The 14-3-3 Protein Homolog ArtA Regulates Development andSecondary Metabolism in the Opportunistic Plant PathogenAspergillus flavus

Beatriz A. Ibarra,a Jessica M. Lohmar,a Timothy Satterlee,a Taylor McDonald,a Jeffrey W. Cary,b Ana M. Calvoa

aDepartment of Biological Sciences, Northern Illinois University, DeKalb, Ilinois, USAbFood and Feed Safety Research Unit, USDA/ARS, Southern Regional Research Center, New Orleans, Louisiana,USA

ABSTRACT The opportunistic plant-pathogenic fungus Aspergillus flavus producescarcinogenic mycotoxins termed aflatoxins (AF). Aflatoxin contamination of agricul-turally important crops, such as maize, peanut, sorghum, and tree nuts, is responsi-ble for serious adverse health and economic impacts worldwide. In order to identifypossible genetic targets to reduce AF contamination, we have characterized the artAgene, encoding a putative 14-3-3 homolog in A. flavus. The artA deletion mutant pres-ents a slight decrease in vegetative growth and alterations in morphological devel-opment and secondary metabolism. Specifically, artA affects conidiation, and this ef-fect is influenced by the type of substrate and culture condition. In addition, normallevels of artA are required for sclerotial development. Importantly, artA negativelyregulates AF production as well as the concomitant expression of genes in the AFgene cluster. An increase in AF is also observed in seeds infected with the A. flavusstrain lacking artA. Furthermore, the expression of other secondary metabolite genesis also artA dependent, including genes in the cyclopiazonic acid (CPA) and ustiloxingene clusters, in this agriculturally important fungus.

IMPORTANCE In the current study, artA, which encodes a 14-3-3 homolog, wascharacterized in the agriculturally and medically important fungus Aspergillus flavus,specifically, its possible role governing sporulation, formation of resistant structures,and secondary metabolism. The highly conserved artA is necessary for normal fungalmorphogenesis in an environment-dependent manner, affecting the balance be-tween production of conidiophores and the formation of resistant structures that arenecessary for the dissemination and survival of this opportunistic pathogen. Thisstudy reports a 14-3-3 protein affecting secondary metabolism in filamentous fungi.Importantly, artA regulates the biosynthesis of the potent carcinogenic compoundaflatoxin B1 (AFB1) as well as the production of other secondary metabolites.

KEYWORDS fungal development, fungal genetics, fungal secondary metabolism,gene regulation

The genus Aspergillus includes both beneficial and harmful species. Aspergillusflavus is among the latter, producing mycotoxins, including potent carcinogenic

polyketides called aflatoxins (AF), when colonizing crops of agricultural importanceworldwide. Oil seeds crops are particularly susceptible hosts, including maize,spices, peanuts, tree nuts (such as almonds, pistachios, hazelnuts, pecans, and Brazilnuts), cottonseed, and sorghum (1–5). These compounds are responsible for nu-merous health problems, including acute aflatoxicosis, immunosuppression, andliver cancer, in humans and other animal species (6). Acute aflatoxicosis is linked tothe consumption of large amounts of AF due to ingestion of contaminated crops,resulting in extreme gastrointestinal symptoms and often death (4). Recent studies

Received 10 October 2017 Accepted 6December 2017

Accepted manuscript posted online 15December 2017

Citation Ibarra BA, Lohmar JM, Satterlee T,McDonald T, Cary JW, Calvo AM. 2018. The14-3-3 protein homolog ArtA regulatesdevelopment and secondary metabolism inthe opportunistic plant pathogen Aspergillusflavus. Appl Environ Microbiol 84:e02241-17.https://doi.org/10.1128/AEM.02241-17.

Editor Volker Müller, Goethe UniversityFrankfurt am Main

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Ana M. Calvo,amcalvo@niu.edu.

GENETICS AND MOLECULAR BIOLOGY

crossm

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 1Applied and Environmental Microbiology

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

have linked AF ingestion with growth impairment in children (6, 7). Exposure to AFcoupled with hepatitis B virus further increases risk of liver cancer (8). AF and othermycotoxins are estimated to contaminate one-quarter of the world’s crops (9).Economically, AF contamination leads to substantial monetary losses yearly, due inlarge part to rejection or reduced value of contaminated crops as well as costsassociated with monitoring and detection in developed countries. In developingcountries, the health risks are a major concern due to the lack of strict regulationand monitoring of levels of AF in commodities prior to consumption by theindigenous population.

Aspergillus flavus efficiently disseminates, causing extensive infestations by produc-ing asexual spores called conidia on specialized structures termed conidiophores (3).Once the fungus is established, formation of highly resistant structures termed sclerotiacontribute to its survival under harsh environmental conditions (10–12). Current ap-proaches are insufficient to control preharvest colonization of crops by A. flavus and AFcontamination of food commodities. New approaches, such as those based on geneticstrategies, could result in the development of new methodologies to reduce dissemi-nation and survival of this organism, as well as AF biosynthesis. With this purpose, it isimportant to gain insight into the genetic regulatory pathways that control A. flavusmorphogenesis and toxin biosynthesis. The current study focuses on an A. flavus geneencoding a putative 14-3-3 protein. These proteins are a group of highly conserved,acidic, small proteins (5, 13) that are found in many different eukaryotic species, oftenpresenting multiple isoforms per species with a wide range of cellular roles. Firstdiscovered in humans, this gene was later characterized across other eukaryotic spe-cies. Isoforms of 14-3-3 homologs have been identified in animals such as Xenopus andDrosophila, as well as in plants and in yeasts (13–15). In mammals, there are sevenisoforms with roles in signal transduction pathways affecting apoptosis, adhesion,cellular proliferation, differentiation, and survival. These proteins form homodimers andheterodimers with different 14-3-3 isomers. The result is a U-shaped structure contain-ing two protein binding sites (5, 14–16). There are two copies in Saccharomycescerevisiae (BMH1 and BMH2) and Schizosaccharomyces pombe (rad24 and rad25) (13, 15,17). Characterization of these four genes and their encoded proteins provided furtherevidence that the 14-3-3 proteins play a role in a vast variety of cellular processes (13).Due to the large potential for protein interactions with 14-3-3 proteins, and theirconservation in eukaryotic organisms, it is possible that 14-3-3 homologs could alsoinfluence important functions in filamentous fungi. A gene encoding a 14-3-3 homolog,artA, was partially characterized in the model fungus Aspergillus nidulans (18), in whichit was shown that overexpression of artA resulted in a conidial polarization defect,presenting abnormal formation of germ tubes.

