Mémoire de Maîtrise en médecine No 3403

The expression of heart enriched

transposable elements

associated lncRNAs

Etudiant Ludovic Dey

Tuteur Prof. Thierry Pedrazzini Dpt de Médecine, CHUV

Co-tuteur Mr Samir Ounzain, Ph.D. Dpt de Médecine, CHUV

Expert Prof. Roger Hullin

Dpt de Médecine, CHUV

Lausanne, 31.01.2017

Table of contents

Abstract .................................................................................................................................................. 1

Introduction ........................................................................................................................................... 2

Cardiovascular disease and myocardial infarction .............................................................................2

Post-infarction pathological remodelling ...........................................................................................2

Long noncoding RNAs and their roles in cardiovascular disease. ......................................................3

Method .................................................................................................................................................. 6

Candidate identification .....................................................................................................................6

LAD Model ..........................................................................................................................................6

Echocardiography ...............................................................................................................................6

Tissue preparation ..............................................................................................................................7

RNA Isolation ......................................................................................................................................7

Reverse Transcription/cDNA synthesis ...............................................................................................7

Quantitative RT-PCR ...........................................................................................................................7

Results & data analysis ........................................................................................................................... 9

Characteristics of the Myocardial infarction model ...........................................................................9

Heart expression of the candidates ....................................................................................................9

Modulation of candidates after infarct ..............................................................................................9

Discussion & Conclusion ....................................................................................................................... 18

Validation of the model ....................................................................................................................18

TE associated lncRNA expression post infarction .............................................................................18

Strength and weakness of the study ................................................................................................19

Perspectives .....................................................................................................................................19

Acknowledgement ............................................................................................................................... 20

Bibliography ......................................................................................................................................... 20

1

Abstract In Switzerland and other developed countries, heart diseases are the major cause of morbidity and

mortality. The vast majority of our genome (98%) is non protein-coding but is pervasively transcribed

in to non-coding RNAs including small (<200 nucleotides) and long (>200 nucleotides), the second

class of which are described in this study. We suspect that these long non coding RNAs play a major

role in gene regulation and are potentially important modulators of heart disease. They could be

used as specific and sensitive biomarkers of pathological states. To test this hypothesis, we analyzed

and compared the expression of a set of transposable elements associated lncRNAs in a mouse

model of myocardial infarction. We noticed a variation in the expression of these lncRNAs between

control mice and infarcted mice but at different temporal points post infarction and in different

regions of the infracted mouse heart. With all these findings, we reveal a novel class of TE associated

heart specific lncRNAs, which could be used as new biomarkers in myocardial infarction.

2

Introduction

Cardiovascular disease and myocardial infarction In Switzerland the most common cause of death are the cardiovascular diseases1 and more than the

half of these deaths being caused by myocardial infarction (MI). Myocardial infarction and the

subsequent pathological remodeling that occurs therefore require the immediate innovation of novel

therapeutic strategies and approaches. (Figure 1.1)

Myocardial infarction (MI) is caused by a reduced blood flow and oxygenation to the heart. The most

common cause in developed countries is induced by the formation of an atherosclerotic plaque in

the coronary arteries (coronary artery disease, CAD).

Atherosclerosis develops in response to a chronic injury of the endothelium of the blood vessels.

Hyperlipidemia, hypertension, diabetes, smoking and other toxins can damage the endothelium

leading to dysfunction. At the same time lipids, mostly cholesterol and cholesterol esters are trapped

in the intimae from the blood circulation. Thus, these two mechanism leads to a secretion of IL-1

witch induces an inflammation and leads to macrophage activation. The macrophages engulf the

lipids accumulated in the media. Macrophage activation is key for the initialization, and the

maintenance of the disease. During this inflammatory phase, the macrophages recruit smooth

muscle cells and promote extracellular matrix synthesis. This stabilizes the plaque generating a

fibrous cap. 2 (Figure 1.2)

An unstable plaque will break and recruit platelets and will thrombose or release cholesterol crystals

into the circulation which embolise in the smaller vessels in heart. These two mechanisms are the

most frequent and will lead to various coronary diseases (stable angina, unstable angina or MI).

My project is linked to acute myocardial infarction (MI), which is classically clinically presented with a

chest pain, because the infarct leads to a death of the myocardial cells resulting in a pathological

remodeling process. Pathological remodeling leads to reduced pump function and ultimately heart

failure. In the acute phase, we see that the reduced oxygen flow leads to a loss of high energy

phosphates and the production of lactic acid. The heart is extremely sensitive to energy deprivation

and that can lead in 60 seconds to a loss of contractility and to an acute heart failure.2 20 to 40

seconds post infarction, the cells undergo acute cell death and undergo necrosis over the following

4-6 hours.

