The expression levels of the transcriptional regulators p300 and CtBP

modulate the correlations between SNAIL, ZEB1, E-cadherin and vitamin D

receptor in human colon carcinomas

Cristina Pe~na1, Jos�e Miguel Garc�ıa1, Vanesa Garc�ıa1, Javier Silva1, Gemma Dom�ınguez1, Rufo Rodr�ıguez2,Constanza Maximiano

1, Antonio Garc�ıa de Herreros

3, Alberto Mu~noz4 and F�elix Bonilla

1*

1Department of Medical Oncology, Hospital Universitario Puerta de Hierro, Madrid, Spain2Department of Pathology, Hospital Virgen de la Salud, Toledo, Spain3Unitat de Biolog�ıa Cellular i Molecular, Institut Municipal d’Investigaci�o Medica-Universitat Pompeu-Fabra, Barcelona, Spain4Instituto de Investigaciones Biom�edicas ‘‘Alberto Sols,’’ Consejo Superior de Investigaciones Cient�ıficas-Universidad

Aut�onoma de Madrid, Spain

ZEB1 and SNAIL repress CDH1 and induce epithelial–mesenchy-mal transition (EMT). However, SNAIL and ZEB1 also activateor regulate other target genes in different ways. For instance, vita-min D receptor (VDR), which activates CDH1 expression uponligand binding, is repressed by SNAIL but induced by ZEB1. Weexamined whether the biological activity of SNAIL and ZEB1 incolon cancer is regulated by interacting cofactors. The mRNAexpression levels of SNAIL and ZEB1, and of transcriptional regu-lators p300 and CtBP, were measured by RT-PCR in tumor andnormal tissue from 101 colon carcinoma patients. Overexpressionof SNAIL was associated with down-regulation of CDH1 and VDR(p 5 0.004 and p < 0.001). CDH1 correlated with VDR (r 5 0.49;p < 0.001). ZEB1 expression also correlated with VDR (r 5 0.23;p 5 0.019). However, when CtBP was strongly expressed, ZEB1was inversely correlated with CDH1 (r 5 20.39; p 5 0.053). Fur-thermore, when there were elevated p300 expression levels, thecorrelation between expression of ZEB1 and VDR was stronger(r 5 0.38; p 5 0.070). Association between SNAIL expression anddown-regulation of CDH1 and VDR was lost in tumors in whichp300 and CtBP were strongly expressed. These results indicate thatthe levels of expression of CtBP and p300 are critical for the actionof SNAIL and ZEB1, which have a pivotal role in EMT, and showthe importance of CtBP and p300 for tumor progression.' 2006 Wiley-Liss, Inc.

Key words: human colorectal cancer; gene expression; p300; CtBP;epithelial-mesenchymal transition genes

A large number of biological processes involve regulation ofgene expression by transcriptional repression.1 ZEB1 and ZEB2are transcriptional repressors that contain zinc-fingers motifs intheir DNA binding domain, and both recognize the same E-boxesin their target genes.2,3 Despite the high homology and the identi-cal overall gene structure of ZEB1 and ZEB2, there are differen-ces in their pattern of expression, the organization of their re-pressor domains and their specificity.3 ZEB1 and ZEB2 repress alarge number of regulators involved in differentiation and devel-opmental events.2,4–12 One such regulator, E-cadherin (encode byCDH1 gene), is located in adherent junctions and contributes tothe maintenance of the adhesive and polarized phenotype of epi-thelial cells.13 When E-cadherin is down-regulated, the epithelialcells acquire a fibroblastoid morphotype accompanied by invasionand migratory properties, which are associated with the epithelial–mesenchymal transition (EMT).14–16 This transition also occursafter expression of SNAIL, another transcriptional repressor withzinc-finger motifs that represses transcription of CDH1 even moreefficiently than ZEB1 or ZEB2.17,18 Moreover, ZEB1 expressionis induced by SNAIL and persists after SNAIL is down-regulatedin tumor cell lines.18

Vitamin D (1a,25-dehydroxyvitamin D3) induces the expres-sion of CDH1 in cells expressing vitamin D receptors (VDRs).19

