The HFE Gene of Browsing and Grazing Rhinoceroses: A Possible Site of Adaptation to a Low-Iron Diet

A

e ironhumans,swe havesingerousdeducedmutationlved in

Blood Cells, Molecules, and Diseases (2001)27(1) Jan/Feb: 342–350 Beutler et al.doi:10.1006/bcmd.2001.0386, available online at http://www.idealibrary.com on

The HFE Gene of Browsing and Grazing Rhinoceroses:Possible Site of Adaptation to a Low-Iron Diet

Submitted 01/08/01(Communicated by E. Beutler, M.D., 01/08/01)

Ernest Beutler,1 Carol West,1 Jeffrey A. Speir,2 Ian A. Wilson,2 and Michael Worley3

ABSTRACT: When rhinoceros species that are browsers in the wild are fed in captivity they becomoverloaded. Presumably, their iron-absorptive mechanisms have evolved to become highly efficient. Inmutations of theHFE gene cause increased iron absorption. To determine whether theHFE gene of rhinocerosehas undergone mutation as an adaptive mechanism to improve iron absorption from iron-poor diets,sequenced the entire coding region of theHFE genes of four species of rhinoceros. Two of these were browspecies and two were grazing species. Although theHFE gene has been well preserved across species, numnucleotide differences were found between rhinoceros and human or mouse, some of which changedamino acids. Of these mutations, only one found in the black rhinoceros appears to be a viable candidatethat might adversely affect HFE function. This mutation, S88T, is in a highly conserved region that is invo
the interaction between transferrin receptor and HFE.© 2001 Academic Press
it-nsue

mo-d byeartr ac-ntrly,the

emi-

de-k-ted

cies

n

ofigsn-hite

ais

be-

islongene6.e

pvel-theirontese

784-2Resea 2037.

mical B es Road,

INTRODUCTION

The regulation of body iron content is of crical importance. Too little iron results in irodeficiency anemia and depletion of some tisenzymes, while too much iron produces hechromatosis, a clinical syndrome characterizecirrhosis, diabetes, bronzing of the skin and hdisease (1). Since there is no mechanism fotively excreting iron from the body, iron conteis regulated by modulating absorption. Cleaeach species must adapt the efficiency ofabsorptive mechanism to the content and chcal state of iron in its diet.

A number of animal species appear tovelop iron overload in captivity (2–9). A striing example has recently been documenamong rhinoceros species. Browsing spesuch as the African black rhinoceros (Dicerosbicornis) and the Sumatran rhinoceros (Dicero-rhinus sumatrensis), which have evolved in a

Correspondence and reprint requests to: Ernest Beutler. Fax: (858)1 Department of Molecular and Experimental Medicine, The Scripps2 Department of Molecular Biology and Skaggs Institute for CheLa Jolla, California 92037.
3 Center for the Reproduction of Endangered Species, Zoological Society
342

environment where their diet consists largelypoor sources of iron, such as leaves and twbecome iron overloaded in captivity. In cotrast, other species, such as the African wrhinoceros (Ceratotherium simum) and Indianrhinoceros (Rhinoceros unicornis), that havediet that consists of grass from which ironpresumably more readily available, do notcome iron overloaded in captivity (10 –12).

In humans hereditary hemochromatosisan autosomal recessive disorder that hasbeen known to be caused by mutation of a glocated in the HLA complex of chromosomeIn 1996 this gene,HFE (13), was cloned. Thre

olymorphic mutations ofHFE are known; twoof these are clearly associated with the deopment of hemochromatosis (13–15) whilethird appears, also, to result in increasedaccumulation (16, 17). TheHFE knockoumouse also accumulates iron (18, 19). Th

083. E-mail: [email protected] Institute, 10550 North Torrey Pines Road, La Jolla, California 9iology, The Scripps Research Institute, 10550 North Torrey Pin

of San Diego, P.O. Box 120551, San Diego, California 92112.

