Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
The inhibitory signaling receptor protocadherin-18 regulates tumor-infiltrating CD8+ T cell
function
Alan B. Frey
Department of Cell Biology and Perlmutter Cancer Center New York University Langone School of Medicine 550 First Avenue, New York, NY 10016 USA Correspondence: [email protected] Tel: (212) 263-8129; FAX: (212) 263-8139 Conflict of Interest Statement: The author declares no potential conflicts of interest. Acknowledgements: Research in the author’s lab was supported by NIH R01CA108573 and Pfizer Inc (through the CTI program), both to ABF, and to NYULSM for core facilities support (P30CA016087 for Cytometry and Cell Sorting, Histopathology, and Genome Technology).
Running title: Protocadherin-18 regulates TIL function
Keywords: inhibitory signaling receptor, tumor infiltrating lymphocyte, immune suppression, immune checkpoint inhibition, lytic function, CD8+ T cells, protocadherin-18
10 figures total
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
2
Abstract
Cancers are infiltrated with antitumor CD8+ T cells that arise during tumor growth, but
are defective in effector phase functions because of the suppressive microenvironment.
The reactivation of TILs can result in tumor destruction, showing that lytic dysfunction in
CD8+ tumor-infiltrating lymphocytes (TILs) permits tumor growth. Like all memory T cells,
TILs express inhibitory signaling receptors (aka checkpoint inhibitor molecules) that
downregulate TCR-mediated signal transduction upon TIL interaction with cells
expressing cognate ligands, thereby restricting cell activation and preventing the effector
phase. Previously we identified a novel murine CD8+ TIL inhibitory signaling receptor,
protocadherin-18, and showed that it interacts with p56lck kinase to abrogate proximal
TCR signaling. Here we show that TILs from mice deleted in protocadherin-18 had
enhanced antitumor activity and that co-blockade of PD-1 and protocadherin-18 in wild-
type mice significantly enhanced TIL effector phase function. These results define an
important role for protocadherin-18 in antitumor T-cell activity.
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
3
Introduction
Effective CD8+ antitumor T-cell responses require several stages of development and
activity: differentiation of antigen-specific cells, homing and entrance into tumor tissue,
recognition of MHC-restricted cognate peptide on tumor cells, and cytolytic function. Each
of these functional stages can be deficient or defective in cancer but the presence of
antigen-specific TILs in many types of tumors argues that antitumor T cells develop and
home (1). However, the tumor microenvironment is robustly immunosuppressive with
potential inhibitory contributions from many cells in the tumor: B cells, cancer-associated
fibroblasts, mast cells, myeloid-derived cells, pericytes, FoxP3+ regulatory T cells, or
vascular endothelia (2). Reversing inhibition in endogenous TILs (and in adoptively-
transferred antitumor T cells) is now recognized as a major therapeutic objective (3).
T cell activation results after T cell receptor (TCR) interaction with cognate antigen.
This generates a positive signal that is integrated with negative signals resulting from the
trans interaction of T-cell surface inhibitory signaling receptors (ISRs) with their cognate
ligands. ISRs, also known as co-inhibitory receptors or cell-surface immune-checkpoint
molecules, are widely expressed and regulate T-cell activation, differentiation,
homeostasis, and effector phase functions. In conditions of chronic antigen exposure and
inflammation, hyporesponsive T cells develop, which characterize latent infection or tumor
growth (4). Two ISRs, CTLA-4 (CD152) and PD-1 (CD274), have emerged as major
inhibitors of antitumor T-cell function. Monoclonal antibody (mAb)-based inhibition of
CTLA-4 or PD-1 activation (targeting either PD-1 or its ligand PD-L1) elicits potent
antitumor activity in various models and clinical trials, especially in treatment of human
tumors having strong inherent antigenicity (5). Although clinical results have been
dramatic (6), successes are limited to subsets of patients having certain tumor types,
suggesting that additional ISRs may be involved in the functional regulation of TILs in
human cancer (7). Supporting this notion, various other T cell ISR (8) such as BTLA,
LAG-3, TIGIT, TIM-3 or VISTA, have different cellular patterns of expression and are
being targeted in experimental mAb-based blockade mono- and combination therapy
trials (9).
Analysis of multiple ISRs that are simultaneously expressed on hyporesponsive T
cells shows that any individual ISR expressed can regulate cell function in vitro, implying
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
4
that, collectively, the repertoire of expressed ISR may function in an additive or
synergistic manner, especially in vivo (10). TILs can be nonlytic in vivo (1, 11, 12) and
express a variety of different ISRs (8) that restrict TIL functionality, leading to tumor
escape from immune killing. Because ISR expression in TILs is intrinsic to T-cell
differentiation and activation status (13-15), the availability of ISR ligands on cells within
the tumor determines if a given ISR is engaged and thus contributes to TIL effector phase
dysfunction (16). Multiple cell types within the tumor microenvironment can potentially
express ISR ligands—including vascular endothelia, tumor cells, myeloid components of
the stroma (DC, macrophages, and myeloid cells), and TILs themselves—making
regulation of TIL function by ISRs complex.
A role for protocadherin-18 (pcdh18) in T-cell function was identified through study of
the nonlytic phenotype of CD8+ TILs in a murine model of colon cancer, in which it was
discovered to interact with p56lck, thereby blocking proximal TCR signaling and cytolysis
(13, 17). Proximal TCR-mediated signaling (calcium flux) in purified TILs is intact if
assessed by activation in vitro with anti-CD3 (18) and TIL lytic function is restored upon
purification and brief culture in vitro (17), properties suggestive of ISR activity. As
opposed to other ISRs, pcdh18 is expressed in activated CD8+ memory T cells
(CD8+CD44+CD62L+CD127hi), is not expressed in B cells, NK cells, naive CD8+ T cells, or
primary CD8+ effector cells, and the kinetics of its transcriptional regulation upon TCR
ligation are that of an immediate-early response gene (13). The only known ligand for
pcdh18 is itself and it mediates homophilic binding (19). Here we show in a murine cancer
model that pcdh18 is a key regulator of antitumor CD8+ T-cell effector-phase function.