We have recently shown that SNAIL also represses VDR expres-sion in tumor cell lines and that its induction in human colorectalcarcinomas is associated with CDH1 and VDR down-regula-

tion.20,21 However, overexpression of ZEB1 was not correlatedwith down-regulation of CDH1 in colorectal tumor tissues,although a trend toward statistical association between ZEB1expression and CDH1 down-regulation was observed in patientswithout SNAIL expression.21 In addition, transfection of ZEB1 intoSW620 colon carcinoma cells up-regulates the expression of en-dogenous VDR.22

The NAD1-dependent corepressor CtBP is involved in the con-trol of E-cadherin transcription in several cell lines. Inactivationof this factor in cell lines either by expression of the viral proteinE1A, which interacts directly with it,9 or by RNA interference23

up-regulates CDH1 transcription. Moreover, analysis of CtBP-knockout versus CtBP-rescued mouse embryo fibroblasts revealedthat CDH1 is regulated by this cofactor.24 CtBP interacts withZEB1 and 2 through a PXDLS motif present in these mole-cules.25,26 Although this sequence is also present in the Drosoph-ila ortholog of SNAIL, where CtBP is involved in the repressionof this factor in this organism,27,28 mammalian SNAIL lacks thismotif, which questions the involvement of CtBP in SNAIL inhuman cells. Recently, the identification of a functional associa-tion of mouse Snail and HDAC1/2 and the corepressors mSin3Athat interact to repress E-cadherin expression through the SNAGmotif of Snail has been described.29

Although SNAIL and ZEB proteins have been classicallydescribed as transcriptional repressors, they can also promote theactivation of such mesenchymal markers as fibronectin and LEF1,in the case of SNAIL, or ovalbumin and VDR gene in the case ofZEB1.18,22,30 Moreover, ZEB1 and ZEB2 also have antagonisticfunctions in the regulation of TGFb/BMP signaling.31 Such regu-lation of the TGFb/BMP signaling is achieved through differentialrecruitment of coactivators and corepressors by ZEB1 or ZEB2.32

Repression by ZEB1 and ZEB2 requires CtBP.25,26 ZEB1 also hasan N-terminal region that binds the coactivators p300 and P/CAF,32 acetyltransferases that loosen chromatin structure.33–35

Furthermore, binding of P/CAF to ZEB1 acetylates several lysineresidues close to the CtBP interaction domain of ZEB1, displacesCtBP and switches ZEB1 from a repressor to an activator.32 Incontrast, ZEB2 does not interact with p300 or P/CAF and thusonly serves as a transcriptional repressor.32 In parallel, it has beensuggested that activation of ovalbumin and VDR genes by ZEB1depends on the recruitment of p300 and P/CAF by ZEB1.32

Cofactors p300 or CtBP vary in their regulation of specific celllines.36,37 Thus, we hypothesize that variations in the concentra-

Grant sponsor: Fundaci�on Cient�ıfica de la Asociaci�on Espa~nola contra elC�ancer; Grant sponsor: SAF; Grant number: SAF2004-01002; Grant spon-sor: Fundaci�on Santander Central Hispano.*Correspondence to: Department of Medical Oncology, Hospital Uni-

versitario Puerta de Hierro, C/ San Mart�ın de Porres, 4, E-28035-Madrid,Spain. E-mail: felixbv@stnet.esReceived 26 January 2005; Accepted 28 March 2006DOI 10.1002/ijc.22083Published online 27 June 2006 in Wiley InterScience (www.interscience.

wiley.com).

Int. J. Cancer: 119, 2098–2104 (2006)' 2006 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

tions of these cofactors could modulate the activity of ZEB1, andperhaps that of SNAIL, in the regulation of CDH1 and VDR. Weexamined this hypothesis in a large series of human colorectal car-cinomas.

Methods

Patients, tumor samples and RNA extraction

The present study, approved by the Research Ethics Board ofour hospital, (Hospital Universitario Puerta de Hierro), was basedon a consecutive series of 101 patients undergoing surgery for colo-rectal cancer between January 1998 and 2003. All the patientswere considered sporadic cases because no clinical antecedents ofFAP were reported, and those with clinical criteria of hereditarynon-polyposis colorectal cancer (Amsterdam criteria) wereexcluded. Both normal and tumor tissue samples were obtainedsequentially immediately after surgery, immersed in RNA laterTM

(Ambion, Austin, TX), snap-frozen in liquid nitrogen and stored at280�C until processing.

