).

Caspase 3 Assay

Cells were harvested in lysis buffer; 20 �l per samplewere used for a 100 �l reaction. The caspase 3 fluori-metric assay was performed according to the manufac-turer’s instructions (Promega). For each sample, trip-licate reactions were performed. Additional reactionsfor each sample were performed with caspase 3–spe-cific caspase inhibitor. Reactions were preincubatedwith or without inhibitor for 30 min at 30°C. The flu-orogenic caspase 3–specific substrate was added andthe reaction was incubated for an additional 30 min at30°C. For quantification of caspase activity, a fluorom-eter was used (Deelux, Goedenstorf, Germany). Thebackground activity from reactions with inhibitor wassubtracted from the values without inhibitor to obtainspecific caspase 3 activity.

Calpain Activity Assay

The activity assay was performed in 100 �l reactions;5 �l purified calpain, 2 �l fluorogenic substrate (10 mMstock solution), 83 �l calpain assay buffer (100 mMimidazole, pH 7.3, 5 mM L-cysteine, 1 mM 2-mercap-toethanol, 10 mM CaCl2), and either 10 �l DMSO forcontrol or 10 �l calpain inhibitor II (50 mM stock solu-tion) were pipetted in a black 96-well plate. Reaction

97TGF-� INDUCES CELL DEATH

was performed at 37°C for 1 h. For quantification ofcalpain activity, a fluorometer was used (Deelux).

FACS Analysis

Cells were harvested by trypsination for 5 min atroom temperature, washed three times with PBS (137mM NaCl, 2.7 mM KCl, 1.4 mM KH2PO4, 4.3 mMNaHPO4 � H2O, pH 7.4) and resuspended in 300 �lPBS. Resuspended cells were fixed by addition of 700 �l100% ethanol and left for at least 30 min at �20°C.Fixed cells were centrifuged and resuspended in 800 �lPBS. After addition of 100 �l RNaseA (1 mg/ml) and100 �l propidium iodide (1 mg/ml), cells were incubatedat 37°C for 30 min; 10,000 freshly stained cells werecounted and analyzed for their cell cycle distributionwith a flow cytometer (Facs-Scan, Beckton Dickinson,Heidelberg, Germany). Cell cycle distribution analysiswas performed with Cell Quest software (BecktonDickinson) based on the characteristic peaks of 2n,intermediate, and 4n DNA content of the cells. Gatesseparating the different cell populations were set man-ually and the software calculated the percentage ofcells present in G1, S-, and G2 phase of the cell cycle aswell as in the sub-G1 peak representing apoptotic cells.

Luciferase Reporter Assay

Twenty thousand cells/well were seeded in a 96-welltissue culture plate. After 24 h, cells were transfectedwith 0.5 �g of the reporter construct and 50 ng ofRenilla luciferase control vector (Promega) using Ef-fectene transfection reagent (Qiagen). After 3 h, DNAcomplexes were removed and the experimental condi-tions were applied. After an additional 18 h, cells wereharvested in passive lysis buffer (Promega) and as-sayed for luciferase activity in a luminometer (LumatB5067, Berthold, Bad Wildbad, Germany) using thedual-luciferase reporter system (Promega).

RESULTSTGF-� Inhibits Proliferation and Induces

Apoptosis in OLI-neu Cells

To investigate the effect of TGF-� on life and death ofoligodendroglial cells, OLI-neu cells were cultured inOPTIMEM medium supplemented with 1% FCS in thepresence and absence of TGF-�1. To measure viablecell numbers, MTT assay was performed, which moni-tors viable cells by their capacity to metabolize a yellowsubstrate into a blue reaction product. As shown inFigure 1A, TGF-� treatment of OLI-neu cells resultedin a reduced number of viable cells within 48 h whencompared to untreated controls. However, this assaygives no information whether the loss of viable cells is

a result of an inhibited proliferation or an active elim-ination of cells by apoptosis.

To decipher if the loss of viable cells is due to reducedproliferation or apoptosis, TGF-�-treated or untreatedOLI-neu cells were analyzed in the flow cytometer.OLI-neu cells were harvested, fixed, and stained withpropidium iodide. The flow cytometric analysis revealsvia DNA staining if cells are arrested at certain cellcycle phases or undergo apoptosis (sub-G1 population).As shown in Figure 1B and C, TGF-�-treated cellsshowed an increased number of cells in the G1 phase ofthe cell cycle, which argues for a G1 arrest. But anadditional increase in apoptotic cells could be seen inthe sub-G1 population representing cells with frag-mented nuclei (Fig. 2B and D). Therefore, we concludethat TGF-� induces in OLI-neu cells a cell cycle arrestas well as apoptosis.

TGF-�-Induced Apoptosis Is Verified by TUNELStaining and Apoptosis ELISA Accompanied

by Caspase 3 Activation

To verify that TGF-� induced apoptosis in our cellsystem of an oligodendroglial precursor cell line, addi-tional experiments were performed. First, we checkedif OLI-neu cells retained the properties of oligodendro-glial precursor cells. Therefore, we fixed OLI-neu cellsand stained them with an antibody against the oligo-dendroglial marker protein O4. In Figure 2A, the stainwith the O4 antibody alone is shown. In Figure 2B, thestaining of OLI-neu cells with the O4 antibody and thedetection of apoptotic cells with TUNEL reagent areshown. This indicates that OLI-neu cells can be specif-ically labeled with the O4 marker. Virtually all cellsshow an O4 signal, proving that OLI-neu cells retainedproperties of oligodendroglial precursors.