1079-9796/01 $35.00Copyright© 2001 by Academic Press

All rights of reproduction in any form reserved

e

f the

ands inironthetheand

e ofin

in

li-edaso-ed

R ol-u a-c n-s n-s A).B s-i tasep edf ingD ec e-s acka dlH

w os,a rosa eralb rin-i ientc ingn

s md ver-n rme sioni

nef c-c toat nt1 hisf Rp nd2

theckdryin-p°C.na

ena-edVThel of

%ander

ght.es of15

mS erev hep ageD ngs

w byl sD w-

Beutler et al. Blood Cells, Molecules, and Diseases (2001)27(1) Jan/Feb: 342–350

doi:10.1006/bcmd.2001.0386, available online at http://www.idealibrary.com on

findings indicate thatHFE plays a role in thregulation of body iron content.

In the present study we sequenced parts ointrons and the entire coding region of theHFEgenes of four rhinoceros species, two grazerstwo browsers, to determine whether mutationthis gene were responsible for the higheruptake of the browsing species. By comparingdeduced amino acid substitutions found inbrowser with sequences found in the mousehuman we conclude that it is possible that ontheHFE mutations identified could play a rolethe increased iron accumulation that is foundone of these species.

MATERIALS AND METHODS

Cell culture and construction of a cDNAbrary. A primary fibroblast culture establishfrom a skin biopsy of a black rhinoceros wobtained from Dr. Oliver Ruder, Zoological Sciety of San Diego. Total RNA was extractfrom confluent fibroblast cultures and poly(A1)

NA was purified on an oligo(dT) cellulose cmn (QuickPrep mRNA purification kit, Pharmia, Piscataway, NJ). A cDNA library was cotructed using the Librarian cDNA Library Cotruction System (InVitrogen, Carlsbad, Criefly, cDNA was synthesized from mRNA u

ng avian myeloblastosis reverse transcriprimed with oligo (dT). cDNA was synthesiz

rom RNase H-treated DNA/RNA duplexes usNA polymerase I. After blunt end ligation of thDNA to EcoRI linkers, the cDNAs were sizelected by agarose gel electrophoresis and pged in thel phage vectorlgt10. The package

ibrary was amplified in theE. coli strain C600fl.

Extraction of genomic DNA.Genomic DNAas prepared from an African black rhinocern African white rhinoceros, an Indian rhinocend a Sumatran rhinoceros from either periphlood mononuclear cells isolated from hepa

zed blood samples by Ficoll–Hypaque gradentrifugation or from tissues obtained dur
ecropsy procedures at the San Diego Zoo andi
343

-

tored at270°C. DNA was isolated by sodiuodecyl sulfate (SDS)–proteinase treatment oight at 55°C, followed by phenol and chlorofoxtraction, ethanol precipitation, and resuspen

n 10 mM Tris–HCl, pH 7.4, 0.1 mM EDTA.

Isolating rhinoceros HFE cDNA and geragments.Oligonucleotides 59-gcctcagagcaggattg and 59-cagtgagtctgcaggctgcgt were usedmplify the fragment of humanHFE cDNA ex-

ending from nucleotide (nt) 85 in exon 2 to070 in exon 6 (just beyond the stop codon). T

ragment was purified using a QIAquick PCurification kit (Qiagen, Hilden, Germany) a00 ng labeled with 100mCi of [a-32P]dATP

(3000 C/mM) using the PCR primers andPrime-It II kit, Stratagene (La Jolla, CA). A blarhinocerosHFE cDNA clone was isolated anpurified by probing the rhinoceros cDNA librawith this probe. Fifteen NZY plates each containg XL1-Blue infected with 50,000 pfu in a toagarose overlay were grown overnight at 37Duplicate lifts were made on 0.45 micron Magnylon transfer membranes (Osmonics Inc.), dtured in 0.5 N NaOH/1.5 M NaCl, neutralizwith 0.5 M Tris–Cl, pH 7.5/1.5 M NaCl and Ucrosslinked using a Stratolinker (Stratagene).membranes were incubated at 42°C in 120 mhybridization mix containing 0.9 M NaCl, 50formamide, 10% dextran sulfate, 1% SDS200mg/ml salmon sperm DNA for 1 to 2 h. Aftadding 0.7 to 1.03 106 cpm per milliliter of the32P probe the incubation was continued overniThe membranes were washed in three chang300 ml of 0.53 SSC, 0.1% SDS at 55°C for

in each and then in 300 ml of 0.23 SSC, 0.1%DS at 55°C for 15 min. The membranes wisualized by exposure to XAR-2 X-ray film. Tositive clones were plaque purified and phNA was isolated from a liquid culture usitandard techniques (20).