All tumors were histologically examined by a pathologist to (i)confirm the diagnosis of adenocarcinoma, (ii) verify the presenceof tumor and select those samples with more than 75% neoplasticcells and (iii) establish the pathological stage.

For 101 patients, RNAs were extracted from tumor and normalsamples. RNA was obtained using RNeasy Mini Kit (Quiagen,Hilden, Germany) and quantified spectrophotometrically.

Real time PCR

Since SNAIL RNA was not detected in normal tissues, SNAILexpression was valued only as presence or absence in tumor tis-sues. To specifically detect SNAIL gene, we used oligonucleotidesthat do not amplify the SNAIL retrogene. This retrogene, SNAIL-like, is highly homologous to SNAIL, but considerably less activethan SNAIL in the repression of CDH1.38 Specific SNAIL primerswere designed from a region with 16 bp differences betweenSNAIL and SNAIL-like. We can thus distinguish between the 2genes when the amplification is carried out, and false results at-tributable to SNAIL-like can be discarded. The primers are shownin Table I.

CDH1, VDR, ZEB1, p300 and CtBP mRNA levels were calcu-lated in the normal and tumor counterpart samples was calculatedby a relative quantification approach in which the amount of thetarget was expressed in relation to the geometric average of 3 ref-erence housekeeping genes: TATA binding protein (TBP), succi-nate dehydrogenase complex subunit A (SDHA) and ubiquitin C(UBC), as it has been previously described.20 The relative concen-trations of target and reference genes were calculated by inter-

polation using a standard curve for each gene generated with aserial dilution of a cDNA prepared from RNA extracted fromSW480ADH cells. The expression level of a target gene in apatient was calculated as the ratio: target in tumor tissue/target innormal tissue (T/N). The quantitative mRNA analysis was con-firmed by a duplicate analysis. The primers used are shown inTable I. For the synthesis of the first strand of cDNA, 400 ng oftotal RNA was retro-transcribed using the Gold RNA PCR CoreKit (PE Biosystems), following the manufacturer’s instructions.Random hexamers were used for cDNA synthesis.

Real-time PCR was performed in a Light-Cycler apparatus(Roche Diagnostics, Mannheim, Germany) using the LightCycler-FastStart DNA Master SYBR Green I Kit (Roche Diagnostics,Mannheim, Germany). Each reaction was performed in a final vol-ume of 20 ll containing 2 ll of the cDNA product sample, a dif-ferent MgCl2 concentration for each primer (Table I), 0.5 lM ofeach primer as well as 13 reaction mix including FastStar DNApolymerase, reaction buffer, dNTPs and SYBR green. Thermal cy-cling for all genes was initiated with a denaturation step of 95�Cfor 10 min followed by 40 cycles (denaturation at 94�C for 0 sec,annealing at different temperature for each gene (Table I) for5 sec, and elongation at 72�C for 5 sec, in which fluorescence wasacquired). At the end of the PCR cycles, melting curve analyses aswell as electrophoresis of the products on nondenaturing 8% poly-acrylamide gels, together with a molecular weight marker, fol-lowed by sequencing, were performed to confirm the generation ofthe specific PCR product expected.

Data analysis

The ratios (T/N) of gene expression were not normally distrib-uted (Kolmogorov-Smirnov test, Lilliefors correction). For thisreason, we normalized the data distribution by using log10 for sta-tistical analysis. We also used the geometric (rather than the arith-metic) average of the (T/N) to describe the expression gene data,for the same reason. The variables analyzed (T/N), when com-pared expression levels of CDH1, VDR, ZEB1, CtBP and p300 inpresence or absence of SNAIL expression in different tissue sam-ples, were contrasted by ANOVA test. The correlation betweengenes expression levels (without SNAIL) was studied using thePearson coefficient.