Analyzing the cell morphology, a higher percentageof elongated as well as rounded cells were found whenTGF-� was applied (Fig. 2C and D). The rounded cellsreflect the morphology of apoptotic cells. This was ver-ified by TUNEL staining of control and TGF-�-treatedcells (Fig. 2E and F). Only in TGF-�-treated cultureswere TUNEL-positive cells detectable.

To prove that the TGF-�-mediated effect on OLI-neucells is not caused by the transformation of this cell linewith the neu-tyrosine kinase, we performed also exper-iments with freshly isolated O2A progenitors of new-born mice. The purified primary progenitor cells wereeither left untreated or treated for 16 h with TGF-�. Asshown in Figure 3C and D, we found a higher percent-age of TUNEL-positive cells in the TGF-�-treated cellpopulation (Fig. 3C) when compared to the control(Fig. 3B).

A commercially available apoptosis ELISA (Roche)was used to measure apoptotic DNA fragmentation.TGF-�-treated and control cells were lysed and sub-jected to analysis with the apoptosis ELISA. As shown

98 SCHUSTER ET AL.

Fig. 1. TGF-� induces growth arrest and apoptosis in OLI-neu cells.A: MTT assay with control and TGF-�-treated OLI-neu cells. Cellswere treated with TGF-�1 for 24 and 48 h, incubated for 30 min withMTT substrate, lysed, and the intensity of the blue reaction productwas measured in an ELISA reader. Intensity is correlated with viablecells and was set as 100% controls. The results of three independentexperiments are shown (error bars SEM). B: FACS analysis withcontrol and TGF-�-treated OLI-neu cells. Cells were treated withTGF-�1 for 24 h, harvested, and fixed in 70% ethanol. Cells were

treated with RNaseA and stained with propidiumjodide for 30 min.Stained cells were analyzed and counted in a flow cytometer. FACSprofile of control and TGF-�-treated cells. C: Diagram showing quan-tification of cells in G1 phase (three independent experiments, errorbars SEM). D: Diagram showing quantification of cells in the sub-G1peak, representing apoptotic cells (three independent experiments,error bars SEM). P values derived from student’s t-test are doubleasterisk, P � 0.01, and triple asterisk, P � 0.001 as compared tocontrols.

99TGF-� INDUCES CELL DEATH

in Figure 4A, TGF-�-treated OLI-neu cells showed anincreased DNA fragmentation when compared to con-trol cells.

Another important step in the apoptotic cascade isthe activation of caspases. Caspase activation is anupstream event occurring before DNA fragmentation

Fig. 2. Analysis of apoptosis in OLI-neu cells. A: Stain with O4antibody alone. B: Staining of OLI-neu cells with O4 antibody anddetection of apoptotic cells with TUNEL reagent show that OLI-neucells retained properties of oligodendroglial precursors. C and D: Cellswere treated with TGF-�1 for 24 h and analyzed by bright-field

microscopy. Arrows point at cells with apoptotic morphology. C: Con-trol cells. D: TGF-�-treated cells. E and F: OLI-neu cells were treatedwith TGF-� for 24 h and stained for apoptotic cells with TUNELreagent and tubulin antibody to visualize cell bodies (Roche). E: Con-trol cells. F: TGF-�-treated cells.

100 SCHUSTER ET AL.

takes place. Figure 4B shows increased caspase 3 ac-tivity in TGF-�1-treated OLI-neu cells, indicating thatthe classical apoptosis pathway involving caspase acti-vation is activated.

TGF-�-Induced Apoptosis Can Be Inhibitedby a Pan-Caspase Inhibitor

Another possibility to control if the TGF-�-mediatedeffect is an apoptotic process is to inhibit all caspases asthe effectors of cell death by an irreversible broad-spectrum caspase inhibitor (Z-VAD-FMK). OLI-neucells were pretreated 30 min with the pan-caspase in-hibitor or DMSO as control and then treated withTGF-�1 for 24 h. Cells were harvested and subjected toflow cytometric analysis as described above to measurethe percentage of apoptotic cells. As shown in Figure4C, the apoptotic cell population is reduced to normallevels in cells pretreated with caspase inhibitors. Fromthe above experiments, we can conclude that TGF-�

activates an apoptotic process in OLI-neu cells involv-ing the activation of caspase 3.

Caspase 3 Activation Can Be Inhibited byCaspase 8 and 9 Inhibitors But Is Not

Influenced by Calpain Inhibitor

Next, the activation process of caspase 3 was ana-lyzed. Since TGF-� is able to activate calpain and cal-pain in turn can cleave and activate caspase 3 (Brownet al., 1999; McGinnis et al., 1999), we asked if calpaincould be involved in this activation process. We pre-treated OLI-neu cells with caplain inhibitor followed byincubation in the presence or absence of TGF-�1 for24 h. Cells were harvested and analyzed for caspase 3activity. As shown in Figure 5A, the application of thecalpain inhibitor could not block TGF-�-mediatedcaspase 3 activation. To show that the calpain inhibitoris really active, we performed a calpain activity assay.Purified calpain was incubated with a fluorogenic sub-

Fig. 3. Photomicrograph illustrating TGF-�-induced apoptosis in cultured primary mouse O2A pro-genitor cells. A and B: LB1 immunoreactivity and TUNEL staining of a control culture. C and D: LB1immunoreactivity and TUNEL-positive signals of cells pretreated with TGF-� for 16 h. Scale bar, 50 �m.[Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

101TGF-� INDUCES CELL DEATH

strate in the presence or absence of calpain inhibitor.As shown in Figure 5C, the calpain inhibitor can effi-ciently block calpain activity in vitro, proving that theinability to block the TGF-�-mediated caspase 3 acti-vation process in vivo is no results of an inactive inhib-itor.