Constructing genomic libraries.An Africanhite rhinoceros genomic library was made

igating a partial BamHI digest of rhinoceroNA into lambda Fix vector (Stratagene) follo

ng the Stratagene protocol. The library contained

Gi eent oft g av ei tiveg andp e.

ined3

0U

r

m leso °C,0 g-m IA-q

ent-t inga eds

E

-o rhi-n itht thes onew thei micD sr tn oc-e the5 rei ames r ine andm ned,te enceso en-B 4);t hiter theb ithA Thei e oft pe-c n thea

s merss oss om-p CR

s


approximately 0.253 106 primary clones. Amore 59 HFE fragment extending from the ATn exon 1 to nt 591 in exon 3 was used to scrhis library. The fragment was made by PCRhe human cDNA clone described above usinector primer (pcalHC 59) and an oligonucleotidn exon 3, 59-cagctccagcaactgctgcag. The posienomic clones isolated were plaque purifiedhage DNA was prepared as described abov

Polymerase chain reactions (PCRs) conta3.5 mM Tris–Cl, pH 8.8, 8.3 mM (NH4)2SO4,

3.35 mM MgCl, 85mg/ml BSA, 5% DMSO, 20mM dNTPs, 250 ng of each oligonucleotide, 1.5Taq polymerase, and 0.5–1mg genomic DNA o100 pg of phage clone DNA per 100ml of PCR

ix. After denaturing for 4 min at 98°C, 30 cycf PCR at 94°C, 30 s, 56–64°C, 30 s and 72.5 to 2.5 min was carried out. Amplified fraents were purified for sequencing using Quick PCR purification kit, Qiagen.

Sequencing was carried out by a fluorescagged dideoxy chain termination method usn ABI (Foster City, CA) Model 377 automatequencer.

TABLE 1

Comparison of the Structure of Humanand RhinocerosHFE Genes

HFE intron size (nt)

Intron No. Human Rhinocero

1 3327 31162 209 2033 1053 8444 157 1315 953 1000

TA

Oligonucleotide Primers Us

Sense primer (59–39)

Exon 1 gatcccactggccaggaagExon 2 ttgattcagaaggtatgtggagExon 3 aggagtctgaggtcattcggExon 4/5 agcttgctttgtctgaacagg
Exon 6 gtgatcagggttgagacgag
344

XPERIMENTAL AND RESULTS

Intron sequences.An HFE clone, 1816 nucletides in length was isolated from the blackoceros cDNA library. It had 87.5% identity w

he humanHFE nucleotide sequence. Whenequence of adjacent exons in the cDNA clas obtained, primers were made to amplify

ntervening sequences from rhinoceros genoNA. The black rhinoceros cDNA library wa

escreened with a more 59 humanHFE probe buo positive clones were found. The white rhinros genomic library was then screened with9 humanHFE probe and 5 positive clones we

solated; the inserts all appeared to be the size, about 9 kb. By using a reverse primexon 3 to sequence the phage clone DNAaking new primers from the sequence obtai

he remainder of the rhinocerosHFE intron andxon sequence was obtained. The exon sequf the four species have been deposited in Gank (Accession No. AY007541–AY00754

he sequences of exon and intron 1 of the whinoceros and of exons and introns 2–6 oflack rhinoceros are deposited in GenBank wccession Nos. AF301581 and AF301582.

ntron sizes are listed and compared to thoshe human in Table 1. Differences between sies in the intron sequences are summarized ippendix.

Coding regions.The rhinocerosHFE intronequence was then used to design intronic prio that theHFE exons of the various rhinocerpecies could be amplified, sequenced and cared. Table 2 lists the primers used to P

2

mplify RhinocerosHFE Exons

ntisense primer (59–39) Fragment size (nt)

gcatcccagtgcccggag 382agggaccgaatgacctcaga 485ggattctgctactctgatcttg 769aagagaagacttctcatggatg 768

BLE

ed to A

A

gtccttagcataacttaacgtag 356

rr e oft them

i arel cids( AAa manH 047n heA hasa thec tityi

pe-c icht cal.T ingc ingc isv thes

c oft at isn , im-p inoa heg whatp isp ata inec tog agb ichi ted.I 21t ersa rveda ub-s FEm ws-i heo r oft rva-

indicatest unctio



amplify and sequence theHFE exons of the fouhinoceros species. The amino acid sequenche black rhinoceros is compared with that ofouse and the human in Fig. 1.