It is likely that as in the case of other eukaryotes, 14-3-3 proteins bind to numerousproteins in Aspergillus spp., affecting diverse signaling pathways, including thoseinvolved in development and secondary metabolism, such as those leading to myco-toxin production. In the current study, an artA homolog was characterized in theagriculturally and medically important fungus A. flavus, specifically, its possible role inthe regulation of conidiation, sclerotial formation, and the production of AF and othersecondary metabolites.

RESULTSartA is highly conserved in fungi and other eukaryotic species. Aspergillus flavus

ArtA (corresponding to artA [GenBank accession number XP_002381065.1]) presents92.0% identity and 95.1% similarity with its homolog in the model fungus A. nidulans(GenBank accession number AAK25817.1). The deduced amino acid sequence of theputative A. flavus artA protein was also compared to those of other putative homologsfrom other Aspergillus spp. (see Fig. S1 in the supplemental material). This analysisindicated that ArtA is highly conserved among species of this genus. The compar-ison between A. flavus artA and the corresponding gene in other ascomycetes aswell as basidiomycetes showed a similar pattern, with homologs found in numerous

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 2

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

species (Fig. 1). Multiple-sequence alignment of these homologs with that of A.flavus demonstrated strong sequence homology, even between distant fungalspecies (Fig. S2 and S3).

artA regulates growth and development in A. flavus. In order to characterizethe role of artA in growth and development in A. flavus, a ΔartA strain and an artAcomplementation (Com) strain were constructed. The deletion strain was confirmed bySouthern blotting (Fig. S4A). Complementation of ΔartA with the artA wild-type (WT)allele was verified by diagnostic PCR (Fig. S4B). Expression levels of artA in wild-type,ΔartA, and artA complementation strains were analyzed using quantitative real-timePCR (qRT-PCR) (Fig. S4C). artA transcripts were not detected in the deletion strain,whereas artA was expressed in the wild-type and complementation strains. Colonygrowth was slightly decreased in the ΔartA strain in comparison to that of the wild type(Fig. 2). Complementation of the ΔartA strain with the artA wild-type allele rescued thewild-type phenotype.

In addition, the absence of artA affected conidiation. However, this effect varieddepending on culture conditions. In top agar-inoculated cultures, the ΔartA strainpresented a decrease in conidial production with respect to the control strains (Fig. 3).This reduction was also accompanied by a decrease in the expression of transcriptionfactor genes brlA and wetA, components of the central regulatory pathway essential forconidiophore formation (19–21; reviewed in reference 22). Interestingly, in point-inoculated cultures, conidiation increased in the artA deletion mutant with respect tothe control strain grown under the same conditions (Fig. S5).

FIG 1 Ascomycota phylogenetic tree of ArtA fungal homologs constructed using MEGA v6.0. Trees were generated with the maximumlikelihood model with a bootstrap value of 1,000.

Role of the 14-3-3 Homolog ArtA in A. flavus Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 3

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

In addition to producing conidia, A. flavus forms resistant structures termed sclero-tia. Our results revealed that in the absence of artA the production of these structureswas precocious and increased with respect to the wild type (Fig. 4). Furthermore, geneexpression analysis of nsdC, encoding a transcription factor necessary for normalsclerotial production in A. flavus (23), showed that an increase in expression of this genecoincided with the observed increase of sclerotia in the ΔartA strain. In contrast, inpoint-inoculated cultures, sclerotial production was delayed and restricted mainly tothe center of the colony (Fig. S5).

artA negatively affects AFB1 production. To determine if artA plays a role in theproduction of aflatoxin B1 (AFB1), the content of this toxin was analyzed in ΔartAcultures as well as in cultures of the wild type and complementation strain (Fig. 5A andB). Deletion of artA resulted in an increase in AF levels compared to those in thecontrols. In addition, expression of AF cluster regulatory genes aflR and aflJ (24, 25) wasanalyzed (Fig. 5C and D). Our results indicated that expression of both regulators wasgreater in the absence of artA than in the controls. Furthermore, expression of ver1,often used as an indicator of AF gene cluster activation, also increased in the artAdeletion mutant (Fig. 5E).

artA influences the expression of other secondary metabolite genes in A.flavus. Aspergillus flavus contains 56 secondary metabolite gene clusters and is knownto produce a wide variety of other metabolites in addition to AF (26–30). In the currentstudy, our results showed that artA also affects the expression of genes involved in thesynthesis of other secondary metabolites, for example, the polyketide synthase-nonribosomal peptide synthetase (PKS/NRPS) gene (AFLA_139490), essential in thesynthesis of the indole-tetramic acid mycotoxin cyclopiazonic acid (CPA) (26), and ustD,

FIG 2 Effects of artA on vegetative colony growth. Colony growth was quantified as colony diameter. A.flavus strains were point inoculated on YGT medium and incubated at 30°C in the dark. Measurementswere taken 5 days after inoculation. Values shown are the means from three samples. Error bars representSEs. Different letters above the columns indicate statistically different values (P � 0.05).

FIG 3 Effects of artA on asexual development. (A) Quantification of conidia after 72 h of incubation of top agar-inoculated cultures. Seven-millimeter cores weretaken from each culture. Conidia were counted using a hemocytometer. (B and C) qRT-PCR expression analyses of brlA and wetA. Error bars represent SEs.Different letters above the columns indicate statistically different values (P � 0.05).

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 4

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

involved in the production of ustiloxin, an inhibitor of microtubule assembly (31).Specifically, artA positively regulates the expression of these genes in A. flavus (Fig. 6).

Effect of artA on peanut seed infection. Due to the fact that the aflatoxin producerA. flavus is an opportunistic pathogen of economically relevant oil seed crops, thepossible effect of artA on peanut seed infection was examined. Our analysis revealedthat in the absence of artA conidial production was increased with respect to thecontrols when the fungus was grown on a peanut seed substrate (Fig. 7). In addition,analysis of AF content in the infected tissue indicated that artA also negatively regulatesAFB1 production under these conditions (Fig. 7).

