63
The human genome of is found where in the human body? • Nucleus • Ribosome • Smooth ER • Cell membrane

The human genome of is found where in the human body?

Embed Size (px)

DESCRIPTION

The human genome of is found where in the human body?. Nucleus Ribosome Smooth ER Cell membrane. The cellular structure where proteins are made is called the. Nucleus Smooth ER Ribosome Cell membrane. DNA and Biotechnology. Announcements. Circulation lab: Due Today! - PowerPoint PPT Presentation

Citation preview

Page 1: The human genome of is found where in the human body?

The human genome of is found where in the human body?

• Nucleus• Ribosome• Smooth ER• Cell membrane

Page 2: The human genome of is found where in the human body?

The cellular structure where proteins are made is called the

• Nucleus• Smooth ER• Ribosome• Cell membrane

Page 3: The human genome of is found where in the human body?

DNA and Biotechnology

Page 4: The human genome of is found where in the human body?

Announcements

• Circulation lab: Due Today!• Homework Assignment #2: Due Wednesday!• Textbook Reading:– Chapter 21: Pgs 449-461– Chapter 19: Pgs 406-412

• Online work: Chapter 21- Due Wednesday!

Page 5: The human genome of is found where in the human body?

Lecture Outline

• DNA- Structure, function, and importance• How DNA works– The central dogma– Transcription and Translation– The DNA code– DNA replication

• PCR- Function, usefulness, how it works• PCR Lab

Page 6: The human genome of is found where in the human body?

The importance of DNA

Page 7: The human genome of is found where in the human body?

The DNA double helix is the code of life

• The blueprint for all structures in your body which are made of protein

• DNA is comprised of nucleotides

Page 8: The human genome of is found where in the human body?

Nulceotides are the monomers of nucleic acid polymers

• Consist of a sugar, a phosphate, and a nitrogen-containing base

• Sugar can be deoxygenated

• Bases contain the genetic information

Page 9: The human genome of is found where in the human body?

There are 4 kinds of DNA bases

Page 10: The human genome of is found where in the human body?

Adenine always matches with

Thymine, Cytosine always

matches with Guanine-

Hydrogen bonds hold bases together

Page 11: The human genome of is found where in the human body?

Living things are extremely complex• Cellular machinery is

sophisticated and required for life

• Cellular machinery is made largely of proteins

• Blueprints for all cellular machinery are contained in genes

• Genes are inherited from parents

• Humans have ~30,000 genes

Page 12: The human genome of is found where in the human body?

Proteins give living things the variety of their structures

Page 13: The human genome of is found where in the human body?

Protein variety is generated by 1o structure- the sequence of amino acids

which make the protein

Page 14: The human genome of is found where in the human body?

Figure 2.12

Amino Acids

• Proteins consist of subunits called amino acids

Page 15: The human genome of is found where in the human body?

How DNA works

• Replication• Transcription• Translation

Page 16: The human genome of is found where in the human body?

The sequence of DNA bases is the code for the primary structure of

proteins

Page 17: The human genome of is found where in the human body?

All cells require a copy of the genome

• Genome- all the genes of the cell • Human genome is made of DNA• DNA is similar in all cells• Gene- 1 DNA Molecule (+

proteins the genetic information to produce a single product (protein)

• DNA replication copies all cellular DNA

Page 18: The human genome of is found where in the human body?

Replication of DNA

Figure 21.2

Page 19: The human genome of is found where in the human body?

In vivo, enzymes such as DNA polymerase make DNA replication happen

Page 20: The human genome of is found where in the human body?

The DNA code

Page 21: The human genome of is found where in the human body?

Computers use binary digital code

• 01100001 = A• 01100010 =B• 01000011 =c• 00100111 = apostrophe• Etc.

• http://www.geek-notes.com/tools/17/text-to-binary-translator/

01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

Page 22: The human genome of is found where in the human body?

How does the DNA code work?

• atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

Page 23: The human genome of is found where in the human body?

The DNA code is (nearly)

universalIt uses groups of 3 bases (codon)

3 bases = 1 codon = 1 amino acid

Page 24: The human genome of is found where in the human body?

And what are these U’s for?

Page 25: The human genome of is found where in the human body?

RNA is ribonucleic acid

• Ribose sugar is not deoxygenated

• RNA is single-stranded

• RNA has Uracil, not Thymine

• There are many kinds: mRNA, rRNA, tRNA, siRNA, etc.

Page 26: The human genome of is found where in the human body?

RNA can fold back on itself

• Single strand offers greater flexibility

Page 27: The human genome of is found where in the human body?

Kinds of RNA

mRNA tRNA

Page 28: The human genome of is found where in the human body?

The Central Dogma of Molecular Biology

• DNA RNA Protein • DNARNA :

Transcription• RNA Protein:

Translation

Page 29: The human genome of is found where in the human body?

DNA RNA Protein Trait

Page 30: The human genome of is found where in the human body?

The Universality of the DNA code makes

this possible

Firefly gene (Luciferase) in a tobacco plant

Page 31: The human genome of is found where in the human body?

Transcription and Translation

Page 32: The human genome of is found where in the human body?

Transcription: DNA RNA

Page 33: The human genome of is found where in the human body?

DNA Codes for RNA, Which Codes for Protein

Figure 21.3

Page 34: The human genome of is found where in the human body?

DNA information is transcribed into mRNA

Note in DNA: sense strand vs. antisense strand

Page 35: The human genome of is found where in the human body?

