Embed Size (px)
Citation preview
The Integration of Metabolite and Hormone Signalling
Drives Seedling Development
by
Michael Stokes
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Cell & Systems Biology
University of Toronto
©Copyright by Michael Stokes
ii
The Integration of Metabolite and Hormone Signalling
Drives Seedling Development
Michael Stokes
Doctor of Philosophy
Department of Cell & Systems Biology, University of Toronto
2013
Abstract
Sugars have a profound impact on plant biology, acting as structural
components, signalling molecules, and sources of energy. As such, the
availability of sugars has important implications for plant growth and
development. Sugar levels rise and fall as part of a daily cycle, while cues
from other environmental stimuli are also in flux. As sessile organisms in an
ever-changing environment, plants must integrate signals from multiple
pathways in order to promote the appropriate developmental responses.
To uncover pathways that interact with sugars during seedling
development, a chemical screen was performed in search of compounds
that modify responses to sucrose. This screen identified an interaction
between the folate inhibitor sulfamethoxazole (SMX) and sucrose that
resulted in changes to auxin signalling and distribution. Synergy between
sucrose and SMX was used to explore the effect of metabolic cues on
iii
auxin signalling during hypocotyl elongation.
A second line of investigation explored whether sucrose and folates
influence root meristem activity. Sucrose induced hormone signalling
pathways that promote cell division and differentiation. Treatment with SMX
perturbed the effect of sucrose on hormone networks that mediate growth,
and resulted in a loss of meristem integrity. This study highlights the
influence of metabolism on hormone signalling at the root apex, and its role
in maintaining balance of a complex signalling network that drives root
growth.
These studies characterise an interaction between metabolic pathways that
is integrated with hormone signalling during plant development. Taken
together, they highlight a mechanism through which plant growth might be
regulated by metabolism.
iv
Acknowledgements
Firstly, I would like to thank my supervisor, Dr Malcolm Campbell, for his generous
support and guidance throughout the time I have spent in his lab. He has been a great
mentor, and I am grateful for having had to the opportunity to work with his group. I
would also like to thank Joan Ouellette, who has put in countless hours keeping the lab
running smoothly. Without her support over the years, this thesis would not have been
possible. I would also like to thank the members of my Advisory Committee, Dr Darrell
Desveaux and Dr Peter McCourt, for guiding my research efforts, their insight and
thoughtful advice is truly appreciated. Thank you to Dr Eiji Nambara and Dr Philip
Benfey, who have devoted their valuable time to review my thesis and take part in my
final defence.
I would like to acknowledge the guidance and friendship of my labmates, who have
helped with brainstorming new ideas, and then with troubleshooting. It has been great
working with you, especially Erin Hamanishi, Mike Prouse, Rohan Patel, Heather
Wheeler, and Joseph Skaf. Special thanks to the graduate students and postdocs in
other labs that have taken time to help me with protocols or to offer advice, especially Dr
Steven Chatfield, Dr Amy Lee, Dr Karl Schreiber and Dr Wenzi Ckurshumova.
I would like to thank my parents Kevin and Rose, and my sisters Adrienne and
Jacqueline, for their encouragement, love and support. Without them I would not be
here. I would like to thank my friends, especially Aarie Glas and Evan Mackenzie, who
offered comic relief at the times it was needed. Above all, I would like to thank Charlotte
Burke for her warmth, kindness, and understanding. Her love has made all the
difference.
v
Table of Contents
ACKNOWLEDGEMENTS ........................................................................... V
LIST OF ABBREVIATIONS ....................................................................... IX
LIST OF FIGURES .................................................................................. XIII
LIST OF TABLES ..................................................................................... XV
CHAPTER 1: INTRODUCTION .................................................................. 1
1.1 Sugars have a profound impact on plant development ...................................... 2
1.2 Sugar levels rise and fall throughout the day, with widespread
consequences .................................................................................................... 3
1.3 Sugars are perceived, resulting in changes to gene expression ........................ 5
1.4 Transcriptome analysis to uncover pathway interactions ................................... 7
1.5 Sugars and hormones ........................................................................................ 7
1.6 Sugars and auxin coordinate plant development ............................................... 8
1.7 Sugars impact the plant metabolome; metabolites can act as signalling..............
molecules that regulate gene expression ........................................................ 12
1.8 Folates effect plant development and productivity ........................................... 12
1.9 Chemical inhibition of THF biosynthesis as a tool for plant sciences ............... 16
1.10 Overcoming redundancy: chemical genetics .................................................... 18
1.11 Combination chemical genetics ........................................................................ 21
1.12 RESEARCH QUESTIONS AND HYPOTHESESError! Bookmark not
defined.22
CHAPTER 2: INTERPLAY BETWEEN SUCROSE AND FOLATE
MODULATES AUXIN SIGNALLING IN ARABIDOPSIS. .......................... 25
2.1 ABSTRACT ...................................................................................................... 25
2.2 INTRODUCTION .............................................................................................. 26
vi
2.3 RESULTS ......................................................................................................... 28
2.3.1 Sulfonamides alter seedling responses to sucrose ................................... 28
2.3.2 Sulfamethoxazole impinges on sucrose-mediated development through
inhibition of Dihydropteroate Synthase (DHPS) ........................................ 29
2.3.3 Changes in transcript abundance of specific auxin signal transduction
components occurs in response to the combined action of SMX and
sucrose ...................................................................................................... 34
2.3.4 Interaction between sucrose and SMX is dependent on auxin transport and
signal transduction .................................................................................... 40
2.3.5 Sucrose and SMX promote auxin signalling in vasculature tissues of the
hypocotyl ................................................................................................... 44
2.4 DISCUSSION ................................................................................................... 45
2.5 MATERIALS AND METHODS ......................................................................... 52
2.5.1 Plant material and growth conditions ......................................................... 52
2.5.2 Chemical screen........................................................................................ 52
2.5.3 Dose response curves and chemical treatments ....................................... 53
2.5.4 Tissue preparation, RNA extraction, and microarray analysis ................... 53
2.5.5 Quantitative RT-PCR ................................................................................. 55
2.5.6 Creation of GUS reporter constructs and histochemical analysis .............. 55
2.5.7 Confocal microscopy ................................................................................. 56
2.5.8 Auxin quantification ................................................................................... 57
2.6 ACKNOWLEDGEMENTS ................................................................................ 58
2.7 SUPPLEMENTAL MATERIAL .......................................................................... 59
CHAPTER 3: METABOLITE AND HORMONE SIGNALLING IS
INTEGRATED AT THE MERISTEM TO DRIVE ROOT GROWTH ........... 75
3.1 ABSTRACT ...................................................................................................... 75
3.2 INTRODUCTION .............................................................................................. 76
3.3 RESULTS ......................................................................................................... 80
3.3.1 Sulfamethoxazole inhibits the effect of sucrose on root elongation ........... 80
vii
3.3.2 Sucrose promotes auxin accumulation at the root tip, which is inhibited by
folate deprivation ....................................................................................... 80
3.3.3 PIN expression may underpin changes in auxin distribution caused by
sucrose and SMX ...................................................................................... 82
3.3.4 Folate deprivation causes ectopic cytokinin signalling .............................. 84
3.3.5 Folates are necessary for cell cycle progression in response to sucrose .. 88
3.3.6 Meristem development is promoted by sucrose and depndent on folates . 90
3.3.7 Phenotypic responses to SMX may be due to restricted cell division ........ 97
3.3.8 Stabilising IAA3/SHY2 signalling rescues meristem disruption ................. 99
3.4 DISCUSSION ................................................................................................. 102
3.5 CONCLUSION ............................................................................................... 107
3.6 MATERIALS AND METHODS ....................................................................... 107
3.6.1 Plant Material and Growth Conditions ..................................................... 107
3.6.2 Root elongation measurements .............................................................. 108
3.6.3 Histochemical assay of GUS reporter activity ......................................... 108
3.6.4 Quantitative real-time PCR (qPCR) ......................................................... 109
3.6.5 Confocal microscopy ............................................................................... 110
3.6.6 Root meristem measurements ................................................................ 110
CHAPTER 4: GENERAL CONCLUSIONS AND FUTURE DIRECTIONS
......................................................................................................... 111
4.1 GENERAL CONCLUSIONS ........................................................................... 112
4.2 FUTURE DIRECTIONS .................................................................................. 116
4.2.1 Exploring the role of other hormone signalling pathways in mediating
responses to sucrose and SMX at the meristem ..................................... 117
4.2.2 Exploring tissue-specific hormone signalling in response to sucrose and
SMX ........................................................................................................ 118
4.2.3 Assessing the oxidative state of the meristem ........................................ 119
4.2.4 Genetic screening to identify novel components of metabolite signalling 120
4.2.5 Uncovering regulators of shoot meristem responses to sucrose ............. 122
viii
CHAPTER 5: A NOVEL F-BOX THAT MEDIATES GALACTOSE
SENSITIVITY (APPENDIX) .................................................................... 128
5.1 INTRODUCTION ............................................................................................ 128
5.2 RESULTS AND DISCUSSION ....................................................................... 129
5.2.1 Galactose caused pleiotropic effects on seedling development .............. 129
5.2.2 Forward genetic screen identifies a galactose-insensitive mutant ........... 130
5.2.3 gim1 disrupts the activity of an F-box with galactose-oxidase activity ..... 132
5.3 FUTURE DIRECTIONS .................................................................................. 136
5.3.1 Confirming the Galactose oxidase and F-box activity of At4g39560 ....... 136
5.3.2 Uncoupling catalytic activity from signalling function ............................... 137
5.4 MATERIALS AND METHODS ....................................................................... 137
5.4.1 Plant materials and growth conditions ..................................................... 137
5.4.2 Microscopy and staining techniques ........................................................ 138
5.4.3 Lignin quantification ................................................................................. 139
6 LITERATURE CITED ....................................................................... 140
COPYRIGHT ACKNOWLEDGEMENTS ................................................. 158
ix
List of Abbreviations
% per cent µM micromolar µL microlitre
µg microgram
ºC degrees Centigrade ABA abscisic acid ABF Auxin-binding F-box ABRC Arabidopsis Biological Resource Centre ACT2 ACTIN2 Ag+ silver ion AGI Arabidopsis Genome Initiative ANOVA analysis of variance APH aphidicolin ARF AUXIN-RESPONSE FACTOR ARR ARABISOPSIS RESPONSE REGULATOR ASK1 ARABIDOPSIS SKP1 HOMOLOGUE 1 ATP adenosine triphosphate AuxRE Auxin Response Element BH Benjamini-Hochberg BR brassinosteroid bri1 brassinosteroid insensitive1 C1 one-carbon CamV Cauliflower mosaic virus cDNA complementary DNA cDHPS cytosolic dihydropteroate synthase CKX1 cytokinin oxidase-dehydrogenase1 cm centimetre Col-0 Columbia-0 Cont’d continued d2-IAA deuterated IAA Da Dalton(s) dH2O distilled water DHFR dihydrofolate reductase DHFS dihydrofolate synthetase DHPS dihydropteroate synthase DIC differential interference contrast DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DPG days-post germination E. coli Escherichia coli EDTA Ethylenediaminetetraacetic Acid EMS ethyl methanesulfonate eto2 ethylene overproducer2 EtOH ethanol
x
FA folic acid FAA Formalin-acetic-alcohol FBP FRUCTOSE-1,6-BISPHOSPHATASE FC fold change FPGS folylpolyglutamate synthetase FW forward GA gibberellic acid gai gibberellic acid insensitive GAL galactose gcrma GC-robust multi-array analysis GEO Gene Expression Omnibus GFP green fluorescent protein gim1 galactose insensitive1 gin glucose-insenstitive GL2 GLABRA2 Glu glutamate GSK GLYCOGEN SYNTHASE KINASE GUS beta-glucoronidase H2Folate dihydrofolate H2O water H2Pterin hydroxydihydropterin H2Pterin-PPi hydroxymethyldihydropterin pyrophosphate H2Pteroate dihydropteroate HCl hydrochloric acid HLB hydrophilic-lipophilic balance HPPK-DHPS hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate
synthase hr hour hy2 elongated hypocotyl2 HXK1 HEXOKINASE1 IAA indole-3-acetic acid JA jasmonic acid K3Fe(CN)6 Potassium hexacyanoferrate(III) K4Fe(CN)6` Potassium hexacyanoferrate(II) LATCA Library of Active Compounds in Arabidopsis LC liquid chromatograph LC-ESI-MS/MS liquid chromatograph electronspray ionization tandem mass
spectrometry LC-MS liquid chromatography-mass spectrometry limma linear model for microarray LRC lateral root cap m-2 s-1 square meter-per-second m/z mass-to-charge ratio mDHPS mitochondrial dihydropteroate synthase min minute mL millilitre
xi
mM millmolar MS Murashige and Skoog msg2 massugu2 MTX methotrexate NaAc sodium acetate NaOH sodium hydroxide NASC Nottingham Arabidopsis Stock Centre ng/gFW nanograms-per-gram-fresh-weight nm nanometre NPA naphthylphthalamic acid OAS O-Acetyl serine pABA para-aminobenzoic acid PAC paclobutrazol PCR polymerase chain reaction phyB phytochromeB PI propidium iodide PIF PHYTOCHROME INTERACTING FACTOR PIN PIN-FORMED PLT PLETHORA plt1;plt2 plethora1;plethora2 pg picogram QC quiescent centre qPCR quantitative polymerase chain reaction RAM root apical meristem RNA ribonucleic acid ROS reactive oxygen species RT-PCR reverse transcriptase polymerase chain reaction reaction RV reverse SAIL Syngenta Arabidopsis Insertion Library SAM shoot apical meristem SCF Skp, Cullin, F-box containing SD standard deviation SDZ sulfadiazine SE standard error shy2 short hypocotyl2 SKP1 S PHASE KINASE-ASSOCIATED PROTEIN 1 SLR single lens reflex SMP sulfamethoxypyridazine SMT sulfameter SMX sulfamethoxazole SMZ sulfamerazine SNA sulfanilamide ssr sucrose and sulfonamide resistant Suc sucrose Sul1 sulfonamide-resistant1 TCS two-component-output-sensor
xii
T-DNA Transfer DNA THF tetrahydrofolate THF-Glu1 tetrahydrofolate monoglutamate THF-Glun tetrahydrofolate polyglutamate TIR1 TRANSPORT INHIBITOR RESPONSE1 UBQ10 POLYUBIQUITIN10 UDP uridine diphosphate Vasc vasculature v/v volume-to-volume w/v weight-to-volume WAX weak anion exchange WOX5 WUSCHEL-RELATED HOMEOBOX5 WT wild type X-GLUC 5-bromo-4-chloro-3-indolyl-β-D-glucoronide
xiii
List of Figures
1. Introduction
1.1 Sucrose induces pleiotropic developmental responses in dark-grown seedlings.
1.2 Structure of the tetrahydrofolate molecule.
1.3 Tetrahydrofolate biosynthesis in plants.
2. Interplay between sucrose and folate modulates auxin signalling in Arabidopsis
2.1 Sucrose conferred hypersensitivity to sulfonamides.
2.2 Overview of C1 metabolism in plants.
2.3 Enhanced DHPS activity attenuated the interaction between sucrose and SMX.
2.4 Synergy between sucrose and SMX restricts the expression of a set of
Aux/IAAs.
2.5 Auxin transport and signalling mediate synergy between sucrose and SMX.
2.6 Co-treatment of sucrose and SMX promotes auxin signalling in the hypocotyl.
S2.1 Sucrose confers hypersensitivity to sulfonamides.
S2.2 Osmotic environment does not affect sensitivity to SMX.
S2.3 Plants with enhanced DHPS activity exhibit resistance to the sucrose-SMX
interaction.
S2.4 Sucrose and SMX do not affect IAA3::GUS and IAA29::GUS expression in the
hypocotyl.
S2.5 Auxin abundance is unchanged by growth in the presence of sucrose and
SMX.
S2.6 Folic acid is not sufficient to alter sensitivity to exogenous auxin, but does
affect hypocotyl elongation in the absence of sucrose.
S2.7 Enhanced DHPS activity does not alter the effect of exogenous auxin on
hypocotyl elongation.
3. Metabolite and hormone signalling is integrated at the meristem to drive root growth
3.1 Sucrose promotes root elongation in dark-grown seedlings, which is restricted
by SMX.
3.2 SMX inhibits auxin accumulation at the root apex, resulting in ectopic signalling
throughout the meristem.
3.3 Sucrose promotes auxin accumulation at the root tip through increased PIN
xiv
abundance and polar localisation.
3.4 SMX decreases PIN protein abundance at the root tip.
3.5 Sucrose promotes cytokinin signalling at the root tip; ectopic signalling induced
by SMX.
3.6 Sucrose and SMX promote cell-cycle progression markers in the meristem.
3.7 Sucrose increases meristem size, yet cotreatment with SMX results in complete
differentiation.
3.8 Meristem integrity diminishes across time.
3.9 Differentiated meristems lose QC specification.
3.10 Blocking cell division with aphidicolin partially phenocopiesSMX.
3.11 Sucrose and SMX does not promote WEE1 transcript abundance.
3.12 IAA3/SHY2 signalling mediates responses to sucrose and SMX.
3.13 Model: Sucrose and folates promote hormone signalling at the meristem to
drive root growth.
3.14 Folic acid rescues disrupted meristem and promotes cell-cycle progression.
4. General conclusions and future directions
4.1 Metabolite sensing modulates hormone interactions during seedling
development.
4.2 Forward-genetic screen identifies a group of sucrose-and-sulfonamide-resistant
(ssr) mutants.
4.3 Ethylene perception does not mediate interaction between sucrose and SMX.
4.4 Auxin and cytokinin mediate shoot meristem activation by sucrose.
5. A novel F-box protein mediates galactose sensitivity (Appendix)
5.1 Galactose inhibits root elongation and vascular development.
5.2 Genetic screen identifies a galactose insensitive mutant1 (gim1).
5.3 Galactose resistance of the gim1 mutant.
5.4 gim1 deficient in At4g39560, encoding a putative galactose oxidase/F-box.
xv
List of Tables
2. Interplay between sucrose and folate modulates auxin signalling in Arabidopsis
2.1 Number of probe sets with significant main effect or interaction determined by ANOVA.
S2.1 Chemical structures and seedling phenotypes.
S2.2 Probe sets with significant sucrose-SMX interaction.
S2.3 Probe sets exhibiting synergy to co-treatment with sucrose and SMX.
S2.4 Summary of probe sets corresponding to core auxin signalling components with significant sucrose main effect.