The nucleotide differences in theHFE cod-ng region between the 4 rhinoceros speciesisted in Table 3 and the deduced amino aAA) are compared with human and mouset the same position. Rhinoceros and huFE coding regions are the same length, 1t, but the mouse is 33 nt or 11 AA longer. Tfrican black rhinoceros HFE nt sequencen 85% identity with the human sequence inoding region by fasta analysis; the AA idens 77.9%.

Sequence variability between rhinoceros sies.There were 27 exonic nucleotides at whhe four rhinoceros species are not identiwenty-one of these produced no codhange. Although occasionally such noncodhanges may be biologically significant, thisery rarely the case, and for this reason only

FIG. 1. Comparison of the amino acid sequences ohe position of the amino acid change that may have f

ix mutations that produced an amino acid t

345

hange are considered further here. Fivehese substitutions were in an amino acid thot conserved between human and mouselying that in these positions a specific amcid is not required for normal function of tene; these regions of the protein are someermissive with respect to which amino acidresent. The glycine to methionine changemino acid 137, the valine to methionhange in amino acid 246, and the alaninelycine at amino acid 345 were found inrazing species; defects in theHFE gene woulde expected in the browsing species, in wh

ron absorption would need to be upregulan the case of the mutations at AA 268 and 3he two genotypes were found both in browsnd grazers. The only change in a consemino acid was the mutation that caused stitution of a threonine for serine-88 in the Holecule. This mutation occurred in one bro

ng species, the Black African, but not in tther (Sumatran) and was not found in eithe

he two grazing species. This rather conse

frican black rhinoceros, human, and mouse. The arrownal significance.

f the A

ive amino acid substitution occurs in a 52-

inon,e is

(Fig.thisonis

)t rinr n-t er,n derW ndS ithT ithn

t itsx-noten-handdi-the92,theE.actam-thenive

use

s sho


residue region of the protein sequence (amacids 81–132) in which with one exceptioevery amino acid in the rhinoceros sequencthe same as either mouse or human or both1). It seems possible that a substitution inhighly conserved region may have an effectthe function of the HFE protein. The mutationlocated on thea1 helix of the HFE protein (21hat is a key interaction site for the transfereceptor (TfR) (22), but there is no direct coact between S88 and TfR (Fig. 2). Howevearby residues Q89 and L85 have vanaals interactions with TfR residues T657 a654, and Q86 forms two hydrogen bonds w658. S88 makes van der Waals contact w

TA

Coding Region Differen

Mutation cDNA No. Genomic No.

Bro

Black Africa

Exon 1 C3 G 27 27 C/CG3 A 48 48 G/GA 3 G 72 72 A/A

Exon 2 T3 C 108 3224 T/TC3 T 126 3242 C/CC3 T 165 3281 C/CC3 G 180 3296 C/CC3 T 189 3305 C/CA 3 G 258 3374 A/AG3 C 263 3379 C/C

Exon 3 T3 C 393 3712 T/TT 3 G 402 3721 T/TA 3 T 410 3729 A/AT 3 C 423 3742 T/TC3 G 486 3805 C/CG3 A 555 3874 G/GT 3 G 573 3892 T/T

Exon 4 G3 A 736 4899 G/GC3 T 783 4946 C/CA 3 T 803 4966 A/AC3 T 813 4976 C/CT 3 C 822 4985 T/TC3 A 876 5039 C/C

Exon 5 C3 T 915 5209 C/CT 3 C 961 5255 T/TA 3 G 1005 5299 A/A

Exon 6 C3 G 1034 6328 C/C

a The best fit between human and mouse HFE amino acid

eighboring K92 and V68 in the loop preceding

346

he a1 helix, and a hydrogen bond fromside-chain hydroxyl group to the carbonyl oygen of W84. Threonine at position 88 doescontribute additional hydrogen bonding pottial, but does occupy a greater volume tserine due to the extra methyl group. The ational space required by threonine may alterclose interactions of surrounding residues KV68, and W84 resulting in subtle changes inlocal a1 helix or nearby loop structures of HFVariations in the HFE structure at TfR contsites can affect the kinetics and thermodynics of complex formation and may attenuateability of HFE to inhibit the TfR–Tf interactio(23). If so, it could represent an adapt