In contrast, the specific inhibition of caspase 8 andcaspase 9 could efficiently block the activation ofcaspase 3 under the same experimental conditions(Fig. 5B). These data suggest that caspases 8 and 9 areboth upstream of caspase 3 activation, while calpaindoes mot mediate TGF-�-induced caspase 3 activation.

p27 Is Upregulated and bcl-XL IsDownregulated During Apoptotic Process

TGF-� induces growth arrest and apoptosis in sev-eral cell types (Chaouchi et al., 1995; Gressner et al.,1997a; Brodin et al., 1999). In oligodendroglial cellsand other cell types, members of the cdk-inhibitor fam-ilies like p27 are upregulated (Polyak et al., 1994;

Alexandrow and Moses, 1997; Kamesaki et al., 1998).This phenomenon has been found to be important foroligodendrocyte differentiation (Durand et al., 1997).One common observation during TGF-�-mediated apo-ptosis is the downmodulation of either bcl-XL or bcl-2,while the level of the proapoptotic bcl-family proteinbax is not affected in most cases (Lafon et al., 1996;Saltzman et al., 1998). Therefore, OLI-neu cells weretreated with TGF-�1 and control cells were left un-treated. Cells were harvested after 24 h and cell ex-tracts were subjected to Western blot analysis withp27-, bcl-2–, bcl-XL–, and bax-specific antibodies.TGF-� treatment led to an increase in p27 protein anda decrease in bcl, whereas protein levels of bcl-2 andbax remain unchanged, suggesting that p27 and bcl-XLare regulated upon TGF-� treatment (Fig. 6).

Downregulation of bcl-XL Is Not aCaspase-Mediated Process

To investigate whether bcl-XL downregulation is aprocess regulating apoptosis upstream of caspase acti-vation and not simply a consequence of activated

Fig. 4. A: Cells were treated with TGF-�1 for 24 h and harvested.Cell extracts were subjected to analysis with an apoptosis ELISA(three independent experiments, error bars SEM). P values derivedfrom student’s t-test are asterisk, P � 0.05 as compared to controls. B:Cells were treated with TGF-�1 for 24 h and harvested. Cell extractswere subjected to analysis with caspase 3 assay (five independentexperiments, error bars SEM). C: Cells were pretreated for 30 minwith Z-VAD-FMK (50 �M), treated with TGF-� for 24 h, and har-vested for FACS analysis (one of several independent experiments).

Fig. 5. Analysis of caspase 3 activation with calpain and caspase 8and 9 inhibitors. A: Cells were treated as described above but pre-treated for 30 min with calpain inhibitor I (50 �M). Cell extracts weresubjected to analysis with caspase 3 assay (three independent exper-iments, error bars SEM). B: Cells were treated as described above butpretreated for 30 min with caspase 8 or caspase 9 inhibitor (50 �M).Cell extracts were subjected to analysis with caspase 3 assay (oneexperiment with duplicate plates of five independent experiments,error bars SEM). C: Diagram showing quantification of calpain activ-ity assay. The assay was performed as described above.

102 SCHUSTER ET AL.

caspases (as caspases can cleave bcl-XL), OLI-neu cellswere pretreated with the caspase inhibitor Z-VAD-FMK prior to the addition of TGF-�1. Cells were har-vested and subjected to Western blot analysis withbcl-XL–specific antibodies. Pretreatment of OLI-neucells with the caspase inhibitor did not result in anincreased bcl-XL level in TGF-�-treated cells whencompared to DMSO- and TGF-�-treated cells (Fig. 7A,lanes 3 and 4). However, there was still a clear reduc-tion of bcl-XL protein level when compared to untreatedcontrol cells (Fig. 7A, lanes 1 and 2) and manifested bythe quantification of band intensity, which has beennormalized to the band intensity of actin (Fig. 7B).Therefore, we can conclude that reduction of bcl-XLprotein level is not induced by caspase cleavage butshould occur upstream of caspase activation.

bcl-XL Is Downregulated at mRNA Level

When bcl-XL regulation is upstream of caspase acti-vation, it seems likely that downmodulation of bcl-XL is

one important step during TGF-�-mediated apoptosis.TGF-� regulates gene expression by activation of Smadproteins (Massague and Chen, 2000). Smad proteinsagain cooperate with other transcription factors to ac-tivate or to inhibit expression of several target genes(Massague and Wotton, 2000). Therefore, we wanted toanalyze whether bcl-XL level is regulated at the tran-scriptional level. OLI-neu cells were treated withTGF-�1 for 16 and 24 h, harvested, and isolated totalRNA was subjected to an RT-PCR reaction with bcl-XL– and actin-specific primers as a control for equalRNA content in the RT reaction. The expression level ofbcl-XL was reduced after 16-h TGF-� treatment (Fig.7C) and decreased further after 24 h (Fig. 7C, lane 6).The level of actin was assayed to control the effectivityof RNA isolation and the RT reaction. As shown inFigure 7C (lanes 1–3), equal amounts of RNA werepresent. Since the RT-PCR method is not quantitative,we used a method that allows us to amplify 18-s rRNAas internal standard in the same reaction tube as thetarget (Quantum, Ambion). Three independent RT-PCR reactions with bcl-XL and 18-s rRNA amplimers inthe same reaction tube were performed using RNAfrom control and TGF-�-treated cells. As shown in Fig-ure 7D, the bcl-XL level is reduced after 16- and 24-hTGF-� treatment. Semiquantitative analysis of threeindependent experiments is shown in Figure 7E. Thesesemiquantitative data clearly show that bcl-XL is re-duced at the mRNA level. Therefore, we conclude thatupon TGF-� treatment, bcl-XL expression is alreadyregulated at the mRNA level.