DISCUSSION

In this work we investigated the role of artA, encoding a putative 14-3-3 protein, inmorphological development and secondary metabolism of the agriculturally and med-ically important fungus A. flavus. Our in silico analysis indicated that the predicted ArtAprotein sequence is highly conserved within its corresponding homologs in ascomy-cetes and basidiomycetes, as well as in other eukaryotes, in which they have beenfound to be involved in the regulation of numerous cellular processes. Approximately200 different proteins from a wide range of eukaryotic organisms have been reportedas binding partners for the 14-3-3 proteins (for examples, see references 16, 32, 33, and34). Although there are numerous studies in yeasts, in which these proteins areessential in most genetic backgrounds (reviewed in reference 13), 14-3-3 proteins aremostly unknown in filamentous fungi, with a few exceptions: in Trichoderma reesei the14-3-3 proteins were shown to affect the secretory system (35); also, overexpression ofthe artA homolog in A. nidulans resulted in changes of polarization of conidia, with

FIG 4 artA regulates sclerotial production in A. flavus. (A) Strains grown on YGT top agar for 48 h and 72 h. In the second row, plateswere sprayed with ethanol before photographs and micrographs were taken. (B) Quantification of sclerotial production. Sixteen-millimeter cores were collected. The sclerotia in each core were counted under a Leica MZ75 dissecting microscope. (C) qRT-PCRexpression analysis of nsdC. Error bars represent SEs. Different letters above the columns indicate statistically different values (P �0.05).

Role of the 14-3-3 Homolog ArtA in A. flavus Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 5

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

defects in the formation of germ tubes (18). The majority of the ArtA protein sequencein A. flavus is conserved with homologs throughout numerous fungal species, withmore variation at the C-terminal region, in agreement with previous observations (13,17). It is possible that the divergent C termini of 14-3-3 proteins could have an effecton the diversity of roles of these proteins in the cell.

Interestingly, our results revealed that artA plays a role in the morphologicaldifferentiation and secondary metabolism of this fungus. Specifically, artA is a positive

FIG 5 artA is a negative regulator of AFB1 biosynthesis. (A) TLC analysis of aflatoxin B1 production in wild-type, ΔartA, andcomplementation strain cultures after 48 h (top) and 72 h (bottom) of incubation. (B) Densitometry of TLC present in panel A. (C, D,and E) qRT-PCR expression analyses of aflR, aflJ, and ver1, respectively, after 48 h of incubation. Error bars represent SEs. Differentletters above the columns indicate statistically different values (P � 0.05).

FIG 6 Effects of artA on the expression of key genes in the ustiloxin and CPA secondary-metabolite geneclusters. The A. flavus strains were top agar inoculated on YGT medium and incubated at 30°C. Myceliumwas collected after 72 h of incubation. qRT-PCR results show the relative expression of the AFLA_139490gene in the CPA gene cluster and the ustD gene in the ustiloxin gene cluster. Error bars represent SEs.Different letters above the columns indicate statistically different values (P � 0.05).

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 6

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

regulator of A. flavus growth, as a slight reduction in the diameter of the ΔartA colonieswas observed compared to those of wild type. In addition to the effect of artA onvegetative growth, artA influences asexual development. When the fungus was grownon top agar-inoculated cultures, deletion of artA resulted in a decrease in conidiation,accompanied by a reduction in expression of brlA and wetA, essential genes in thecentral regulatory pathway that controls asexual development (19, 21). However, whenA. flavus was grown as point-inoculated cultures on the same medium, the outputchanged and conidiation was enhanced in the ΔartA strain with respect to the controls.Similarly, conidiation also increased in the absence of artA when grown on a differentsubstrate, such as peanut seeds. This suggests that the role of artA in asexual devel-opment depends on environmental clues, such as cell density or crowdedness (36), aswell as the type of substrate on which the organism is grown, acting as a modulator ofA. flavus development and contributing to the optimization of spore disseminationdepending on external stimuli.

Aspergillus flavus also produces sclerotia, structures that allow this fungus to survive

FIG 7 Effects of artA on A. flavus peanut seed infection. The NC94022 Virginia peanut line was infectedwith the A. flavus strains and incubated at 30°C in the dark for 7 days. (A) Photographs of the infectedpeanuts after incubation. (B) TLC analysis of AFB1 present in infected peanuts. (C) Densitometry of TLCin panel B. (D) Quantification of conidia produced on infected peanut cotyledons. The experiment wascarried out in triplicate. Error bars represent SEs. Different letters above the columns indicate statisticallydifferent values (P � 0.05).

Role of the 14-3-3 Homolog ArtA in A. flavus Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 7

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

extreme environmental conditions (10–12, 23, 37). These hard-pigmented structuresconsist of compact mycelia (1, 6) that are vestigial forms of the sexual fruiting bodies(38, 39). Additional research by Horn et al. (40) on the sexual stage in A. flavusdemonstrated the presence of ascospores in A. flavus sclerotia (termed stromata) underlaboratory conditions. The current study revealed that artA also regulates sclerotialproduction in this fungus. In this case, absence of artA resulted in an effect oppositethat observed for conidiation, influencing the developmental balance between thesetwo morphological stages. On top agar-inoculated plates, the absence of artA greatlypromoted sclerotial production, while in point-inoculated cultures, ΔartA sclerotia wereformed only at the center or near the center of the colony, where cell density and rapiddepletion of nutrients occur, while formation of conidiophores abundantly occurred inthese colonies. The differential effects of artA on sclerotial formation under differentculture conditions suggest, as in the case of conidiation, that artA is a mediatorbetween the environment cues and the developmental changes observed in thismycotoxigenic fungus.