The data were divided into quartiles (25, 50 and 75%), depend-ing on the concentration of CtBP and p300, to examine the possi-ble changes in the correlation between CDH1, VDR, ZEB1 andSNAIL. Again, the correlations were studied using the Pearsoncoefficient or the ANOVA test. The expression levels (T/N) defin-ing the 4 groups for each gene were: CtBP, 0.60 (25%), 0.99

TABLE I – SEQUENCE OF THE PRIMERS AND CONDITIONS FOR THEAMPLIFICATION OF EACH GENE

Primers Sequence T.A(�C)

[Mg21](mM)

TBP F: TCTGGGATTGTACCGCAGC 59 3R: CGAAGTGCAATGGTCTTTAGG

SDHA F: TGGGAACAAGAGGGCATCTG 59 3R: CCACCACTGCATCAAATTCATG

UBC F: ATTTGGGTCGCGGTTCTTG 59 3R: TGCCTTGACATTCTCGATGGT

SNAIL F: CACTATGCCGCGCTCTTTC 68 3R: GGTCGTAGGGCTGCTGGAA

CDH1 F: AGAACGCATTGCCACATACACTC 60 4R: CATTCTGATCGGTTACCGTGATC

VDR F: TTGCCATACTGCTGGACGC 60 2R: GGCTCCCTCCACCATCATT

ZEB1 F: GCCAATAAGCAAACGATTCTG 55 3R: TTTGGCTGGATCACTTTCAAG

CtBP F: ACTGTGGCCTTCTGCGACG 59 3R: GGTGTGGTACATCAGGGCCC

p300 F: GGCTGTATCAGAGCGTATTGTC 59 3R: CCTCGAAATAAGGCAATTCC

TABLE II – MEDIAN, MINIMUM AND MAXIMUM VALUES OF CDH1, VDR,ZEB1, p300 AND CtBP EXPRESSION DATA

CDH1 VDR ZEB1 p300 CtBP

Median 0.92 2.17 2.34 0.69 1.01Minimum 0.03 0.13 0.02 0.03 0.07Maximum 209.97 66.20 417.19 8.4 157.74

TABLE III – GEOMETRIC AVERAGE OF THE RATIOS (T/N) OF CDH1, VDRAND ZEB1 EXPRESSION REGARDING SNAIL PRESENCE IN TUMOR TISSUEAND PEARSON CORRELATION COEFFICIENT (r) OF THE CORRELATION

BETWEEN THE EXPRESSION LEVELS OF CDH1, VDR AND ZEB1

CDH1 VDR ZEB1

Geometric average of the ratios (T/N)SNAIL

Yes 0.83 0.31 0.47No 1.93 0.91 0.43p 0.004 <0.001 0.832

Pearson correlation coefficientCDH1 _ r 5 0.49; p < 0.001 r 520.10; p5 0.32VDR – – r 5 0.23; p5 0.019

2099CORRELATIONS BETWEEN EMT GENES REGARDING p300 AND CtBP

(50%) and 1.33 (75%); p300, 0.8 (25%), 1.45 (50%) and 2.33(75%).

In all statistical tests two-tailed p values �0.05 were consideredstatistically significant.

Statistical analysis was performed using package SPSS version11.0.

Results

Gene expression data

The expression levels of CDH1, VDR, SNAIL, p300 and CtBPmRNA in a series of 101 colorectal tumors and their normal mu-cosa counterparts were measured by real time (RT)-PCR asdescribed in Material and Methods. The medians, the minimumand the maximum values of gene expression are listed in Table II.SNAIL mRNA expression was detected in 62 of the 101 patients(61.4%).

In a previous study, to validate these mRNA results and exam-ine whether E-cadherin protein expression in tumors cells was ho-mogeneous, we performed immunohistochemical analyses.21 Weconcluded that no significant changes in E-cadherin expression indifferent tumor regions were detected and that, there was a strictcorrelation between the CDH1 RNA and protein expressionresults.21 Moreover, we also determined that deregulation of SNAILand ZEB1 expression in tumor sample is due to a deregulation of thesegenes in the carcinoma cells and not in the mesenchymal cells.21

Correlations between ZEB1, SNAIL, CDH1 and VDRgenes in colon tumors

As described in previous studies,19,21 the analysis of 101 pa-tients showed an association between SNAIL expression and

down-regulation of CDH1 and VDR genes (p 5 0.004 and p <0.001, respectively, ANOVA test) (Table III). Likewise, theexpression levels of VDR and CDH1 were directly correlated, butlevels of ZEB1 only correlated with VDR (Table III).