Methods
Animals
Wild-type C57BL/6 male mice were from Taconic (Hudson, NY). The pcdh18 gene-
deleted mouse (Pcdh18tm1(KOMP)Vlcg) was obtained from the Komp Repository Knockout
Mouse Project (# 14494, via Regeneron Pharmaceuticals, Tarrytown, NY).
Reagents
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
5
Doxycycline, puromycin, protein G-agarose, and polymyxin B-agarose were from Sigma
Aldrich (St. Louis, MO). Magnetic immunobeads for isolation of human (130-096-495) or
murine (130-049-401) T cells were from Miltenyi Biotec (San Diego, CA). Primary
antibodies for flow cytometry were from eBiosciences (San Diego, CA) and secondary
reagents (Alexa 647-, HRP-anti-rabbit Ig) from Jackson ImmunoResearch (West Grove,
PA, 111-625-144 and 111-035-144). Anti-TCR H57-597 was purified from hybridoma
conditioned medium using protein G-agarose. Rabbit Ab reactive to the cytoplasmic
domain of pcdh18 was produced using a Gst-fusion protein as immunogen as described
(13). Rabbit and mouse Abs reactive to the extracellular domain of pcdh18 (amino acids
37, Glu- 690, Ser) were produced using a His-tag protein expressed in CHO cells as
immunogen. The rabbit Ab was purified on Protein G-agarose and the murine serum used
as serum in passive transfer (see below). SIINFEKL-tetramer was from MBL International
(Woburn, MA). Anti-CD8 (clone 53.6.7) used for in vivo depletion was purified from
hybridoma conditioned medium using Protein G-agarose and was absorbed on Polymyxin
B-agarose before dialysis versus PBS. Anti-PD-1 Ab 29F.1A12 (the gift of G. Freeman,
Dana Farber, Cambridge, MA) or control Rat IgG2a (BioXCell, Lebanon, NH) were
similarly treated for potential LPS contamination.
MCA38 cells (obtained from N. Restifo, NIH, circa 1990) and RMA-S cells (from M.
Bevan, Univ. of Washington) were routinely tested for mycoplasma contamination
(MP0025-1KT, Sigma Aldrich, St. Louis, Mo).The cell lines have not been authenticated
by our lab and were cultured for < 10 passages before new stocks were thawed . Listeria
monocytogenes-ova, the gift of Eric Pamer (MSKCI, NY), was prepared and used as
described (13). Human Leukopaks were obtained from the New York Blood Center
(Queens, NY).
Pcdh18 shRNA virus
The pTRIPZ vector (Dharmacon/GE Lifesciences, Lafayette, CO) was used to express
candidate pcdh18 shRNAs. Candidate pcdh18 targets were:
ATGTCCTGGCTAAGAATCTGAA = 'a', CACCAAGCCTCTCCTCAGTGAG = 'b',
CGCCACTCCTGCTGTTGAGGTC = 'c', and scrambled control
GACTAGTCTTACGATACATGCA. Recombinant vectors were sequenced to confirm
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
6
insert sequences. Virus was produced in HEK293 cells, concentrated by centrifugation,
and used for infection in the presence of Polybrene. Vectors containing TurboGFP (and
separately lacking GFP) were produced and were titered on HEK293 cells. Knockdown in
MCA38 cells used an MOI of 1.
Flow cytometry and cell sorting
MCA38 cells were fixed and permeabilized (eBiosciences, 88-8824) before labeling with
rabbit anti-pcdh18, or control rabbit Ig, which was detected using PE-conjugated goat-
anti-rabbit IgG. Human CD8+ memory T cells were isolated after Ficoll purification of
PBMC followed by FACS isolation using antibodies to CD8, CD44, CD27, and CD45RO
(eBiosciences). TILs were isolated by magnetic immunobeading (Miltenyi Corp, San
Diego, CA).
Tumor formation
Wild-type MCA38 cells or MCA38 cells transduced with either virus encoding shRNA
'pcdh18b' or control virus, both lacking GFP, were injected ip or sc into 6-8 week male
mice and observed for 15 weeks or until sacrifice was required. Mice received
doxycycline in drinking water (50 g/mL) as indicated. Subcutaneous tumors were
measured with calipers and volume was calculated as: (W2 x L)/2). P values for group
comparisons of tumor growth were calculated using the two-tailed nonparametric Mann-
Whitney (GraphPad Prism 5.0).
Antibody treatment of mice
Five or 10 days after seeding of tumor as indicated, mice received ip injections of 0.2 mg
of purified anti–PD-1 Ab 29F.1A12 or control Rat IgG2a (in PBS), or 0.05 mL mouse anti-
pcdh18 sera (or control sera) twice per week. MCA38 tumors were initiated sc and on day
10 mice received control Ig, anti-PD-1, anti-pcdh18 or both. Data are representative of
two independent experiments (n = 5 per group). For the experiment shown in Fig. 4,
comparison of average tumor size at 4 weeks of growth for treatment starting at day 5 is
P < 0.001 (wild-type average size was 0.78 cm3 and pcdh18–/– is 0.21 cm3). Murine anti-
pcdh18 serum was prepared by immunization of pcdh18–/– mice with recombinant pcdh18
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
7
extracellular domain (amino acids 39-690). Immunized mice were bled and pooled sera
was used for passive transfer.
MCA38 cell growth in vitro
MCA38 cells (2.5 x 104) infected with 'pcdh18b' or control lentivirus were plated in
triplicate in 48-well plates in the presence of doxycycline (0.001 mg/mL) and were
enumerated after trypan blue staining.