In addition to its effect of fungal development, artA also affects secondary metab-olism in A. flavus. AFB1 levels were significantly increased in the deletion mutant bothin laboratory medium and on seeds, indicating that artA negatively regulates theproduction of this toxin. Genes involved in secondary metabolism are normally foundin clusters (41–45). This is also the case for the AF gene cluster. Two well-knownendogenous regulatory genes are found within the AF cluster, aflR and aflJ. Theexpression of both aflR and aflJ (also called aflS) was increased in the absence of artA.Furthermore, expression of ver1 (also called aflM), which is a structural gene in the AFpathway that is commonly used as an indicator of AF cluster activation, was alsoenhanced, coinciding with the observed increase in AF biosynthesis. These resultsindicate that artA is a key negative regulator of AF gene expression and concomitantAF production. Importantly, our chemical analysis indicated that artA also affects thesynthesis of other metabolites. Different from the case of the AF genes, expression ofthe PKS/NRPS (AFLA_139490) and ustD (AFLA_095040) genes, corresponding to theCPA and ustiloxin gene clusters, respectively, was negatively regulated by artA. Theseresults indicate a broad regulatory role for this gene in A. flavus secondary metabolismdifferentially affecting diverse gene clusters.

ArtA homologs have been previously described as scaffolds/adaptors interactingwith numerous proteins and influencing multiple cell functions (5, 13, 15, 16, 46–49).ArtA could interact with and modulate the function of proteins present in the cell andalso affect the transcriptional machinery for the expression of numerous genes, includ-ing those observed in this study, such as the developmental genes brlA, wetA, and nsdC,as well as the described artA-dependent secondary-metabolite genes.

In conclusion, A. flavus artA encodes a highly conserved 14-3-3 homolog that isrequired for normal fungal morphogenesis in an environment-dependent manner,affecting the balance between production of conidiophores and the formation ofresistant structures that are necessary for the dissemination and survival of thisopportunistic pathogen. In addition, to our knowledge this is the first report of a 14-3-3protein affecting secondary metabolism in filamentous fungi; importantly, artA nega-tively regulates the biosynthesis of the potent carcinogenic compound AFB1 as well asthe production of other secondary metabolites in this agriculturally and medicallyrelevant fungus.

MATERIALS AND METHODSSequence alignment and phylogenetic analysis. The gene sequence and the deduced amino

acid sequence corresponding to A. flavus artA (AFLA_092450 and XP_002381065.1, respectively)(accession numbers for amino acid sequences are provided in Table 1) were obtained from NCBI.Sequencing verification using primers A.fl_artA-SEQ5=F and A.fl_artA-SEQ3=R (Table 2) indicatederrors, specifically two guanine deletions, in the published sequence at positions 941 and 949 fromthe start codon. The corrected sequence was used in this study.

The BLASTP search tool was used to identify homologs in other fungal species. The accessionnumbers corresponding to all sequences used in this study are listed in Table 1. MUSCLE sequencealignment (http://www.ebi.ac.uk/Tools/msa/muscle/) was used with all sequences. This was followed

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 8

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

by shading using the Color Align Conservation from the Sequence Manipulation Suite (http://www.bioinformatics.org/sms2/color_align_cons.html).

The software MEGA v6.0 was used for sequence alignment and analysis (50). After input of data intoMEGA, MUSCLE settings were used to generate a multiple-sequence alignment. For generation ofphylogenetic trees, a maximum likelihood model was used with a bootstrap value of 1,000 (http://megasoftware.net/).

Strains and culture conditions. In order to characterize the artA gene, CA14 (ΔpyrG ΔniaD Δku70)(SRRC collection number 1709), a WT CA14 (pyrG� niaD� Δku70) control strain, artA deletion mutantTBAI3 (ΔartA::pyrG niaD� Δku70), and a complementation strain (ΔartA::pyrG artA::niaD Δku70), TBAI6,were used. All strains were grown on YGT medium (5 g of yeast extract, 20 g of glucose, and 1 ml of traceelements [51]) at 30°C in the dark, unless otherwise specified. Agar (10 g/liter) was added in the case ofsolid medium. Strains were maintained as 30% glycerol stocks at �80°C.

Generation of the �artA strain. The artA deletion cassette was constructed using fusion PCR aspreviously described (52). The 5= and 3= untranslated (UTR) fragments were first PCR amplified from A.flavus genomic DNA using primers 1346 and 1347 (full names are given in Table 2), obtaining a 1.399-kbproduct, and primers 1348 and 1349, obtaining a 1.587-kb product, respectively. A third fragmentcontaining the auxotrophic marker A. fumigatus pyrG was PCR amplified from plasmid p1439 usingprimers 1358 and 1359. Primers 1362 and 1363 were used to fuse these three fragments, resulting in thegeneration of a deletion cassette that was then transformed into A. flavus CA14 (ΔpyrG ΔniaD Δku70).

All the primers used in this study are listed in Table 2. Fungal transformation was performed asprevious described (53). Transformants were selected on Czapek Dox (CZ; Difco, Franklin Lakes, NJ) plussucrose as an osmotic stabilizer without supplementation of uridine and uracil. Transformants wereconfirmed by Southern blotting. A selected artA deletion strain, TBAI2, was then transformed with thewild-type niaD allele from A. flavus, previously PCR amplified from genomic DNA with primers 1576 and1577, to obtain a prototroph, TBAI3.

Generation of the complementation strain. A complementation strain was obtained by transform-ing the A. flavus ΔartA mutant with the artA wild-type allele. The complementation vector was generatedas follows. A DNA fragment containing the artA wild-type allele was PCR amplified from A. flavuswild-type genomic DNA using primers 1507 and 1513. The resulting PCR product was digested with PstIand subsequently ligated to pSD52.2, containing A. fumigatus niaD, which was previously digested withthe same enzyme, resulting in plasmid pBAI2. This plasmid was transformed into TBAI2. The presence ofthe complementation plasmid in the transformants was verified by diagnostic PCR. The resultingcomplementation strain was denominated TBAI6.