ERK MAPK Cascade Is Downmodulated AfterTGF-� Treatment

To investigate the signaling cascades involved in theapoptotic process, we used luciferase reporter assays asa first screening. Because NF-kB and several MAPkinase cascades are involved in the regulation of apo-ptotic processes (Jarpe et al., 1998; Foo and Nolan,1999; Davis, 2000), we used reporter constructs moni-toring the activity of the Smad cascade, NF-kB, JNK,and p42/p44 MAPK cascade. Cells were transfectedwith reporter constructs and harvested after 24 h forluciferase assay. As shown in Figure 8A, the Smadcascade was activated as luciferase activity of thepSBE reporter was increased after TGF-� treatment.NF-kB and jun activity remained unchanged (Fig. 8Band C). However, the activity of the GAL4-c-Elk-1 re-porter monitoring activity in the p42/p44 MAP kinasepathway was reduced to about 30% as compared tocontrols (Fig. 8D). These data show that upon TGF-�treatment, Smad proteins are activated and the MAPkinase pathway responsible for signaling survival isdownmodulated. The NF-kB cascade is also involved incellular survival and the JNK cascade, which has beendescribed to be responsible for the active induction ofcell death, remains unaffected in TGF-�-treated OLI-neu cells. Therefore, we can conclude that the down-

Fig. 6. Analysis of p27, bcl-2, bcl-XL, and bax protein levels. Cellswere treated with TGF-�1 for 24 h and harvested for Western blotanalysis; 100 �g of extract were separated in a 12.5% SDS-polyacryl-amide gel and blotted onto PVDF membrane. The membrane wasincubated overnight with antibodies diluted 1:100 in PBS-T with 1%dry milk. After washing, the membrane was incubated 1 h withsecondary antibody (diluted 1:10,000 in PBS-T with 1% dry milk). Thesignals were detected with a chemiluminescence imager as describedin text.

103TGF-� INDUCES CELL DEATH

Fig. 7. Analysis of bcl-XL regulation. A: Cells were treated as de-scribed above but pretreated with the pan-caspase inhibitor Z-VAD-FMK (50 �M); 100 �g of cell extract were separated in a 12.5%SDS-polyacrylamide gel and blotted onto PVDF membrane. The mem-brane was incubated overnight with bcl-XL–specific antibody diluted1:100 in PBS-T with 1% dry milk. After washing, the membrane wasincubated 1 h with secondary antibody (diluted 1:10,000 in PBS-Twith 1% dry milk). The signals were detected with a chemilumines-cence imager as described in text. B: Diagram showing quantification

of Western blot analysis. C: RT-PCR analysis of bcl-XL and actinmRNA. Cells were treated as described above and harvested after 16and 24 h. RNA was isolated and transcribed into cDNA as describedin text. Actin and bcl-XL were amplified with specific primers. D:Quantum RT-PCR analysis. cDNA from control and TGF-�-treatedcells was prepared as described above. PCR with bcl-XL and 18-srRNA was performed in the same reaction tube. E: Quantification ofthree independent experiments described in C (error bars SEM).

104 SCHUSTER ET AL.

modulation of a survival pathway seems to be oneimportant step during TGF-�-mediated apotosis.

To analyze the TGF-� effect on the MAP kinasepathway in more detail on the protein level, we usedphospho-specific antibodies raised against the phos-phorylated and activated forms of p42/p44 to monitorthe activation state of p42/p44 MAPK. OLI-neu cellswere treated for 24 h with TGF-�1 and harvested forWestern blot analysis. The phosphorylated form of p42/p44 MAPK is reduced in TGF-�-treated cells (Fig. 9).The protein level of p42/p44, however, remains con-stant, arguing for a reduced phosphorylation with con-stant protein levels of p42/p44. This confirms the dataderived from the luciferase experiments, where re-duced activity of the GAL4-c-Elk-1 reporter constructwas found.

In conclusion, these data clearly show that TGF-�induces apoptotic cell death in cells of oligodendroglialorigin. The detailed analysis of the TGF-�-dependentapoptotic signaling pathway involves the downregula-tion of survival-promoting, antiapoptotic signals suchas bcl-XL and the ERK MAPK cascade, leading to theexecution of cell death via caspase 8–, caspase 9–, andfinally caspase 3–dependent mechanisms.

DISCUSSION

Programmed cell death is a widespread phenomenonduring normal development of multicellular organisms(Jacobson et al., 1997). Apoptosis is necessary, for ex-ample, for the sculpturing of digits, the removal of atail, or the elimination of lymphocytes with false spec-ificity (Jacobson et al., 1997). In the nervous system,cell death occurs in many cell populations, eliminatingabout 50% of the cells (Oppenheim, 1991). In previousstudies, we could show that TGF-� plays an importantrole during programmed neuron death in vivo (Kriegl-stein et al., 2000; Dunker et al., 2001). Immunoneutral-ization of endogenous TGF-� in chick embryos preventsontogenetic cell death of several neuron populations ofthe central and peripheral nervous system (Krieglsteinet al., 2000), as well as in the central retina (Dunker etal., 2001). To analyze the molecular basis of this phe-nomenon in more detail, we established a cell culturesystem that allowed us to study regulatory mecha-nisms involved in TGF-�-mediated apoptosis in vitro.Initial studies identified the oligodendroglial cell lineOLI-neu as a very useful and appropriate model sys-tem: TGF-� does induce apoptosis in OLI-neu cells invitro and oligodendrocytes are also developmentallyinvolved in programmed cell death. As their neuronalcounterparts, about 50% of originally generated oligo-dendrocytes die for example in the optic nerve of the rat(Barres et al., 1992). A similar situation can be found inthe developing neocortex, where about 40% of thenewly generated oligodendrocytes are lost (Trapp et al.,1997).