1
Chapter 1
Introduction
2
1 Introduction
1.1 Sugars Have a Profound Impact on Plant Development
As sessile organisms in an ever-changing environment, plants must be able to
sense their surroundings in order to promote the appropriate responses, which may
include changes to directional growth (Esmon et al., 2005; Ding et al., 2011). This
developmental plasticity allows plants to optimise growth and development in
response to their environment (De Kroon et al., 2009). Some stimuli, such as light,
can be sensed directly through the activity of receptors (Chory, 1994; Quail, 1998,
2007). Alternatively, plants can indirectly sense changes in their environment
through the perception of metabolites that accumulate under certain conditions (Kim
et al., 1999; Stevenson et al., 2000; Bouche and Fromm, 2004; Vergara et al.,
2012).
Sugars are one example of a metabolite that can modify growth and development
(Smith and Stitt, 2007). Playing a multifaceted role as structural components,
sources of energy, and as signalling molecules, the effect of sugar signalling can be
seen across all stages of the plant life cycle (Rolland et al., 2006). At the earliest
stages of plant growth, germination and establishment are inhibited by sugars
(Dekkers et al., 2004; Gibson, 2005; Yuan and Wysocka-Diller, 2006). As the
seedling matures, sugars promote primary root elongation and the emergence of
lateral roots, giving rise to root system architecture (Nieuwland et al., 2009; Sanz et
al., 2011; Kircher and Schopfer, 2012). Vegetative growth and developmental state
are influenced by sugars, as the application of sugar to the shoot apex can induce
floral transition (Corbesier et al., 2002; Smith and Stitt, 2007; Coneva et al., 2012).
Sugars influence leaf senescence as well (Quirino et al., 2000; Parrott et al., 2005),
though the exact role they play in this process is contested (van Doorn, 2008).
Taken together, it is apparent that sugar signals play an influential role across the
life of a plant.
3
Some striking effects of sugar on plant development can be observed by exposing
dark-grown plants to sugar (Roldan et al., 1999; Baier et al., 2004; Casson and
Lindsey, 2006). In the absence of light, seedlings enter into skotomorphogenic
development that is characterized by elongated hypocotyls, inhibition of root growth,
and an apical hook that is believed to protect the shoot apical meristem as the plant
pushes through soil to reach light (Zadnikova et al., 2010). Treatment with sucrose
to the aerial tissues is sufficient to break the etiolated seedling from
skotomorphogenic development (Roldan et al., 1999). In these dark-grown
seedlings, sugars can promote the development of true leaves, and plants are able
to grow right through to flowering and seed set (Roldan et al., 1999). This implies
that light itself is dispensable in breaking etiolated growth, and that the products of
photosynthesis are sufficient to induce traits typically associated with
photomorphogenesis (Roldan et al., 1999).
In addition to promoting the development of true leaves, sucrose is sufficient to
induce root elongation in dark-grown seedlings (Kircher and Schopfer, 2012).
Though there is evidence that photoreceptor-mediated light signalling plays a role
during primary root elongation (Dyachok et al., 2011), it appears that light is
dispensable so long as sugar signalling is maintained (Kircher and Schopfer, 2012).
It has been proposed that photosynthetically-derived sucrose acts as a long-distance
signal to induce root elongation once the cotyledons have established
photosynthetic competency (Kircher and Schopfer, 2012). In this manner, sucrose
acts as a metabolic signal to the root that favorable above-ground conditions have
been met (Kircher and Schopfer, 2012).
1.2 Sugar Levels Rise and Fall Throughout the Day, With
Widespread Consequences
Sugar levels rise and fall on a daily cycle, reaching maximal levels toward the end of
the day, and decreasing throughout the night (Blasing et al., 2005). During the day,
sucrose produced through photosynthesis is converted to starch, which is used at
4
night to support growth in the absence of light (Caspar et al., 1985; Geiger and
Servaites, 1994). Studies using extended night treatments (Osuna et al., 2007;
Usadel et al., 2008) or genetic mutants with reduced sugar levels (Blasing et al.,
2005) have shown that the availability of sucrose during the night is important for
maintaining growth. Plant growth becomes arrested in the absence of sucrose,
highlighting the importance of sugars in supporting plant development.
Sugars influence gene transcription and other metabolic processes, therefore daily
fluctuations in carbohydrate abundance have profound influences on plant biology
(Blasing et al., 2005; Smith and Stitt, 2007; Usadel et al., 2008). Sugars induce
widespread changes to the transcriptome, and the daily flux of sugar accounts for a
large portion of daily transcript cycling that are part of the circadian rhythms in plants
(Blasing et al., 2005). Whereas the circadian rhythm is entrained by numerous
environmental stimuli, such as light and temperature (McClung, 2006), cellular sugar
abundance is a dominant influence in daily cycling of the transcriptome (Blasing et
al., 2005). Sugar signaling also feeds directly into clock machinery that governs the
circadian rhythm (Dalchau et al., 2011). Through transcriptome activity, the
signalling architecture of the cell is changed and results in altered sensitivity to
environmental stimuli (Hotta et al., 2007). Known as gating, responsiveness to a
stimulus can be modulated based on the status of the circadian rhythm (Hotta et al.,
2007; Harmer, 2009). As daily flux of sugars moderate transcriptome activity, the
sugar status of the plant can gate responses to environmental and endogenous
stimuli.
Sugars modulate responses to inorganic nutrients, offering an example of how
endogenous metabolic signals can gate plant responses to their environment (Price
et al., 2004; Muller et al., 2005). By analyzing the transcriptome of seedlings treated
with sugars and nitrate or phosphate independently, then comparing this response to
seedlings given both treatments, interactions between inorganic nutrients and
sugars were explored (Price et al., 2004; Muller et al., 2005). Using this experimental
design, cluster analysis identified sets of transcripts that responded synergistically to
glucose and nitrate (Price et al., 2004). Whereas previous experiments studying
5
nitrate responses were performed in the presence of sucrose (Wang et al., 2000;
Wang et al., 2003), Price et al identified that many of these responses were
dependent on the sugar (Price et al., 2004). Similar trends were observed in studies
looking at transcriptome-wide interactions between sucrose and phosphate (Muller
et al., 2005), suggesting that sugars influence plant responses to a variety of other
nutrients.
To put this into a biological context, as the levels of carbohydrate availability rise and
fall throughout the day (Blasing et al., 2005), pathway interactions may allow plants
to fine-tune signalling and responses. In this manner, endogenous metabolic signals
are integrated with inorganic nutrient pathways to influence plant responses to the
environment.
1.3 Sugars are perceived, resulting in changes to gene
expression
As sugars are an important factor for growth, plants have evolved numerous sensing
pathways to detect sugar abundance (Moore et al., 2003; Rolland et al., 2006; Smith
and Stitt, 2007; Smeekens et al., 2010; Cho and Yoo, 2011). These sensing
pathways often invoke changes in gene expression that allow plants to capitalise on
carbohydrate resources (Koch, 2004; Wiese et al., 2005; Cho et al., 2006). In this
way the sugar can act not only to provision growth, but also acts as a signal that
informs development.
The main glucose sensor in plants is HEXOKINASE1 (HXK1), an enzyme that
functions in the conversion of phosphorylated hexose sugars, and is a key
component of a sugar signalling pathway (Jang et al., 1997; Moore et al., 2003).
HXK1 phospohorylates glucose as part of glycolysis, playing a functional role in
plant primary metabolism (Moore et al., 2003; Rolland et al., 2006). The metabolic
function of HXK1 can be uncoupled from its signalling role by introducing point
mutations to the catalytic domain (Moore et al., 2003). Catalytically-inactive mutants
maintain glucose signalling function, supporting the hypothesis that HXK1 plays a
6
dual role in metabolism and sugar sensing (Moore et al., 2003). In keeping with this,
nuclear-localised HXK1 interacts with other signalling components to mediate the
transcription of glucose-responsive genes (Cho et al., 2006). The combined activity
of sugar metabolism and signalling enables tight coordination of plant development
with resource availability(Rolland et al., 2006).
Other metabolic enzymes play a dual role in sensing sugars and regulating
transcriptional responses. The fructose metabolism enzyme FRUCTOSE 1,6
BISPHOSPHATASE (FBP), which produces fructose-6-P during sucrose synthesis
(Rolland et al., 2006), mediates fructose signalling during seedling development
(Cho and Yoo, 2011). Similar to experiments with HXK1 (Moore et al., 2003),
catalytically-dead alleles of FBP maintain gene regulatory functions (Cho and Yoo,
2011). These studies highlight a mechanism through which sugars act both as
metabolic constituents and as signalling molecules. Sugars provide energy as
nutrients to support the growth of new tissues. Metabolic flux is detected by
enzymes involved in the metabolism of sugars, resulting in changes in gene
expression that affect resource demand.
Though sucrose induces widespread changes to gene expression, it is unclear to
what extent this effect is due to the degradation of sucrose into its constituent
hexoses. Both glucose and fructose induce changes in gene expression, and can be
generated from sucrose through invertases (Pego and Smeekens, 2000; Price et al.,
2004; Rolland et al., 2006; Cho and Yoo, 2011). There is evidence of disaccharide-
sensing mechanisms in plants that supports the role of sucrose as a signalling
molecule independently of glucose and fructose (Barker et al., 2000; Huijser et al.,
2000; Loreti et al., 2000; Solfanelli et al., 2006; Mudgil et al., 2009). As sucrose is
the main transported sugar in plants, it would make sense for plants to possess
mechanisms through which they can be detected. The extent to which glucose and
fructose are necessary for plant responses to sucrose is an issue of ongoing
research. Sugars are readily interconverted in plant cells, making this an issue that
is difficult to address experimentally.
7
1.4 Transcriptome Analysis to Uncover Pathway Interactions
By comparing the transcriptome-level responses to two individual treatments relative
to their combined treatment, interactions between signalling pathways can be
uncovered (Price et al., 2004; Muller et al., 2005). Though this has proven
successful in a variety of contexts, different methods of microarray analysis have
been implemented. The analysis by Price et al used k-means clustering to identify
groups of transcripts that responded synergistically or antagonistically to glucose
and nitrate treatments (Price et al., 2004). Synergy was defined as any changes in
response to the cotreatment that was greater than the added responses of both
treatments individually (Price et al., 2004). Similarly, Muller et al defined interaction
as a change in abundance level in response to the two factors together, which is
significantly different than expected from either treatment individually (Muller et al.,
2007). Hierarchical clustering of transcripts fitting this definition identified three
clusters, one of which was enriched for transcripts involved in growth and
development that exhibited a positive interaction between phosphate and sucrose
treatments (Muller et al., 2007). Pathways that promote growth were activated only
when the metabolic and nutrient resources were available to support growth (Muller
et al., 2007).
1.5 Sugars and Hormones
Many responses to sugar are mediated through hormone signalling, adding to the
complexity of sugar signalling networks in plants (Gazzarrini and McCourt, 2001;
Gibson, 2005; Rolland et al., 2006). Forward-genetic screens have identified sugar-
insensitive mutants to be novel alleles of hormone signalling components,
highlighting the extensive crosstalk between sugars and hormones in regulating
plant development (Gibson, 2005). For example, by screening for mutants resistant
to glucose, a set of glucose-insensitive (gin) mutants were isolated (Zhou et al.,
1998), many of which were later found to be novel alleles of known abscisic acid
(ABA) and ethylene hormone pathways (Zhou et al., 1998; Arenas-Huertero et al.,
8
2000). Similar findings were uncovered by screening for altered sensitivity to
sucrose (Gibson et al., 2001; Rook et al., 2001; Baier et al., 2004), suggesting that
responses to sugar are generally mediated through hormone signalling, and may not
be sugar-specific.
Anthocyanin production in seedlings exemplifies the complex interplay that exists
between sucrose and hormone signalling, and highlights the manner in which
hormones can either enhance or negate the effect of sugars (Loreti et al., 2008;
Jeong et al., 2010). Growth in the presence of sucrose causes an increase in
anthocyanin accumulation in seedlings (Loreti et al., 2008; Jeong et al., 2010), that
is associated with increased expression of genes encoding biosynthetic enzymes
(Solfanelli et al., 2006; Loreti et al., 2008). When seedlings were treated with
sucrose in the presence of ABA or jasmonic acid (JA), the effect of sucrose was
approximately twice as high as it had been in the absence of the hormones (Loreti et
al., 2008). Intriguingly, ABA and JA induced no effect on anthocyanins when treated
independently of sucrose, indicating that they are acting to modulate the effect of
sucrose rather than exerting an additive effect (Loreti et al., 2008). Contrary to ABA
and JA, the presence of GA completely inhibited the inductive effect of sucrose on
anthocyanin accumulation, yet again induced no change when treated independently
(Loreti et al., 2008). Taken together, these studies highlight the manner in which
sugars and hormone signalling converge to shape plant growth. The nature of this
interaction, whether inhibitory or synergistic, can be hormone dependent.
1.6 Sugars and Auxin Coordinate Plant Development
Auxin is a plant hormone that plays an important role in establishing patterning and
shaping morphology (Blilou et al., 2005; Woodward and Bartel, 2005; Vanneste and
Friml, 2009). Given that sugars promote some morphological traits, it is plausible
that auxin signalling mediates some developmental responses to sugar. For
example, in the absence of light, treatment with exogenous sucrose is sufficient to
promote the development of true leaves, restricts hypocotyl elongation, and
promotes root development (Figure 1.1) (Roldan et al., 1999; Kircher and Schopfer,
9
2012). Auxin is involved in all three of these processes by acting as an instructive
signal during phyllotaxy (Reinhardt et al., 2003), promoting cell expansion in the
hypocotyl (Tatematsu et al., 2004; Saito et al., 2007), and regulating cell division and
patterning in the root meristem (Aida et al., 2004; Perilli et al., 2012). Despite this,
very few sugar-insensitive mutants have been identified as disrupted in auxin
signalling, as have been found in other hormone signalling pathways (Gibson, 2005).
This may be a result of the extensive redundancy that exists in the auxin signal
transduction pathway (Okushima et al., 2005; Overvoorde et al., 2005). The extent
to which auxin mediates responses to sugars remains poorly understood.
There is evidence that sugars and light signalling pathways interact downstream of
the photoreceptors to promote auxin accumulation (Lilley et al., 2012; Sairanen et
al., 2012). A modest increase in auxin abundance was observed in response to
sucrose, yet this was diminished in the pifQ mutant, which is deficient in four
members of the PHYTOCHROME INTERACTING FACTOR (PIF) family of
transcription factors (Shin et al., 2009; Lilley et al., 2012). Treatment with high levels
of glucose promoted the accumulation of auxin, and induced the expression some
genes in the auxin biosynthetic pathway (Sairanen et al., 2012). Taken together,
these studies suggest that sugars may direct plant development by inducing auxin
biosynthesis, or by influencing the distribution of auxin across plant tissues.
Auxin signal transduction is mediated by a core set of transcription factors, called
AUXIN-RESPONSE FACTORs (ARFs), that are bound to the promoters of early
auxin-responsive genes (Ulmasov et al., 1999; Hagen and Guilfoyle, 2002). These
ARFs interact with the Aux/IAA family of transcriptional repressors that bind to the
ARFs in the absence of auxin (Liscum and Reed, 2002; Tiwari et al., 2003). Auxin
interacts with its receptor family of F-BOX proteins, promoting an interaction
between the receptor and other members of an SCF ubiquitin-ligase complex
(Dharmasiri et al., 2005; Dharmasiri et al., 2005; Kepinski and Leyser, 2005). This
complex targets the Aux/IAA repressors for degradation via the 26S proteasome
(Dharmasiri et al., 2005; Santner et al., 2009). ARFs can then regulate the
10
Figure 1.1. Sucrose induces pleiotropic developmental responses in dark-grown seedlings. Seedlings grown in liquid media in the absence (left panels) of presence (right panels) of 30mM sucrose. (A) Whole seedlings after seven days of growth. (B) Shoot apical meristem and true leaves imaged after fourteen days of growth. (C) Detail of hypocotyls after seven days of growth. (D) Primary roots after seven days of growth.
11
expression of their target genes (Dharmasiri and Estelle, 2004; Dharmasiri et al.,
2005). The accumulation of auxin in plant tissues is fundamental to initiating auxin
signaling (Gray et al., 2001; Vanneste and Friml, 2009). The active transport of auxin
between cells and tissues is facilitated by the PIN-FORMED (PIN) family of auxin
efflux carriers (Blilou et al., 2005; Feraru and Friml, 2008; Robert and Friml, 2009).
PINs focus auxin to create concentration gradients that are fundamental to auxin
signalling (Grieneisen et al., 2007; Robert and Friml, 2009; Vanneste and Friml,
2009). The accumulation of auxin in is under control of developmental and
environmental cues, which is facilitated by the regulation of PIN abundance and
subcellular localisation (Feraru and Friml, 2008; Vanneste and Friml, 2009). Sugars
can promote the accumulation of auxin in specific tissues (Mishra et al., 2009;
Mudgil et al., 2009; Lilley et al., 2012); however, the role that sugars play in
influencing PIN abundance is not known. Pathways that modify PIN activity can
direct auxin localization and may offer a mechanism through which development is
influenced by environmental conditions (Vanneste and Friml, 2009).
Glucose induces lateral root formation, a trait typically associated with auxin
signalling (Dubrovsky et al., 2008; Mishra et al., 2009; Sanz et al., 2011; Muraro et
al., 2013). This similarity suggested a connection between glucose and auxin
signalling, and prompted a study into the nature of this interaction (Mishra et al.,
2009). Rationalising that glucose might influence auxin signalling during root
development, transcriptome analysis was performed using seedlings treated with
glucose, auxin, or a combination of the two (Mishra et al., 2009). This design
enabled the authors to explore the extent to which glucose can influence auxin-
responses at the transcript level (Mishra et al., 2009). A large subsets of genes were
identified as responding synergistically to glucose and auxin, including many core
auxin signalling components (Mishra et al., 2009). This interaction between glucose
and auxin highlights crosstalk between metabolic and hormone signalling as a driver
of plant development.