Morphological studies. The possible role of artA in the regulation of fungal growth, conidiation, andsclerotial development was investigated. A. flavus wild-type, ΔartA, and complementation strains were

TABLE 1 Accession numbers for sequences of ArtA used for sequence alignment andphylogenetic analysis

Species GenBank accession number

Aspergillus flavus XP_002381065.1Aspergillus oryzae XP_001823993.1Aspergillus niger XP_001218186.1Aspergillus kawachii GAA85416.1Aspergillus clavatus XP_001272853.1Aspergillus ruber EYE98024.1Aspergillus fischeri XP_001265893.1Aspergillus fumigatus XP_749464.1Aspergillus nidulans AAK25817.1Penicillium digitatum XP_014531373.1Penicillium rubens XP_002562230.1Penicillium subrubescens OKO90863.1Talaromyces marneffei XP_002150416.1Trichoderma virens XP_013949592.1Trichoderma reesei CAC20377.1Fusarium verticillioides XP_018750037.1Fusarium fujikuroi KLO89980.1Fusarium graminearum XP_011326500.1Neurospora crassa XP_964462.1Candida albicans XP_721512.1Schizosaccharomyces pombe NP_594167.1Saccharomyces cerevisiae ONH73069.1Trichosporon asahii XP_014184402.1Puccinia graminis XP_003328515.1Botryobasidium botryosum KDQ15383.1Coprinopsis cinerea XP_001837506.1Ustilago maydis XP_011387257.1Agaricus bisporus XP_006456745.1Neolentinus lepideus KZT24546.1

Role of the 14-3-3 Homolog ArtA in A. flavus Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 9

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

point inoculated on YGT solid medium and incubated at 30°C for 5 days. Fungal growth was measuredas colony diameter. The experiment was carried out with three replicates. To quantify production ofconidia, spores (106 conidia/ml) from each strain were top agar inoculated on YGT medium. After 48 hand 72 h of incubation, 7-mm cores were harvested and homogenized in water. Conidia were quantifiedusing a hemocytometer (Hausser Scientific, Horsham, PA) under a bright-field Nikon Eclipse E400microscope (Nikon Inc., Melville, NY). In addition, 16-mm cores were harvested and washed with 70%ethyl alcohol (EtOH) to visualize and quantify sclerotial production. Micrographs were taken with a LeicaMZ7.5 microscope coupled with a Leica MC170 camera (Leica Microsystems Inc., Buffalo Grove, IL). Theexperiment was performed with three replicates. An additional experiment was carried out with YGTpoint-inoculated cultures incubated for 7 days. Plates were photographed before and after washes with70% EtOH. The experiment included three replicates.

Aflatoxin analysis. To analyze the effect of artA on the production of AF, specifically AFB1, spores(5 � 106 conidia) from wild-type, ΔartA, and complementation strains were top agar inoculated on YGTmedium and incubated for 72 h. Three 16-mm cores were collected, and toxin was extracted with 5 mlof chloroform. AF extracts were then allowed to dry overnight and resuspended in 250 �l of chloroform.Thin-layer chromatography (TLC) was used to separate the extracts using a chloroform-acetone (85:15,vol/vol) solvent system. A standard of AFB1 (Sigma-Aldrich, St. Louis, MO) was used as a reference. TheTLC plate (Macherey-Nagel, Bethlehem, PA) was air dried, sprayed with a 12.5% AlCl3 solution in 95%ethanol, and baked at 80°C for 10 min. The samples were visualized using UV detection at 375 nm.Densitometry of AF bands in the TLC plates was carried out using Gelquant.NET software. This experi-ment included three replicates.

Gene expression analysis. Wild-type, ΔartA, and complementation strains were top agar inoculated(5 � 106 conidia) on YGT medium and incubated for 48 h and 72 h. Mycelium from each strain wascollected and lyophilized overnight. Total RNA was extracted using TRIsure (Bioline, Taunton, MA) and anRNeasy minikit (Qiagen, Valencia, CA) as described by the manufacturers. Five micrograms of total RNAwas treated using RQ1 DNase (Promega, Madison, WI) to remove possible DNA contamination. Approx-imately 1 �g of DNase-treated RNA was used for cDNA synthesis using Moloney murine leukemia virus(MMLV) reverse transcriptase (Promega). qRT-PCR was performed utilizing an Mx3000p thermocycler(Agilent Technologies, Santa Clara, CA) with SYBR green Jumpstart Taq Ready Mix (Sigma) to evaluate the

TABLE 2 Primers used in this study

Name Sequence (5= ¡ 3=)1346-AflartA08271_5=F CGCGGGTGAGTCAGCGGGTC1347-AflartA08271_5=R GAGGGCCAAAAGCAACGGAAAAAGCAAGTATGAAATGG1348-AflartA08271_3=F GAACGCCTCCACCGAGAAGAAGGAGGA1349-AflartA08271_3=R GGCGAGGCGGGGAGAGTAAGCATTTTCAC1352-AflartA08271_Asc1 AAAAAGGCGCGCCATGGGTCACGAAGATGCTGTTTATCTGGCCAAGC1353-AflartA08271_Not1 AAAAAAAAAAAGCGGCCGCTCAGCAGCGGCTCGGCTCAG1358-08271artApyrGF CCATTTCATACTTGCTTTTTCCGTTGCTTTTGGCCCTCACCGGTCGCCTCAAACAATGCTCT1359-08271artApyrGR TCCTCCTTCTTCTCGGTGGAGGCGTTCGTCTGAGAGGAGGCACTGATGCG1362-Afl_artA_NF GGGACTCTGGTGCTTGGATACGGGC1363-Afl_artA_NR CTAGCCCCATCTCAGCCACACCC1507-Afl_artA_Comp. F AAAAAAACTGCAGCGCGGGTGAGTCAGCGGGTC1513-Afl_artA_Comp. R AAAAAAACTGCAGGGAGCGACGATGCGCGTGGAG1576-13837-flavus-niaD F CGTGGCGAGATGTTTGACTATCGAATCAC1577-13837-flavus-niaD R AGGGAGCCGTGACACTTGGCCTCAfla_18S F TGATGACCCGCTCGGCACCTTACGAGAAATCAAAGTAfla_18S R GGCCATGCACCACCATCCAAAAGATCAAGAAAGAGCqPCR-Afla_artA_F GGCGAGTCTAAGGTCTTCTACCACAAGATqPCR-Afla_artA_R GGTTGTCTCTGAGAAGCTGCATCATCAGqPCR-Afla_brlA_F TATCCAGACATTCAAGACGCACAGqPCR-Afla_brlA_R GATAATAGAGGGCAAGTTCTCCAAAGqPCR_Afla_wetA_F GGGCTGTTCACGCCTGATCTqPCR_Afla_wetA_R GACCCCCTTGCAGGATGTCAqPCR_Afla_nsdC_F GGAAGTTACGCTCCTGAAGATGqPCR_Afla_nsdC_R CGTTCGTCCTCTTCATCCATACqPCR-Afla_ver1 F CCGACAACCACCGTTTAGATGGCqPCR-Afla_ver1 R ACGTCTTTCAGGTGACCGAACGATAqPCR-Afla_aflR_F GCAACCTGATGACGACTGATATGGqPCR-Afla_aflR_R TGCCAGCACCTTGAGAACGATAAGqPCR-Afla_aflJ_F TGGAATATGGCTGTAGGAAGTGqPCR-Afla_aflJ_R CATCCGAGTGAGCGTATCCqPCR-Afla PKS/NRPS CPA F TCGGGAGACTGCGGTCAACTCqPCR-Afla PKS/NRPS CPA R CCCACATAGAGTTTGTCGTCCGGqPCR-Afla Ustiloxin ustD NRPS F TGCACAGGCAGAAACACCTCTTGqPCR-Afla Ustiloxin ustD NRPS R CCGGGGGGAAAGGGAAGGAAA.fl_artA-SEQ5=F GGACACCTTATTAACATTTGTCGCAGAGCA.fl_artA-SEQ3=R GTTTGAGGGGGCACGAGTCTG