Tumor infiltrating lymphocyte preparation
TILs were prepared from either 5 (for use as effector cells in in vitro killing assays) or 10-
15 pooled tumors (for RNAseq analyses) per experiment by magnetic immunobeading as
described (13, 17). For Nanostring and RNAseq analyses, after enrichment by magnetic
immunobeading, TILs were stained with anti-CD8 and anti-TCR and purified by FACS
before purification of RNA. For assay of IFN production, 10 tumors were pooled to purify
TILs. Quadruplicate wells (2 x 105 cells/) were stimulated in vitro (for 36 h using plate-
bound anti-TCR) before assay of supernatants by ELISA (eBioscience, # 88-8314-88,
minimum sensitivity= 0.7 pg/mL).
Cytotoxicity assay.
Target cell killing was assessed (using freshly-isolated TILs or TILs that were cultured in
complete RPMI-1640 medium overnight) by MTT assay (Sigma-Aldrich) in quadruplicate
wells for each E:T ratio. Targets were either MCA38 tumor or RMA-S cells (pulsed with
SIINFEKL or control Kb binding peptide for 2 h at 26°). For determination of lytic
efficiency, maximal target cell lysis was calculated after treating target cells with 1% Triton
X-100 and used the formula: % cytotoxicity = (experimental- spontaneous
release)/(maximal release- spontaneous release) X 100.
TIL immune cell profiling
Wild-type mice were reconstituted with bone marrow from congenic pcdh18–/– mice
(Thy1.2) and MCA38 tumors developed. CD8+ TILs were combined from 5 individual
mice, then FACS-purified (by Thy1 expression) before RNA isolation and analysis by
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
8
Nanostring Pancancer Immune Cell profiling (Nanostring Technologies, Seattle, WA)
performed by the NYU School of Medicine Genome Technology Center.
MCA38 TIL were purified (combining 10 pooled tumors grown in WT mice) by
magnetic immunobeading and FACS, RNA was prepared, converted to cDNA and used
and analyzed by gene array (13) or RNAseq. RNAseq was performed on two
independent biological replicates of TIL (n = 6 and 10 pooled tumors each) isolated by
magnetic immunobeading followed by FACS.
Immunocytochemistry of human LN
Anonymized normal LN samples were de-parafinized and reacted with rabbit anti–pcdh-
18 (1:3,000) that was detected with HRP-conjugated donkey-anti-rabbit and amplified with
biotin/tyramide (Sigma-Aldrich, St. Louis, MO) and Alexa 594 Streptavidin essentially as
described (20). Samples were also labeled with mouse anti-CD8 (1:300) that was
detected with donkey-anti-mouse Alexa 488. Two individual LN were analyzed and 5
microscopic fields were counted for each sample which were scored by a blinded
observer.
Checkpoint inhibitor blockade of human T cells in vitro
PBMC were prepared by Ficoll gradient from a single donor (1.21 x 109 total cells) and
used to isolate CD8+ T cells by magnetic immunobeading. Total CD8+ cells were isolated
by negative selection ('untouched'), then CD45RA+ cells by positive selection (naïve).
CD45RO+ cells (memory) were then used to isolate Cm by positive selection (CD27+) and
Em (CD27–, 'untouched'). Cells were plated in triplicate in round-bottom wells using 96
well plates (22 x 103 cells/well) with or without blocking or control Ab (10 g/mL) as
indicated.
Results
Blockade of pcdh18 ligand expression in tumor targets restores TIL lytic function.
Pcdh18 is expressed in dysfunctional MCA38 TILs, within which it interacts with
p56lck. It is postulated to play a functional role in the lack of cytolytic activity of MCA38-
infiltrating T cells recovered from MCA38 tumor-bearing mice (13). The transiently
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
9
blocked proximal TCR-mediated signaling in these TILs is coincident with the tumor-
induced defect in cytotoxicity (21). Because pcdh18 binds to itself in a trans fashion (20),
and the inhibition of TIL lytic function by contact with cognate tumor cells implies a
reversible activation switch reminiscent of ISR interactions with their cognate ligands (17),
we examined the activation of TIL pcdh18 when cognate tumor cells had expression of
pcdh18 knocked down (22). We tested three shRNAs for their abilities to downregulate
pcdh18 expression in the cognate tumor cells that were used as targets for in vitro
cytolysis assays (Fig. 1). Expression of target sequence 'b' in MCA38 reduced pcdh18
mRNA 94% compared to controls (Fig. 1A), and pcdh18 protein was undetectable in
those tumor cells (Fig. 1B). As has been observed in almost every tumor model (16, 23),
freshly-isolated ('nonlytic') TILs lacked lytic function against MCA38 that express pcdh18
(Fig. 1C, solid blue tracing), but after purification and brief culture of the TILs, cytolysis
was restored (solid red tracing). In contrast, cognate MCA38 with pcdh18 knocked down
due to expression of shRNA were efficiently killed, even by freshly-isolated TILs (broken
blue tracing). (The robust lytic function of 'fresh' TILs was more pronounced than for TILs
after brief in vitro culture ('recovery'), possibly because many TILs are effete immediately
after the in vitro 'recovery' period, as suggested by higher annexin-V binding compared to
freshly-isolated TILs (24). The expression of pcdh18 on tumor cells was thus necessary to
engage pcdh18 on TILs and initiate its inhibitory function.
In the L. monocytogenes-OVA infection model, antigen-specific CD8+ T cells
accumulate in nonlymphoid tissue long after the infection is cleared, and these cells
resemble TILs in terms of cell surface expression of memory markers (25). However,
tissue-resident anti–L. monocytogenesOVA T cells are cytolytic immediately upon isolation
[as assessed by lytic activity towards OVA-expressing or SIINFEKL-pulsed RMA-S cells,
(25, 26))], whereas TILs are not (18). Thus, we asked if the tumor microenvironment
might induce defective effector-phase function in anti–L. monocytogenes T cells that
infiltrate tumor tissue. Mice were infected with L. monocytogenes-OVA at different times
relative to MCA38 tumor seeding (10 days prior, coincident, or 10 days after) and the lytic
function of CD8+ T cells isolated from tumor tissue after 20 days of growth was
determined (Fig. 1D). The time of infection relative to tumor seeding did not affect the
anti–L. monocytogenes-OVA response. CD8+ T cells had no lytic activity towards cognate
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
10
MCA38 tumor cells (red tracings). The same population of T cells, however, had efficient
lytic activity towards RMA-S cells pulsed with SIINFEKL (solid black tracings), but not
target RMA-S cells pulsed with control peptide.This experiments shows that residence in
tumor tissue is not sufficient to induce either pcdh18 expression or lytic dysfunction . We
found that mice infected with L. monocytogenes-OVA developed antigen-specific T cells
that both expressed pcdh18 protein and were maintained more than 1 year after infection
(Supplementary Fig. S1).