3

etween Rhinoceros Species

Nucleotides

Amino acidsGrazers

umatran White African Indian Rhino Human Mo

G/G C/C C/C L9L L LG/A G/G G/G R16R Q WG/G A/A G/G P24P L PC/C C/C C/C G36G G GC/C C/C T/T H42H L LC/C C/C T/T D55D D DG/G C/C C/C A60A F SC/T C/C C/C H63H H HG/G G/G G/G Q86Q Q HG/G G/G G/G S88T S SC/C T/T C/C S131S S SG/G T/T G/G G134G G GA/A A/A T/T K137M K RT/T T/T C/C D141D D DG/G C/C C/C A162A A AA/A G/G G/G R185R R KG/G G/G G/G L191L L LG/G A/A G/G V246M M LT/T C/C T/T D261D D DT/T A/A T/T E268V I LC/C C/C T/T A271A A AT/T T/T C/C P274P P PC/C A/A C/C P292P P PT/T C/C C/C L305L L MC/C T/T C/C F321L F a

G/G A/A A/A S335S S SC/C G/G C/C A345G A T

ws a gap in this position.

BLE

ces b

wsers

n S

change in the low iron environment in which

heing

ckay

crystals mbers aref ck Africanr ssed proteina



the black African rhinoceros evolved. Tchange is not present in the other brows

FIG. 2. Location of the serine-88 to threonine mutatructure of the complex between human HFE (blue) arom the atomic coordinates numbered according to thehinoceros, is designated S66, and the numbers of thes shown in the text and tables.

c/t 147

347

is likely that in that species, and in the blaAfrican rhinoceros as well, other proteins m

f black African rhinoceros HFE from the analysis of the(magenta) [PDB access code 1de4 (22)]. Residue nu

ssed protein; hence, S88, the mutation found in the blar amino acids are also 22 less than those in the proce

species tested, the Sumatran rhinoceros, and itplay a role in upregulating iron absorption.

APPENDIX

Nucleotide Differences in Intervening Sequences between Rhinoceros Species

Intron location Mutation Genomic No.

Browsers Grazers

African Black Sumatran African White Indian

Upstream of the ATG285 to21 a/g 282 a/a g/g a/a g/g

c/t 256 c/c t/t c/c c/ca/g 232 g/g a/a g/g a/a

Intron 1, 59 77 to 166t/c 84 t/t c/c t/t c/cc/a 108 c/c c/c c/c c/a

tion ond TfRproceothe

c/c c/c c/c t/t

/ccccsert

del



Browsers Grazers


c/t 149 c/c t/t c/c c/cIntron 1, 39 3135 to 3192 t/c 3139 t/t t/t t/t c/c

c del 3150–3153 ccc/ccc cccc/cccc cccc/cccc ccccgcctcc insert After 3139 No insert gcctcc No insert No in

c/t 3154 c/t c/c c/c t/tc/g 3155 g/g c/c c/c c/cg/a 3166 g/g g/g g/g a/ac/t 3187 c/c c/c c/c t/t

Intron 2 3457 to 3649 c/a 3465 c/c a/a c/c a/ag/a 3469 g/g g/g a/a g/gt/c 3479 t/t c/c t/t c/cg/a 3486 g/g a/a g/g a/aa/g 3513 a/a a/a g/g a/ag/a 3525 g/g a/a g/g g/ga/g 3539 a/a g/g g/g g/gg/t 3558 g/g t/t g/g g/ga/g 3561 a/a a/a a/a g/gc/t 3595 c/c c/c c/c t/tc/t 3617 c/c c/c t/t c/ca/c 3618 a/a c/c c/c c/c