12
1.7 Sugars Impact the Plant Metabolome; Metabolites Can Act
as Signalling Molecules That Regulate Gene Expression
Sugars influence the metabolic profile of the plant cell (Gibon et al., 2006; Osuna et
al., 2007; Usadel et al., 2008). As carbohydrate reserves become depleted,
decreases in several fatty acids and organic acids, like fumarate and malate, occurs
(Usadel et al., 2008). Depletion of carbohydrates also causes an increase in
tocopherol biosynthesis and elevated amino acid pools that occurred as a result of
protein degradation (Usadel et al., 2008). Within three hours of resupplying sucrose,
many of the metabolic effects of sucrose starvation are reversed, indicating a rapid
recovery of biosynthetic metabolism (Osuna et al., 2007). Cellular sugar abundance
influences the metabolic profile of the plant, and suggests that the daily cycling of
sugar abundance could affect a wide range of metabolic pathways.
Metabolites can act as signalling molecules to regulate gene expression (Kim et al.,
1999; Stevenson et al., 2000; Vergara et al., 2012). For example, in times of sulfate
deficiency the cysteine precursor O-Acetyl serine (OAS) accumulates (Kim et al.,
1999), which is detected by plants and regulates the expression of genes involved in
sulfur acquisition (Hirai et al., 2003). In this sense, a metabolite can act as a
signalling molecule to inform the plant of its environmental condition and activate the
appropriate response. Given the affect that sugars have on plant metabolism, it is
possible that sugar exerts an effect on plant growth and development through its
influence on various plant metabolite pools.
1.8 Folates Effect Plant Development and Productivity
Folate biosynthesis is a branch of primary metabolism that is important for plant
productivity (Storozhenko et al., 2007; Mehrshahi et al., 2010). The tetrahydrofolate
(THF) molecule comprises three components: pteridine, para-aminobenzoate
(pABA), and a polyglutamate chain that can vary in length (Figure 1.2A) (Hanson
and Gregory, 2002; Sahr et al., 2005). Folates are classified based on the
13
methylation state at N-5 and N-10 of the THF molecule (Figure 1.2 B) (Ravanel et
al., 2011). THF acts as a co-factor in various single-carbon transfer reactions,
collectively termed one-carbon (C1) metabolism (Hanson and Roje, 2001; Hanson
and Gregory, 2002), by donating methyl units from these sites (Ravanel et al., 2011).
These C1 reactions are necessary for the synthesis of secondary metabolites such
as lignin and choline, and are important for the production of serine and glycine
(Hanson and Gregory, 2002). Folates are a core component of primary metabolism
and are involved in many facets of plant metabolism.
Given the importance of folates in a number of metabolic processes, it is not
surprising that mutants deficient in folate metabolism exhibit developmental
phenotypes (Goyer et al., 2005; Storozhenko et al., 2007; Mehrshahi et al., 2010;
Srivastava et al., 2011). In a screen for mutants with defective root growth,
Srivastava et al identified a folylpolyglutamate synthetase (FPGS)-deficient line with
restricted root elongation (Srivastava et al., 2011). The quiescent centre of the fpgs
mutants were disorganised, leading to differentiation of the stem cell pool at the root
meristem (Srivastava et al., 2011). These findings highlight the importance of folates
in supporting root growth, and the maintenance of meristematic potential at the root
apex.
Polyglutamylation of the tetrahydrofolate molecule is important for maintaining folate
stability and homeostasis (Akhtar et al., 2010; Mehrshahi et al., 2010).
Folylpolyglutamate synthetase (FPGS) exists in three isoforms in Arabidopsis, each
isoform is active in a different organelle to support compartmentalisation of folate
metabolism, and is involved in the addition of the polyglutamate tail to the THF
molecule (Mehrshahi et al., 2010). Loss-of-function mutant analysis indicated that
each of the three isoforms was dispensable, as each individual mutant exhibited no
morphological phenotype (Mehrshahi et al., 2010). In contrast, the double-mutant
fpgs1 fpgs3 exhibited a severely dwarfed phenotype, and the mutant combinations
of fpgs1 fpgs2 and fpgs2 fpgs3 resulted in embryo and seedling lethality,
respectively (Mehrshahi et al., 2010). Folate metabolism is necessary for seedling
14
Figure 1.2. Structure of the tetrahydrofolate molecule. (A) Tetrahydrofolate (THF) consists of three components, a Pterin ring, p-aminobenzoate, and a polyglutamate sidechain. (B) Folates are classed by the methylation state of N-5 and N-10. These locations act as the methyl donor sites in C1 metabolism. (Modified from Ravanel et al. 2011).
15
Figure 1.3. Tetrahydrofolate biosynthesis in plants. Abbreviations: HPPK, hydroxymethyldihydropterin pyrophosphokinase; DHPS, dihydropteroate synthase; DHFS, dihydrofolate synthetase; DHFR, dihydrofolate reductase; FPGS, folylpolyglutamate synthetase; pABA, para-aminobenzoic acid; ATP, adenosine triphosphate; Glu, glutamate; H2Pterin-PPi, hydroxymethyldihydropterin pyrophosphate; H2Pterin, hydroxydihydropterin; H2Pteroate, dihydropteroate; H2Folate, dihydrofolate; THF, tetrahydrofolate; THF-Glu1, tetrahydrofolate monoglutamate; THF-Glun, tetrahydrofolate polyglutamate.
16
vitality, and supports normal plant growth and development. The study by Mehrshahi
et al offers insight into the redundancy that exists within the folate biosynthetic
pathway (Ravanel et al., 2001; Storozhenko et al., 2007; Mehrshahi et al., 2010).
Despite the subcompartmentalisation of each isozyme, individual loss-of-function
mutants exhibited little phenotype, suggesting that the compartmentalisation of
polyglutamilisation may be redundant (Mehrshahi et al., 2010). Genetic redundancy
is present at multiple steps in folate metabolism, in that multiple isoforms exist to
perform the same enzymatic step (Ravanel et al., 2001; Storozhenko et al., 2007;
Akhtar et al., 2010; Mehrshahi et al., 2010).
In addition to highlighting the importance of folates in plant growth and reproductive
development, the study by Mehrshahi et al also eluded to a connection between
folate metabolism and sucrose during seedling development (Mehrshahi et al.,
2010). Double fpgs2 fpgs3 mutants, which typically failed to grow beyond
germination, were able to become established when growing on media containing
sucrose (Mehrshahi et al., 2010). To date, this represents the only established
connection between folate metabolism and sugar signalling in plants.
1.9 Chemical Inhibition of THF Biosynthesis as a Tool for Plant
Sciences
Chemical inhibition of THF biosynthesis can be used to study the effect of folates on
plant biology (Ravanel et al., 2011). There are two main targets of chemical
inhibition, the bifunctional enzyme hydroxymethyldihydropterin pyrophosphokinase-
dihydropteroate synthase (HPPK-DHPS) and dihydrofolate reductase (DHFR)
(Ravanel et al., 2011). DHPS uses para-aminobenzoic acid (pABA) and
dihydropterin as substrates in the synthesis of Dihydropteroate, which is then
combined with glutamate to generate dihydrofolate (Hanson and Gregory, 2002;
Storozhenko et al., 2007). Dihydrofolate is reduced by DHFR to create
tetrahydrofolate, which then goes on to facilitate C1-metabolism in plants (Hanson
and Roje, 2001; Ravanel et al., 2011).
17
DHFR can be targeted by a number of inhibitors differing in structural class, though
methotrexate (MTX) is most commonly used (Ravanel et al., 2011). As some
cancers rely on folates to support rapid rates of cell division, MTX has been used
extensively in chemotherapy (Bertino, 2009). MTX has also been used in plants to
explore the role of folates in amino acid metabolism (Prabhu et al., 1997; Prabhu et
al., 1998), root development (Srivastava et al., 2011), and chlorophyll biosynthesis
(Van Wilder et al., 2009). This is not an ideal approach, as MTX is highly toxic and
produces xenobiotic stress responses in plants (Loizeau et al., 2008).
Alternatively, folate biosynthesis can be restricted by the inhibition of DHPS, which is
targeted by the sulfonamide family of compounds (Brown, 1962). Sulfonamides bind
and inhibit the DHPS active site by acting as a competitive inhibitor to pABA (Brown,
1962; Prabhu et al., 1997; Prabhu et al., 1998). Sulfonamides have been used in
plants to measure the effect of folate-dependent metabolic processes, such as
glycine metabolism (Prabhu et al., 1997). Treatment with sulfonamide has
uncovered the involvement of folates in processes such as DNA methylation (Zhang
et al., 2012), and plant defence (Schreiber et al., 2008; Noutoshi et al., 2012). These
novel roles for folates in plant development were indentified in high-throughput
chemical-genetic screens. The fact that inhibitors of folate synthesis can induce
disparate phenotypes speaks to the far reaching influence of this central metabolic
pathway on plant growth and development.
Due to the existence of DHPS in microbes and plants, but not in humans,
sulfonamides have a long history of use as antimicrobials (Wise and Abou-Donia,
1975). As a result, bacteria have developed resistance to sulfonamides at the site of
inhibition, by evolving a DHPS protein that shows reduced affinity for the compound
(Wise and Abou-Donia, 1975). This has been exploited by plant researchers, who
have cloned this gene from Escherichia coli and expressed it in plants to confer
resistance to sulfonamides (Guerineau et al., 1990). This resistance trait is now used
as the sulfonamide resistant1 (Sul1) selectable marker during genetic transformation
(Guerineau et al., 1990; Hadi et al., 2002), and was used in the creation of the GABI-
KAT collection of T-DNA insertion lines (Rosso et al., 2003).
18
1.10 Overcoming Redundancy: Chemical Genetics
Plants have evolved multiple sugar-sensing pathways, and it is likely that there is
genetic redundancy within many of these pathways (Smith and Stitt, 2007). Though
forward-genetic screening has proven useful in uncovering some sugar signalling
components (Gibson, 2005), this approach is limited by an inability to uncover
mutant phenotypes that are masked by genetic redundancy (McCourt and
Desveaux, 2010; Toth and van der Hoorn, 2010). It is necessary to employ alternate
methods that circumvent functional redundancy in order to establish a more
complete picture of sugar signalling networks that govern plant development.
One method that can be used to overcome functional redundancy is to probe
biological systems with chemical perturbation, rather than genetic mutation
(Stockwell, 2004; Robert et al., 2009). Termed chemical genetics, this approach
involves screening chemical libraries for compounds that induce a phenotype of
interest, then working to uncover how the chemical is modifying protein function
(Stockwell, 2000, 2004). When used in tandem with classical genetic approaches,
this technique has proven to be a powerful tool for elucidating biological function in
plants (Dai et al., 2005; Zheng et al., 2006; Park et al., 2009).
Chemical genetics can be used to overcome functional redundancy associated with
multimember gene families (De Rybel et al., 2009; Park et al., 2009). For example, a
chemical that inhibits the active site of an enzyme may block that enzyme from
functioning and thus induce a phenotype (McCourt and Desveaux, 2010). This
chemical inhibitor may act as a general antagonist to the enzyme, and overcome
functional redundancy by binding the common active site of the whole family of
enzymes (De Rybel et al., 2009; McCourt and Desveaux, 2010; Toth and van der
Hoorn, 2010). In this way, the chemical inhibitor acts analogously to a higher-order
genetic loss-of-function mutation (McCourt and Desveaux, 2010). Alternatively,
functional redundancy may be overcome by using a selective agonist to activate a
single member of a closely-related family (Park et al., 2009; Toth and van der Hoorn,
2010). The role of that gene, and by extension that gene family, can be uncovered
19
by screening for mutants resistant to the selective agonist (Park et al., 2009).
Another shortfall of classical genetics is that some mutations are lethal when in a
homozygous state, making them difficult to study and impossible to maintain as
homozygous, non-segregating plant lines (McCourt and Desveaux, 2010; Candela et
al., 2011). Instead, chemical inhibitors can be added or removed at different time
points so as not to inhibit a critical developmental state (Toth and van der Hoorn,
2010; Hicks and Raikhel, 2012). This tunability of the chemical system allows the
investigation into genes that were once difficult explore.
The choice of chemical library used for screening can dictate the success of the
experiment (Walters and Namchuk, 2003; Shelat and Guy, 2007). Some chemical
libraries are collections of known compounds, such as natural products and
bioactive molecules (Stockwell, 2000; Smukste and Stockwell, 2005; Shelat and
Guy, 2007). These libraries often have high levels of success in chemical-genetic
screening, owing to the wide range of molecular structures present in the collection
(Shelat and Guy, 2007). These diversity-oriented libraries increase the range of
protein structures that can be targeted in the screen, increasing the chance of
success in high-throughput chemical screening (Stockwell, 2004).
Focused libraries are generally created with a priori knowledge of the protein target
or with the goal of increasing the efficacy of a known active molecule (Sodeoka et
al., 2001; Jimonet and Jager, 2004; Stockwell, 2004). These libraries can be
synthesized from a core structure, or scaffold, and various functional moieties
attached (Stahura et al., 1999; Sodeoka et al., 2001; Stockwell, 2004; Welsch et al.,
2010). Through slight modifications to chemical structure, the activity of the molecule
is altered (Stockwell, 2004). The type of library chosen for the chemical screen
depends on the goal of the experiment, whether to identify the new components in
biological phenomena, or to target specific proteins of interest (Stockwell, 2004;
Shelat and Guy, 2007).
The efficacy of a compound in eliciting a biological response is dependent on
20
properties that enable the chemical to enter the living cell and maintain bioactivity
(Lipinski, 2000). The cellular membrane is a semi-permeable barrier that prohibits
many compounds from entering the cell, and therefore limits the number of proteins
that can be targeted in a chemical screen (Hopkins and Groom, 2002). Compounds
that are successful in passing through the cell membrane, and thus most useful in
chemical genetics experiments, generally conform with Lipinski’s Rule of Five
(Lipinski, 2000). These physico-chemical properties highlight factors influencing
compound solubility and permeability, two determinants of drug bioavailability
(Lipinski, 2000; Hopkins and Groom, 2002). Chemicals become less effective as
useful drugs owing to poor absorption or membrane permeability when they have a
molecular mass above 500 Da, when there are more than five hydrogen-bond
donors, when more than ten hydrogen-bond acceptors, and when they exhibit a high
level of lipophilicity (Lipinski, 2000). These traits influence the ability of the chemical
to enter the cell and maintain activity, and inherently limit the number of different
types of structures that can be useful for chemical screening.
Limitations on the number and breadth of chemical structures that are useful for
inclusion in a chemical library impacts the number of proteins that can be targeted
by chemical screening (Lipinski, 2000; Hopkins and Groom, 2002). The term
“druggable genome” was coined to reflect the total number of proteins that can be
targeted by chemical screening (Hopkins and Groom, 2002). Estimates have put the
number of possible targets that can be hit with Lipinski-rule-of-five-complaint
compounds at around 10% in various model organisms (Hopkins and Groom, 2002).
This number is derived based on assumptions that most drug targets contain active
sites for competitive inhibition, yet only a portion of proteins of an organism have an
active site that can be targeted (Hopkins and Groom, 2002). The fact that only a
subset of molecular pathways can be targeted by chemical biology is an important
consideration when designing a high-throughput chemical screen.
When assessing potential leads from a chemical screen, it is important to consider
that many compounds become degraded or metabolized upon entry to the cell
(Eichelbaum and Burk, 2001; He et al., 2011). Chemical degradation may result in
21
lower abundance of that compound and reduced efficacy, or may result in the
generation of a new molecule with bioactivity (Zhao et al., 2007). This latter scenario
may confound results and, in the case of pharmaceuticals, render the chemical non-
viable as a drug lead (Eichelbaum and Burk, 2001; He et al., 2011). Sometimes the
metabolism of the compound in vivo is necessary to introduce bioactivity, and can be
used to uncover biological processes. This was the case in a screen that identified
hypostatin as the target for glycosylation by a UDP glycosyltransferase in
Arabidopsis (Zhao et al., 2007). In this instance, the metabolism of the compound
was in fact causative for the phenotype of the compound, which was used to
uncover processes in plant biology (Zhao et al., 2007).
1.11 Combination Chemical Genetics
Distinct signalling pathways can converge to modulate the activity of one another,
adding to the complexity to biological systems (Segre et al., 2005; Lehar et al.,
2007). A comprehensive understanding of pathway interactions is necessary to fully
appreciate the response of biological systems to their environment (ten Tusscher
and Scheres, 2011). To uncover novel interactions, chemical combination screens
can be performed in search of pairs of compounds that induce synergistic or
antagonistic effects (Lehar et al., 2007; Farha and Brown, 2010; Piotrowski et al.,
2010). Depending on the nature of the interaction, and the effect that each
compound has on its protein target, information related to the topology of the
underlying signalling pathway can be inferred (Lehar et al., 2007; Yeh and Kishony,
2007). Chemical combination screens have been used extensively in the
pharmaceutical industry to discover drug combinations for use in syncretic drug
therapies (Keith et al., 2005). This approach is now becoming an important tool to
explore the complex interactions between signalling pathways that underpin
organism-level responses to their environment (Lehar et al., 2007; Yeh and Kishony,
2007; Falconer et al., 2011; ten Tusscher and Scheres, 2011).
Chemical combination screens are performed by systematically screening through
pairs of chemicals for responses that deviate from what can be expected from each
22
compound individually (Lehar et al., 2008; Falconer et al., 2011). Synergistic
responses to combined treatments can indicate an interaction between pathways,
though the best measure of synergy is debated (Keith et al., 2005). One common
measure of synergy is Bliss Independence, which describes a null hypothesis of two
compounds affecting the same phenotype through distinct, non-interacting pathways
(Bliss, 1939; Keith et al., 2005). In this scenario, if two compounds each induce a
50% inhibition when applied individually, then cotreatment should cause a 75%
inhibition; deviation from this is considered an interaction (Bliss, 1939). The Bliss
Independence model is widely considered to be the most relevant to signal pathway
analysis in biological systems (Keith et al., 2005). Screening for synergistic
responses to treatments is a method through which pathway interactions can be
uncovered (Lehar et al., 2007; Yeh and Kishony, 2007). This approach can glean
new insight into the manner through which organisms fine-tune sensitivity to
endogenous and environmental stimuli.
1.12 Research Questions and Hypotheses
Plant responses to sugars are mediated in part through interactions with other
signaling pathways. Transcriptome studies have uncovered both antagonistic and
synergistic responses between sugars and inorganic nutrients (Price et al., 2004;
Muller et al., 2007), and genetic screens found sugar insensitivity in hormone
signalling mutants (Gibson, 2005). The nature of these interactions is difficult to
tease apart, but is an important component in our understanding of how the plant
system uses these signals to shape development. To uncover novel pathways that
interact with sucrose, a combination chemical genetic screen was undertaken. Using
hypocotyl elongation as the phenotypic output, it was reasoned that chemicals
exhibiting synergy with sucrose were affecting pathways that interact with sugar
signalling. This screen identified that the sulfonamide family of compounds exhibited
synergistic responses with sucrose during etiolated hypocotyl elongation.