Delay of tumor formation after pcdh18 knockdown in tumor.
Knockdown of pcdh18 in tumor cells did not affect either the in vitro growth of MCA38
cells (Fig. 2A) nor the incidence or growth rate of tumors in CD8–/– mice (Fig 2B).
However, tumor growth in wild-type mice was significantly delayed (Fig. 2C, P < 0.001),
indicating that antitumor growth control mediated by T cells was enhanced in the
absence of pcdh18 in the tumor. To evaluate the effects on tumor growth of T cells that
lack pcdh18, MCA38 tumors with normal expression of pcdh18 were grown in pcdh18–/–
mice (Fig. 2D). Similar to delay in tumor growth of tumor cells lacking pcdh18 in wild-type
mice (Fig 2C), MCA38 tumor growth in pcdh18–/– mice was significantly delayed
compared to wild-type mice, implying that TILs in pcdh18–/– mice have enhanced effector-
phase function.
pcdh18–/– TILs upregulate gene expression for a variety of immune functions.
Why tumor development in pcdh18–/– mice was only delayed and not obviated was
investigated by analysis of gene expression in TILs from pcdh18–/– mice. Bone marrow
from wild-type and pcdh18–/– mice was used to generate bone-marrow chimeras in Thy1
congenic mice. Wild-type and pcdh18–/– MCA38 TILs isolated from the same tumors were
analyzed by Nanostring Immune Cell profiling containing 562 targets (Fig. 3). The data is
displayed as the ratio of expression of a given gene in pcdh18–/– TILs compared to wild-
type TILs and showed pcdh18–/– TILs had significant upregulation of many immune
function genes including those involved in T-cell activation and signaling (e.g., CD2, CD3,
CD8, CD122, CD278, p56lck, Zap70, TCR), the effector phase (GrzA and B, Prf), and
chemokines and cytokine receptors (Cxcr6, Ccr7 and CD122, CD212, CD218, IL27R).
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
11
In addition, pcdh18–/– TILs robustly expressed genes associated with negative functional
regulation (PD-1, NKG2a, CTLA-4, CD94, TIGIT, Sh2d1, CD5), most of which were
previously identified by gene array as expressed in nonlytic wild-type TILs
(Supplementary Fig. S2).
Blockade of PD-1 in pcdh18–/– mice enhanced antitumor TIL function.
Because expression of PD-1 is both highly expressed in wild-type TILs (13) and
significantly upregulated in pcdh18–/– TILs, analysis of the major PD-1 ligand (PD-L1) in
MCA38 tumor cells was assessed by flow cytometry (Fig. 4A, top). Cultured MCA38 cells
uniformly expressed little PD-L1, but exposure to IFN induced expression. In vivo more
host stromal cells expressed PD-L1 compared to tumor cells at early in tumor growth, but
at later times when the percentage of tumor cells within the tumor tissue increased, tumor
cell expression became dominant (Fig. 4A, bottom). PD-L1 expression following
inflammation in MCA38 tumor has been observed (27).
The finding that primary MCA38 tumors upregulate PD-L1 expression as a function of
time of growth prompted analysis of tumor growth in mice treated with PD-1 blockade (Fig
4B). Ab-mediated PD-1 blockade in wild-type mice significantly delayed growth of early
stage tumors (P < 0.001 on day 5, Fig 4B, top, solid lines), an effect that was diminished if
treatment was initiated after 10 days of tumor growth (dashed lines). Anti-PD-1 blockade
in pcdh18–/– mice inhibited tumor growth, even if treatment was delayed, and this effect
was more pronounced than in wild-type mice (Fig 4B, bottom). The average time to reach
half-maximal tumor size (~0.6 cm3) in wild-type mice treated with anti–PD-1 was 3 to 4
weeks but in pcdh18–/– mice is 5 to 6 weeks. A similar effect was noted in mice deleted for
the LAG-3 ISR (28).
An essential role for CD8+ T cells in mediating the delay of tumor growth following
anti–PD-1 blockade was assessed by depleting T cells in both wild-type and pcdh18–/–
mice (Fig 4c). Tumor volume was measured at 25 days of growth and showed both an
essential role for CD8+ T cells and an additive benefit of PD-1 blockade in pcdh18–/– mice
compared to PD-1 blockade in wild-type mice (average tumor volume ~0.1 cm3 versus ~
0.28 cm3, respectively).
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
12
The phenotype of TILs isolated from MCA38 tumors grown in wild-type and pcdh18–/–
mice was assessed by determination of IFN production upon isolation (at 26 days of
growth) and activation in vitro (Fig 4D). Following PD-1 blockade, TILs from wild-type
mice produced IFN immediately after isolation and pcdh18–/– TILs produced slightly more
IFN. The highest IFN secretion was seen in TILs from pcdh18–/– mice that were also
treated with anti–PD-1, an observation that is in keeping with those mice having the
smallest tumors (Fig 4C).
Antibody blockade of pcdh18 enhances anti–PD-1 tumor therapy in wild-type mice
Ab-mediated PD-1 blockade in wild-type mice delayed tumor growth (Fig 4B, top), an
effect that was enhanced in pcdh18–/– mice (Fig 4B, bottom), which we interpret to mean
that activity of both PD-1 and pcdh18 restrains CD8+ TILs function. To test the effect of
simultaneous blockade of PD-1 and pcdh18 on tumor growth, murine anti-pcdh18 serum
reactive with recombinant extracellular domain of pcdh18 was developed and was tested
for effect on tumor growth by passive transfer of sera (Supplementary Figs. S4 and S5).