Translation: RNA Protein

Page 36: The human genome of is found where in the human body?

tRNA’s carry an amino acid at one end, and have an anticodon at the other

Figure 21.6

Amino acid(phenylalanine)

mRNA

Anticodon

Amino acidattachment site:Binds to a specific amino acid.

Anticodon:Binds to codon on mRNA, following complementary base-pairing rules.

Page 37: The human genome of is found where in the human body?

The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in

sequence

Page 38: The human genome of is found where in the human body?

tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete

Page 39: The human genome of is found where in the human body?

In this way, the proteins in nature are virtually limitless

Page 40: The human genome of is found where in the human body?

Proteins are incredibly diverse at the molecular level

Insulin

ATP synthase

Rubisco

NitrogenaseFibrin

A few examples

Protein function depends greatly on shape

Page 41: The human genome of is found where in the human body?

In the DNA code, syntax is critical

• THE RED DOG ATE THE BIG CAT• THE RED DOT ATE THE BIG CAT• THG ERE DDO GAT ETH EBI GCA• THR EDD OGA TET HEB IGC AT • THE RED DOG ATE THE BBI GCA T• THE RED RED DOG ATE THE BIG CAT• RED DOG ATE THE BIG CAT

Page 42: The human genome of is found where in the human body?

Damaged DNA (a mutation) causes damaged proteins

Page 43: The human genome of is found where in the human body?

Consequences of a single base substitution

• Misshapen protein• Misshapen red blood

cell• Clogged capillaries• Cellular damage• Resistance to malaria

Page 44: The human genome of is found where in the human body?

Because the DNA code is universal, genes can be moved from one living thing to another

Figure 21.14 (1 of 2)

Step 1: Isolate DNA fromtwo sources.

Step 2: Cut both DNAswith the same restriction enzyme.

Step 3: When mixed, the DNAs recombine by base pairing.

Bacterium

Plasmid

Cell with gene of interest

Source (donor) DNA

Fragments of source DNA

Page 45: The human genome of is found where in the human body?

PCR

Page 46: The human genome of is found where in the human body?

PCR can replicate DNA in vitro

1. dNTPs2. Mg++ containing Buffer3. Taq polymerase4. Primers for your gene

of interest5. Thermal cycler6. A gene (piece of DNA)

you are interested in All together = DNA xerox

machine!

Page 47: The human genome of is found where in the human body?

PCR can replicate DNA in vitro• Step 1- Melting

– DNA denatures• Step 2- Annealing

– Primers bind to complementary sequences

• Step 3- Elongation– Taq DNA polymerase adds

free nucleotides to strands• Cycle is complete, DNA has

doubled• Process can begin again

Page 48: The human genome of is found where in the human body?

dNTPs

• Individual DNA nucleotides

• Four kinds- A, C, G, and T

• They match up with template DNA

Page 49: The human genome of is found where in the human body?

Taq Polymerase

• DNA polymerase isolated from Thermophilus aquaticus bacteria

• Lives in hot springs- heat resistant

• Optimal Taq temp- 72C

Page 50: The human genome of is found where in the human body?

Primers

• Single-stranded DNA sequences of 15-30 bp specific to gene of interest

• One at the 5’ start, the other at the 3’ end of your gene

Page 51: The human genome of is found where in the human body?

Thermal Cycler

• Melting point of DNA= ~94C

• Annealing temp = 55C

• Optimal Taq polymerase temp= 72C

Page 52: The human genome of is found where in the human body?

When one DNA molecule is copied to make two DNA molecules, the new DNA contains

1. A) 25% of the parent DNA. 2. B) 50% of the parent DNA. 3. C) 75% of the parent DNA. 4. D) 100% of the parent DNA. 5. E) none of the parent DNA.

Page 53: The human genome of is found where in the human body?

Importance of PCR

Page 54: The human genome of is found where in the human body?

With 6 billion base pairs in a human genome still means 6 million differences

Page 55: The human genome of is found where in the human body?

PCR can amplify DNA, a great help in forensics and diagnostics

• Other uses: modifying genes, detecting genes

• How it works:1. High heat breaks H-bonds

between base pairs2. Primers bind to sequence of

interest3. Heat-tolerant Taq

polymerase copies4. Goto 15. Each round doubles the

amount of DNA

Page 56: The human genome of is found where in the human body?

DNA is pretty stable, and ancient DNA can be studied- PCR allows amplification of a very small

sample

Page 57: The human genome of is found where in the human body?

Whodunnit? Suspect 1 or

2?

Page 58: The human genome of is found where in the human body?

Genetic Engineering

Figure 21.15

Page 59: The human genome of is found where in the human body?

Genetic Engineering

Figure 21.15 (1 of 2)

Step 1:Double-stranded DNA is unzipped by gentle heating, forming single strands that serve as templates for new strands.

Step 2: The templates are mixed with primers, nucleotides, and DNA polymerase.

Step 3: The mixture is cooled to allow for base pairing.

Primer

+

Double-stranded DNAsample

Page 60: The human genome of is found where in the human body?

Genetic Engineering

Figure 21.15 (2 of 2)

Step 4:Complementary DNA strands form on each template strand. The amount of DNA is now doubled.

Repeatprocedure: The amount of DNA is doubled again.

The procedure is repeated many times, doublingthe amount of DNA with each round.

Page 61: The human genome of is found where in the human body?

Different sequences of DNA are cut by

different restriction enzymes

• Sequences which are cut differently have different sized pieces

• Electrophoresis can differentiate them in the same way

Page 62: The human genome of is found where in the human body?

Human DNA can differ in length at various sites

Page 63: The human genome of is found where in the human body?

DNA of different length is easily measured using gel electrophoresis