Transcriptome analysis found that cotreatment of sucrose and sulfamethoxazole
(SMX) resulted in changes in the transcript abundance of core auxin signalling
23
components.
Hypothesis 1: Sulfonamides modulate endogenous auxin signalling during
sucrose-mediated development.
To address this hypothesis, a series of experiments were undertaken to explore the
effect of sulfonamides on sugar signalling, and to understand the molecular basis for
this interaction. This study identified a specific auxin signalling pathway that
mediates the interaction between folates and sugars, providing insight into the
regulation of seedling development by primary metabolism.
By exploring the pleiotropic effects of sucrose on plant development, it was found
that sugars promoted meristematic activity that ultimately shapes root growth. In the
absence of sucrose, very little meristem activity was observed. Treatment with
sucrose promoted cell-cycle progression and hormone signalling that resulted in root
elongation. This effect of sucrose was perturbed by sulfonamide, causing a
misexpression of cell-cycle markers and a disruption in hormone signalling that was
partially phenocopied by treatment with a cell-cycle inhibitor. The presence of either
the sulfonamide or the cell-cycle inhibitor resulted in meristem differentiation, yet
only when treated in the presence of sucrose.
Hypothesis 2: Metabolism influences cell division and differentiation at the
root apex through hormone signalling networks.
Taken together, these studies provide insight into the metabolic cues that govern
plant development, highlighting the interaction between metabolic pathways as a
unique feature through which hormone signalling can be modulated. It is postulated
that the integration of metabolic and hormone signalling allows plants to fine-tune
sensitivity to a complex, and ever-changing environment.
24
Chapter 2
Interplay between sucrose and folate modulates auxin
signalling in Arabidopsis.
This chapter has been accepted for publication in Plant Physiology as:
Stokes ME, Chattopadhyay A, Wilkins O, Nambara E, and Campbell MM. (2013).
Interplay between sucrose and folates modulates auxin signalling in Arabidopsis.
Plant Physiology. DOI: http://dx.doi.org/10.1104/pp.113.215095
Contributions: MES, MMC designed research; MES, AC, OW, EN performed
research; MES, AC, OW, EN, MMC analysed data; MES, MMC wrote manuscript
with editorial assistance from AC, OW, EN.
25
2 Interplay between sucrose and folate modulates
auxin signalling in Arabidopsis.
2.1 ABSTRACT
As sessile organisms growing in an ever-changing environment, plants must
integrate multiple regulatory inputs to promote the appropriate developmental
responses. One such nutritional signal is cellular sugar levels, which rise and fall
throughout the day and affect a variety of developmental processes. To uncover
signalling pathways that modulate sugar perception, compounds from the library of
active compounds in Arabidopsis (LATCA) were screened for the ability to perturb
developmental responses to sucrose in Arabidopsis thaliana seedlings. This screen
found that sulfonamides, which inhibit folate biosynthesis in plants, restrict hypocotyl
elongation in a sugar-dependent fashion. Transcriptome analysis identified a small
set of transcripts that respond the interaction between sulfonamide and sucrose,
including a number of transcripts encoding Aux/IAAs, negative regulators of auxin
signal transduction. Chemical inhibition of auxin transport or genetic disruption of
auxin signalling relieved this interaction, suggesting that responses to these two
nutritional stimuli are mediated by auxin. Reporter systems used to track auxin
signalling and distribution showed enhanced activity in the vascular region of the
hypocotyl in response to co-treatment of sucrose and sulfonamide, yet no change in
auxin abundance was observed. Taken together, these findings suggest that the
interplay between sucrose and folates acts to fine-tune auxin sensitivity and affects
auxin distribution during seedling development.
26
2.2 INTRODUCTION
Sugars play a multifaceted role in plant biology, acting as structural components,
sources of energy, and signalling molecules (Rolland et al., 2006). The effect of
sugars on development can be seen across all stages of the plant life cycle, from
germination and establishment (Zhou et al., 1998; Rognoni et al., 2007), through
vegetative growth and floral transition (Ohto et al., 2001; Corbesier et al., 2002) until
senescence (Wingler and Roitsch, 2008). At the earliest stages of plant growth, the
perception of sugars influences a number of seedling traits, including primary root
growth (Freixes et al., 2002; Yazdanbakhsh et al., 2011) and hypocotyl elongation
(Stevenson and Harrington, 2009). As carbohydrate availability fluctuates on a
diurnal cycle (Blasing et al., 2005), other metabolic and environmental stimuli are in
flux as well (Gibon et al., 2006). It is therefore necessary for sugar signals to be
integrated with other signalling pathways to promote the appropriate developmental
responses.
Studies into the effect of sugars on plant growth have revealed a connection
between carbohydrates, nutrient status, and primary metabolism (Gibon et al., 2006;
Usadel et al., 2008). Transcriptome analysis has uncovered many overlapping and
synergistic responses between treatment with sugars and with inorganic nutrients,
such as nitrate and phosphate, suggesting both similar response pathways as well
as interactions between signalling components (Price et al., 2004; Muller et al.,
2007). Sugar availability has also been linked to the transcriptional regulation of
many components of primary and secondary metabolism, including the oxidative
pentose-phosphate pathway (Lejay et al., 2008), the anthocyanin biosynthetic
pathway (Solfanelli et al., 2006), and starch metabolism (Sokolov et al., 1998),
among others. It is apparent that sugars impact many facets of plant metabolism,
and that some of these changes may be regulated at the transcriptional level.
Many plant responses to sugar are mediated by the interaction between metabolic
and hormone signalling pathways (Gazzarrini and McCourt, 2001; Rolland et al.,
2006; Rook et al., 2006). Forward genetic screens have uncovered sugar-resistant
27
mutants to be novel alleles of known hormone mutants, highlighting the extensive
crosstalk between sugar- and hormone-signalling pathways (Zhou et al., 1998;
Arenas-Huertero et al., 2000; Laby et al., 2000; Gibson et al., 2001). Crosstalk
between hormone pathways is a well-explored phenomenon, and there are many
examples of hormone pathways that modify, impinge upon or promote the signalling
of other hormones (Depuydt and Hardtke, 2011). In instances where points of
crosstalk do exist, interplay between metabolite and hormone signalling may offer a
point through which primary metabolism can direct plant growth and development
(Falkenberg et al., 2008).
Given the level of redundancy that exists within metabolic and hormone signalling
pathways, it is likely that there are pathways that interact with and modify sugar
perception that have not been elucidated thus far by classical genetic methods
(Smith and Stitt, 2007). As an alternate approach to forward genetic screening,
chemical genetics can be used to overcome issues of functional redundancy
(McCourt and Desveaux, 2010; Toth and van der Hoorn, 2010). For example, a
chemical could bind and inhibit the common active site of a group of redundant
proteins (De Rybel et al., 2009), or activate a single member of a family of closely-
related receptors (Park et al., 2009). In either scenario, chemical genetics may be
used to illuminate biological function that is masked by functional redundancy and
likely unattainable through classical forward-genetic approaches.
In addition to overcoming functional redundancy, interconnectivity between biological
processes can be inferred by screening for compounds that act synergistically on a
phenotypic output (Lehar et al., 2007; Yeh and Kishony, 2007; Owens et al., 2010).
Termed “combination chemical genetics”, this approach entails screening chemical
libraries in the presence of a compound of interest to uncover secondary chemicals
that enhance or negate its effect (Lehar et al., 2008). Hits from these screens can
act antagonistically, additively, or synergistically, based on the manner in which their
targets interact biologically (Lehar et al., 2007; Lehar et al., 2008). When chemicals
act synergistically on a given phenotype, it is believed that the chemicals affect
interacting molecular pathways (Yeh et al., 2006; Lehar et al., 2007).
28
In the present study, a combination chemical genetic screen was used to identify
pathways that modify plant responses to sugar. This screen uncovered
sulfonamides, known to inhibit tetrahydrofolate (THF) biosynthesis in plants (Prabhu
et al., 1998), to act synergistically with sucrose to inhibit etiolated hypocotyl
elongation. The pool of folates produced by the THF biosynthetic pathway are
required for a variety of metabolic processes and provides the cofactors for the
methyl-transfer reactions that constitute one-carbon (C1) metabolism in plants
(Hanson and Roje, 2001). Though folate metabolism is important for normal plant
growth and development (Van Wilder et al., 2009; Mehrshahi et al., 2010; Srivastava
et al., 2011), the existence of any specific interaction between sugar signalling and
folates is unknown. Here, the folate inhibitor sulfamethoxazole was used to explore
the role of folates in mediating developmental responses to sucrose.
2.3 RESULTS
2.3.1 Sulfonamides alter seedling responses to sucrose
Chemicals were screened from the Library of Active Compounds in Arabidopsis
(LATCA), and were selected as positive “hits” based on the ability to act
synergistically with sucrose to inhibit hypocotyl elongation (Figure 2.1A). Of the 2100
compounds screened, 33 positive hits were reconfirmed in a secondary screen
(Supplemental Table S2.1). Though positive hits were derived from a variety of
structural classes and functions, the largest group of successful hits belonged to the
sulfonamide family of compounds, which were chosen for further study (Figure
2.1B). Dose-response curves for five sulfonamides showed a saturable, dose-
dependent inhibition of hypocotyl elongation that was enhanced by the presence of
sucrose (Figure 2.1C, Supplemental Figure S2.1). The interaction between sucrose
and sulfonamides was not related to the osmotic potential of the growth media
(Supplemental Figure S2.2). The core structure for this family of compound is
sulfanilamide (Figure 2.1B) (Prabhu et al., 1997; Prabhu et al., 1998), a compound
not found in the LATCA library. When tested, sulfanilamide did not exert as strong of
an effect compared to other sulfonamides, and required a much higher concentration
29
to exert an effect on hypocotyl elongation (Figure 2.1C, Supplemental Figure S2.1).
This indicates that the R-group plays a role in determining the efficacy of the
sulfonamide. Since sulfamethoxazole (SMX) exerted the strongest effect, it was
chosen for use in subsequent experiments. This enabled experiments to be carried
out at lower working concentrations of the chemical, which helped reduce any off-
target effects of the sulfonamide.
2.3.2 Sulfamethoxazole impinges on sucrose-mediated development
through inhibition of Dihydropteroate Synthase (DHPS)
Sulfonamides are a class of compounds known to inhibit the tetrahydrofolate (THF)
biosynthetic pathway by competing with para-amino benzoic acid (pABA) for the
active site of dihydropteroate synthase (DHPS; Figure 2.2A) (Prabhu et al., 1997;
Prabhu et al., 1998; Storozhenko et al., 2007). DHPS is an enzyme that combines
dihydropterin and pABA to form dihydropteroate, which is then polyglutamylated and
reduced to form THF (Hanson and Gregory, 2002). THF exists bound to C1 units at
various oxidation states, collectively termed folates, and acts as a cofactor in a
variety of single-carbon transfer reactions (C1 metabolism) (Hanson and Roje, 2001;
Hanson and Gregory, 2002).
Though sulfonamides have previously been shown to inhibit DHPS (Prabhu et al.,
1997), it is possible that the compounds affected other processes as well, or that the
sulfonamides were metabolized to new compounds with alternate modes of action
(Zhao et al., 2007). It was therefore necessary to confirm that the phenotypes
observed were related to the inhibition of DHPS, rather than secondary effects of the
compound. To this end, chemical complementation was performed by
supplementing the growth medium with either pABA, or folic acid (FA). The addition
of the DHPS substrate (pABA) or product (FA) negated the inhibitory effect of SMX,
and rescued hypocotyl elongation (Figure 2.2, B and C). This was consistent with
30
Figure 2.1. Sucrose conferred hypersensitivity to sulfonamides. (A) Chemicals selected as positive hits based on the ability to act synergistically with sucrose to inhibit hypocotyl elongation in dark-grown seedlings. (B) Structures of five sulfonamides identified in the chemical screen, plus the core structure sulfanilamide. SNA, sulfanilamide; SMZ, sulfamerazine; SMX, sulfamethoxazole; SDZ, sulfadiazine; SMT, sulfameter; SMP, sulfamethoxypyridazine. (C) Dose-response curves of five sulfonamides identified in original chemical screen and the core structure, sulfanilamide, indicate that the effect of sulfonamide on hypocotyl elongation is augmented by the presence of sucrose. Data represent the mean ±SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals.
31
Figure 2.2. Overview of C1 metabolism in plants. (A) Sulfamethoxazole inhibits dihydropteroate synthase (DHPS), an early step in tetrahydrofolate (THF) biosynthesis. (B-C) Supplementing media with either Folic acid or pABA rescues hypocotyl elongation. Dark-grown seedlings were raised in the presence of 30mM sucrose and SMX, as indicated. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals. Letters indicate values with statistically significant differences (P<0.05; ANOVA followed by Tukey’s b).
32
the fact that FA supplements the folate pool downstream of DHPS, and therefore
compensates for the effect of the compound. In the case of pABA, the effect of SMX
was likely reversed by out-competing SMX at the DHPS active site.
To verify that the inhibition of DHPS was modifying sensitivity to sucrose, the effect
of SMX was tested on plants with elevated DHPS activity. It was reasoned that if
DHPS is the true target of SMX, then elevating DHPS abundance would confer
resistance to the compound. The Arabidopsis genome contains two DHPS isoforms,
one mitochondrial (At4g30000) and one cytosolic (At1g69190) (Storozhenko et al.,
2007); each was constitutively expressed under the control of the cauliflower mosaic
virus (CamV) 35S promoter in planta. Activity of the construct was confirmed by
measuring the expression of DHPS in three independently-transformed lines using
qPCR (Supplemental Figure S2.3A). Although constitutive expression of either
isoform attenuated the inhibitory effect of SMX at a lower concentration, higher
concentrations of sulfonamide still inhibited hypocotyl elongation at a level similar to
wild type (Figure 2.3, Supplemental Figure S2.3B). The need for higher
concentrations of SMX to produce an effect equivalent to wild type in plants over-
expressing DHPS was consistent with DHPS being the primary target for the
sulfonamide. As a means of explaining the heightened sensitivity to SMX conferred
by sucrose, it was hypothesised that sucrose negatively regulates DHPS and that
when growing in sucrose the seedlings simply have lower DHPS abundance. To test
this, the expression of both isoforms was measured in response to sucrose using
qPCR, and it was found that sucrose did not affect transcript abundance of either
DHPS isoform (Supplemental Figure S2.3C).
As plants that constitutively expressed the wild-type DHPS alleles maintained
sensitivity to higher concentration of SMX, an additional test was undertaken to
confirm that the binding of DHPS was necessary to confer sensitivity to sucrose.
Plants expressing a microbial sulfonamide-resistant (sul1) DHPS were used to
corroborate the mild resistance conferred by over-expressing the wild-type plant
DHPS. Consistent with the hypothesis that inhibition of DHPS by the sulfonamide
33
Figure 2.3. Enhanced DHPS activity attenuated the interaction between sucrose and SMX. Hypocotyls were measured from seven-day-old dark-grown seedlings raised in the presence of sucrose and SMX, as indicated. Plants constituvely expressing either the mitochondrial (35S::mDHPS) or the cytosolic (35S::cDHPS) isoform exhibited mild resistance to the synergistic effect of sucrose and SMX, compared to WT. Plants expressing the bacterial SMX-resistant DHPS (sul1) exhibited greater resistance than plants expressing wild-type plant alleles. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals. Letters indicate values with statistically-significant differences (P<0.05; ANOVA followed by Tukey’s b).
34
caused hypersensitivity to sucrose, plants harbouring the sul1 marker were highly
resistant to SMX (Figure 2.3, Supplemental Figure S2.3B). These plants exhibited a
markedly higher resistance to the sulfonamide, compared to the plant harboring the
wild-type DHPS alleles. Taken together, the chemical complementation assays and
resistance conferred by enhanced DHPS activity supported the notion that the
inhibition of DHPS caused heightened sensitivity to sucrose.
2.3.3 Changes in transcript abundance of specific auxin signal
transduction components occurs in response to the combined
action of SMX and sucrose
The transcriptome-level responses of seedlings to sucrose and SMX were examined
by microarray analysis. Concentrations of sucrose and SMX were identified that had
no effect on hypocotyl elongation when administered separately (10mM sucrose,
0.2µM SMX), but inhibited elongation when they were present together in the growth
media (Figure 2.4A). When the relationship between these treatments was tested
using a two-way analysis of variance (ANOVA), it was determined that the effect
sucrose and SMX exhibited an interaction (P<0.01). These treatments were then
used as the basis for a microarray experiment aimed at uncovering changes in the
transcriptome that may underpin this interaction. Total RNA was extracted from
three-day-old dark-grown seedlings that were cultured in MS growth media alone, or
in media supplemented with sucrose, SMX, or a combination of sucrose and SMX.
Thus, the experiment was designed as a 2 X 2 complete randomized factorial
ANOVA (two sucrose treatments and two SMX treatments). This enabled the
identification of genes with significant differential transcript accumulation in response
to either sucrose or SMX, independently of the other compound (main effects) or
whose response to SMX treatment was dependent on the presence or absence of
sucrose in the media (interaction).
Growth in the presence of 10mM sucrose promoted widespread changes to the
transcriptome, whereas treatment with 0.2µM SMX induced many fewer changes
35
Table I: Number of probe sets with significant main effect or interaction determined by ANOVAa
Effect Number of probe sets
Sulfamethoxazole main effect 12
Sucrose main effect 9292
Sucrose-sulfamethoxazole interaction 19
aBenjamini–Hochberg (BH) adjusted P < 0.1 (Benjamini and Hochberg, 1995).