Post-infarction pathological remodeling The most accurate predictor of the heart pump function post MI is remodeling. Classically, post

remodeling the heart exhibits both systolic and diastolic dysfunction.

Cardiac remodeling occurs post exposure to a myocardial stress, which can be physiological (for

example sport or pregnancy) or pathological after an injury such as an infarct, the pathological model

assessed in this study. This pathological remodeling leads to a disorganization of the muscle instead

of the physiological remodeling. This disorganization is associated with glycolysis, sarcomere

3

disorganization, alterations in calcium handling, contractility changes, necrosis and fibrosis and

ultimately myocardial dysfunction.

During physiological remodeling, the hypertrophy is associated with concentric hypertrophy. That

means an increased wall thickness but only little changes in the chamber volume systolic or diastolic.

Physiological hypertrophy is associated with increasing the number of cardiomyocytes, without

pathological fibrosis.

On the contrary, the pathological model is in response to neurohumoral activation, an increased

overload or other pathological stressors. This can lead to a quick and dramatic remodeling; it can

have a mass increase of 35% in hours post over-afterload. The persisting stress activates a chemical

pathway through neurohumoral pathways which provoke the release of an amount of cytokine then

the sarcomere activation and a mechanical pathway through the mechanical stress that activates

stretch-sensitive channel to activate the cytoskeleton and Ca2+ protein. The activation of the

sarcomere, the cytoskeleton and the Ca2+ proteins communicates to the nucleus to induce

hypertrophic gene expression programs. (Figure 1.3)

The mechanical stress induces the release of growth factors which include insulin-like growth factor

I, angiotensin II, and endothelin-1. Mechanical stretch is capable of activating angiotensin II receptors

in cardiomyocytes directly, without angiotensin II. Today, the most known factor implicated in

cardiac remodeling is angiotensin. Therapeutic treatments for the chronic phase post infarction

include a conversion enzyme blocker (AT1 antagonist) that inhibits AT1 signaling and pathological

remodeling. 3, 4.

The next phase during pathological remodeling is myocardial dilatation. Dilatation occurs when the

stress persists chronically, but it necessary not to forget that dilatation can also occur acutely and

lead to rapid death. This condition will not be described in our work. Chronic dilatation occurs when

there is a misbalance of calcium homeostasis. The dilatation is associated with apoptosis and fibrosis

of the myocardial tissue. In the pathophysiology we see a systolic dysfunction, the heart doesn’t

pump as well as needed and a reduces ejection fraction (EF%) and a systemic reduced blood flow

ultimately resulting in end stage heart failure.4

Long noncoding RNAs and their roles in cardiovascular disease. DNA sequences that encode protein coding genes (mRNA) represent only <2% of the RNA

transcribed in the cell. The other 98% was previously assumed to be non-functional and mistakenly

referred to as junk DNA5. Recently this assertion has been cast in doubt with the discovery of the

long non coding RNAs (lncRNAs) which are defined as a >200 nucleotides in length with no protein

coding potential.

LncRNAs are classified in categories depending on their genomic location. The intergenic lncRNAs are

not linked with genes (1). The other categories are linked with genes. The sense lncRNA (2) overlaps

a gene on the same strand, the antisense lncRNA (6) overlaps a gene on the opposite strand, the

divergent lncRNA (2) are on the antisense strand divergently transcribed from promoter proximal to

parent protein coding gene, the intronic (4) and exonic (5) are respectively in an intron or an exon of

a gene.(figure 1.4)6, 7

4

The potential of the lncRNA and the other non-coding RNA has emerged in recent years. Numerous

studies now consider them as potential new biomarkers for the heart function because of their

stability and the specificity in tissue and stress dependent expression. 10, 11

For most lncRNAs we do not understand their exact function, but they encode important functional

roles in many organs. The lncRNAs that interest us are cardiac specific lncRNAs. Some of them are

newly discovered as specific to cardiac remodeling and to heart failure8. Importantly it is also

emerging that parasitic elements of the genome, known as transposable elements (TE), represent

important genetic elements contributing to the birth and functional diversification of heart enriched

lncRNAs. The goal of this project is therefore to characterize the expression of TE associated heart

enriched lncRNAs during post infarction remodeling.