Effect of CtBP and p300 on the correlation betweenZEB1 and VDR expression

We examined the effect of CtBP and p300 expression levels onthe correlation between ZEB1 and VDR. Tumors were divided into4 groups on the basis of CtBP and p300 expression as described inMaterial and Methods: CtBP-0 (T/N values lower than 0.60),CtBP-1 (from 0.60 to 0.99 T/N values), CtBP-2 (from 0.99 to 1.33T/N values) and CtBP-3 (T/N values higher than 1.33); p300-0(T/N values lower than 0.8), p300-1 (from 0.8 to 1.45 T/N values),p300-2 (from 1.45 to 2.33 T/N values) and p300-3 (T/N valueshigher than 2.33). The correlation between ZEB1 and VDR wasnot affected by the expression of CtBP (Fig. 1a). However, whenVDR and ZEB1 were studied with regard to p300, we observed anincrease of the Pearson correlation coefficient between expressionlevels of ZEB1 and VDR associated to p300 increase: 20.16 (p 50.938) for p300-0 group and 0.38 (p 5 0.070) for p300-3 group(Fig. 1b).

FIGURE 1 – Effect of CtBP (a) or p300 (b) expression on the correlation between VDR and ZEB1 in tumor tissues. r 5 Pearson correlationcoefficient.

FIGURE 2 – Effect of CtBP (a) or p300 (b) expression on the corre-lation between E-cadherin and ZEB1 in tumor tissues. r 5 Pearsoncorrelation coefficient.

FIGURE 3 – Association between SNAIL and CDH1 expressionregarding CtBP (a) and p300 (b) expression. The graphs show the quar-tiles 25, 50 and 75, values lower than 1.5 box lengths and the outliers(O) of CDH1 expression. p values was calculated by ANOVA test.

2100 PE~NA ET AL.

FIGURE 2.

FIGURE 3.

Effect of CtBP and p300 on the inverse correlationbetween ZEB1 and CDH1 expression

Tumors with high CtBP expression present a better correlationbetween CDH1 and ZEB1 than the tumors with low CtBP expres-sion. In this case, we observed an increase of the Pearson correla-tion coefficient between ZEB1 and CDH1, but with negative signdue to the inverse correlation, related to CtBP increase. The Pear-son correlation coefficient between ZEB1 and CDH1 was 20.19in the CtBP-0 group (p 5 0.365) and 20.391 in the CtBP-3 group(p5 0.053) (Fig. 2a).

In contrast, p300 expression did not affect the correlationbetween ZEB1 and CDH1 (Fig. 2b).

Effect of CtBP and p300 on the association between SNAILexpression and CDH1 or VDR down-regulation

With the exception of the CtBP-3 group, the associationbetween SNAIL expression in the tumor and down-regulation ofCDH1 and VDR was lost in tumor with high expression of CtBPor p300 (Figs. 3 and 4).

Discussion

In this study, we show that levels of coregulators CtBP or p300affect the correlation between the expression of ZEB1, SNAIL,CDH1 and VDR genes in human colon tumors. The direct correla-tion between ZEB1 and VDR was stronger when the levels of thecoactivator p300 were higher. Expression of ZEB1 correlatedinversely with CDH1 only when the corepressor CtBP levels were

high. Both correlations were near to statistical significance. How-ever, the correlations between SNAIL and the down-regulation ofCDH1 and VDR genes were lost when the levels of both cofactorsincrease.

It has been suggested that the mechanism by which ZEB1 acti-vates VDR22 and ovalbumin30 involves recruitment of such coacti-vators as p300 or P/CAF and displacement of CtBP.32 Our results-showing a higher correlation between ZEB1 and VDR in tumorswith p300 expression support this hypothesis (Pearson correlationcoefficient in the p300-3 group was 0.38, regard to 0.23 in thecomplete series). Despite the statistical significance in the com-plete series between ZEB1 and VDR, the Pearson correlation coef-ficient is low (0.23), suggesting that it could be a random event.