36
Figure 2.4
37
Figure 2.4. Synergy between sucrose and SMX restricts the expression of a set of Aux/IAAs. (A) Concentrations of sucrose and SMX were determined which when administered independently induced no effect on hypocotyl elongation, yet inhibited it when administered together (10mM sucrose, 0.2µM SMX). Two-way ANOVA indicated an interaction between the two treatments (P<0.01); these conditions formed the basis of the microarray experiment to explore transcriptome-level changes that may underpin the interaction. (B) Three Aux/IAAs identified by ANOVA exhibited sucrose-dependent responses to SMX (IAA3, IAA6, and IAA29). IAA19 transcript abundance responded synergistically to co-treatment with sucrose and SMX. Transcript abundance values are displayed in log2 scale. (C) Heatmap includes 117 probe sets that correspond to transcripts identified for which the effect of sucrose and SMX together (columns 9-12) was at least two-fold greater than the additive effect of treatment with SMX alone (columns 4-6) and sucrose alone (columns 7-9). Each column corresponds to a discrete biological sample and all treatments are presented as biological triplicate replicates. Red indicates higher, and blue indicates lower, levels of transcript abundance. Hierarchical clustering performed using Pearson correlation coefficients, and data are row-normalized to identify trends in transcript abundance across treatments irrespective of absolute abundance. (D-E) In the absence of SMX, IAA6::GUS and IAA19::GUS expression is observed throughout the hypocotyl tissues of seven-day-old dark grown seedlings; co-treatment of sucrose and SMX caused a restriction of reporter expression. Images were taken along the centre of the hypocotyl, midway between the shoot apical meristem and the root-hypocotyl junction. Scale bar, 50µm.
38
transcript abundance profile (Table 2.1). A total of 9292 transcripts had significant
changes in abundance in response to sucrose, independently of the presence of
SMX. In contrast, the effect of SMX was modest: 12 transcripts exhibited altered
abundance in response to the chemical and there was no apparent trend towards a
specific signalling pathway or developmental response. The sucrose-dependent
effect of SMX (interaction) was significant for 19 transcripts (Supplemental Table
S2.2), including a number of cell-wall-related enzymes and three members of the
Aux/IAA family of transcriptional regulators: IAA3, IAA6, and IAA29. All three
Aux/IAAs exhibited decreased transcript abundance in response to co-treatment with
sucrose and SMX (Figure 2.4B).
Given the inhibitory effect that the combined treatment of sucrose and SMX had on
the hypocotyl length, compared to the effects of SMX alone, it was striking that so
few transcripts were identified for which this interaction was significant. We
hypothesized that the magnitude of the changes induced by the co-treatment may
differ from that induced by either sucrose or SMX alone; however, because of the
low power of the ANOVA and the stringency of corrections for multiple testing, these
effects may have been missed (Wilkins et al., 2010). For this reason, a second
approach was used to identify transcripts that exhibited synergistic responses to the
co-treatment with sucrose and SMX. Linear models were used to identify genes with
differential transcript accumulation in the presence of sucrose and SMX together
compared with their expression in the absence of either compound. From this set of
differentially accumulating transcripts, a subset of transcripts were identified for
which the effect of sucrose and SMX together was at least two-fold greater than the
additive effect of treatment with sucrose alone and SMX alone (synergy); 117
transcripts met this criteria (Supplemental Table S2.3). The abundance values for
these transcripts were row-normalised and visualised using a heat map, so that
trends in transcript accumulation across the four treatments could be observed,
irrespective of the absolute abundance (Figure 2.4C). Within this group, a fourth
Aux/IAA was identified that has previously been shown to regulate auxin responses
in the hypocotyl, IAA19/MSG2 (Tatematsu et al., 2004). Similar to the three
39
Aux/IAAs identified by the two-way ANOVA, IAA19 was characterised by decreased
transcript abundance in response to the co-treatment of sucrose and SMX (Figure
2.4B).
Promoter::GUS fusions were generated to assess the spatial regulation of each of
the four Aux/IAAs identified in the microarray analysis. The promoter region of each
gene was fused upstream of the uidA sequence, and GUS staining was assessed.
IAA6::GUS and IAA19::GUS showed expression patterns that were consistent with
the microarray analysis and supported the hypothesis that these Aux/IAAs may
regulate responses to SMX and sucrose in the hypocotyl. When grown in the
absence of SMX, the IAA6::GUS reporter showed a high level of expression
throughout the hypocotyl tissues (Figure 2.4D). The presence of SMX restricted
expression of the reporter when administered in the presence of sucrose, and the
interaction between sucrose and SMX can be seen in the expression of the reporter
at the four concentrations used in the microarray analysis (10mM sucrose, 0.2µM
SMX). Treating seedlings with both 10mM sucrose and 1µM SMX together
completely inhibited expression of the reporter in the hypocotyl, whereas treatment
with 1µM SMX in the absence of sucrose still allowed moderate expression. The
IAA19::GUS reporter exhibited expression throughout the hypocotyl, similar to the
IAA6::GUS line (Figure 2.4E). Treatment with SMX did not restrict IAA19::GUS
expression independently of the presence of sucrose; however, co-treatment with
sucrose resulted in expression of the construct exclusively in the vascular cylinder,
and inhibited expression in other tissues of the hypocotyl. Neither the IAA3::GUS nor
the IAA29::GUS reporter showed any change in expression within the hypocotyl
tissues in response to the treatments (Supplemental Figure S2.4). Changes in the
expression profiles of IAA3 and IAA29 were observed in other tissues, suggesting
that the sucrose-SMX interaction is not limited to the hypocotyl, and may be a more
general response throughout the plant.
40
2.3.4 Interaction between sucrose and SMX is dependent on auxin
transport and signal transduction
To test whether auxin transport is necessary to mediate the interaction between
sucrose and SMX, plants were grown in the presence of sucrose, SMX and/or the
inhibitor of polar auxin transport, naphthylphthalamic acid (NPA) (Morgan, 1964).
The presence of 1µM NPA in the growth media attenuated the interaction between
sucrose and SMX, and rescued hypocotyl elongation (Figure 2.5A). NPA also
affected hypocotyl elongation differently depending on whether sucrose was present
in the media or not. NPA restricted elongation in the absence of sucrose, yet exerted
no effect in its presence, suggesting that despite equal hypocotyl lengths, auxin
transport is regulated differentially between these two treatments. These data
support the findings of the microarray experiment, and suggest that the interaction
between folates and sucrose is dependent on polar auxin transport.
Given that SMX perturbs plant metabolism, it was hypothesised that the compound
affects auxin homeostasis, which might explain the changes in Aux/IAA transcript
abundance uncovered by the microarray experiment. To test this hypothesis, indole-
3-acetic acid (IAA) was extracted from dark-grown seedlings raised in the presence
of sucrose, SMX, or a combination of the two treatments, and quantified using liquid
chromatography-mass spectrometry (LC-MS). Seedlings were sampled after three
or seven days of growth, to assess changes in IAA abundance in response to growth
treatments across time. Though IAA levels were lower in samples taken after seven
days of growth, there was no change in IAA abundance in response to the growth
treatments (Figure 2.5B). Auxin was also quantified from seedlings grown in higher
concentrations of sucrose and SMX (30mM and 1µM, respectively) to test whether
there were concentration-dependent effects not observed at lower concentrations.
Similar to the trends observed at lower concentrations, higher levels of sucrose and
SMX did not affect IAA abundance (Supplemental Figure S2.5). It was concluded
that any changes in auxin activity suggested by the transcriptome analysis were
occurring independently of auxin levels.
41
As an alternate hypothesis, the role of auxin signal transduction in mediating
crosstalk between sucrose and SMX was explored. This genetic analysis made use
of mutants lacking the functional auxin signalling components IAA19 and ARF7.
IAA19 has an established role in mediating hypocotyl elongation in response to
auxin, and has been shown to interact with AUXIN RESPONSE FACTOR7 (ARF7;
(Tatematsu et al., 2004). A dominant-negative allele of IAA19, msg2, is able to
stably block auxin signal transduction, overcoming redundancy in the signalling
pathway (Tatematsu et al., 2004). Similarly, the ARF7-dependent signalling pathway
can be shut down by loss-of-function mutations in ARF7. Though many arf mutants
do not exhibit mutsant phenotype due to functional redundancy, arf7 loss-of-function
mutants display reduced auxin sensitivity and tropic responses in the hypocotyl,
suggesting that ARF7 may promote specific and partially non-redundant functions in
auxin responses (Okushima et al., 2005). Both the dominant-negative msg2 allele
and the arf7 loss-of-function mutants were resistant to the inhibition of hypocotyl
elongation induced by the action of SMX and sucrose (Figure 2.5C). These findings
support the hypothesis that the interaction between sucrose and SMX is dependent
on auxin signalling, and that phenotypes observed in the hypocotyl are likely related
to the activity of the ARF7-dependent auxin response pathway.
Having established that co-treatment with sucrose and SMX perturbed auxin
signalling, it was hypothesised that treatment with folic acid would alter seedling
responses to auxin. Treatment with exogenous IAA inhibits hypocotyl elongation in
dark grown seedlings (Tatematsu et al., 2004). This hypothesis was not supported,
in that supplementing the growth media with concentrations of FA up to 50µM did
not alter responses to exogenous auxin (Supplemental Figure S2.6). Similar findings
were observed using lines with enhanced DHPS activity, where heightened DHPS
expression had no effect on exogenous auxin (Supplemental Figure S2.7), indicating
that DHPS itself is not directly involved in auxin signalling. Taken together, it is
concluded that though folates may be necessary to maintain normal endogenous
auxin signalling, they are not sufficient to alter seedling responses to exogenous
IAA.
42
Figure 2.5
43
Figure 2.5. Auxin transport and signalling mediate synergy between sucrose and SMX. (A) Blocking polar auxin transport with NPA attenuated the synergistic effect of sucrose and SMX on hypocotyl elongation. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals (P<0.01; ANOVA followed by Tukey’s b). (B) Indole-3-acetic acid (IAA) was extracted from three- and seven-day-old dark-grown seedlings, and quantified by LC/MS. No change in auxin abundance was observed in response to the sucrose or SMX treatments, though seedlings sampled after seven days of growth exhibited reduced auxin levels, on a per-gram fresh weight (FW) basis. Data represent the mean ± SD from three independent experiments (P<0.05; ANOVA followed by Tukey’s b). (C) The IAA19/ARF7 auxin signalling pathway is necessary for the interaction between sucrose and SMX. msg2 is a stable IAA19 allele resistant to degradation in the presence of auxin (Tatematsu et al., 2004), whereas arf7 is a loss-of-function mutant (Okushima et al., 2005). In both mutant backgrounds, synergy between sucrose and SMX is attenuated and hypocotyl elongation is rescued. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals. Letters indicate values with statistically significant differences (P<0.01; ANOVA followed by Tukey’s b).
44
2.3.5 Sucrose and SMX promote auxin signalling in vasculature tissues
of the hypocotyl
Two auxin-responsive reporter systems were used to assess changes in auxin
signalling and accumulation within the hypocotyl: DII-VENUS and DR5. The DII-
VENUS system was created by fusing the degron motif of Aux/IAA28 to the VENUS
fluorescent protein (Brunoud et al., 2012). Due to the auxin-sensitive degron, the
reporter is degraded in the presence of auxin. Consequently, cells with greater auxin
concentrations have lower abundance of the reporter (Brunoud et al., 2012). Thus,
the DII-VENUS reporter system inversely tracks the distribution of auxin in plant
tissues (Brunoud et al., 2012). By contrast, intensity of the reporter in the DR5
system is greater in cells where auxin is being perceived. The DR5 system consists
of tandem repeats of the Auxin-responsive element (AuxRE) fused to a minimal
promoter (Ulmasov et al., 1997), driving the expression of a reporter gene (Sabatini
et al., 1999).
When raised in the absence of sucrose, the DII-VENUS lines showed expression of
the reporter in the nuclei of cells along the centre of the hypocotyl, in what appears
to be the vasculature. In the absence of sugar, the reporter was observed along the
vasculature region irrespective of the presence of SMX. Seedlings grown in the
presence of both sucrose and SMX exhibited less expression of the reporter in the
vascular region, and at higher concentrations of SMX, expression of the reporter
was greatly restricted (Figure 2.6A).
Fluorescence intensity was quantified to assess tissue-specific changes in auxin
distribution in response to sucrose and SMX. The fluorescence intensity of nuclei
from vascular cells relative to those of ground tissue cells was represented as a
ratio, where a value of 1 indicated equal distribution across vascular and ground
tissues. In the absence of sucrose, the ratio of fluorescence remained close to 1,
irrespective of the presence of SMX. This indicated that auxin remained evenly
distribution between the tissues of the hypocotyl. SMX caused a decrease in
fluorescence in the vasculature, indicated by a reduced ratio of intensity between
45
vasculature and ground tissues when sucrose was present. These data support the
qualitative assessment that auxin appears to accumulate preferentially in the
vascular tissues in response to sucrose and SMX.
Auxin signalling as indicated by the DR5 reporter system was consistent with the
trends observed using the DII-VENUS system. Treatment with either SMX or
sucrose individually did not induce expression of the DR5::GUS reporter, nor was
expression observed in response to the combined treatments of sucrose and SMX at
lower concentrations (Figure 2.6B). In contrast, expression of the reporter appeared
within the vascular region of plants treated with 1µM SMX, but only in the presence
of sucrose. Taken together, the reporter systems indicate that the interaction
between sucrose and SMX promotes auxin accumulation in the vasculature of the
hypocotyl.
Based on these data, a model is proposed in which folate deprivation caused by
SMX results in changes to auxin distribution. Treatment with SMX resulted in auxin
becoming localised to the vasculature, where IAA19/ARF7-dependent signalling
mediates responses to auxin and inhibits hypocotyl elongation (Figure 2.6C). The
accumulation of auxin in the vasculature is likely the result of transport from other
tissues, as evidenced by the attenuation of this affect by treatment with NPA.
2.4 DISCUSSION
Combination chemical genetics can be used to overcome genetic redundancy and
probe molecular pathways for interaction (Lehar et al., 2007; Lehar et al., 2008). By
screening for compounds that act synergistically on a given phenotype, connectivity
between targeted pathways can be explored (Lehar et al., 2007; Lehar et al., 2008).
As exogenous sucrose exerts a mild restrictive effect on etiolated hypocotyl
elongation, it was reasoned that sucrose could be used as the base compound in a
combination chemical screen to identify pathways that modify sugar perception.
Through this screen, an interaction between folate biosynthesis and sucrose
signalling was uncovered. These two pathways appeared to influence auxin
46
Figure 2.6
47
Figure 2.6. Co-treatment of sucrose and SMX promotes auxin signalling in the hypocotyl. The DII-VENUS reporter system exhibited high levels of fluorescence in the vascular region of the hypocotyl. Treatment with SMX and sucrose caused a decrease in VENUS fluorescence, yet this effect was not observed when seedlings were treated with SMX or sucrose alone. White numbering indicates the ratio of fluorescence intensity in to vasculature relative to the ground tissues, mean±SD for at least ten individuals. Fluorescence decreased preferentially in the vasculature compared to the ground tissues (A). Scale bar, 100µm. DR5::GUS expression was observed in the hypocotyl vascular region during growth in the presence of both sucrose and SMX, suggesting auxin signalling is enhanced by the combined action of these two treatments (B). Scale bar, 50µm. Images were taken along the centre of the hypocotyl, midway between the shoot apical meristem and the root-hypocotyl junction. A proposed model depicting changes in auxin distribution that may underpin the sucrose-SMX interaction (C). In the absence of SMX, auxin is evenly distributed at low concentrations throughout the hypocotyl. SMX causes auxin accumulation in the vasculature, resulting in hypocotyl inhibition via IAA19/ARF7 signalling.
48
signalling through the regulation of a subset of Aux/IAAs. In this sense, the
metabolic system has been perturbed by restricting folate biosynthesis, and a small
and clearly defined signalling mechanism was changed as a result. Metabolic,
hormonal and developmental pathways represent a web of interconnected signalling
processes that are integrated to shape growth and development, and it is possible
that during normal seedling development folates and sucrose act in concert to shape
auxin distribution and sensitivity.
Forward genetic studies have been widely implemented to uncover the genetic basis
for plant responses to sugars, and have proven successful in uncovering multiple
sugar perception and signalling pathways (Jang et al., 1997; Zhou et al., 1998; Xiao
et al., 2000; Rook and Bevan, 2003; Rook et al., 2006). Despite these successes,
this approach is often limited by an inability to uncover mutant phenotypes masked
by genetic redundancy, where a loss in the activity of one gene through mutation
can be compensated by the activity of a related gene (McCourt and Desveaux,
2010; Toth and van der Hoorn, 2010). The Arabidopsis genome contains two
isoforms of DHPS (Storozhenko et al., 2007), which may explain why dhps mutants
have not been uncovered in screens for sugar-sensitive mutants, as it is possible
that either isoform is sufficient to maintain wild-type levels of metabolic flux through
the THF biosynthetic pathway. The general inhibition by sulfamethoxazole is
believed to restrict the activity of both isoforms equally, and thus promote a
phenotypic response while maintaining seedling viability. In this sense, treatment
with sulfamethoxazole promoted a phenotype analogous to a double “knockdown”
mutation that uncovered a role for DHPS in mediating sucrose responses.
Though this study highlights a novel role for DHPS during seedling development, the
effects of the folates in shaping plant growth have been well documented
(Storozhenko et al., 2007; Van Wilder et al., 2009; Mehrshahi et al., 2010;
Srivastava et al., 2011). A direct connection between folate and sucrose was
observed by Mehrshahi et al. (2010), who uncovered an important role for
folylpolyglutamate synthetase (FPGS) across many facets of plant development,
including hypocotyl and root elongation (Mehrshahi et al., 2010). Double fpgs2
49
fpgs3 mutants were seedling lethal, but could be partially rescued by the presence of
sucrose (Mehrshahi et al., 2010). To our knowledge, this finding represents the only
reported connection directly linking sucrose to the folate pool; however, most studies
involving folates were undertaken using light-grown materials, and it is possible that
the interaction between folates and photosynthetically-derived sugars underpin
some phenotypes observed in these studies.
Treating the aerial tissues of dark-grown seedlings with sucrose can induce
profound changes in morphology, such as the initiation of leaf development and root
elongation (Roldan et al., 1999). Though the promotion of these traits is generally
thought to be underpinned by changes in local auxin distribution (Reinhardt et al.,
2003; Grieneisen et al., 2007), no change in total auxin abundance was observed
during growth in the presence of sucrose. It is therefore possible that the promotive
effect of sucrose on the development of these traits is a result of a redistribution of
auxin, rather than de novo biosynthesis. Though auxin has been proposed not to
play a dominant role during etiolated hypocotyl elongation (Jensen et al., 1998), our
data suggest that the effect of sucrose and SMX on hypocotyl elongation is
dependent on polar auxin transport. If sucrose is indeed promoting a change in
auxin distribution, then this may explain why blocking polar auxin transport
attenuated the interaction between sucrose and SMX.