As shown in this study, OLI-neu cells do respond toTGF-� by activating smad-mediated transcription,which results in cell cycle arrest in the G1 phase aswell as apoptosis. Although it has been previously re-ported that TGF-� influences proliferation and differ-entiation of oligodendrocyte precursors (McKinnon etal., 1993), our data show for the first time that an

Fig. 8. Analysis of signaling cascades. Cells were transfected withreporter constructs as described in text and treated with TGF-� for24 h. Cells were harvested in passive lysis buffer and 10 �l were usedfor luciferase assay. A: pSBE reporter monitoring Smad activation.B: NFk-B–responsive element monitoring NFk-B activity. C: Junpromoter monitoring JNK activity. D: GAL4-c-Elk1 reporter monitor-ing p42/p44 MAPK activity. Each panel represents data from threeindependent experiments (error bars SEM).

Fig. 9. Analysis of p42/p44 MAPK activity. Cells were treated withTGF-� for 24 h as described above; 100 �g of cell extract were sepa-rated in a 12.5% SDS-polyacrylamide gel and blotted onto PVDFmembrane. The membrane was incubated overnight with phospho-ERK or p42/p44-specific antibody diluted 1:100 in PBS-T with 1% drymilk. After washing, the membrane was incubated 1 h with secondaryantibody (diluted 1:10,000 in PBS-T with 1% dry milk). The signalswere detected with a chemiluminescence imager as described in text.

105TGF-� INDUCES CELL DEATH

oligodendroglial progenitor cell line is sensitive forTGF-�-induced apoptosis. This is in line with the find-ing of Yu et al. (2000) that TGF-� induces growtharrest and apoptosis in primary rat oligodenrocytes.Molecularly, they found an upregulation of p27, whichwe can also conform for TGF-�-treated OLI-neu cells,and a downregulation of cyclin D. However, Yu et al.(2000) did not investigate the apoptotic process in theseprimary rat oligodendrocytes in detail. Our data pre-sented in this study outline the TGF-�-induced apopto-tic pathway in OLI-neu cells as follows: TGF-� in-creased the activity of caspase 3, which could beblocked by inhibitors of the initiator caspases 8 and 9.TGF-� is able to regulate proteases of the calpain fam-ily (Gressner et al., 1997b) and calpain has been impli-cated in TGF-�-mediated apoptosis (Brown et al.,1999). Several studies report an activation of calpain inresponse to several apoptotic stimuli (Squier et al.,1994; Waterhouse et al., 1998), and caspase 3 has beenshown to be a substrate for calpain (McGinnis et al.,1999). Therefore, we investigated the role of calpainafter TGF-� stimulation. We found no decrease incaspase 3 activity, when we treated the cells with cal-pain inhibitor I. This shows clearly that TGF-� acti-vates the classical caspase pathway via caspase 8 and9 as initiator caspases. A study investigating apoptosisin Burkitt’s lymphoma cells revealed that TGF-� seemsto induce apoptosis via a caspase 8–dependent butdeath receptor–independent mechanism (Inman andAllday, 2000). In this paradigm, application of acaspase 9 inhibitor could only partially block TGF-�-mediated apoptosis. The finding that both caspase 8and 9 inhibitors can completely block apoptosis in OLI-neu cells could be explained by a sequential activationwhere caspase 8 would be upstream of caspase 9. It hasalready been described that besides the direct activa-tion of caspase 3 by caspase 8, caspase 3 activation canbe mediated by caspase 8 with caspase 9 as a mediator,which finally processes procaspase 3 to the active form(Qin et al., 1999). Therefore, a sequential mechanism isprobably involved in TGF-�-mediated apoptosis of OLI-neu cells.

Another very common observation during TGF-�-mediated apoptosis is the downregulation of bcl-2 orbcl-XL (Lafon et al., 1996; Saltzman et al., 1998). In linewith these findings, we observed a decrease of bcl-XLprotein and mRNA level within 24 h. The decrease atthe protein level could not be blocked by the pan-caspase inhibitor Z-VAD-FMK, which argues togetherwith the reduced mRNA level of bcl-XL for a TGF-�-induced downregulation upstream of caspase activa-tion. This is an important new finding when we con-sider that bcl-2 and bcl-XL can be cleaved by caspasesduring the apoptotic process (Clem et al., 1998; Grand-girard et al., 1998). Therefore, downregulation of bcl-XLseems to be an important step in TGF-�-induced apo-ptosis and not a simple product of caspase activation.Vice versa, this could be the critical step leading to theactivation of caspase 9 via APAF-1 and subsequently tothe activation of caspase 3. Under normal conditions,