5

Figure 1.1: principal causes of dead in

population ages in Switzerland. OFS Figure 1.2: scheme of the formation of a cholesterol plaque. From Robbins, pathologic basis of disease

(1)

(2)

(3) (4) (5)

(6)

Figure 1.4: different lecture senses of lncRNA Figure adapted from Graziella Curtale and Franca Citarella. “Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response”. Int. J. Mol. Sci. 2013, 14(9), 17347-17377

Figure 1.3: scheme of the pathway to the hypertrophy. From Joseph A. Hill, M.D., Ph.D., and Eric N. Olson, Ph.D., “Cardiac Plasticity” N Engl J Med, 2008; 358:1370-1380

6

Method

Candidate identification Eight novels lncRNA which are predicted to be associated with transposable elements and heart

specific and which were still not studied are selected. We postulated that these lncRNAs may be

modulated post MI. These lncRNAs were selected based on their highly heart enrichment, the

correlation with the cardiac physiology and association with a specific family of transposable

element.

LAD Model A division in 2 equivalent groups of mice will be done (the homogeneity of the groups will be

discussed later) a SHAM group, the control mice. These mice encounter a heart operation but the

ligature is not tied. They shouldn’t have an infarct but they have the same physiological stress as the

other mice. The second group of mice encounters the same operation and a 7.0 silk ligature near the

insertion of the left descending coronary artery.

The Operation is executed under complete anesthesia with IP injection of a mixture of

ketamin/xylazine/acepromazin (65/15/2 mg/kg) and the mice are placed on a warming pad for

maintenance of body temperature. Mice laying on the back receive an endotracheal intubation and

the mice were placed on artificial ventilation with a mini-rodent ventilator (tidal volume = 0.2ml, rate

= 120 breaths/min). They receive an ocular gel to hydrate the cornea during the procedure. The

correct intubation is controlled with the symmetric expansion of the thorax. The thorax is opened

after shaving the hairs and a surgical disinfection with Betadine. The thoracotomy is performed,

pectoris muscle are separated transversally, the rib dissected in the fourth costal space and

pericardium opened. After the ligature, the thorax is closed (chest and skin) with 6-0 and 5-0 sutures.

After the operation the mice become antalgic drugs

Echocardiography Echo data are collected the same day as the sacrifice with the VEVO 2100 Ultrasound machine with a

30 MHz probe. The mice under light anesthesia, shaved undergo the echo. The heart function and

the heart morphology are observed. These data allows us to be sure that the MI mice have a relevant

and comparable infarct. The following data are collected. The heart rate is a control; we want with

the anesthesia that it stays between 400 and 500 beats per minute. Diastolic and systolic internal

ventricular septum (IVS;d and IVS;s), diastolic and systolic left ventricular free posterior wall

thickness (LVPW;d and LVPW;s), and left ventricular internal end-diastolic and end-systolic chamber

(LVID;d and LVID;s) dimensions were measured in M mode echo. Left ventricular fractional

shortening (%FS) and ejection fraction (%EF) are also calculated. The EF is calculated with: (LV Vol;d-

LV Vol:s)/ LV Vol;d x100, LV Vol meaning Left ventricle volume systolic and diastolic. The left

ventricle mass is also calculated. Infarct data are also collected, indirectly with heart function. These

are left ventricle systolic and diastolic area (LV systole/diastole area LA and SA respectively) and

related the percentage of area shortening (LV systole area / LV diastole area).

7

Tissue preparation Mice are sacrificed by CO2 exposure and the heart is isolated. Atrium and ventricles are separated

and weighed. A sample close to the infracted zone (border zone or BZ) and a sample of the non-

infarcted viable zone (remote zone or RZ) are collected. The samples are sorted at -80°C to preserve

RNAs. The tibia is also excised and measured. At the end, the following data are collected:

Ventricular Weight, Atrial weight, Heart weight and Tibia length. The Tibia length is the most

consistent measurement for the age and the size of mice.

RNA Isolation Total RNA is extracted from these mice heart samples using the RNeasy isolation kit from QIAGEN ®

following the standard user guide. The purity and the total amount of RNA in the sample is quantified

with a OD260/280 using a Nanodrop. To have the best conservation possible the samples stays at 4°

when worked with, -80° in a freezer when not.

Reverse Transcription/cDNA synthesis A DNAse treatment is executed and the reverse transcription is executed using SuperScript II kit

(INVITROGEN®) with random hexamer primers according to manufacturers instructions.