Control mice developed tumors with characteristic kinetics (detectable at 6-7 days),
treatment with anti-pcdh18 slightly but consistently delayed growth, and anti–PD-1 was
more effective at tumor inhibition than anti-pcdh18. Control mice developed tumors with
characteristic kinetics (detectable at 6-7 days), treatment with anti-pcdh18 slightly but
consistently delayed growth, and anti–PD-1 was more effective at tumor inhibition than
anti-pcdh18. Consistent with the observations that anti–PD-1 treatment is more effective
in pcdh18–/– mice compared to wild-type mice (Fig. 4B), combined antibody therapy was
dramatically more effective than either monotherapy.
Pcdh18 expressed in human memory T cells mediated AICD and IFN secretion.
The expression of pcdh18 in human T cells was examined by immunocytochemistry
analysis of human LN (Fig. 5A). Regions containing CD8+ or CD4+ T cells showed less
abundant, but coincident, pcdh18 staining in a subset of T cells, ~ 5% of each single
positive cell type compared to single staining of CD8 or CD4 cells. We further analyzed
pcdh18 expression in freshly-isolated CD8+ memory T cells FACS-purified from normal
donor PBMC (Fig. 5B) wherein effector-memory CD8+ cells (CD44+CD45RO+CD27–)
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
13
were shown to contain pcdh18 protein. Expression of pcdh18 in the Em1 (CD44+CD27–
CD45RO–) subpopulation of CD8+ memory cells was especially strong, given that the
immunoblot signal was obtained from only 1.4 x 105 cells, whereas it is a minor fraction of
total CD8+ T cells in the peripheral blood. These analyses corroborated our previous
findings in mice that show CD8+ effector memory T cells, but not naive cells, express
pcdh18 (13) and extend those findings, in that pcdh18 was also found in memory CD4+ T
cells. Similar to mouse (13), human CD8+ human central memory T cells (CD27+, 'Cm')
expressed pcdh18 protein after in vitro activation coincident with conversion to CD27–
effector memory cells (Supplementary Fig. S6).
The role of pcdh18 in effector-phase functions of human memory T cells was
examined (Fig. 5C). Similar to the phenotype of TILs (24) and primary murine lytic effector
cells transfected to express pcdh18 (13), in vitro activation of purified pcdh18+ effector-
memory CD8+ T cells resulted in AICD, but inclusion of anti-pcdh18 enhanced viability
and cell recovery and had a slightly additive effect in conjunction with blocking anti–PD-1.
Checkpoint inhibitor blockade also enhanced effector phase function of activated primary
human CD8+CD27– memory T cells in that IFN secretion was dramatically increased
(Fig. 5D).
Discussion
Activation of T cells results from integration of a positive signal, generated by TCR
recognition of cognate antigen, with a negative signal, generated by interaction of ISR
with cognate ligands that are expressed on the antigen-expressing cell with which the T
cell interacts (15). The relative balance of signals from these two opposing systems
results from the number of receptors interacting with their cognate ligands and influences
the T-cell activation threshold, thus determining the functional outcome. The lytic
dysfunction of the effector-phase that typifies CD8+ TILs (1) is mediated by intrinsic
expression of the ISRs characteristic of effector memory cells (13). Engagement by the
ISR ligands expressed in the tumor environment results in abrogation of proximal TCR
signaling. Analysis of the basis for defective TIL lytic function in the murine
adenocarcinoma MCA38 model showed that the lytic defect is manifested by a failure to
mobilize TIL lytic granules upon conjugation with cognate tumor cells (18, 29); is transient
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
14
in nature, being rapidly reversed upon purification (13, 18, 21); and is induced by TILs
contact with cognate tumor cells (21, 30). Biochemical assessment of TIL signal
transduction in the MCA38 model revealed that although proximal TCR-mediated
signaling is intact when assessed with a surrogate antigen (by anti-CD3 TCR ligation)
(18), when cognate tumor cells are used to stimulate TILs in vitro, Zap70 is not activated,
implicating defective p56lck activity (21). In nonlytic nonsignaling TILs, pcdh18 interacts
with p56lck and expression of pcdh18 in signaling-competent primary lytic effector CD8+ T
cells (that do not endogenously express pcdh18) induces the TIL phenotype: proximal
TCR signaling is blocked at Zap70 activation coincident with abrogation of lytic function
(13). These characteristics strongly supported pcdh18 being an inhibitory signaling
receptor in TILs, one whose expression is restricted to memory T cells (13), and
motivated the experiments reported in this work.
ISRs initiate inhibitory signaling after binding to cognate ligand in trans (31), so we
determined the effect of silencing pcdh18 ligand expression in cognate tumor cells upon
TIL lytic response, and found that the poor lytic ability of freshly-isolated TILs could be
overcome with the use of tumor targets lacking pcdh18, showing that pcdh18 acted like
an ISR. The growth of MCA38 tumors lacking pcdh18 was significantly delayed, as was
the growth of wild-type MCA38 in pcdh18–/– mice, corroborated the in vitro data. These
experiments show that pcdh18 interaction with ligand initiated TIL functional deficiency.
Comparison of pcdh18–/– to wild-type TILs showed changes in the expression of
genes involved in the antitumor T-cell immune response, including genes encoding
inhibitory signaling receptors (e.g. PD-1). Nonetheless, effector-phase functions were also
increased in pcdh18–/– TILs as shown by enhanced tumor clearance, which was
correlated with increased expression of GrzB and IFN.