Consistent with the notion that sugars promote auxin activity, sucrose conferred
hypersensitivity to exogenous IAA (Supplemental Figure S2.5). As sugars can
promote the development of traits often associated with auxin, such as leaf
development and root elongation (Roldan et al., 1999; Kircher and Schopfer, 2012),
this hypersensitivity to auxin may underpin some developmental responses to
sucrose. Though the treatments used in this study did not affect total auxin
abundance, recent studies highlight the influence of sugars on auxin accumulation
during seedling development (Lilley et al., 2012; Sairanen et al., 2012). The notion
that sucrose promotes auxin activity in etiolated seedlings is supported by the
observation that transcript abundance of many auxin-related signalling components
was changed by growth in the presence of sucrose (Supplemental Table S2.4).
50
Folate deprivation resulted in changes to auxin distribution, resulting in the inhibition
of hypocotyl elongation. Quantifying DII-VENUS expression indicated a preferential
accumulation of auxin in the vascular tissues, relative to ground tissues, in response
to SMX. It is possible that folates are especially important in the vasculature, and
that phenotypic responses to folate deprivation are a result of tissue-specific
signalling. Blocking the effect of SMX with NPA suggests that auxin may be
transported from neighbouring tissues to the vasculature in response to the
sulfonamide, though the possibility that differential rates of auxin synthesis and
metabolism between tissue types is contributing to this distribution cannot be ruled
out. Though folates are not sufficient to alter responses to exogenous IAA, they are
necessary to maintain normal auxin signalling during etiolated hypocotyl elongation.
It may be that auxin inhibits hypocotyl elongation by signalling in the ground tissues,
or through signalling pathways not influenced by folates.
Aux/IAAs are core components of auxin signal transduction that negatively regulate
auxin signalling through their interaction with Auxin Response Factors (ARFs)
(Hagen and Guilfoyle, 2002; Liscum and Reed, 2002; Tiwari et al., 2003). In the
presence of auxin, Aux/IAAs are degraded, allowing ARFs to mediate transcription
of auxin-responsive genes (Tiwari et al., 2001; Liscum and Reed, 2002). The four
Aux/IAAs identified in the microarray analysis have previously been shown to
regulate hypocotyl elongation (Kim et al., 1996; Reed et al., 1998; Tatematsu et al.,
2004; Koini et al., 2009). IAA3/SHY2 and IAA6/SHY1 were originally identified in
genetic screens for suppressors of the long-hypocotyl phenotypes of phyB and hy2,
respectively (Kim et al., 1996; Reed et al., 1998). In both cases, dominant alleles
were isolated that suppress hypocotyl elongation, and were posited to impinge on
light-mediated hypocotyl elongation (Kim et al., 1998; Reed et al., 1998).
IAA19/MSG2 was identified in a screen for mutants exhibiting auxin insensitivity in
the hypocotyl, and has been shown to mediate tropic responses (Tatematsu et al.,
2004; Saito et al., 2007). Though less is known about the specific role of IAA29, a
study into plant growth at high temperatures found that IAA29 mediated hypocotyl
elongation in response to heat stress (Koini et al., 2009). In a number of different
51
contexts, these Aux/IAAs have been found to regulate hypocotyl development in
response to both environmental and endogenous stimuli, suggesting that perhaps
they might serve as a point of integration for multiple regulatory inputs.
Transcriptional reporters for each of the four Aux/IAAs identified by the microarray
experiment supported the hypothesis that interplay between sucrose and SMX
impinged on the expression of these Aux/IAAs. The IAA6::GUS reporter exhibited
marked changes in activity throughout the hypocotyl, suggesting this regulator may
play a more prominent role in the hypocotyl phenotype observed by treatment with
SMX and sucrose. Similarly, altered IAA19::GUS expression was observed in the
ground tissues of the hypocotyl. These changes were similar to those reported by
Saito et al. (2007), who observed that during tropic responses, IAA19 expression
was observed in expanding cells of the hypocotyl ground tissue layers, and inhibited
in cells that were restricted in elongation (Saito et al., 2007). Perhaps this regulation
underpins the short-hypocotyl phenotype, as a restriction of IAA19 expression may
result in an inhibition of cell expansion throughout the ground tissues of the
hypocotyl. Given that the transcription of Aux/IAAs is activated by auxin (Abel et al.,
1995), it may be that the decrease in IAA6::GUS and IAA19::GUS expression in the
ground tissue, and the concomitant increase in IAA19::GUS expression in the
vascular tissues, indicated a change in auxin distribution (Figure 2.6C). In this
model, auxin becomes transported from the ground tissue to the vasculature, where
IAA19/ARF7-dependent signalling occurs to restrict hypocotyl elongation. The
genetic and pharmacogenetic analyses supported this hypothesis, as either the
inhibition of polar auxin transport or the inactivation of the IAA19/ARF7 signalling
pathway resulted in insensitivity to the sucrose-SMX interaction.
Given the high level of redundancy within the Aux/IAA gene family (Overvoorde et
al., 2005), it is possible that all four Aux/IAAs uncovered by the array analysis act in
concert to modify plant growth in response to metabolic cues. Changes to Aux/IAA
transcript abundance has been observed in response to treatment with hormones
(Nakamura et al., 2003), as well as changes to nutrient status (Falkenberg et al.,
2008), and may offer a point of crosstalk through which other pathways may modify
52
auxin signalling (Nakamura et al., 2003). By adjusting the abundance of these
negative regulators, it may be possible that nutrient status can adjust auxin
sensitivity. Currently, the mechanism through which SMX promotes changes to
Aux/IAA abundance remains unclear, and whether the compound directly regulates
Aux/IAA transcript levels, or whether the changes in overall transcript abundance are
a result of changed auxin distribution in the seedling, remains to be tested. Future
work will explore the mechanisms through which auxin signalling and distribution are
regulated in response to metabolic cues during seedling development.
2.5 MATERIALS AND METHODS
2.5.1 Plant material and growth conditions
Wild-type Arabidopsis thaliana, ecotype Columbia-0 (Col-0), seeds were obtained
from the Nottingham Arabidopsis Stock Centre (NASC); all transgenic lines and
mutants are of the Columbia ecotype. Plants harbouring the DR5::GUS construct
were described previously (Sabatini et al., 1999), as were the dominant-negative
IAA19 allele (msg2) and the arf7 loss-of-function mutants (Tatematsu et al., 2004;
Okushima et al., 2005). All plant materials were grown in Conviron growth cabinets
(Conviron, Winnipeg, Canada) at 21ºC in a 16/8hr photoperiod at 135µmol m-2 s-1.
2.5.2 Chemical screen
Seeds were sown in 96-well microtiter plates containing 200µL 1X Murashige and
Skoog (MS) liquid growth media (Murashige and Skoog, 1962), with alternate rows
supplemented with 30mM sucrose. Gamborg’s vitamin solution (Sigma-Aldrich,
Oakville, Canada) was added (0.1% v/v) after autoclaving the media (Gamborg et
al., 1968). Chemicals were drawn from the Library of Active Compounds in
Arabidopsis (LATCA), provided by Dr Sean Cutler (UC Riverside), and adjusted to a
final concentration of 2.5µM in each well. Approximately twenty seeds were added to
each well in the microtiter plate. The plates were wrapped in aluminium foil and cold
stratified at 4C, after which they were exposed to six hours of light to promote
53
germination, rewrapped in the foil, and then transferred to the growth chamber. After
seven days in the growth cabinet, the microtiter plates were unwrapped, the growth
media was drawn from the wells, and the seedlings were fixed by adding
approximately 250µL Farmer’s Fixative (3:1, ethanol:acetic acid) to each well,
ensuring that all seedlings were entirely submersed in the fixative. Upon rehydration
using autoclaved dH20, seedlings were aligned on agarose plates and photographed
using a Canon EOS Rebel XT EF-S 18-55 digital camera. Hypocotyl lengths were
measured using ImageJ software (rsbweb.nih.gov/ij/).
2.5.3 Dose response curves and chemical treatments
Dose-response curves and chemical complementation analyses made use of a
concentrated stock solution of each chemical, dissolved in dimethylsulfoxide
(DMSO). Experimental concentrations were adjusted from this stock solution by
dilution in sterile liquid growth media. An equivalent volume of DMSO was added to
MS medium as a control. Seeds were sterilized as described above, and sown in
24-well microtiter plates in 2mL full strength MS growth media supplemented with
the experimental treatments (Murashige and Skoog, 1962). Plates were then
wrapped in light-blocking foil, and cold-stratified for three days at 4ºC. After
stratification, plates were unwrapped and exposed to light for six hours to promote
germination. Plates were wrapped in foil, and transferred to a Conviron growth
cabinet (Conviron, Winnipeg, Canada) at 21ºC in a 16/8hr photoperiod at 135µmol
m-2 s-1. After seven days of growth in the cabinet, seedlings were fixed, aligned on
agarose plates, and measured as described above.
2.5.4 Tissue preparation, RNA extraction, and microarray analysis
Seedlings (Col-0) were grown in 24-well microtiter plates in MS liquid media
(Murashige and Skoog, 1962), supplemented with 10mM sucrose, 0.2µM
sulfamethoxazole, or both 10mM sucrose and 0.2µM sulfamethoxazole together.
Four plates, comprising three experimental treatments and one non-treatment
control, were prepared together using sterilized seeds as described above. The four
54
plates were each individually wrapped in light-blocking foil, and cold-stratified at 4ºC
for three days. The plates were then unwrapped and exposed to light for six hours to
promote germination, after which they were wrapped and placed in a Conviron
growth chamber (Conviron, Winnipeg, Canada) as described above. Together,
these four plates comprise one biological replicate; the experiment was repeated
three times to generate three biological replicates for the microarray experiment.
After three days of growth, hundreds of seedlings were harvested from each plate
under a green safelight, snap frozen in liquid nitrogen, and ground to a fine powder
in a mortar and pestle. RNA was extracted using the RNeasy RNA extraction kit
(Qiagen, Mississauga, Canada), and was precipitated overnight in 3M NaAc at -80ºC
to achieve concentrations necessary for prehybridization procedures. RNA quality
was determined electrophoretically. For each sample, 5μg of total RNA was reverse
transcribed (SuperScript II; Invitrogen), labeled and hybridized to the Arabidopsis
ATH1 Genome Array according to manufacturer’s protocols (Affymetrix) at the
Centre for the Analysis of Genome Evolution & Function at the University of Toronto,
Canada.
GeneChip data analysis was performed using the Bioconductor suite (Gentleman et
al., 2004) in R statistical programming language (R Development Core Team, 2009;
http://www.R-project.org) using the affy package (Gautier et al., 2004). All 12 arrays
were pre-processed together using GC-robust multi-array analysis (gcrma) (Wu et
al., 2004). Expression data were filtered to remove probe sets which reported low
transcript abundance and low variance across all arrays (minimum intensity of 100
on at least two arrays, minimum inter-quartile range of 0.5 on the log2-scale). The
pre-processed data were analysed as a 2 X 2 factorial complete randomized
ANOVA using the linear model for microarray (limma) package in R (R Development
Core Team, 2009). The linear model was parameterized by group means with a
manually defined sum-to-zero contrast matrix to test directly for the contrasts of
interest: the main and interaction effects overall, as well as the effect of the co-
treatment with sucrose and SMX. A Benjamini-Hochberg false discovery rate of 0.1
was applied to the output of all tests (Benjamini and Hochberg, 1995). Data,
55
description of the experimental design and methods are available for download as
GEO accession GSE37484.
2.5.5 Quantitative RT-PCR
Total RNA was prepared as described above, except that RNA was treated with
DNAse to reduce risk of amplification from genomic DNA. A total of 4µg RNA was
used for cDNA synthesis from oligo(dT)18 with SuperScript II Reverse Transcriptase
(Invitrogen), following the manufacturer’s instructions. Real-time quantitative PCR
(qRT-PCR) was performed using the iCycler iQ real-time PCR detection system
(Bio-Rad, Toronto, Canada). The relative abundance of cDHPS and mDHPS
transcripts were determined by the Pfaffl method (Pfaffl, 2001), using ACTIN2 as a
reference gene. A melting curve was performed to assess primer specificity. The
primers used were as follows: mDHPS FW5’TGTTGATAATGATACAGTTGC3’,
RV5’CTCAAGTAGAGTTCAGAAGCA3’, cDHPS
FW5’GACTATGGGATCAGTGTAACC3’, RV5’CCTTTGTATAATACCGTCTTT3’,
ACT2 FW5’GGCTCCTCTTAACCCAAAGGC3’,
RV5’CACACCATCACCAGAATCCAGC3’.
2.5.6 Creation of GUS reporter constructs and histochemical analysis
Four IAA promoter::GUS constructs were created using the Clontech In-Fusion
reporter system (Clontech). For each construct, primers were designed to amplify
2kb upstream of the transcriptional start site from genomic Columbia DNA, as
follows: IAA3 (At1g04240),
FW5’CCGGCGCGCCAAGCTGTCATTGGTTACACGTGTACG3’,
RV5’GATCTACCATGTCGAAACTTTGAGGCAAAAGTGTGT3’, IAA6 (At1g52830),
FW5’CCGGCGCGCCAAGCTTTCTCTCCCTCGCAAATGTCT3’,
RV5’GATCTACCATGTCGAATCTTGCTGGAGACCAAAACC3’, IAA19 (At3g15540),
FW5’CCGGCGCGCCAAGCTATCCTTGAGACTTGTAATATT3’
RV5’GATCTACCATGTCGAATTGTAGTAATGGCACCGCGT3’, IAA29
(At4g322290), FW5’CCGGCGCGCCAAGCTAACAAAACATATGTCAATGTC3’,
56
RV5’GATCTACCATGTCGAGAATTAGAGGATCATGAGTAT3’. These PCR
products were incorporated into a modified pCAMBIA1390 by homologous
recombination, directly upstream of the uidA sequence. These plasmids were
introduced into E. coli by heat shock for amplification of plasmids, which were then
extracted using a miniprep kit (Qiagen, Mississauga, Canada) and sequenced to
ensure accuracy. These plasmids were transformed into Agrobacterium tumefaciens
strain GV3101 by heat shock method. Arabidopsis ecotype Columbia was then
inoculated using the floral dip method (Clough and Bent, 1998). Successful T1
transformants were selected by growth on medium containing 25µg/mL hygromycin.
To facilitate GUS staining, seedlings were immersed in 90% Acetone at -20ºC for 20
minutes, followed by two rinses in 50mM sodium phosphate buffer to remove
acetone. GUS expression was assessed by incubating seedlings at 37ºC in GUS
buffer containing 50mM sodium phosphate, pH7, 1mg/mL (w/v) 5-bromo-4-chloro-3-
indolyl-β-D-glucoronic acid (X-GLUC; Sigma-Aldrich, Oakville, Canada), 0.5mM
K3Fe(CN)6, 0.5mM K4Fe(CN)6, 10mM EDTA. Staining times vary between
constructs. IAA6::GUS was incubated for 16hrs; IAA19::GUS and DR5::GUS were
incubated for 24hrs. After staining, seedlings were rinsed in autoclaved dH20,
followed by fixation in FAA (50% ethanol, 10% acetic acid, 10% formaldehyde).
Tissues were cleared using a chloral hydrate solution (125g chloral hydrate in 50mL
30% glycerol solution) as described previously (Willemsen et al., 1998). Seedlings
were observed using an Olympus BX5 microscope (Olympus), and images were
captured with a QImaging MicroPublisher 3.3RTV digital camera using QCapture
version 2.7 software.
2.5.7 Confocal microscopy
The DII-VENUS reporter was visualised using a Leica SP5 confocal microscope
(Leica, Mannheim, Germany). An argon laser at 514nm was used for excitation while
emittance was measured at wavelengths between 518nm and 560nm (Yellow
Channel/VENUS) and between 595nm and 690nm (Red Channel/PI). Hypocotyls
were counter-stained with propidium iodide by transferring seedlings to the
57
appropriate growth media containing 10µg/mL prodidium iodide (PI; Sigma-Aldrich,
Oakville, Canada). This was performed under a green safe light, while being
cautious to disturb the seedlings as little as possible. Images were prepared using
Leica Application Suite Advanced Fluorescence – Lite (Leica). Fluorescence was
quantified using ImageJ. The intensities of at least ten randomly-selected nuclei
were quantified from both the vasculature and the ground tissue. For each nucleus,
a neighbouring region was also measured for intensity to subtract background noise.
A ratio of intensity of vasculature cells and the ground tissue cells was generated for
ten individuals and averaged for each treatment.
2.5.8 Auxin quantification
Indole-3-acetic acid (IAA) was extracted from whole dark-grown seedlings after three
or seven days of growth using solid phase extraction as described by Preston et al.
(2009) with minor modifications (Preston et al., 2009). Approximately 10-15 mg of
frozen tissue was submerged in 1 mL of 80% (v/v) methanol containing 1% (v/v)
glacial acetic acid along with 300 pg of d2-IAA (Sigma-Aldrich) as an internal
standard. Tissues were disrupted in a TissueLyser II (Qiagen, Mississauga,
Canada), and stored at 4ºC overnight. The samples were centrifuged to remove
debris, and the pellet was washed twice. The supernatant was evaporated in a
SpeedVac, reconstituted in 1 mL of 1% (v/v) acetic acid, and passed through a pre-
equilibrated Oasis HLB column (Waters, Ireland) according to the manufacturer’s
instruction. The IAA fraction was washed with 1mL of water containing 1% (v/v)
acetic acid, and eluted with 1 mL methanol containing 1% (v/v) acetic acid. The
sample was evaporated in a SpeedVac and reconstituted in 1 mL of water
containing 1% (v/v) acetic acid. The resultants were applied to preconditioned Oasis
WAX columns (Waters, Ireland), washed with 1mL of methanol, and eluted with 1mL
of methanol containing 1% (v/v) acetic acid. The solvent was removed under
vacuum and subjected to the liquid chromatograph electronspray ionization tandem
mass spectrometry (LC-ESI-MS/MS; Agilent 6410 TripleQuad LC/MS system). An
LC (Agilent 1200 series) equipped with a 50 mm x 2.1 mm, 1.8-m Zorbax SB-
58
Phenyl column (Agilent) was used with a binary solvent system comprising 0.01%
(v/v) acetic acid in water (Solvent A) and 0.05% (v/v) acetic acid in acetonitrile
(Solvent B). Separations were performed using a gradient of increasing acetonitrile
content, and an initial flow rate of 0.2 mL min-1. The gradient was increased linearly
from 97% A, 3% B to 50% A, 50% B over 15 min, then acetonitrile content was
increased linearly to 98% over 1 min and held for 1 min. This condition was held for
an addition 0.5 min with an increased flow rate of 0.3 mL min-1. After 1 min, the initial
condition was restored and allowed to equilibrate for 7.5 min for the next analysis.