Quantitative RT-PCR The qRT-PCR is processed using the Applied Biosystems SYBR Green and TaqMan PCR kits and

analysis is processed using an ABI Prism 7500 cycler. The relative expression is then analyzed with a

measurement of the ∆∆Ct method. The primers for the 8 novel lncRNAs are in the following table.

8

Lnc Forward Reverse

TE1 GTGGGGAGGTCAGCTACAA CGGAAATGGTTTGAAATGCT

TE2 ACAGACCTGCAGCAGTGAGA GCTAGGGAACGCAGAACAAG

TE3 AAGGCTTCCCAGAGAAGGAG ACTGGGTGAGTCTCGCTGTT

TE4 TGGGACAGCAGAGCTAAGGT AGATTCCAGCACGCACTTCT

TE5 AAAGGGAAGAGGGAAAACGA CGTCTAGAACCAGCCCAGAG

TE6 TTTGGAGATGGAACCTGGAG TCTGGTATGGGGGAGACTTG

TE7 GGTTGGGTGCCTATTAAACG GGTTCATGAGCCTTTGGAAG

TE8 /RMR73 GAGCCAAGTGCACACAGAAA TGGTCTGTTCCTGGCCTTAG

TaqMan Probe

Col1a1 Mm_00801666_g1

CTGF Mm_01192931_g1

ANF Mm_01255747_g1

Myh7 Mm_00600555_m1

Table 1: Used primers for the new lnc set and TaqMan Probe

9

Results & data analysis

Characteristics of the Myocardial infarction model Experimented mice are separated into two groups. The control group (SHAM) and the infarcted

group (MI) are all comparable physiologically in basal unstressed conditions. The mice have all the

same size (see tibia length on figure 2) and the same heart rhythm during the intervention.

Myocardial infarctions were executed and myocardial characteristics were passed over a temporal

period. For example, the internal diameter increases from D1 to D28 after the infarct parallel with

the volume of LV (LV Vol) increases with the dilatation. The EF linked with the heart function

deceases between D1 and D28. The ratio between the ventricle weigh ant the tibia length (VW/TL)

which increases in the days after infarct is indicative of cardiac hypertrophy and pathological

remodeling. Echocardiographic data presented here validate the myocardial infarction model used

and the evolution of pathological remodeling within these mice. (Figure 2)

To validate the remodeling response at the molecular level, gene expression profiling was executed

for canonical remodeling and stress markers. The transcriptional induction of fibrotic genes or of

fetal genes is an important hallmark of post infarction remodeling. The stress markers genes such as

ANF and BNP are important to predict the dilatation and the related heart dysfunction. We

demonstrate that the fibrotic markers increase within days, proving the efficacy of the model. CTGF

is more sensitive and shows variations from D1 with Col1a1 significantly induced by 7 days post

infarction. Myh7 increases also with a kinetic with significance only since D7. The muscle stress

markers increases quickly too, since day 3 we can objectivize the kinetic. BNF, the actually used

blood marker for heart insufficiency is unfortunately cannot be analyzed. (Figure 3)

Heart expression of the candidates Using the UCSC-browser with publically available ChIP and RNA-Seq datasets (see Table 4) we

selected lncRNA candidates whose transcriptional start site was contributed by the TE, RMER19.

Interestingly, upon further interrogation using publically available ChIP and RNA-Seq datasets, all 8

unique RMER19 associated lncRNAs were heart enriched and associated with interesting cardiac

chromatin marks (i.e.H3K4me3, H3k27Ac).

TE1, TE3, TE4, TE7 and TE8 are highly heart specific and are expressed in no other organs. TE5 is also

heart specific but is also expressed in testis. The last two lncRNA which I analyze are TE2 and TE6.

Both are highly expressed in heart but are also expressed in other tissues.

Modulation of candidates after infarct Expression profiling characterized the expression of TE heart enriched novel lncRNAs during post

infarction remodeling. The most compelling expression kinetics were associated with lncRNAs TE3,

TE5, TE6 and RMER73 (TE8), which are described in detail below. TE3 is upregulated in the days

following the infarct. What is really exciting is the kinetics of expression exhibited by TE3 lncRNA.

When we compare the sham level and the expression level at day 14 or 28 we observed a 5-fold up-

regulation. The upregulation appears not immediately after the infarct. At day 1 we can see that the

levels are similar. What is also interesting is that in the remote zone at day 7 we cannot see any

10

changes of this lnc, which means that TE3 could be related with the cardiac remodeling specifically at

the area of infarction and not directly to the heart function.