MCA38 TILs in wild-type mice are CD62lo (24), defining them as effector-memory T
cells, and clearly contain pcdh18 protein [which was the basis for its identification (13,
17)], thus it was interesting to note that RNA encoding pcdh18 was not robustly
expressed in freshly-isolated pcdh18–/– TILs. CD8+ memory T cells express pcdh18 RNA
(13) and upon activation, as CD62Lhi central-memory cells convert to CD62Llo effector-
memory cells, similar to the kinetics of activation of immediate-early response genes,
pcdh18 mRNA is rapidly upregulated following activation, but is quickly terminated and
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
15
degraded (13). This is likely the reason why prior RNA analysis of memory T cells failed
to detect pcdh18 expression (32). Rapid loss of pcdh18 RNA after activation shows that
dependency on RNA expression data for evaluation of involvement of a given candidate
ISR in T cell function need be corroborated with protein expression analyses.
Pcdh18 is highly expressed in embryonic brain, where it functions as a patterning
receptor (33), localizes to the to the neuronal synapse (34), and interacts with the brain
src homolog p59fyn (35). It is also expressed in various adult tissues (36), but until our
initial report (13) was not known to be expressed in the immune system. In the
hematopoietic system expression was restricted to the T cell lineage, including CD4+ T
cells, but only following differentiation to the memory state. Since pcdh18 was expressed
only in memory cells (and dendritic cells), pcdh18 appears to play an adjunct role in
regulation of the effector phase, in contrast to other IRS (e.g., PD-1) which are also
expressed in naive cells. Thus, we consider the function of pcdh18 to modify or sculpt the
effector phase, depending upon the expression of its ligand (itself) in tumor cells. Since
multiple ISRs are co-expressed in antitumor T cells (37), it seems reasonable to propose
that inhibition of pcdh18 in conjunction with other target ISRs like PD-1 may find utility in
experimental therapy of cancer. In this regard, we note that inspection of the cBioPortal
database shows amplification of pcdh18 ligand in a few cancer types (breast, prostate,
desmoplastic small-round-cell tumors), wherein it seems reasonable to predict anti-
pcdh18 intervention may be impactful (38).
ISRs, typified by PD-1, often function to raise the threshold of immune cell activation
by recruiting inhibitory phosphatases Shp-1 or Shp-2 (encoded by Ptpn6 and Ptpn11,
respectively) from the cytoplasm into proximity with components of the antigen receptor
wherein molecules important in signal transduction are inactivated by dephosphorylation
(39). Thus, because pcdh18 binds directly to p56lck (13), it differs mechanistically from
most ISRs and may represent a novel class of ISR that functions by direct interaction with
key enzymes in the proximal TCR signaling pathway, a class which may include other
src-binding proteins LIME, Sit, and TSAd. In this regard it is of interest that mRNA for all
three of these src-binding proteins are expressed at high levels in nonlytic TILs (13).
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
16
Acknowledgements
I am endebted to the many persons who materially contributed to this project: Adam
Blasidell, Rachel Brody, Jeremy Burns, Luis Chiriboga, Devon Columbus, Adrian
Erlebacher, Adriana Heguy, Tim Hemesath, Mythili Koneru, Ngozi Monu, Sasa Radoja,
Mohini Ragasagi, David Schaer, Sergio Trombetta, Alejandro Ulloa, Claire Vanpouille-
Box, Edwin Vazquez-Cintron.
Figures and figure legends
Figure 1. Inhibition of pcdh18 expression in MCA38 tumor cells enabled TIL killing
in vitro. A. 48 h after infection with lentiviruses expressing shRNA, MCA38 cells were
analyzed by qRT-PCR. Data shown is the average of 3 separate transductions. B. MCA38
infected with shRNA 'pcdh18b' lentivirus were analyzed by flow cytometry for pcdh18
expression C. Nonlytic (freshly-isolated) or lytic (overnight culture) MCA38 TILs were used
as effector cells and MCA38 tumor cells expressed either control or pcdh18 shRNA as
indicated. D. Freshly-isolated TILs from mice infected with Listeria monocytogenes-OVA for
the indicated times were assessed for lytic function using either cognate MCA38 tumor
(red tracings), SIINFEKL-pulsed RMA-S cells as targets (solid tracings), or RMA-S cells
pulsed with control peptide (dashed tracings).
Figure 2. Tumor formation after pcdh18 knockdown in MCA38 was delayed. A.
MCA38 cells infected with pcdh18b shRNA or control lentivirus were plated for the
indicated times and enumerated. B, CD8–/– mice (n = 10 per group), or C, wild-type mice
(n = 10 per group), were injected subcutaneously with MCA38 cells (2 x 105) transduced
with pcdh18b shRNA (solid line) or control lentivirus (dashed line) and tumor size
measured over time. Mice received doxycycline in drinking water. In C, P < 0.01 (student
t test) for average group tumor volume at week 5. D. Wild-type or pcdh18–/– mice were
injected ip with 2 x 105 MCA38 cells (n = 40 per group, P < 0.001, Gehan-Breslow-
Wilcoxon, GraphPad Prism).
Figure 3. Expression of immune cell molecules in wild-type and pcdh8–/– TILs.
Congenic mice were reconstituted with bone marrow from pcdh18–/–mice and MCA38
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
17
tumors developed (n = 5). CD8+ TILs were analyzed by Nanostring Pancancer
Immune Cell Profiling. Data is shown as expression in pcdh18–/– TILs (Thy1.2)
relative to wild-type (Thy1.1) TILs.
Figure 4. Involvement of PD-1 in regulation of TIL function in pcdh18–/– mice. A.
MCA38 cells were treated with IFN for 4 (green),12 (blue), or 24 (red tracings) h and
analyzed for PD-L1 expression (top). MCA38 tumors were seeded in congenic mice and
PD-L1 expression in Thy1.2+ tumor and Thy1.1+ stromal cells analyzed by flow cytometry
(bottom). B. Effect of anti–PD-1 (given on day 5 -solid lines or day 10 -dashed lines) on
tumor growth in wild-type (top panel) or pcdh18–/– mice (bottom panel). Data are
representative of two independent experiments (n = 5 per group). Comparison of average
tumor size at 4 weeks of growth for treatment starting at Day 5 is P < 0.001 (wild-type
average size was 0.78 cm3 and pcdh18–/– is 0.21 cm3). C. SC MCA38 tumors were
developed and mice received anti-CD8 (or control Ig) on day 5, 10, and 15 or anti–PD-1
starting on day 10. Tumor volumes in mice were determined 25 days after tumor injection.