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 10

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

expression of artA as well as the expression of regulatory genes involved in development (brlA, wetA, andnsdC) and secondary-metabolite production (aflR, aflJ, ver1, the PKS/NRPS gene [AFLA_139490], and ustD[AFLA_095040]). cDNA was normalized to A. flavus 18S ribosomal gene expression, and the relativeexpression levels were calculated using the threshold cycle (2�ΔΔCT) method (54). Primers used for geneexpression analysis are listed in Table 2.

Pathogenicity assay. The NC94022 Virginia peanut line used in this study was kindly providedby Baozhu Guo (USDA, Tifton, GA). The methods utilized in this study are similar to those describedby Zhuang et al. (55), with minor modifications. Briefly, the shelled viable peanut cotyledons (0.3 gto 0.4 g), with the embryos removed, were surface sterilized utilizing a 10% beach solution;cotyledons were submerged for approximately 1 min. The peanut cotyledons were then washedtwice in sterile water and dried. Approximately 10 cotyledons were infected on the adaxial surfaceof the cotyledon per fungal strain (approximately 105 conidia/cotyledon) and incubated at 30°C for7 days in the dark.

Quantification of conidia in infected seeds. Two infected peanut cotyledons were collected inindividual 1.7-ml Eppendorf tubes. One milliliter of water was added into each tube and vortexed for 1min. Conidia were quantified using a hemocytometer (Hausser Scientific) under a bright-field NikonEclipse E400 microscope (Nikon Inc.). This experiment was carried out in duplicate.

AFB1 analysis of infected seeds. Infected cotyledons (four per strain) were ground in liquidnitrogen and added to a 50-ml Falcon tube containing 12 ml of water. Samples were extracted with 6 mlof acetone at room temperature for 3 h on a rotary platform. Extracts were then filtered through a pieceof Whatman paper and collected into a separate 50-ml Falcon tube. Seventeen milliliters of methylenechloride was added to the tubes and vortexed for 1 min. The samples were then centrifuged for 5 minat 4,000 rpm before 15 ml of the bottom organic phase was collected and filtered through sodium sulfateto remove any excess water. Extracts were collected into a 50-ml glass beaker and allowed to evaporate.Samples were then resuspended in 2 ml of methylene chloride and transferred to another 50-ml beaker,in which they were allowed to evaporate again. Finally, the extracts were solubilized in 150 �l of acetone.Ten microliters of each sample was analyzed by TLC as described above.

Statistical analysis. Statistical analysis was carried out for all quantitative data in this study. Analysisof variance (ANOVA) in conjunction with Tukey’s post hoc test was carried out using the statisticalsoftware program R version �64 3.3.0.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02241-17.

SUPPLEMENTAL FILE 1, PDF file, 2.0 MB.

ACKNOWLEDGMENTSThis work was supported by USDA grant 58-6435-4-015 and the Department of

Biological Sciences at Northern Illinois University.We thank Bahzhu Guo (USDA, Tifton, Georgia) for kindly providing the NC94022

Virginia peanut line used in this study.

REFERENCES1. Amaike S, Keller NP. 2011. Aspergillus flavus. Annu Rev Phytopathol

49:107–133. https://doi.org/10.1146/annurev-phyto-072910-095221.2. Bennett JW. 2010. An overview of the genus Aspergillus. Aspergillus.

Caister Academic, Poole, United Kingdom.3. Hedayati MT, Pasqualotto AC, Warn PA, Bowyer P, Denning DW. 2007.

Aspergillus flavus: human pathogen, allergen and mycotoxin producer. Mi-crobiology 153:1677–1692. https://doi.org/10.1099/mic.0.2007/007641-0.

4. Wu F, Guclu H. 2012. Aflatoxin regulations in a network of global maizetrade. PLoS One 7(9):e45151. https://doi.org/10.1371/journal.pone.0045151.

5. Yang X, Lee WH, Sobott F, Papagrigoriou E, Robinson CV, Grossmann JG,Sundström M, Doyle DA, Elkins JM. 2006. Structural basis for protein-protein interactions in the 14-3-3 protein family. Proc Natl Acad Sci U S A103:17237–17242. https://doi.org/10.1073/pnas.0605779103.

6. Wu F, Groopman JD, Pestka JJ. 2014. Public health impacts of foodbornemycotoxins. Annu Rev Food Sci Technol 5:351–372. https://doi.org/10.1146/annurev-food-030713-092431.

7. Khlangwiset P, Shephard GS, Wu F. 2011. Aflatoxins and growthimpairment: a review. Crit Rev Toxicol 41:740 –755. https://doi.org/10.3109/10408444.2011.575766.

8. Groopman JD, Kensler TW, Wild CP. 2008. Protective interventions to pre-vent aflatoxin-induced carcinogenesis in developing countries. Annu RevPublic Health 29:187–203. https://doi.org/10.1146/annurev.publhealth.29.020907.090859.