bcl-XL sequesters APAF-1 and inhibits caspase activa-tion (Hu et al., 1998; Pan et al., 1998). When bcl-XLlevel is reduced, free APAF-1 can recruit and activateprocaspase 9 in a cytochrome c–dependent manner (Liet al., 1997). The relative levels of pro- and antiapop-totic proteins of the bcl-2 family are believed to be keydeterminants in the regulation of cell death and sur-vival (Reed et al., 1996). When the level of antiapop-totic proteins like bcl-XL is reduced, this would conse-quently lead to apoptosis even if levels of proapoptoticproteins remained unchanged. We found equalamounts of bax protein as well in control as in TGF-�-treated cells. This means that TGF-� can disturb inOLI-neu cells the balance between pro- and antiapop-totic proteins at the antiapoptotic side. The analysis ofknockout mice revealed that the reduction of neuronaldeath alone does not consequently lead to severe mal-functions of the nervous system at least in the securityof the laboratory surrounding. For example, bcl-2transgenic mice (Martinou et al., 1994) or Bax knock-out mice (Knudson et al., 1995) show normal life spansdespite their increased number of neurons. On theother hand, Apaf-1 and caspase 9 knockout mice(Kuida et al., 1998; Yoshida et al., 1998) show severephenotypes leading to embryonic lethality. bcl-XLknockout mice died at embryonic day 13 due to exten-sive apoptosis, indicating that bcl-XL expression is nec-essary during early development (Motoyama et al.,1995). This, however, underlines that the regulation ofbcl-XL levels is of importance for the in vivo situationand our data imply an important role for TGF-� in thisprocess.

Another finding during our investigation points atthe same direction. When we analyzed the signalingpathways that have been shown to regulate cellularsurvival or death decisions (NF-kB and ERK for sur-vival, Jun for death), it turned out that the proapop-totic JNK pathway was not influenced by TGF-�. JNKhas not in every cell system a proapoptotic role (Mielkeand Herdegen, 2000), and the JNK1/JNK2 double-knockout mice underline that by showing that inhibi-tion of cell death hinders the closure of the neural tube,whereas apoptotic death in the dorsal plate is activated(Kuan et al., 1999). This underlines that the effect ofJNK is cell type specific.

However, the ERK pathway promoting cellular sur-vival and antagonizing the death-inducing effects ofthe JNK pathway (Xia et al., 1995) was downregulatedin OLI-neu cells after TGF-� application. The NF-kBpathway also implicated in cellular survival or apopto-sis, which is dependent on the cell system and the modeof stimulation (Foo and Nolan, 1999), remained unaf-fected in our paradigm. Experiments with dominantnegative and gain-of-function components of the JNKpathway demonstrated an important role for this path-way in neuronal cell death (Xia et al., 1995). In theirparadigm, JNK-dependent apoptosis was blocked byERK activation. This may be an important hint thatlike the balance between pro- and antiapoptotic bcl-2family proteins, MAPK pathways must be balanced

106 SCHUSTER ET AL.

under normal conditions to prevent cell death. Thismeans for our cell system again that the downregula-tion of the ERK pathway is sufficient to induce celldeath without a concomitant activation of the JNKpathway. Another study shows in an ischemia para-digm by application of the neuroprotective moleculePACAP downregulation of JNK activity and upregula-tion of ERK activity in hippocampal neurons (Shioda etal., 1998). TGF-� has been shown to downmodulateERK activity in pancretic carcinoma cells (Giehl et al.,2000). This effect has been coupled to activation of aprotein phosphatase and inhibition of proliferation inthese cells. However, the authors did not investigate ifTGF-� induced apoptosis in their system and it re-mains unclear if this downregulation is linked withreduced proliferation rate or apoptosis.

In conclusion, our data present strong evidence thatTGF-� may not only play a role during developmentalneuron death but also for developmental death of oli-godendrocytes. To substantiate these findings, TGF-�-induced killing of oligodendrocytes during developmentin vivo as well as in the context of diseases such asmultiples sclerosis remains to be shown.

ACKNOWLEDGMENTS

The authors thank Gerlinde Kuhnreich and HeikePalm for excellent technical assistance, Dr. NicoleDunker and Marcel Groot for fruitful discussions, Dr.Jacqueline Trotter for providing the OLI-neu cells, andDrs. Gerald Thiel, Peter ten Dijke, and Carl-HenrikHeldin for providing several plasmids. Supported bythe Deutsche Forschungsgemeinschaft (Kr1477/8-1 toK.K.) as well as by the DFG graduate program (toH.B.).

REFERENCES

Alexandrow MG, Moses HL. 1997. Kips off to Myc: implications forTGF beta signaling. J Cell Biochem 66:427–432.

Barres BA, Hart IK, Coles HS, Burne JF, Voyvodic JT, RichardsonWD, Raff MC. 1992. Cell death in the oligodendrocyte lineage.J Neurobiol 23:1221–1230.

Brodin G, ten Dijke P, Funa K, Heldin CH, Landstrom M. 1999.Increased smad expression and activation are associated with apo-ptosis in normal and malignant prostate after castration. CancerRes 59:2731–2738.

Brown TL, Patil S, Cianci CD, Morrow JS, Howe PH. 1999. Trans-forming growth factor beta induces caspase 3-independent cleavageof alphaII-spectrin (alpha-fodrin) coincident with apoptosis. J BiolChem 274:23256–23262.

Casaccia-Bonnefil P. 2000. Cell death in the oligodendrocyte lineage:a molecular perspective of life/death decisions in development anddisease. Glia 29:124–135.

Cazac BB, Roes J. 2000. TGF-beta receptor controls B cell responsive-ness and induction of IgA in vivo. Immunity 13:443–451.

Chaouchi N, Arvanitakis L, Auffredou MT, Blanchard DA, Vazquez A,Sharma S. 1995. Characterization of transforming growth factor-beta 1 induced apoptosis in normal human B cells and lymphoma Bcell lines. Oncogene 11:1615–1622.