Data are representative of two independent experiments (n = 5 per group). **, P < .001
compared to mice receiving no Ab. D. TILs were isolated from tumors of mice that did NOT
receive anti-CD8 (in panel C) and IFN production determined 26 days after tumor
injection. *, P < .01; **, P < .001 compared to WT mice.
Figure 5. Pcdh18 expression in human CD8+ and CD4+ T cells. A. Normal human LN
(n = 2, 5 consecutive sections/LN) were stained with anti-pcdh18 (red) and anti-CD8 or
anti-CD4 (green). Sections were scored for the ratio of pcdh18+ cells detected in the CD8+
or CD4+ T cell populations, as “# pcdh18+CD8+ T cells/ # CD8+ T cells" and “# of
pcdh18+CD4+ cells /# of CD4+ T cells". The percent of “double positive cells” was
calculated for each sample. Arrows indicate double-positive cells (CD4 or CD8 plus
pcdh18). B. Human CD8+ T cells from two pooled donors ('Leukopack') by collection of
PBMC on Ficoll, enrichment of CD8+ T cells by magnetic immunobead negative selection,
and FACS as described in 'Methods'. Cells were lysed in SDS-PAGE sample buffer before
immunoblot analysis of equal number of cell equivalents (1.4 x 105/lane). C. Primary
human CD8+CD45RO+CD27– effector memory (Em) T cells were isolated and stimulated
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
18
with OKT3 (2ug/mL) with or without a rabbit IgG anti-pcdh18, anti-PD-1, or control IgG of
appropriate species. Cell number data (C) is representative of three experiments.
Supernatants of cells in C were collected for IFN ELISA (in D) and is representative of
two experiments.
Citations
1 Radoja, S. and A. B. Frey. Cancer-induced defective cytotoxic T lymphocyte effector function: another mechanism how antigenic tumors escape immune-mediated killing. Mol Med 2000:6:465-79. 2 Frey, A. B. Suppression of T cell responses in the tumor microenvironment. Vaccine 2015. 3 Hanahan, D. and L. M. Coussens. Accessories to the crime: functions of cells recruited to the tumor microenvironment. Cancer Cell 2012:21:309-22. 4 Wherry, E. J. T cell exhaustion. Nat Immunol 2011:12:492-9. 5 Chen, D. S. and I. Mellman. Oncology meets immunology: the cancer-immunity cycle. Immunity 2013:39:1-10. 6 Sharma, P. and J. P. Allison. The future of immune checkpoint therapy. Science 2015:348:56-61. 7 Pitt, J. M., M. Vetizou, R. Daillere, M. P. Roberti, T. Yamazaki, B. Routy, P. Lepage, I. G. Boneca, M. Chamaillard, G. Kroemer and L. Zitvogel. Resistance Mechanisms to Immune-Checkpoint Blockade in Cancer: Tumor-Intrinsic and -Extrinsic Factors. Immunity 2016:44:1255-69. 8 Vazquez-Cintron, E. J., N. R. Monu and A. B. Frey. Tumor-induced disruption of proximal TCR-mediated signal transduction in tumor-infiltrating CD8+ lymphocytes inactivates antitumor effector phase. J Immunol 2010:185:7133-40. 9 Topalian, S. L., J. D. Wolchok, T. A. Chan, I. Mellman, K. Palucka, J. Banchereau, S. A. Rosenberg and K. Dane Wittrup. Immunotherapy: The path to win the war on cancer? Cell 2015:161:185-6. 10 Pauken, K. E. and E. J. Wherry. Overcoming T cell exhaustion in infection and cancer. Trends Immunol 2015:36:265-76. 11 Frey, A. B. and N. Monu. Signaling defects in anti-tumor T cells. Immunol Rev 2008:222:192-205.
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
19
12 Schietinger, A., M. Philip, V. E. Krisnawan, E. Y. Chiu, J. J. Delrow, R. S. Basom, P. Lauer, D. G. Brockstedt, S. E. Knoblaugh, G. J. Hammerling, T. D. Schell, N. Garbi and P. D. Greenberg. Tumor-Specific T Cell Dysfunction Is a Dynamic Antigen-Driven Differentiation Program Initiated Early during Tumorigenesis. Immunity 2016:45:389-401. 13 Vazquez-Cintron, E. J., N. R. Monu, J. C. Burns, R. Blum, G. Chen, P. Lopez, J. Ma, S. Radoja and A. B. Frey. Protocadherin-18 is a novel differentiation marker and an inhibitory signaling receptor for CD8(+) effector memory T cells. PLoS ONE 2012:7:e36101. 14 Pardoll, D. M. The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer 2012:12:252-64. 15 Chen, L. and D. B. Flies. Molecular mechanisms of T cell co-stimulation and co-inhibition. Nat Rev Immunol 2013:13:227-42. 16 Frey, A. B. Suppression of T cell responses in the tumor microenvironment. Vaccine 2015:33:7393-400. 17 Monu, N. and A. B. Frey. Suppression of proximal T cell receptor signaling and lytic function in CD8+ tumor-infiltrating T cells. Cancer Res 2007:67:11447-54. 18 Radoja, S., M. Saio, D. Schaer, M. Koneru, S. Vukmanovic and A. B. Frey. CD8(+) tumor-infiltrating T cells are deficient in perforin-mediated cytolytic activity due to defective microtubule-organizing center mobilization and lytic granule exocytosis. J Immunol 2001:167:5042-51. 19 Thu, C. A., W. V. Chen, R. Rubinstein, M. Chevee, H. N. Wolcott, K. O. Felsovalyi, J. C. Tapia, L. Shapiro, B. Honig and T. Maniatis. Single-cell identity generated by combinatorial homophilic interactions between alpha, beta, and gamma protocadherins. Cell 2014:158:1045-59. 20 Blaisdell, A., A. Crequer, D. Columbus, T. Daikoku, K. Mittal, S. K. Dey and A. Erlebacher. Neutrophils Oppose Uterine Epithelial Carcinogenesis via Debridement of Hypoxic Tumor Cells. Cancer Cell 2015:28:785-99. 21 Koneru, M., D. Schaer, N. Monu, A. Ayala and A. B. Frey. Defective proximal TCR signaling inhibits CD8+ tumor-infiltrating lymphocyte lytic function. J Immunol 2005:174:1830-40. 22 Chen, W. V. and T. Maniatis. Clustered protocadherins. Development 2013:140:3297-302. 23 Frey, A. B. (2008). Cancer-induced signaling defects in antitumor T cells. Mechanisms of tumor immue suppression. A. a. Hurwitz and D. I. Gabrilovich. New York, Springer: 69-100.