9. Robens J, Cardwell K. 2003. The costs of mycotoxin management to the

USA: management of aflatoxins in the United States. J Toxicol Toxin Rev22:139 –152. https://doi.org/10.1081/TXR-120024089.

10. Coley-Smith JR, Cooke RC. 1971. Survival and germination of fungal sclero-tia. Annu Rev Phytopathol 9:65–92. https://doi.org/10.1146/annurev.py.09.090171.000433.

11. Malloch D, Cain RF. 1972. The Trichocomataceae: ascomycetes withAspergillus, Paecilomyces and Penicillium imperfect states. Can J Bot50:2613–2628. https://doi.org/10.1139/b72-335.

12. Wicklow DT. 1987. Survival of Aspergillus flavus sclerotia in soil. Trans BrMycol Soc 89:131–134. https://doi.org/10.1016/S0007-1536(87)80073-6.

13. van Heusden GPH, Steensma HY. 2006. Yeast 14-3-3 proteins. Yeast23:159 –171. https://doi.org/10.1002/yea.1338.

14. Lalle M, Leptourgidou F, Camerini S, Pozio E, Skoulakis EMC. 2013. Interk-ingdom complementation reveals structural conservation and functionaldivergence of 14-3-3 proteins. PLoS One 8(10):e78090. https://doi.org/10.1371/journal.pone.0078090.

15. van Heusden GPH. 2009. 14-3-3 proteins: insights from genome-widestudies in yeast. Genomics 94:287–293. https://doi.org/10.1016/j.ygeno.2009.07.004.

16. Fu H, Subramanian RR, Masters SC. 2000. 14-3-3 proteins: structure,function and regulation. Annu Rev Pharmacol Toxicol 40:617– 647.https://doi.org/10.1146/annurev.pharmtox.40.1.617.

17. Gelperin D, Weigle J, Nelson K, Roseboom P, Irie K, Matsumoto K,Lemmon S. 1995. 14-3-3 proteins: potential roles in vesicular transport

Role of the 14-3-3 Homolog ArtA in A. flavus Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 11

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

and Ras signaling in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A92:11539 –11543. https://doi.org/10.1073/pnas.92.25.11539.

18. Kraus PR, Hofmann AF, Harris SD. 2002. Characterization of the Asper-gillus nidulans 14-3-3 homologue, ArtA. FEMS Microbiol Lett 210:61– 66.https://doi.org/10.1111/j.1574-6968.2002.tb11160.x.

19. Adams TH, Boylan MT, Timberlake WE. 1988. brlA is necessary andsufficient to direct conidiophore development in Aspergillus nidulans.Cell 54:353–362. https://doi.org/10.1016/0092-8674(88)90198-5.

20. Adams TH, Timberlake WE. 1990. Developmental repression of growthand gene expression in Aspergillus. Proc Natl Acad Sci U S A 87:5405–5409. https://doi.org/10.1073/pnas.87.14.5405.

21. Adams TH, Wieser JK, Yu J. 1998. Asexual Sporulation in Aspergillusnidulans. Microbiol Mol Biol Rev 62:35–54.

22. Krijgsheld P, Bleichrodt R, van Veluw GJ, Wang F, Müller WH, DijksterhuisJ, Wösten HA. 2013. Development of Aspergillus. Stud Mycol 74:1–2.https://doi.org/10.3114/sim0006.

23. Cary JW, Harris-Coward PY, Ehrlich KC, Mack BM, Kale SP, Larey C, CalvoAM. 2012. NsdC and NsdD affect Aspergillus flavus morphogenesis andaflatoxin production. Eukaryot Cell 11:1104 –1111. https://doi.org/10.1128/EC.00069-12.

24. Chang PK. 2003. The Aspergillus parasiticus protein AFLJ interacts withthe aflatoxin pathway-specific regulator AFLR. Mol Gen Genomics 268:711–719. https://doi.org/10.1007/s00438-003-0809-3.

25. Woloshuk CP, Yousibova GL, Rollins JA, Bhatnagar D, Payne GA. 1995.Molecular characterization of the afl-1 locus in Aspergillus flavus. ApplEnviron Microbiol 61:3019 –3023.

26. Chang PK, Horn BW, Dorner JW. 2009. Clustered genes involved incyclopiazonic acid production are next to the aflatoxin biosynthesisgene cluster in Aspergillus flavus. Fungal Genet Biol 46:176 –182. https://doi.org/10.1016/j.fgb.2008.11.002.

27. Khaldi N, Seifuddin FT, Turner G, Haft D, Nierman WC, Wolfe KH, Fedo-rova ND. 2010. SMURF: genomic mapping of fungal secondary metab-olite clusters. Fungal Genet Biol 47:736 –741. https://doi.org/10.1016/j.fgb.2010.06.003.

28. Terabayashi Y, Sano M, Yamane N, Marui J, Tamani K, Sagara J, DohmotoM, Oda K, Ohshima E, Tachibana K, Higa Ohashi YS, Koike HH, MachidaM. 2010. Identification and characterization of genes responsible forbiosynthesis of kojic acid, an industrially important compound fromAspergillus oryzae. Fungal Genet Biol 47:953–961. https://doi.org/10.1016/j.fgb.2010.08.014.

29. Tokuoka M, Seshime Y, Fujii I, Kitamoto K, Takahashi T, Koyama Y. 2008.Identification of a novel polyketide synthase-nonribosomal peptide syn-thetase (PKS-NRPS) gene required for the biosynthesis of cyclopiazonicacid in Aspergillus oryzae. Fungal Genet Biol 45:1608 –1615. https://doi.org/10.1016/j.fgb.2008.09.006.

30. Zhang S, Monahan BJ, Tkacz JS, Scott B. 2004. Indole-diterpene genecluster fromAspergillus flavus. Appl Environ Microbiol 70:6875– 6883.https://doi.org/10.1128/AEM.70.11.6875-6883.2004.

31. Umemura M, Nagano N, Koike H, Kawano J, Ishii T, Miyamura Y, KikuchiM, Tamano K, Yu J, Shin-ya K, Machida M. 2014. Characterization of thebiosynthetic gene cluster for the ribosomally synthesized cyclic peptideustiloxin B in Aspergillus flavus. Fungal Genet Biol 68:23–30. https://doi.org/10.1016/j.fgb.2014.04.011.