The next interesting lncRNA is the TE5. This one shows a completely different expression profile. This

lncRNA is downregulated either in the BZ or in the RZ. That means TE5 could be linked with the heart

(dys)function. Unfortunately the expression in D7 BZ shows no statistical significance due to a large

standard deviation. The low n numbers (4 SHAM and 4 MI) at this time point and the presence of an

outsider in the SHAM group could explain that. However there is a trend for down-regulation.

TE6 as TE5 and TE8 are also downregulated in the BZ such as in the RZ. We can observe a low

significance in these data (p-value close to 0.1) because of the large variability of these data.

Finally, TE8 is down regulated post infarction in the BZ. This TE is immediately low, already at D1 and

remain as low as D1 until D14. That could also correlate with the heart function. This lncRNA is also

downregulated in RZ but not in the first day, only at D7.

TE1, TE2, TE4 and TE7 exhibit no statistically significant expression changes post MI. Therefore, they

could have another function, not directly linked with infarct or heart failure.

11

Figure 2.1: Heart rate and tibia length in D1, D3, D7 and D14 of SHAM mice (white) and LAD-treated mice (red)

Figure 2.2: Physiological echocardiographic derived data at D1, D3, D7 and D14 of SHAM mice (white) and LAD-treated mice (red)

D1 D3

D1 D1

D1 D1

D1 D1

D1

D3 D3

D3 D3

D3 D3

D3 D7

D7 D7

D7 D7

D7 D7

D7 D14

D14

D14 D14

D14 D14

12

Figure 3: Relative expression of the typical stress markers as positive control of SHAM mice (white) and LAD-treated mice (red). CTGF and Col1a1 are Fibrosis markers, Myh7 is a muscle marker, ANF and BNP are muscle stress markers.

D1

D3

D7

D14

D28

13

TE 1

TE2

Figure 4.1: Tissue specificity of new lncRNA set

14

TE 3

TE4

Figure 4.2: Tissue specificity of new lncRNA set

15

TE 5

TE6

Figure 4.3: Tissue specificity of new lncRNA set

16

TE 7

TE8 / RMER73

Figure 4.4: Tissue specificity of new lncRNA set

17

Figure 5: Relative and comparative expression of the 8 novel lnc between control mice (SHAM in white) and infarcted mice (MI in red) at respectively D1, D3, D7, D14 and D28 for border zone (BZ) and respectively D1 and D7 for remote zone (RZ).

18

Discussion & Conclusion

Validation of the model We demonstrate that our LAD-treated mice as model for the myocardial infarction is accompanied

on the one hand by changes in the expression of TE associated lncRNAs and on other hand by

changes in the physiology of the heart and in expression changes of cardiac stress markers (Figure 2

and 3). We also demonstrate that the selected new candidates are highly heart enriched. These

characteristics are very important to validate the model as a heart and disease specific biomarkers.

Furthermore, we observed that our set of TE associated lncRNAs are more modulated when they are

more heart specific, when comparing the TE expression and the UCSC (Figure 4 and 5). In conclusion

we can say that our LAD model shows results close to a physio-pathological infarct model. We can

say too that we selected a promising set of novel TE associated lncRNA candidates.

TE associated lncRNA expression post infarction In our lncRNA set, TE3, TE5, TE8 and TE6 exhibit particularly interesting expression kinetics. We can

classify our results in two sets: the up-regulated lncRNA and the down-regulated lncRNAs. The up-

regulated are likely lncRNA linked with the initiation and development of pathological remodeling.

The RZ of the upregulated lncRNAs remain in the days after the infarct not over-expressed. This

ascertainment demonstrates also these as remodeling factors. We can also suggest the possibility

that the up-regulated lncRNA are secreted in blood which can also show the utility as biomarker.

Some studies also concluded at the presence of kind of non-coding RNAs in blood circulation and the

utility as biomarker.12

The second group of lncRNAs, the down-regulated ones such as the TE 5 and TE8 are likely linked

with the heart function. They show themselves already at the beginning low and remain low and

they are present in both BZ and RZ. These two assertions also demonstrate a potentially link

between these lncRNA and heart function. It would be of interest to determine the putative

expression of these candidates in plasma.

Some of our TE associated heart enriched lncRNAs exhibit statistically significant expression kinetics

post infarction implicating them as potentially interesting regulatory molecules in the context of post

infarction pathological remodeling.

Globally the different kinetics and results between the BZ and the RZ shows a great specificity to a

process in the heart infarct such as remodeling. Some of our LncRNA presents a symmetric

modulation of the BZ and the RZ which likely correlate with a modulation of the function, as the

actual biomarkers.