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
20
24 Radoja, S., M. Saio and A. B. Frey. CD8+ tumor-infiltrating lymphocytes are primed for Fas-mediated activation-induced cell death but are not apoptotic in situ. J Immunol 2001:166:6074-83. 25 Masopust, D., V. Vezys, A. L. Marzo and L. Lefrancois. Preferential localization of effector memory cells in nonlymphoid tissue. Science 2001:291:2413-7. 26 Masopust, D., V. Vezys, E. J. Usherwood, L. S. Cauley, S. Olson, A. L. Marzo, R. L. Ward, D. L. Woodland and L. Lefrancois. Activated primary and memory CD8 T cells migrate to nonlymphoid tissues regardless of site of activation or tissue of origin. J Immunol 2004:172:4875-82. 27 Terawaki, S., S. Chikuma, S. Shibayama, T. Hayashi, T. Yoshida, T. Okazaki and T. Honjo. IFN-alpha directly promotes programmed cell death-1 transcription and limits the duration of T cell-mediated immunity. J Immunol 2011:186:2772-9. 28 Woo, S. R., M. E. Turnis, M. V. Goldberg, J. Bankoti, M. Selby, C. J. Nirschl, M. L. Bettini, D. M. Gravano, P. Vogel, C. L. Liu, S. Tangsombatvisit, J. F. Grosso, G. Netto, M. P. Smeltzer, A. Chaux, P. J. Utz, C. J. Workman, D. M. Pardoll, A. J. Korman, C. G. Drake and D. A. Vignali. Immune inhibitory molecules LAG-3 and PD-1 synergistically regulate T-cell function to promote tumoral immune escape. Cancer Res 2012:72:917-27. 29 Bronte, V., T. Kasic, G. Gri, K. Gallana, G. Borsellino, I. Marigo, L. Battistini, M. Iafrate, T. Prayer-Galetti, F. Pagano and A. Viola. Boosting antitumor responses of T lymphocytes infiltrating human prostate cancers. J Exp Med 2005:201:1257-68. 30 Koneru, M., N. Monu, D. Schaer, J. Barletta and A. B. Frey. Defective adhesion in tumor infiltrating CD8+ T cells. J Immunol 2006:176:6103-11. 31 Greenwald, R. J., G. J. Freeman and A. H. Sharpe. The B7 family revisited. Annu Rev Immunol 2005:23:515-48. 32 Wherry, E. J., S. J. Ha, S. M. Kaech, W. N. Haining, S. Sarkar, V. Kalia, S. Subramaniam, J. N. Blattman, D. L. Barber and R. Ahmed. Molecular signature of CD8+ T cell exhaustion during chronic viral infection. Immunity 2007:27:670-84. 33 Shapiro, L. and D. R. Colman. The diversity of cadherins and implications for a synaptic adhesive code in the CNS. Neuron 1999:23:427-30. 34 Dustin, M. L. and D. R. Colman. Neural and immunological synaptic relations. Science 2002:298:785-9. 35 Homayouni, R., D. S. Rice and T. Curran. Disabled-1 interacts with a novel developmentally regulated protocadherin. Biochem Biophys Res Commun 2001:289:539-47.
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
21
36 Kim, S. Y., S. Yasuda, H. Tanaka, K. Yamagata and H. Kim. Non-clustered protocadherin. Cell Adh Migr 2011:5:97-105. 37 Blackburn, S. D., H. Shin, W. N. Haining, T. Zou, C. J. Workman, A. Polley, M. R. Betts, G. J. Freeman, D. A. Vignali and E. J. Wherry. Coregulation of CD8+ T cell exhaustion by multiple inhibitory receptors during chronic viral infection. Nat Immunol 2009:10:29-37. 38 cBioPortal1. http://www.cbioportal.org/cross_cancer.do?cancer_study_list=&cancer_study_id=all&data_priority=0&case_ids=&patient_case_select=sample&gene_set_choice=user-defined-list&gene_list=PCDH18. 2017. 39 Paling, N. R. and M. J. Welham. Role of the protein tyrosine phosphatase SHP-1 (Src homology phosphatase-1) in the regulation of interleukin-3-induced survival, proliferation and signalling. Biochem J 2002:368:885-94.
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Figure 1on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Figure 2on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Figure 3 on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Figure 4on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Figure 5on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187
Published OnlineFirst September 5, 2017.Cancer Immunol Res Alan B. Frey tumor infiltrating CD8+ T cell functionThe inhibitory signaling receptor protocadherin-18 regulates
Updated version
10.1158/2326-6066.CIR-17-0187doi:
Access the most recent version of this article at:
Material
Supplementary
http://cancerimmunolres.aacrjournals.org/content/suppl/2017/09/02/2326-6066.CIR-17-0187.DC1
Access the most recent supplemental material at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerimmunolres.aacrjournals.org/content/early/2017/09/02/2326-6066.CIR-17-0187To request permission to re-use all or part of this article, use this link
on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187