Intron 3, 59 3936 to 4100 t/g 3953 t/t t/t t/t g/gc/t 3964 c/c t/t c/c c/c

g insert After 3970 None g/g None g/gg/t 3993 g/g g/g g/g t/tg/a 3999 g/g a/a g/g g/g

acc del 4029–4031 acc acc del acc del accc/t 4075 c/c c/c t/t c/cg/c 4086 g/g g/g g/g c/ct/c 4095 t/t c/c c/c c/c

Intron 3, 39 4730 to 4779 c/t 4771 c/c c/c c/c t/tIntron 4 5056 to 5186 t/c 5090 t/t t/t t/t c/c

a/g 5100 a/a a/a a/a g/gc/t 5114 c/c t/t c/c c/ct/a 5147 t/t a/a t/t t/tt/c 5150 t/t c/c c/c c/cg/a 5154 g/g g/g g/g a/a

Intron 5, 59 5301 to 5400 a/g 5311 a/a g/g a/a a/at/c 5336 t/t c/c t/t c/ct/c 5360 t/t c/c c/c c/ct/a 5362 t/t a/a t/t t/tt/c 5364 t/t c/c c/c c/cc/g 5367 c/c g/g c/c g/ga/g 5388 a/a g/g a/a a/aa/g 5393 a/a g/g g/g g/g

Intron 5, 39 6217 to 6300 g/a 6231 g/g g/g a/a g/ga/g 6238 a/a g/g a/a a/ag/c 6239 g/g g/g g/g c/cc/a 6253 c/c a/a a/a a/ag/a 6271 g/g g/g g/g a/a

Intron 6 6342 to 6529 c/a 6342 c/c a/a c/c a/ag/c 6357 g/g c/c c/c c/ct/c 6404 t/t t/t t/t g/gc/t 6406 c/c t/t c/c t/t

APPENDIX—Continued

a/g 6410 a/a g/g a/a g/g

348

SNaEDa




Browsers Grazers


t/c 6416 t/t c/c t/t c/cg del 6471 g/g g/g g/g g delc/t 6505 c/c t/t c/c t/t

APPENDIX—Continued

c/t/g 6525 c/c t/t g/g g/g

hed by.)

B.).ith

his

71)at-

sis,-

995)canbyronby

hys-.

M.,V.

ironro-

R. H.in

.J.iron

e,lop-tou-

onicckem-

cy-

ity

95)

nts

7G.

hro-t

T.notvol-ata

health

, S.,dy,R.,98)red-

ACKNOWLEDGMENTS

This is manuscript No. 13583-MEM from Tcripps Research Institute. This study was supporteIH Grants DK53505-02 (E.B.) and CA58896 (I.A.Wnd by funds from the Stein Endowment Fund (E..B. gratefully acknowledges helpful discussions wr. Donald Paglia, who first called this problem tottention.

REFERENCES

1. Fairbanks, V. F., Fahey, J. L., and Beutler, E. (19Clinical Disorders of Iron Metabolism. Grune & Strton, New York.

2. Brayton, C. (1992) Amyloidosis, hemochromatoand atherosclerosis in a roseate flamingo (Phoenicopterus ruber). Ann. N. Y. Acad. Sci.653,184–190.

3. Cornelissen, H., Ducatelle, R., and Roels, S. (1Successful treatment of a channel-billed Tou(Ramphastos vitellinus) with iron storage diseasechelation therapy: Sequential monitoring of the icontent of the liver during the treatment periodquantitative chemical and image analyses.J. AvianMed. Surg.9, 131–137.

4. Gosselin, S. J., and Kramer, L. W. (1983) Pathopiology of excessive iron storage in mynah birds.J. AmVet. Med. Assoc.183,1238–1240.

5. House, J. K., Smith, B. P., Maas, J., Lane, V.Anderson, B. C., Graham, T. W., and Pino, M.(1994) Hemochromatosis in salers cattle.J. Vet. In-tern. Med.8, 105–111.

6. Lavoie, J. P., and Teuscher, E. (1993) Massiveoverload and liver fibrosis resembling haemochmatosis in a racing pony.Equine Vet. J.25, 552–554.