The down-regulation of CDH1 by ZEB1 reported elsewhere9,18

was not found in our study in the whole series. We previouslyreported the loss of the association between overexpression ofSNAIL and down-regulation of CDH1 at high levels of ZEB.21 Fur-thermore, a trend toward statistical significance was observed inthe association between ZEB1 up-regulation and CDH1 down-reg-ulation in patients without SNAIL expression.21 It has beenreported that SNAIL and ZEB1 recognize the same E-boxes inCDH1 and other target genes.2 Therefore, we proposed a model inwhich Either SNAIL or ZEB1 could alternatively bind to CDH1E-boxes and repress the expression of this gene. We also sug-gested that variations in the levels of cofactors could modulateZEB1 activity.21 The results shown here support this modelbecause overexpression of ZEB1 and down-regulation of CDH1correlated in tumors with high CtBP expression.

FIGURE 4 – Association between SNAIL and VDR expression regarding CtBP (a) and p300 (b) expression. The graphs show the quartiles 25,50 and 75, values lower than 1.5 box lengths, the outliers (O) and the extremes (*) of VDR expression. p values was calculated by ANOVA test.

2102 PE~NA ET AL.

It has recently been proposed that p300 could play a role in pro-moting CDH1 expression in epithelial breast cells.39 Our data incolon cancer tumors did not reveal any association with p300expression levels and the correlation between ZEB1 and CDH1,since independently of p300 expression levels no correlationbetween ZEB1 and CDH1 was observed. Perhaps the p300-medi-ated activation of CDH1 expression described by Liu et al. was in-dependent of ZEB1 expression.

Our results also indicate that CtBP is not involved in the repres-sion of CDH1 by SNAIL, which is consistent with the lack ofbinding sites for CtBP on the mammalian forms of this factor.Therefore, the mechanism of action of SNAIL may have changedduring evolution, and the function of CtBP-repression may now beperformed by ZEB1 and 2.

Other authors have reported that variations in cofactors levelsaffect the development of cancer. For example, altered expression

of AIB1, a member of the SRC-1 family of nuclear receptors, maycontribute to the development of steroid-dependent cancers.40

Again, the coactivator ARA70, an androgen receptor, enhancestranscription of androgen-responsive genes in prostate cancer.41,42

However, this is the first study to show that cofactor levels couldaffect the progression of colorectal cancer.

Together, our results show that CtBP and p300 levels are impor-tant factors in the control of the expression of genes crucial for theEMT, and therefore, for tumor progression, at least in human co-lon cancer. More studies should be performed in large series andin other types of cancer to verify this hypothesis.

Acknowledgements

We thank R. Rycroft for help with the English manuscript andM.E. G�omez for selection of tumor samples.

References

1. Ogbourne S, Antalis TM. Transcriptional control and the role ofsilencers in transcriptional regulation in eukaryotes. Biochem J 1998;331:1–14.

2. Postigo AA, Ward E, Skeath J, Dean DC. zfh-1, the Drosophilahomologe of ZEB, is a transcriptional repressor that regulates somaticmyogenesis. Mol Cell Biol 1999;19:7255–63.

3. Postigo AA, Dean DC. Differential expression and function of mem-bers of the zfh-1 family of zinc finger/homeodomain repressors. ProcNatl Acad Sci USA 2000;97:6391–6.

4. Genetta T, Ruezinsky D, Kadesch T. Displacement of an E-box-bind-ing repressor by basic helix-loop-helix proteins: implications for B-cell specificity of the inmonoglobulin heavy-chain enhancer. Mol CellBiol 1994;14:6153–63.

5. Postigo AA, Dean DC. ZEB, a vertebrate homolog of Drosophila Zfh-1, is a negative regulator of muscle differentiation. EMBO J 1997;16:3935–43.