Now we know that these RNAs are heart specific, variable between BZ and RZ that shows specificity

to a process and they are also modulated in mice, the next step could be to find the homologues in

human and detect them in the blood. These could one day be new biomarkers for heart diseases.

Other lncRNAs are also specific for other pathologies and parallel works on this theme could also be

useful to have predictive biomarkers for the most current physiologic or pathological changes in

human body. This study is one of the first about lncRNA), but the potential is infinite. 9, 10,11,12

19

Strength and weakness of the study The main problem in this study is the small n numbers. The most consistent time point is at 28 days

with 6 SHAM and 9 MI mice. The least time points are D3 and D14 with respectively 3 SHAM vs 4 MI

and 3 SHAM vs 3 MI. This can explain the great variance that exists in each group. Some of them such

as TE6 that shows on graphs a real difference with the mean expression but these differences are not

statistically significant. Despite this problem, this is a preliminary study characterizing the expression

of a unique set of TE associated lncRNAs post myocardial infarction and it must be integrated with

other datasets in the future to have some statistically significant results.

To explain the variance in this study it is also important to know that all the experiments are

handmade thus human error and variance in technical execution is likely.

The author reports no conflict of interest.

Perspectives In the next steps we would characterize whether these lncRNAs are detectable in the circulating

plasma and use them as potentially highly sensitive and heart-specific biomarkers.

We can also consider the presence of human orthologue of these lncRNAs which would involve the

analysis of human tissue and blood to compare in healthy and sick subjects. That could also lead to

an extensive research on specific biomarkers for the physiological traits or for pathologies. It could

become a new tool for the diagnostic, the management of patient with heart disease.

Of course at the best, the lncRNA would be used to offer new therapeutic possibilities by modifying

the physiology, act on the fibrosis in the acute phase or to obtain regeneration of cardiomyocytes.

20

Acknowledgement I really want to thank my co-tutor, Samir Ouzain, who leads me into this work and show me the way

to go through a scientific way. I would like to thank my Tutor Thierry Pedrazzini for the lab. Really

important too are Tal Beckmann and Rudi Micheletti who show me the technique in lab, the way to

go and for a part of the data. I would like to thank too the whole lab too for the help and the laugh

during my thesis.

Bibliography 1: OFS, 2013 data’s

2: Robbins and Cotran, Pathologic basis of disease eight edition, 2010, chapter 11, pp 487-528

3: Diana Zaliaduonyte-Peksiene, Sandrita Simonyte &all, “ Left ventricular remodelling after acute myocardial

infarction: Impact of clinical, echocardiographic parameters and polymorphism of angiotensinogen gene”,

Journal of the Renin-Angiotensin-Aldosterone System, 2014, Vol. 15(3), 286–293

4: Joseph A. Hill, M.D., Ph.D., and Eric N. Olson, Ph.D., “Cardiac Plasticity” N Engl J Med, 2008; 358:1370-1380

5: Hangauer MJ, Vaughn IW, McManus MT. “Pervasive transcription of the human genome produces

thousands of previously unidentified long intergenic noncoding RNAs”. PLoS Genet. 2013;9:e1003569

6: Mercer TR, Mattick JS. “Structure and function of long noncoding RNAs in epigenetic regulation”. Nat Struct

Mol Biol. 2013;20:300–307.

7 : Graziella Curtale and Franca Citarella. “Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune

Response”. Int. J. Mol. Sci. 2013, 14(9), 17347-17377

8: Regalla Kumarswamy, Christophe Bauters & all, “The circulating long non-coding RNA LIPCAR predicts

survival in heart failure patients”, Circ Res. 2014;114:1569-1575;

9: Ounzain, S., S. Crippa, and T. Pedrazzini, “Small and long non-coding RNAs in cardiac homeostasis and

regeneration”. Biochim Biophys Acta, 2013. 1833(4): p. 923-33.

10: Creemers, E.E., A.J. Tijsen, and Y.M. Pinto, “Circulating microRNAs: novel biomarkers and extracellular

communicators in cardiovascular disease?” Circ Res, 2012. 110(3): p. 483-95.

11: Wang, G.K., et al., “Circulating microRNA: a novel potential biomarker for early diagnosis of acute

myocardial infarction in humans”. Eur Heart J, 2010. 31(6): p. 659-66.

12: Semenov, D.V., et al., “Fragments of noncoding RNA in plasma of human blood”. Ann N Y Acad Sci, 2008.

1137: p. 130-4.