7. Pearson, E. G., Hedstrom, O. R., and Poppenga,(1994) Hepatic cirrhosis and hemochromatosisthree horses.J. Am. Vet. Med. Assoc.204,1053–1056

8. Randell, M. G., Patnaik, A. K., and Gould, W.(1981) Hepatopathy associated with excessivestorage in mynah birds.J. Am. Vet. Med. Assoc.179,
1214–1217.
349

9. Spalding, M. G., Kollias, G. V., Mays, M. B., PagC. D., and Brown, M. G. (1986) Hepatic encephaathy associated with hemochromatosis in a tococan.J. Am. Vet. Med. Assoc.189,1122–1123.

10. Paglia, D. E., and Dennis, P. (1999) Role of chriron overload in multiple disorders of captive blarhinoceroses (Diceros bicornis). Proceedings of thAmerican Association of Zoo Veterinarians, Colubus, Ohio, October 9–14, 1999, pp. 163–171.

11. Paglia, D. E., and Radcliffe, R. W. (2000) Anthracline cardiotoxicity in a black rhinoceros (Dicerosbicornis): Evidence for impaired antioxidant capaccompounded by iron overload.Vet. Pathol.37, 86–88.

12. Smith, J. E., Chavey, P. S., and Miller, R. E. (19Iron metabolism in captive black (Diceros bicornis)and white (Cerathotherium simum) rhinoceroses.J.Zool. Wildl. Med.26, 525–531.

13. Feder, J. N., Gnirke, A., Thomas, W.,et al. (1996) Anovel MHC class I-like gene is mutated in patiewith hereditary haemochromatosis.Nat. Genet.13,399–408.

14. Beutler, E. (1997) The significance of the 18(H63D) mutation in hemochromatosis.Am. J. HumGenet.61, 762–764.

15. Beutler, E. (1997) Genetic irony beyond haemocmatosis: Clinical effects of HLA-H mutations.Lance349,296–297.

16. Beutler, E., Felitti, V. J., Ho, N. J., and Gelbart,(1999) Commentary: On HFE S65C variant isassociated with increased transferrin saturation inuntary blood donors by Naveen Arya, SubrChakrabrati, Robert A. Hegele, Paul C. Adams.BloodCells Mol. Dis.25, 358–360.

17. Beutler, E., Felitti, V., Gelbart, T., and Ho, N. (2000) Teffect of HFE genotypes in patients attending a heappraisal clinic.Ann. Intern. Med.133,329–337.

18. Zhou, X. Y., Tomatsu, S., Fleming, R. E., ParkkilaWaheed, A., Jiang, J., Fei, Y., Brunt, E. M., RudD. A., Prass, C. E., Schatzman, R. C., O’Neill,Britton, R. S., Bacon, B. R., and Sly, W. S. (19HFE gene knockout produces mouse model of heitary hemochromatosis.Proc. Natl. Acad. Sci. USA95,2492–2497.

19. Levy, J. E., Montross, L. K., Cohen, D. E., Fleming,

ta-not

82)ld

.,r,

ture

or.

J.hro-re-

99)with.


M. D., and Andrews, N. C. (1999) The C282Y mution causing hereditary hemochromatosis doesproduce a null allele.Blood 94, 9–11.

20. Maniatis, T., Fritsch, E. F., and Sambrook, J. (19Molecular Cloning: A Laboratory Manual. CoSpring Harbor Laboratory Press, New York.

21. Lebron, J. A., Bennett, M. J., Vaughn, D. EChirino, A. J., Snow, P. M., Mintier, G. A., FedeJ. N., and Bjorkman, P. J. (1998) Crystal struc
of the hemochromatosis protein HFE and character-
350

ization of its interaction with transferrin receptCell 93, 111–123.

22. Bennett, M. J., Lebro´n, J. A., and Bjorkman, P.(2000) Crystal structure of the hereditary haemocmatosis protein HFE complexed with transferrinceptor.Nature403,46–53.

23. Lebron, J. A., West, A. G., and Bjorkman, P. J. (19The hemochromatosis protein HFE competestransferrin for binding to the transferrin receptorJ.
Mol. Biol. 294,239–245.

Documents

The HFE Gene of Browsing and Grazing Rhinoceroses: A Possible Site of Adaptation to a Low-Iron Diet