Clem RJ, Cheng EH, Karp CL, Kirsch DG, Ueno K, Takahashi A,Kastan MB, Griffin DE, Earnshaw WC, Veliuona MA, HardwickJM. 1998. Modulation of cell death by Bcl-XL through caspaseinteraction. Proc Natl Acad Sci USA 95:554–559.

Curtis R, Cohen J, Fok-Seang J, Hanley MR, Gregson NA, ReynoldsR, Wilkin GP. 1988. Development of macroglial cells in rat cerebel-lum: I, use of antibodies to follow early in vivo development andmigration of oligodendrocytes. J Neurocytol 17:43–54.

Davis RJ. 2000. Signal transduction by the JNK group of MAP ki-nases. Cell 103:239–252.

Durand B, Gao FB, Raff M. 1997 Accumulation of the cyclin-depen-dent kinase inhibitor p27/Kip1 and the timing of oligodendrocytedifferentiation. EMBO J 16:306–317.

Dunker N, Schuster N, Krieglstein K. 2001. Transforming growthfactor beta modulates programmed cell death in the retina of thedeveloping chick. Development 128:1933–1942.

Foo SY, Nolan GP. 1999. NF-kappaB to the rescue: RELs, apoptosisand cellular transformation. Trends Genet 15:229–235.

Giehl K, Seidel B, Gierschik P, Adler G, Menke A. 2000. TGFbeta1represses proliferation of pancreatic carcinoma cells which corre-lates with Smad4-independent inhibition of ERK activation. Onco-gene 19:4531–4541.

Grandgirard D, Studer E, Monney L, Belser T, Fellay I, Borner C,Michel MR. 1998. Alphaviruses induce apoptosis in Bcl-2-overex-pressing cells: evidence for a caspase-mediated, proteolytic inacti-vation of Bcl-2. EMBO J 17:1268–1278.

Gressner AM, Lahme B, Mannherz HG, Polzar B. 1997a. TGF-beta-mediated hepatocellular apoptosis by rat and human hepatomacells and primary rat hepatocytes. J Hepatol 26:1079–1092.

Gressner AM, Lahme B, Roth S. 1997b. Attenuation of TGF-beta-induced apoptosis in primary cultures of hepatocytes by calpaininhibitors. Biochem Biophys Res Comm 231:457–462.

Hu Y, Benedict MA, Wu D, Inohara N, Nunez G. 1998. Bcl-XL inter-acts with Apaf-1 and inhibits Apaf-1-dependent caspase-9 activa-tion. Proc Natl Acad Sci USA 95:4386–4391.

Inman GJ, Allday MJ. 2000. Apoptosis induced by TGF-beta 1 inBurkitt’s lymphoma cells is caspase 8 dependent but is death re-ceptor independent. J Immunol 165:2500–2510.

Jacobson MD, Weil M, Raff M. 1997. Programmed cell death in animaldevelopment. Cell 88:347–354.

Jarpe MB, Widmann C, Knall C, Schlesinger TK, Gibson S, Yujiri T,Fanger GR, Gelfand EW, Johnson GL. 1998. Anti-apoptotic versuspro-apoptotic signal transduction: checkpoints and stop signs alongthe road to death. Oncogene 17:1475–1482.

Jung M, Kramer E, Grzenkowski M, Tang K, Blakemore W, Aguzzi A,Khazaie K, Chlichlia K, von Blankenfeld G, Kettenmann H. 1995.Lines of murine oligodendroglial precursor cells immortalized by anactivated neu tyrosine kinase show distinct degrees of interactionwith axons in vitro and in vivo. Eur J Neurosci 7:1245–1265.

Kamesaki H, Nishizawa K, Michaud GY, Cossman J, Kiyono T. 1998.TGF-beta 1 induces the cyclin-dependent kinase inhibitor p27Kip1mRNA and protein in murine B cells. J Immunol 160:770–777.

Knudson CM, Tung KS, Tourtellotte WG, Brown GA, Korsmeyer SJ.1995. Bax-deficient mice with lymphoid hyperplasia and male germcell death. Science 270:96–99.

Krieglstein K, Richter S, Farkas L, Schuster N, Dunker N, Oppen-heim RW, Unsicker K. 2000. Reduction of endogenous transforminggrowth factors beta prevents ontogenetic neuron death. Nat Neu-rosci 3:1085–1090.

Kuan CY, Yang DD, Samanta Roy DR, Davis RJ, Rakic P, Flavell RA.1999. The Jnk1 and Jnk2 protein kinases are required for regionalspecific apoptosis during early brain development. Neuron 22:667–676.

Kuida K, Haydar TF, Kuan CY, Gu Y, Taya C, Karasuyama H, Su MS,Rakic P, Flavell RA. 1998. Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell 94:325–337.

Laemmli UK. 1970. Cleavage of structural proteins during the assem-bly of the head of bacteriophage T4. Nature 227:680–685.

Lafon C, Mathieu C, Guerrin M, Pierre O, Vidal S, Valette A. 1996.Transforming growth factor beta 1-induced apoptosis in humanovarian carcinoma cells: protection by the antioxidant N-acetylcys-teine and bcl-2. Cell Growth Differ 7:1095–1104.

Levi G, Gallo V, Ciotti MT. 1986. Bipotential precursors of putativefibrous astrocytes and oligodendrocytes in rat cerebellar culturesexpress distinct surface features and “neuron-like” gamma-ami-nobutyric acid transport. Proc Natl Acad Sci USA 83:1504–1508.

Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, AlnemriES, Wang X. 1997. Cytochrome c and dATP-dependent formation ofApaf-1/caspase-9 complex initiates an apoptotic protease cascade.Cell 91:479–489.

Martinou JC, Dubois-Dauphin M, Staple JK, Rodriguez I, FrankowskiH, Missotten M, Albertini P, Talabot D, Catsicas S, Pietra C. 1994.Overexpression of BCL-2 in transgenic mice protects neurons fromnaturally occurring cell death and experimental ischemia. Neuron13:1017–1030.

107TGF-� INDUCES CELL DEATH

Massague J, Chen YG. 2000. Controlling TGF-beta signaling. GenesDev 14:627–644.

Massague J, Wotton D. 2000. Transcriptional control by the TGF-beta/Smad signaling system. EMBO J 19:1745–1754.

McCarthy KD, de Vellis J. 1980. Preparation of separate astroglialand oligodendroglial cell cultures from rat cerebral tissue. J CellBiol 85:890–902.

McGinnis KM, Gnegy ME, Park YH, Mukerjee N, Wang KK. 1999.Procaspase-3 and poly(ADP)ribose polymerase (PARP) are calpainsubstrates. Biochem Biophys Res Comm 263:94–99.

McKinnon RD, Piras G, Ida JA Jr, Dubois-Dalcq M. 1993. A role forTGF-beta in oligodendrocyte differentiation. J Cell Biol 121:1397–1407.

Mielke K, Herdegen T. 2000. JNK and p38 stresskinases-degenera-tive effectors of signal- transduction-cascades in the nervous sys-tem. Prog Neurobiol 61:45–60.

Motoyama N, Wang F, Roth KA, Sawa H, Nakayama K, Nakayama K,Negishi I, Senju S, Zhang Q, Fujii S. 1995. Massive cell death ofimmature hematopoietic cells and neurons in Bcl-x–deficient mice.Science 267:1506–1510.

Oppenheim RW. 1991. Cell death during development of the nervoussystem. Ann Rev Neurosci 14:453–501.

Pan G, O’Rourke K, Dixit VM. 1998. Caspase-9, Bcl-XL, and Apaf-1form a ternary complex. J Biol Chem 273:5841–5845.

Polyak K, Kato JY, Solomon MJ, Sherr CJ, Massague J, Roberts JM,Koff A. 1994. p27Kip1, a cyclin-Cdk inhibitor, links transforminggrowth factor-beta and contact inhibition to cell cycle arrest. GenesDev 8:9–22.

Qin H, Srinivasula SM, Wu G, Fernandes-Alnemri T, Alnemri ES, ShiY. 1999. Structural basis of procaspase-9 recruitment by the apo-ptotic protease-activating factor 1. Nature 399:549–557.

Reed JC, Miyashita T, Takayama S, Wang HG, Sato T, Krajewski S,Aime-Sempe C, Bodrug S, Kitada S, Hanada M. 1996. BCL-2 familyproteins: regulators of cell death involved in the pathogenesis ofcancer and resistance to therapy. J Cell Biochem 60:23–32.

Saltzman A, Munro R, Searfoss G, Franks C, Jaye M, Ivashchenko Y.1998. Transforming growth factor-beta-mediated apoptosis in theRamos B-lymphoma cell line is accompanied by caspase activationand Bcl-XL downregulation. Exp Cell Res 242:244–254.

Scurlock B, Dawson G. 1999. Differential responses of oligodendro-cytes to tumor necrosis factor and other pro-apoptotic agents: role ofceramide in apoptosis. J Neurosci Res 55:514–522.

Schuster N, Krieglstein K. 2002. Mechanisms of TGF-�-mediatedapoptosis. Cell Tissue Res 307:1–14.

Shioda S, Ozawa H, Dohi K, Mizushima H, Matsumoto K, Nakajo S,Takaki A, Zhou CJ, Nakai Y, Arimura A. 1998. PACAP protectshippocampal neurons against apoptosis: involvement of JNK/SAPKsignaling pathway. Ann NY Acad Sci 865:111–117.

Squier MK, Miller AC, Malkinson AM, Cohen JJ. 1994. Calpainactivation in apoptosis. J Cell Physiol 159:229–237.

Trapp BD, Nishiyama A, Cheng D, Macklin W. 1997. Differentiationand death of premyelinating oligodendrocytes in developing rodentbrain. J Cell Biol 137:459–468.

Waterhouse NJ, Finucane DM, Green DR, Elce JS, Kumar S, AlnemriES, Litwack G, Khanna K, Lavin MF, Watters DJ. 1998. Calpainactivation is upstream of caspases in radiation-induced apoptosis.Cell Death Differ 5:1051–1061.

Weller M, Constam DB, Malipiero U, Fontana A. 1994. Transforminggrowth factor-beta 2 induces apoptosis of murine T cell cloneswithout down-regulating bcl-2 mRNA expression. Eur J Immunol24:1293–1300.

Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. 1995.Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.Science 270:1326–1331.

Yoshida H, Kong YY, Yoshida R, Elia AJ, Hakem A, Hakem R,Penninger JM, Mak TW. 1998. Apaf1 is required for mitochondrialpathways of apoptosis and brain development. Cell 94:739–750.

Yu C, Takeda M, Soliven B. 2000. Regulation of cell cycle proteins byTNF-alpha and TGF-beta in cells of oligodendroglial lineage. J Neu-roimmunol 108:2–10.

108 SCHUSTER ET AL.