32. Kumar R. 2017. An account of fungal 14-3-3 proteins. Eur J Cell Biol96:206 –217. https://doi.org/10.1016/j.ejcb.2017.02.006.

33. van Heusden GPH. 2005. 14-3-3 proteins: regulators of numerouseukaryotic proteins. IUBMB Life 57:623– 629. https://doi.org/10.1080/15216540500252666.

34. van Hemert MJ, van Heusden GPH, Steensma HY. 2001. Yeast 14-3-3proteins. Yeast 18:889 – 895. https://doi.org/10.1002/yea.739.

35. Vasara T, Keränen S, Penttilä M, Saloheimo M. 2002. Characterization oftwo 14-3-3 genes from Trichoderma reesei: interactions with yeast secre-tory pathway components. Biochim Biophys Acta 1590:27– 40. https://doi.org/10.1016/S0167-4889(02)00197-0.

36. Horowitz Brown S, Zarnowski R, Sharpee WC, Keller NP. 2008. Morpho-logical transitions governed by density dependence and lipoxygenaseactivity in Aspergillus flavus. Appl Environ Microbiol 74:5674 –5685.https://doi.org/10.1128/AEM.00565-08.

37. Duran RM, Cary JW, Calvo AM. 2007. Production of cyclopiazonic acid,aflatrem, and aflatoxin by Aspergillus flavus is regulated by veA, a genenecessary for sclerotial formation. Appl Microbiol Biotechnol 73:1158 –1168. https://doi.org/10.1007/s00253-006-0581-5.

38. Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombinationin the aflatoxin-producing fungus Aspergillus flavus. Proc Natl AcadSci U S A 95:388 –393. https://doi.org/10.1073/pnas.95.1.388.

39. Ramirez-Prado JH, Moore GG, Horn BW, Carbone I. 2008. Characteriza-tion and population analysis of the mating-type genes in Aspergillusflavus and Aspergillus parasiticus. Fungal Genet Biol 45:1292–1299.https://doi.org/10.1016/j.fgb.2008.06.007.

40. Horn BW, Sorensen RB, Lamb MC, Sobolev VS, Olarte RA, WorthingtonCJ, Carbone I. 2014. Sexual reproduction in Aspergillus flavus sclerotianaturally produced in corn. Phytopathology 104:75– 85. https://doi.org/10.1094/PHYTO-05-13-0129-R.

41. Georgianna DR, Fedorova ND, Burroughs JL, Dolezal AL, Bok JW,Horowitz-Brown S, Woloshuk CP, Yu J, Keller NP, Payne GA. 2010.Beyond aflatoxin: four distinct expression patterns and functionalroles associated with Aspergillus flavus secondary metabolism geneclusters. Mol Plant Pathol 11:213–226. https://doi.org/10.1111/j.1364-3703.2009.00594.x.

42. Gibbons JG, Rokas A. 2013. The function and evolution of the Aspergillusgenome. Trends Microbiol 21:14 –22. https://doi.org/10.1016/j.tim.2012.09.005.

43. Keller NP, Hohn TM. 1997. Metabolic pathway gene clusters in filamen-tous fungi. Fungal Genet Biol 21:17–29. https://doi.org/10.1006/fgbi.1997.0970. doi:

44. Yu J, Cleveland TE, Bierman WC, Bennett JW. 2005. Aspergillus flavusgenomics: gateway to human and animal health, food, safety, and cropresistance to diseases. Rev Iberoam Micol 22:194 –202. https://doi.org/10.1016/S1130-1406(05)70043-7.

45. Yu J, Keller N. 2005. Regulation of secondary metabolism in filamen-tous fungi. Annu Rev Phytopathol 43:437– 458. https://doi.org/10.1146/annurev.phyto.43.040204.140214.

46. Bustos DM. 2012. The role of protein disorder in the 14-3-3 interactionnetwork. Mol Biosyst 8:178 –184. https://doi.org/10.1039/C1MB05216K.

47. Kleppe R, Martinez A, Døskeland SO, Haavik J. 2011. The 14-3-3 proteinsin regulation of cellular metabolism. Semin Cell Dev Biol 22:713–719.https://doi.org/10.1016/j.semcdb.2011.08.008.

48. Milroy L, Brunsveld L, Ottmann C. 2013. Stabilization and inhibition ofprotein-protein interactions: the 14-3-3 case study. ACS Chem Biol8:27–35. https://doi.org/10.1021/cb300599t.

49. Yaffe MB. 2002. How do 14-3-3 proteins work? Gatekeeper phosphory-lation and the molecular anvil hypothesis. FEBS Lett 513:53–57. https://doi.org/10.1016/S0014-5793(01)03288-4.

50. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6:Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol30:2725–2729. https://doi.org/10.1093/molbev/mst197.

51. Hill TW, Kafer E. 2001. Improved protocols for Aspergillus minimalmedium: trace elements and minimal medium stock solution. FungalGenet Rep 48:8. https://doi.org/10.4148/1941-4765.1173.

52. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N,Osmani SA, Oakley BR. 2006. Fusion PCR and gene targeting in Asper-gillus nidulans. Nat Protoc 1:3111–3120. https://doi.org/10.1038/nprot.2006.405.

53. Cary JW, Ehrlich KC, Bland JM, Montalbano BG. 2006. The aflatoxinbiosynthesis cluster gene, aflX, encodes an oxidoreductase involvedin the conversion of versicolorin A to demethylsterigmatocystin. ApplEnviron Microbiol 72:1096 –1101. https://doi.org/10.1128/AEM.72.2.1096-1101.2006.

54. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(�Delta Delta C(T)) method.Methods 25:402– 408. https://doi.org/10.1006/meth.2001.1262.

55. Zhuang Z, Lohmar JM, Satterlee T, Cary JW, Calvo AM. 2016. The mastertranscription factor mtfA governs aflatoxin production, morphologicaldevelopment and pathogenicity in the fungus Aspergillus flavus. Toxins(Basel) 8(1):E29. https://doi.org/10.3390/toxins8010029.

Ibarra et al. Applied and Environmental Microbiology

March 2018 Volume 84 Issue 5 e02241-17 aem.asm.org 12

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from