The retention time of IAA and d2-IAA was 11.6 min. MS/MS conditions were as
follows: capillary 4.0 kV; source temperature, 100 oC; desolvation temperature, 350
oC; cone gas flow, 0 L/min; desolvation gas flow, 12 L/min; fragmentor, 110; collision
energy, 18; polarity, positive; MS/MS transition, 178/132 m/z for d2-IAA and 176/130
m/z for endogenous IAA. A calibration curve was made using MassHunter software.
2.6 ACKNOWLEDGEMENTS
We are grateful to Joan Ouellette and Thanh Nguyen for excellent technical
assistance. We would also like to thank Hilda Doan and Ray Persaud for assistance
with data collection. We are grateful to Dr Kotaro Yamamoto for sharing previously-
published materials. The authors are also very appreciative for the thoughtful and
helpful commentary given by the anonymous reviewers.
59
2.7 SUPPLEMENTAL MATERIAL
Supplemental Figure S2.1. Sucrose confers hypersensitivity to sulfonamides. Dose-response curves for five sulfonamides identified in the chemical screen, plus the core structure sulfanilamide. Shown here are the effects of the compounds at higher concentrations than shown in the main body of the text.
60
Supplemental Figure S2.2. Osmotic environment does not affect sensitivity to SMX. Seven day-old etiolated seedlings grown in liquid media supplemented with sugar at 30mM. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals.
61
Supplemental Figure S2.3. Plants with enhanced DHPS activity exhibit resistance to the sucrose-SMX interaction. (A) Plants were transformed with constructs expressing either the cytosolic (cDHPS) or mitochondrial (mDHPS) isoform of Dihydropteroate synthase under the control of the 35S cauliflower mosaic virus promoter. Three independently-transformed lines were tested by qPCR to confirm elevated DHPS transcript abundance. (B) Plant lines expressing either the 35S::cDHPS or 35S::mDHPS construct were resistant to lower concentrations of SMX, yet succumbed to wild-type levels of inhibition at higher concentrations. Only the plant line expressing the microbial sulfonamide-resistant allele of DHPS (sul1) was resistant to SMX at all concentrations tested. Note: Only lines 35S::mDHPS-1 and 35S::cDHPS-1 were shown in the main body of the text. (C) The affect of sucrose on DHPS transcript abundance was assessed using qPCR; no significant change was observed (ANOVA, p<0.01).
62
Supplemental Figure S2.4. Sucrose and SMX do not affect IAA3::GUS and IAA29::GUS expression in the hypocotyl. Seven-day-old dark-grown seedlings were raised in the presence of sucrose and SMX, as indicated. IAA3::GUS did not exhibit staining in the hypocotyls in during etiolated growth in response to sucrose and SMX (A). IAA29::GUS was expressed faintly throughout the vascular region and was unaffected by presence of sucrose or SMX. Images were taken along the centre of the hypocotyl, midway between the shoot apical meristem and the root-hypocotyl junction. Scale bar, 50µm.
63
Supplemental Figure S2.5. Auxin abundance is unchanged by growth in the presence of sucrose and SMX. Indole-3-acetic acid (IAA) was extracted from seedlings grown in the presence of sucrose and SMX, and quantified by LC/MS. Seedlings were harvested after three or seven days of growth. Though seedlings harvested after seven days of growth tended to contain less auxin on a per-gram fresh weight (FW) basis, the treatments did not induce a significant change in auxin abundance (P<0.05; ANOVA followed by Tukey’s b).
64
Supplemental Figure S2.6. Folic acid is not sufficient to alter sensitivity to exogenous auxin, but does affect hypocotyl elongation in the absence of sucrose. Seedlings were grown in media containing sucrose and SMX, and supplemented with folic acid (FA), to explore whether treatment with FA alters responses to exogenous auxin. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals.
65
Supplemental Figure S2.7. Enhanced DHPS activity does not alter the effect of exogenous auxin on hypocotyl elongation. Transgenic lines with elevated DHPS expression were treated with indole-3-acetic (IAA) acid to explore whether DHPS plays a direct role in response to exogenous IAA. Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals. (P<0.01; ANOVA followed by Tukey’s b).
66
Supplemental Table S2.1
67
Supplemental Table S2.1 (Cont’d)
68
Supplemental Table S2.1. Chemical structures and seedling phenotypes. Chemicals were screened for inhibitory effects in the sucrose treatment that were less severe in the absence of sucrose. All chemicals were added at 2.5µM, in either the absence or presence of 30mM sucrose. One chemical, methacycline HCl, seemed to negate the restrictive effect of the sucrose, and is included here.
69
Supplemental Table S2.2. Probe sets with significant sucrose-SMX interaction.
AGI ID Annotation
At3g14210 ESM1 (epithiospecifier modifier 1); carboxylesterase/ hydrolase, acting on ester bonds
At2g43620 chitinase, putative
At1g74010 strictosidine synthase family protein
At1g08090 NRT2.1 (NITRATE TRANSPORTER 2:1); nitrate transmembrane transporter
At1g74460 GDSL-motif lipase/hydrolase family protein
At1g01990 Unknown protein
At5g64120 peroxidase, putative
At1g19380 unknown protein
At5g15290 integral membrane family protein
At2g01300 unknown protein
At4g12550 AIR1; lipid binding
At1g04240 IAA3/SHY2 (SHORT HYPOCOTYL 2); transcription factor
At2g32540 CSLB03; cellulose synthase/ transferase/ transferase, transferring glycosyl groups
At3g53980 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein
At5g48010 THAS1 (THALIANOL SYNTHASE 1); catalytic/ thalianol synthase
At4g32280 IAA29 (INDOLE-3-ACETIC ACID INDUCIBLE 29); transcription factor
At4g22610 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein
At2g17430 MLO7 (MILDEW RESISTANCE LOCUS O 7); calmodulin binding
At1g52830 SHY1/IAA6 (INDOLE-3-ACETIC ACID 6); transcription factor
70
Supplemental Table S2.3. Probe sets exhibiting synergy to co-treatment with sucrose and SMX. Values represent log2 fold change.
AGI ID Annotation Suc SMX Suc* SMX
At3g14210 ESM1 (epithiospecifier modifier 1) 1.16 0.87 7.07
At4g38080 hydroxyproline-rich glycoprotein family protein 2.65 0.12 6
At5g04120 phosphoglycerate/bisphosphoglycerate mutase 0.96 1.19 5.24
At1g74010 strictosidine synthase family protein 0.2 0.02 4.03
At1g08090 NRT2.1 (NITRATE TRANSPORTER 2:1); 0.4 0.21 3.9
At1g74460 GDSL-motif lipase/hydrolase family protein 0.51 0.5 3.77
At5g26220 ChaC-like family protein 0.44 0.26 3.4
At5g49520 ATWRKY48; transcription factor 0.65 0.51 3.4
At5g12420 unknown protein 0.2 0.58 3.02
At1g54970 RHS7 structural constituent of cell wall 1.05 0.02 3.01
At2g41730 unknown protein 0.81 0.6 2.96
At5g44550 integral membrane family protein 1.24 0.03 2.76
At5g40590 DC1 domain-containing protein -0.03 0.2 2.66
At4g38420 sks9 (SKU5 Similar 9); copper ion binding / oxidoreductase 0.42 0.34 2.64
At5g13900 LTP-family protein 0.72 0.03 2.4
At4g20390 integral membrane family protein 0.93 0.2 2.34
At5g09520 hydroxyproline-rich glycoprotein family protein 0.41 0.44 2.09
At2g22510 hydroxyproline-rich glycoprotein family protein 0.41 0.01 2.08
At2g04050 MATE efflux family protein 0.17 0.26 2.01
At4g38950 kinesin motor family protein 0.62 0.08 1.99
At1g05680 UDP-glucoronosyl/UDP-glucosyl transferase family protein -0.21 0.23 1.96
At2g47550 pectinesterase family protein 0.57 0.25 1.9
At5g19110 extracellular dermal glycoprotein-related / EDGP-related -0.32 0.37 1.87
At4g02330 ATPMEPCRB; pectinesterase 0.13 0.26 1.86
At3g30720 QQS (QUA-QUINE STARCH) -0.23 0.21 1.76
At3g20110 CYP705A20; electron carrier/ heme binding 0.52 0.13 1.72
At5g23940 EMB3009 (embryo defective 3009); transferase/ groups 0.53 0.03 1.68
At5g41610 CHX18__ATCHX18; cation:proton antiporter/ 0.28 0.04 1.45
At2g32020 GCN5-related N-acetyltransferase (GNAT) family protein 0.27 0.14 1.44
At1g12950 RSH2__MATE efflux family protein 0.28 0.08 1.37
At2g41090 calmodulin-like calcium-binding protein, 22 kDa (CaBP-22) 0.5 0.13 1.34
At2g41230 unknown protein 0.22 0.31 1.32
At3g26470 unknown; 0.01 0.11 1.3
At1g78340 ATGSTU22; glutathione transferase -0.6 0.54 1.29
At3g50400 GDSL-motif lipase/hydrolase family protein -0.1 0.35 1.28
At1g44830 AP2 domain-containing transcription factor TINY, putative 0.26 0.15 1.21
At5g44820 unknown protein -0.22 0.73 1.2
71
At5g52750 heavy-metal-associated domain-containing protein -0.1 0.53 1.17
At4g30280 XTH18 hydrolyzing O-glycosyl compounds 0.32 0.19 1.07
At1g68760 ATNUDX1 (NUDIX HYDROLASE 1) 0.36 0.08 1.03
At2g41100 ATCAL4__TCH3 (TOUCH 3); calcium ion binding -0.26 0.11 0.98
At1g54540 FUNCTIONS IN: molecular_function unknown; INVOLVED -0.12 0.23 0.94
At4g24120 YSL1 (YELLOW STRIPE LIKE 1); oligopeptide transporter 0.3 0.13 0.93
At5g54020 zinc ion binding 0.24 0.13 0.91
At5g66070 zinc finger family protein 0.21 0.17 0.9
At1g77670 aminotransferase class I and II family protein 0.32 0.03 0.86
At2g28710 zinc finger family protein 0.36 0.02 0.85
At2g37430 zinc finger family protein (ZAT11) 0.09 0.16 0.77
At4g39210 APL3; glucose-1-phosphate adenylyltransferase 0.09 0.11 0.76
At2g03670 CDC48B; ATP binding / nucleotide binding 0.22 0.11 0.75
At5g47250 disease resistance protein (CC-NBS-LRR class) 0.15 0.08 0.72
At5g14920 gibberellin-regulated family protein 0.01 0.12 0.65
At2g39200 MLO12 (MILDEW RESISTANCE LOCUS 12) -0.26 0.51 0.65
At3g19490 NHD1; potassium:hydrogen antiporter 0.16 0.06 0.64
At1g07570 APK1A; protein serine/threonine kinase -0.08 0.26 0.63
At3g62330 zinc knuckle (CCHC-type) family protein 0.07 0.01 0.58
At4g31930 MAM33 family protein -0.37 0.45 0.57
At5g58270 ATM3; ATPase, transporter 0.17 0.05 0.56
At5g13240 transcription regulator -0.23 0.06 0.53
At3g10720 pectinesterase, putative -0.42 0.13 0.53
At5g25440 protein kinase family protein -0.04 0.01 0.5
At5g40780 LTH1; amino acid transmembrane transporter -0.07 0.02 0.47
At4g31700 RPS6; structural constituent of ribosome 0.06 0.03 0.47
At3g54960 ATPDI1; protein disulfide isomerase 0.13 0.04 0.45
At2g36720 PHD finger transcription factor, putative 0.12 0.02 0.42
At5g49970 PDX3; pyridoxamine-phosphate oxidase -0.09 -0.01 -0.39
At4g35510 unknown protein -0.01 -0.04 -0.4
At1g25988 cell cycle control protein-related 0.12 -0.2 -0.45
At1g21880 LYM1 (LYSM DOMAIN GPI-ANCHORED PROTEIN 1) -0.14 -0.09 -0.48
At2g26710 CYP72B1_ BAS1; oxygen binding / steroid hydroxylase 0.14 -0.06 -0.51
At1g32700 zinc-binding family protein -0.15 -0.06 -0.53
At5g12960 catalytic 0.05 -0.13 -0.54
At3g06770 glycoside hydrolase family 28 protein 0.14 -0.23 -0.54
At4g21660 spliceosome associated protein-related -0.06 -0.06 -0.57
At1g09750 chloroplast nucleoid DNA-binding protein-related -0.2 -0.02 -0.59
At3g01670 unknown protein 0.42 -0.18 -0.63
At5g66910 disease resistance protein (CC-NBS-LRR class), putative -0.11 -0.07 -0.64
At4g31750 WIN2 (HOPW1-1-INTERACTING 2) -0.25 -0.04 -0.64
72
At2g01735 RIE1 (RING-FINGER PROTEIN FOR EMBRYOGENESIS) -0.05 -0.05 -0.67
At5g56040 leucine-rich repeat protein kinase, putative -0.21 -0.13 -0.68
At1g75380 wound-responsive family protein -0.06 -0.14 -0.68
At5g42130 mitochondrial substrate carrier family protein 0.06 -0.3 -0.7
At2g14680 MEE13__myosin heavy chain-related -0.27 -0.07 -0.74
At3g16940 calmodulin-binding protein 0.14 -0.05 -0.75
At2g21880 ATRABG2__ATRAB7A; GTP binding 0.02 -0.08 -0.77
At5g01270 ATCPL2__CPL2; double-stranded RNA binding -0.27 -0.06 -0.8
At3g29575 AFP3 (ABI FIVE BINDING PROTEIN 3) 0.13 -0.17 -0.81
At1g52190 proton-dependent oligopeptide transport (POT) -0.04 -0.07 -0.82
At1g80380 phosphoribulokinase/uridine kinase-related 0.13 -0.23 -0.83
At5g07680 ATNAC4; transcription factor -0.11 -0.15 -0.85
At1g01620 PIP1;3; water channel -0.08 -0.19 -0.89
At2g42160 zinc finger (ubiquitin-hydrolase) domain-containing protein -0.18 -0.17 -0.91
At3g15540 MSG2/IAA19 (INDOLE-3-ACETIC ACID INDUCIBLE 19) 0.08 -0.07 -0.93
At4g38050 transmembrane transporter -0.33 -0.07 -0.95
At5g60860 AtRABA1f; GTP binding -0.27 -0.08 -0.96
At1g49500 unknown protein -0.13 -0.17 -1.01
At5g56270 ATWRKY2__WRKY2; transcription factor -0.4 -0.04 -1.08
At3g06500 beta-fructofuranosidase, putative -0.32 -0.17 -1.08
At5g16600 AtMYB43 (myb domain protein 43); transcription factor -0.18 -0.27 -1.1
At1g18460 lipase family protein -0.31 -0.13 -1.1
At5g61250 AtGUS1 (Arabidopsis thaliana glucuronidase 1); -0.28 -0.24 -1.11
At2g03450 PAP9 (PURPLE ACID PHOSPHATASE 9 -0.1 -0.14 -1.15
At1g69570 Dof-type zinc finger domain-containing protein -0.29 -0.31 -1.22
At4g18780 ATCESA8_CESA8; cellulose synthase -0.3 -0.07 -1.23
At5g62100 ATBAG2 (BCL-2-ASSOCIATED ATHANOGENE 2) -0.35 -0.13 -1.36
At2g41640 transferase, transferring glycosyl groups -0.7 -0.06 -1.6
At4g25420 ATGA20OX1_GA5__GA20OX1; gibberellin 20-oxidase -0.08 -0.14 -1.64
At2g44230 unknown protein -0.4 -0.25 -1.64
At4g20840 FAD-binding domain-containing protein -0.56 -0.14 -1.74
At1g79410 AtOCT5; carbohydrate transmembrane transporter 0.11 -0.5 -1.78
At2g21820 unknown protein -0.61 -0.02 -2.21
At1g78970 ATLUP1__LUP1 (LUPEOL SYNTHASE 1) -1.01 -0.08 -2.57
At3g16690 nodulin MtN3 family protein -0.89 -0.35 -2.68
AtMg01370 ORF111D__hypothetical protein -0.42 -0.2 -2.74
At5g54250 CNGC4_DND2; calmodulin binding / cation channel -0.59 -0.05 -2.96
At2g20670 unknown protein -1.15 -0.63 -3.76
At3g47340 DIN6/ASN1 (DARK-INDUCED6) -1.99 -0.57 -5.79
73
Supplemental Table S2.4. Probe sets corresponding to core auxin signalling components with significant sucrose main effect. Included are all ARFs, PINs, Aux/IAAs, and TIR1/ABF receptors that exhibit significantly different transcript abundance as sucrose main effect.
AGI ID Annotation logFC
At4g32280 IAA29 -3.05944
At1g52830 SHY1/IAA6 -3.04908
At2g33310 IAA13 -1.28281
At5g60450 ARF4 -1.22406
At3g16500 IAA26 -1.18098
At5g43700 IAA4 -1.01689
At1g04550 IAA12 -0.7519
At4g14560 IAA1 -0.71296
At4g28640 IAA11 -0.68284
At1g04240 IAA3/SHY2 -0.64264
At1g34310 ARF12 -0.62344
At2g33860 ARF3 -0.49389
At2g22670 IAA8 -0.47739
At5g20730 ARF7 -0.47635
At3g15540 MSG2/IAA19 -0.38994
At1g51950 IAA18 -0.37328
At1g19850 ARF5/IAA24/MP 0.418896
At1g12820 AFB3 (AUXIN SIGNALING F-BOX 3); 0.425684
At3g23030 IAA2 0.448501
At1g19220 ARF19 0.519155
At4g03190 AFB1 0.559422
At5g65670 IAA9 0.600887
At3g62980 TIR1 0.70477
At5g57090 PIN2 0.742782
At5g62000 ARF1 0.842096
At1g54990 AXR4 (AUXIN RESISTANT 4) 0.978478
At1g73590 PIN1 1.165418
At2g38120 AUX1 1.209541
At1g23080 PIN7 1.268093
At5g49980 AFB5 1.289189
At1g77690 LAX3 1.349983
At3g26810 AFB2 1.602314
At1g70940 PIN3 1.713011
At4g23980 ARF9 1.717657
At2g01420 PIN4 1.71859
At1g30330 ARF6 1.889166
At5g37020 ARF8 2.306753
At5g62000 ARF2 6.019152
74
Chapter 3
Metabolite and hormone signalling is integrated at the
meristem to drive root growth
75
3 Metabolite and hormone signalling is integrated at the
meristem to drive root growth
3.1 ABSTRACT
Nutrient sensing at the root apex helps drive the meristematic activity that ultimately
shapes root growth. Given the sensitivity of the root meristem to changes in nutrient
abundance, as well as the established role that hormone signalling plays in
meristem development, the root meristem offers a unique platform through which the
interaction between metabolite- and hormone-signalling pathways can be explored.