6. Postigo AA, Sheppard AM, Mucenski ML, Dean DC. c-Myb and Etsfactors synergize to overcome transcriptional repression by ZEB.EMBO J 1997;16:3924–34.

7. Sekido R, Murai K, Funahashi J, Kamachi Y, Fujisawa-Sehara A,Nabeshima Y, Kondoh H. c-Myb and Ets factors synergize to over-come transcriptional repression by ZEB. Mol Cell Biol 1994;14:5692–700.

8. Takagi T, Moribe H, Kondoh H, Higashi Y. dEF1, a zinc finger andhomeodomain transcription factor, is required for skeleton patterningin multiple lineages. Development 1998;125:21–31.

9. Grooteclaes ML, Frisch SM. Evidence for a function of CtBPin epithelial gene regulation and anoikis. Oncogene 2000;19:3823–8.

10. Murray D, Precht P, Balakir R, Horton WE, Jr. The transcription fac-tor dEF1 is inversely expressed with type II collagen mRNA and canrepress Col2a1 promoter activity in transfected chondrocytes. J BiolChem 2000;275:3610–18.

11. Comijin J, Berx G, Vermasen P, Verschueren K, van Grunsven L,Bruyneel E, Mareel M, Huylebroeck D, van Roy FE. The two-handedE-box binding zinc finger protein SIP1 downregulates E-cadherin andinduces invasion. Mol Cell 2001;7:1267–78.

12. Fontemaggi G, Gurtner A, Strano S, Higashi Y, Sacchi A, Piaggio G,Blandino G. The transcriptional repressor ZEB regulates p73 expres-sion at the crossroad between proliferation and differentiation. MolCell Biol 2001;21:8461–70.

13. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestratingcellular signals at adherens junctions. Cell 2003;112:535–48.

14. De Wever O, Mareel M. Role of tissue stroma in cancer cell invasion.J Pathol 2003;200:429–47.

15. Takeichi M. Morphogenetic roles of classic cadherins. Curr Opin CellBiol 1995;7:619–27.

16. Huber O, Bierkamp C, Kemler R. Cadherins and catenins in develop-ment. Curr Opin Cell Biol 1996;8:685–91.

17. Batlle E, Sancho E, Franc�ı C, Dom�ınguez D, Monfar M, Baulida J,Garc�ıa de Herreros A. The transcription factor Snail is a repressor ofE-cadherin gene expression in epithelial tumor cells. Nat Cell Biol2000;2:84–9.

18. Guaita S, Puig I, Franc�ı C, Garrido M, Dom�ınguez D, Batlle E,Sancho E, Dedhart S, Garc�ıa de Herreros A, Baulida J. Snail inductionof epithelial to mesenchymal transition in tumor cells is accompaniedby MUC1 repression and ZEB1 expression. J Biol Chem 2002;277:39209–16.

19. Palmer HG, Gonz�alez-Sancho JM, Espada J, Berciano MT, Puig I,Baulida J, Quintanilla M, Cano A, Garc�ıa de Herreros A, Lafarga M,Mu~noz A. Vitamin D3 promotes the differentiation of colon carci-noma cells by the induction of E-cadherin and the inhibition of b-cat-enin signaling. J Cell Biol 2001;154:1–22.

20. Palmer HG, Larriba MJ, Garc�ıa JM, Ordo~nez-Moran P, Pe~na C, Peir�o S,Puig I, Rodr�ıguez R, de la Fuente R, Bernad A, Poll�an M, Bonilla F,et al. The transcription factor SNAIL represses vitamin D receptor ex-pression and responsiveness in human colon cancer. Nat Med 2004;10:917–19.

21. Pe~na C, Garc�ıa JM, Silva J, Garc�ıa V, Rodr�ıguez R, Alonso I, Mill�anI, Garc�ıa de Herreros A, Mu~noz A, Bonilla F. E-cadherin and vitaminD receptor regulation by SNAIL and ZEB1 in colon cancer: clinicopa-thological correlations. Hum Mol Genet 2005;14:3361–70.

22. Lazarova DL, Bordonaro M, Sartorelli AC. Transcriptional regulationof the vitamin D3 receptor gene by ZEB. Cell Growth Differ 2001;12:319–26.

23. Shi Y, Sawada JI, Sui G, Affar EB, Whetstine JR, Lan F, Ogawa H,Luke MPS, Nakatani Y, Shi Y. Coordinated histone modificationsmediated by a CtBP co-repressor complex. Nature 2003;422:735–8.

24. Grooteclaes ML, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH,Frisch SM. C-terminal-binding protein corepresses epithelial andproapoptotic gene expression programs. Proc Natl Acad Sci USA2003;8:4568–73.

25. Postigo AA, Dean DC. ZEB represses transcription through interac-tion with the corepressors CtBP. Proc Natl Acad Sci USA 1999;96:6683–8.

26. Van Grunsven LA, Michiels C, van de Putte T, Nelles L, Wuytens G,Verschueren K, Huylebroeck D. Interaction between Smad-interactingprotein-1 and the corepressors C-terminal binding protein is dispensa-ble for transcriptional repression of E-cadherin. J Biol Chem 2003;278:26135–45.

27. Nibu Y, Zhang H, Bajor E, Barolo S, Small S, Levine M. dCtBPmediates transcriptional repression by Knirps, Kruppel and Snail inthe Drosophila embryo. EMBO J 1998;17:7009–20.

28. Nibu Y, Zhang H, Levine M. Interaction of short-range repressorswith Drosophila CtBP in the embryo. Science 1998;280:101–4.

29. Peinado H, Ballestar E, Esteller M, Cano A. Snail mediates E-cadherin repression by the recruitmentof the Sin3A/histone deace-tylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 2004;24:306–19.

30. Chamberlain EM, Sanders MM. Identification of the novel playerdEF1 in strogen transcriptional cascades. Mol Cell Biol 1999;9:213–24.

31. Postigo AA. Opposing functions of ZEB proteins in the regula-tion of the TGFb/BMP signalling pathway. EMBO J 2003;22:2443–52.

32. Postigo AA, Depp JL, Taylor JJ, Kroll KL. Regulation of Smad sig-nalling through a differential recruitment of coactivators and corepres-sors by ZEB proteins. EMBO J 2003;22:2453–62.

33. Bannister AJ, Kouzarides T. The CBP co-activator is a histone acetyl-transferase. Nature 1996;384:641–3.

34. Ogryzko VV, Shiltz RL, Russanova V, Howard BH, Nakatani Y. Thetranscriptional coactivators p300 and CBP are histone acetyltransfer-ases. Cell 1996;87:953–9.

35. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y. Ap300/CBP-associated factor that competes with the adenoviral onco-protein E1A. Nature 1996;382:319–24.

2103CORRELATIONS BETWEEN EMT GENES REGARDING p300 AND CtBP

36. Vienonen A, Miettinen S, Manninen T, Altucci L, Wilhelm E,Ylikomi T. Regulation of nuclear receptor and cofactor expression inbreast cancer cell lines. Eur J Endocrinol 2003;148:469–79.

37. Poser I, Bosserhoff AK. Transcription factors involved in development andprogression of malignant melanoma. Histol Histopathol 2004;19:173–88.

38. Locascio A, Vegas S, de Frutos CA, Manzanares M, Nieto MA. Bio-logical potencial of a functional human SNAIL retrogene. J Biol Chem2002;277:38803–9.

39. Liu Y-N, Lee W-W, Wang C-Y, Chao T-H, Chen Y, Chen JH. Regu-latory mechanisms controlling human E-cadherin gene expression.Oncogene 2005;24:8277–90.

40. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, GuanXY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS. AIB1, a steroidreceptor coactivator amplified in breast and ovarian cancer. Science1997;277:965–8.

41. Yeh S, Chang C. Cloning and characterization of a specific coactiva-tor, ARA70, for the androgen receptor in human prostate cells. ProcNatl Acad Sci USA 1996;3:5517–21.

42. Miyamoto H, Yeh S, Wilding G, Chang C. Promotion of agonist ac-tivity of antiandrogens by the androgen receptor coactivator, ARA70,in human prostate cancer DU145 cells. Proc Natl Acad Sci USA1998;95:7379–84.

2104 PE~NA ET AL.