Root elongation is inhibited in dark-grown seedlings, a characteristic of
skotomorphogenic development. Treatment with sucrose is sufficient to release this
inhibition and promote primary root elongation in dark-grown seedlings. This effect of
sucrose was associated with changes in hormone signalling at the meristem,
resulting in altered rates of cell division and differentiation that determine meristem
productivity. Recently, the folate biosynthesis inhibitor, sulfamethoxazole (SMX),
was found to perturb seedling responses to sucrose. This effect was related to
changes to auxin signalling and distribution. Here, SMX and sucrose were used to
probe the effect of metabolism on hormone signalling at the root meristem. SMX
treatment of dark-grown seedlings induced pleiotropic effects at the root meristem,
including a disruption of cell division and changes to hormone signalling. Prolonged
exposure to sucrose and SMX resulted in a complete differentiation of the meristem.
Taken together, these findings indicate that metabolic cues influence hormone
signalling pathways to promote division and differentiation, and in the absence of
metabolic inputs required to support division, the meristem succumbs entirely to
differentiation.
76
3.2 INTRODUCTION
Root growth is dependent on the activity of a small group of rapidly dividing cells at
the tip, called the root apical meristem (RAM(Beemster and Baskin, 1998; Scheres,
2007). As new cells are created through division at the RAM, other cells are
displaced from this region and enter into a phase of differentiation and elongation
(Scheres, 2007; Perilli et al., 2012). As displaced cells mature, they give rise to the
tissues that constitute a functional root organ (Perilli et al., 2012). The relative rates
of cell division and differentiation at the meristem determine its overall productivity
(Dello Ioio et al., 2007; Dello Ioio et al., 2008; Tsukagoshi et al., 2011), which is
tightly controlled by developmental and environmental cues (Bennett and Scheres,
2010; Ubeda-Tomas and Bennett, 2010; Tsukagoshi et al., 2011). The integration of
multiple signalling inputs enables plants to maintain optimal growth rates, and
establish root system architecture in response to an ever-changing environment
(Teale et al., 2008).
The high level of cellular activity at the root apex is dependent on nutrient acquisition
and metabolism, which support the rapidly dividing tissues (Francis and Halford,
2006). Consistent with this, supplying roots with metabolic products, such as sugars,
promotes root elongation (Baskin et al., 2001; Freixes et al., 2002). Sugars play
important roles in plant development as both structural components in cell walls, and
as sources of energy (Rolland et al., 2006); therefore, it is necessary for the plant to
detect the abundance of sugars to match growth rates with carbohydrate availability
(Smith and Stitt, 2007). Sugar perception and signalling pathways can modulate the
activity of other regulatory pathways (Moore et al., 2003; Mudgil et al., 2009). In this
manner, sugar signalling is integrated with environmental or endogenous signals to
mediate growth and development.
Sucrose can influence plant growth by promoting cellular proliferation through the
regulation of D-type and B-type cyclins, connecting primary metabolism to growth
and development (Riou-Khamlichi et al., 1999; Riou-Khamlichi et al., 2000; Skylar et
al., 2011). D-type cyclins are also under hormonal control and may offer a potential
77
point of crosstalk between hormone signalling and metabolic cues (Riou-Khamlichi
et al., 1999; Riou-Khamlichi et al., 2000). In addition, cyclinB1;1 is regulated by
sugar signalling in the shoot apical meristem (SAM), linking sugars to multiple
stages of cell-cycle progression, and across diverse tissue types (Skylar et al.,
2011). In the root, cyclinB1;1 also regulates rates of cell division in response to
hormone signalling, and contributes to the size of the root meristem (Ubeda-Tomas
et al., 2009; Gonzalez-Garcia et al., 2011; Hacham et al., 2011). Given that multiple
inputs regulate cyclin activity, cyclins may offer a point at which hormone signalling
and metabolic cues may be integrated to regulate plant growth.
A complex interaction of hormone signalling pathways converge at the root apex to
dictate meristematic activity (Ubeda-Tomas and Bennett, 2010; Perilli et al., 2012).
The regulation of cell division and differentiation is mediated through crosstalk
between auxin and cytokinin (Dello Ioio et al., 2008; Moubayidin et al., 2010). Auxin
is transported through the root vascular tissues by the concerted action of the PIN-
FORMED (PIN) family of auxin efflux carriers, resulting in a maximum at the root tip
(Sabatini et al., 1999; Aida et al., 2004; Blilou et al., 2005; Grieneisen et al., 2007).
The auxin maxima are important for establishing the quiescent centre, which
maintains the pool of stem cells in this location through positional cues (vandenBerg
et al., 1997; Aida et al., 2004; Blilou et al., 2005; Sarkar et al., 2007). Additionally,
the auxin gradient promotes cell division in the meristem, resulting in the proliferation
of cells that contribute to root growth (Galinha et al., 2007; Grieneisen et al., 2007).
Cytokinin signalling antagonises auxin at the transition zone, promoting
differentiation as cells mature and exit the meristematic region (Dello Ioio et al.,
2007; Moubayidin et al., 2010). Cytokinin signalling is mediated by the Arabidopsis
Response Regulators (ARRs) that act redundantly to promote (Type B) or
antagonise (Type A) cytokinin signalling pathways (To et al., 2004; Mason et al.,
2005). Cytokinin promotes differentiation at the transition zone by inducing the
expression IAA3/SHY2 (Dello Ioio et al., 2008), a negative regulator of auxin signal
transduction (Tian and Reed, 1999; Tian et al., 2002). IAA3/SHY2 inhibits the
expression of PIN1, PIN3, and PIN7 to restrict auxin flow to the root tip, resulting in
78
reduced rates of cell division (Dello Ioio et al., 2008; Perilli et al., 2012). In this
manner, crosstalk between cytokinin and auxin signalling influences the relative
rates of cellular division and differentiation that ultimately give rise to meristem size
and productivity (Dello Ioio et al., 2008; Moubayidin et al., 2009; Moubayidin et al.,
2010).
The elevated rates of cell division at the meristem represents a major investment of
energy and nutrients (Francis and Halford, 2006). To ensure that these resources
are sufficient to support growth, it is plausible that metabolite and hormonal
regulatory pathways are integrated to match rates of cell division with resource
availability (Francis and Halford, 2006). The joint regulation of cyclins by sugars and
hormones supports the notion that these two pathways are integrated to coordinate
growth. Consistent with this, recent findings have alluded to inputs derived from
primary metabolism in mediating root meristem activity (Srivastava et al., 2011). A
recent screen for mutants exhibiting reduced primary root elongation uncovered that
folates are necessary to maintain proper meristem organisation (Srivastava et al.,
2011), drawing a connection between folates and the regulation of root growth.
We recently reported on an interaction between sulfamethoxazole (SMX), a folate
biosynthesis inhibitor, and sucrose (Stokes, 2013). This interaction perturbed auxin
signalling and distribution during hypocotyl elongation (Stokes, 2013). Folates are
necessary for a wide variety of cellular processes including amino acid metabolism
and nucleotide biosynthesis, and are cofactors in one-carbon metabolism (Hanson
and Roje, 2001; Hanson and Gregory, 2002). Given the regulatory role of auxin at
the root meristem, it is hypothesised that metabolism may influence root growth
through auxin signalling. Here, the folate inhibitor SMX is used to probe the effect of
folates and sucrose in shaping hormone signalling at the meristem.
79
Figure 3.1. Sucrose promotes root elongation in dark-grown seedlings, which is restricted by SMX. (A) Seedlings were grown for seven days in the dark in the presence of sucrose and SMX, as indicated. (B) Root measurements were taken from seven-day-old dark-grown seedlings. Data represent mean±SE of three independent experiments; each data point represents at least thirty-six individuals (B; p<0.01, ANOVA followed by Tukey’s b).
80
3.3 RESULTS
3.3.1 Sulfamethoxazole inhibits the effect of sucrose on root elongation
In the absence of a carbon source, dark-grown A. thaliana seedlings exhibit minimal
root elongation (Kircher and Schopfer, 2012). A recent report by Kircher and
Schopfer (2012) suggested that sucrose can act as a long distance signal to
promote root elongation upon developing photosynthetic competency (Kircher and
Schopfer, 2012). Consistent with previous reports (Kircher and Schopfer, 2012;
Lilley et al., 2012), sucrose was sufficient to induce primary root elongation in dark-
grown seedlings (Figure 3.1). As folate inhibition can alter plant responses to
sucrose (Stokes, 2013), root elongation was measured in the presence of SMX, to
test whether folates influence the effect of sucrose on root development. Growth in
the presence of SMX restricted root elongation, which was completely inhibited at
1µM (Figure 3.1). This suggests that the promotion of root elongation by sucrose is a
folate-dependent process.
3.3.2 Sucrose promotes auxin accumulation at the root tip, which is
inhibited by folate deprivation
The interplay between sucrose and SMX perturbs auxin signalling and distribution
during seedling development (Stokes, 2013). Auxin signalling was assessed during
growth in the presence of sucrose and SMX, to test whether changes in auxin
distribution underpin responses to SMX during root growth. Two auxin-responsive
reporter systems were used to explore the effect of sucrose on auxin accumulation
at the root tip. The DII-VENUS reporter comprises the Aux/IAA28 degron motif fused
to the VENUS fluorophore (Brunoud et al., 2012). The reporter becomes degraded in
the presence of auxin and inversely tracks auxin accumulation in plant tissues
(Brunoud et al., 2012). The DR5 synthetic promoter consists of tandem repeats of
the auxin responsive element (AuxRE) fused to the 35S minimal promoter, and
serves to track auxin signalling in plant tissues
81
Figure 3.2. SMX inhibits auxin accumulation at the root apex, resulting in ectopic signalling throughout the meristem. (A) Dark-grown DII-VENUS seedlings grown for seven days in media supplemented to sucrose and SMX, as indicated Scale: 50µm. Tissues counter-stained with propidium iodide to aid visualisation of root structures. (B) Dark-grown DR5::GUS seedlings grown for fourteen days in media supplemented with sucrose and SMX, as indicated.
82
(Ulmasov et al., 1997; Sabatini et al., 1999). Both auxin-responsive reporters
indicated that sucrose promotes the accumulation of auxin at the root tip (Figure
3.2). The DII-VENUS reporter exhibited decreased fluorescence at the root tip and
the ground tissue layers of the meristem; whereas, the DR5::GUS reporter showed
stronger staining in the root tip during growth in the presence of sucrose. Taken
together, these reporters indicate sucrose promoted the accumulation of auxin at the
root tip, which is consistent with previous work into the role of sugar signalling on
plant development (Mudgil et al., 2009; Lilley et al., 2012).
DII-VENUS and DR5::GUS expression was monitored to explore whether auxin
plays a role in mediating the interaction between sucrose and SMX at the root
meristem. When seedlings were treated with SMX in the presence of sucrose, the
DII-VENUS system showed a high level of fluorescence throughout the root tip,
indicating a reduction in auxin abundance. In the absence of sucrose, SMX induced
no change in DII-VENUS expression (Figure 3.2A). Treatment with SMX appeared
to induce ectopic auxin signalling throughout the meristem, primarily in the vascular
region, as evidenced by the increased expression domain of the DR5::GUS reporter
(Figure 3.2B). Similar to the trends observed with the DII-VENUS system, the
expression of DR5::GUS indicated that in the absence of sucrose, there is a low
level of auxin found at the root tip, which was unaffected by treatment with SMX. The
sulfonamide perturbed auxin distribution only when administered in the presence of
sucrose.
3.3.3 PIN expression may underpin changes in auxin distribution caused
by sucrose and SMX
The transport of auxin to the root apex is facilitated by the function of PIN auxin
efflux carriers, especially PIN1, PIN3, and PIN7 (Blilou et al., 2005; Dello Ioio et al.,
2008). Microarray data mining uncovered PIN transcripts that had significant
changes in transcript abundance in response to sucrose (Stokes, 2013). Four PINs
were identified that exhibited elevated transcript abundance in response to 10mM
83
Figure 3.3. Sucrose promotes auxin accumulation at the root tip through increased PIN abundance and polar localisation. (A-B) Sucrose promoted auxin accumulation at the root tip. (C) Mining microarray data identified four PIN transcripts that exhibit elevated abundance in response to sucrose. (D-F) PIN translational fusions grown in the dark for seven days in the presence of sucrose. (G-I) Scale bar, 50µm. Detail shows PIN subcellular localisation. Scale: 25µm.
84
sucrose, including PIN1, PIN3, and PIN7 (Figure 3.3C). Translational fusions were
used to track protein abundance and localisation of these three PINs in response to
sucrose and SMX. Consistent with the increased auxin accumulation induced by
sucrose, all three of the PIN-GFP reporter lines tested showed increased PIN
abundance during growth in the presence of sucrose (Figure 3.3D-I). In the absence
of sucrose, GFP signal was faint and evenly distributed throughout the expression
domain. Sucrose promoted stronger GFP signal, as well as greater protein
localisation to the plasma membrane (Figure 3.3G-I).
The interaction between sucrose and SMX does not affect auxin abundance under
these conditions (Stokes, 2013), therefore phenotypes associated with these
treatments are likely the result of changes to auxin distribution or signalling.
Changes in auxin activity indicated by the DII-VENUS and DR5::GUS reporters may
be underpinned by changes in PIN abundance or localization. PIN translational
fusions were used to test whether changes in PIN abundance might explain the
differences in auxin distribution at the root tip. Treatment with SMX decreased PIN
abundance in the meristem, but only when administered in the presence of sucrose
(Figure 3.4A-C). This trend was observed for all three PIN proteins tested, though
variable levels of inhibition were observed between reporter lines. SMX also caused
a sucrose-dependent decrease in PIN3 and PIN7 transcript abundance, consistent
with the trends observed with the translational fusions (Figure 3.4D). PIN1 did not
respond to SMX at the transcriptional level.
3.3.4 Folate deprivation causes ectopic cytokinin signalling
The transport of auxin to the root tip is restricted by cytokinin signalling, which
inhibits PIN expression through the SHY2/IAA3 signalling pathway (Dello Ioio et al.,
2008; Moubayidin et al., 2010). Consequently, changes in auxin distribution
observed in response to sucrose and SMX could be the result of cytokinin signalling.
The cytokinin-responsive TCS::GFP reporter was used to track cytokinin signalling in
vivo (Muller and Sheen, 2008). The TCS::GFP reporter indicated that cytokinin
85
Figure 3.4
86
Figure 3.4. SMX decreases PIN protein abundance at the root tip. (A-C) PIN translational fusions grown in the dark for seven days in presence of 10mM sucrose and SMX, as indicated. Scale bar, 50µm. (D) Transcript abundance of PIN1, PIN3 and PIN7 was measured in seven day-old etiolated seedlings grown in presence of 10mM sucrose and SMX, as indicated. Data represent mean ±SD of three independent experiments.
87
Figure 3.5. Sucrose promotes cytokinin signalling at the root tip; ectopic signalling induced by SMX. Dark-grown TCS::GFP lines grown for seven days in media supplemented with sucrose and SMX, as indicated. Scale bar, 50µm.
88
signalling was strongest in the columella cells at the distal root tip during etiolated
root growth. The presence of sucrose increased reporter intensity, suggesting that
cytokinin signalling was enhanced by sucrose, yet there was no change in the
spatial distribution (Figure 3.5). In contrast, SMX induced strong TCS::GFP
expression throughout the lateral root cap, in addition to the expression in the
columella cells. SMX also promoted expression of the reporter in some vascular
cells in the apical meristem. The TCS::GFP reporter system indicated that co-
treatment of sucrose and SMX resulted in ectopic cytokinin signalling.
3.3.5 Interaction between sucrose and SMX perturbs cell-cycle
progression at the meristem
As sucrose was sufficient to promote root elongation in dark-grown plants, sucrose
might promote meristematic activity at the root tip. Sucrose induces the expression
of cyclinD2 (cycD2) and cyclinD3 (cycD3) in A. thaliana cell cultures (Riou-Khamlichi
et al., 2000; Richard et al., 2002). D-type cyclins promote G1-to-S-phase transition in
plants (De Veylder et al., 2007), and are potential regulatory checkpoints in
response to environmental cues during cell-cycle progression (Riou-Khamlichi et al.,
2000; Dewitte and Murray, 2003). The later G2-to-M phase is regulated, in part, by
another member of the cyclin family, cyclinB1;1 (De Veylder et al., 2007). CyclinB1;1
regulates cell division at the meristem, and contributes to changes in overall size of
the organ in response to hormonal cues (Ubeda-Tomas et al., 2009; Gonzalez-
Garcia et al., 2011; Hacham et al., 2011).
Two cell-state transition markers (cycD2::GUS and cycB1;1::GUS) were used to
assess whether sucrose promotes cell-cycle progression at the root tip (Donnelly et
al., 1999; Riou-Khamlichi et al., 2000; Masubelele et al., 2005). The cycD2::GUS
reporter was induced by sucrose in a concentration-dependent manner, supporting
the hypothesis that sucrose promotes meristematic activity (Figure 3.6A). CycD2
transcript abundance, also increased in response to sucrose, as determined by RT-
qPCR (Figure 3.6B). Contrary to this, cycB1;1::GUS was not induced by sucrose
89
Figure 3.6. Sucrose and SMX promote cell-cycle progression markers in the meristem. (A, C)Seven-day-old dark-grown cycD2::GUS and cycB1;1::GUS seedlings grown in presence of sucrose and SMX, as indicated. Scale bar: 50µM. (B, D) Transcript abundance of cyclinD2 and cyclinB1;1 quantified with qPCR. Data represent mean±SD of three independent experiments.
90
alone, and no change in cycB1;1 transcript abundance was observed (Riou-
Khamlichi et al., 2000), the mechanism through which this is accomplished, and how
this relates to overall meristematic activity, is not known. The effect of sucrose on
cell-cycle progression might be buffered by input from other nutritional cues. To test
whether folate status modifies the effects of sucrose on meristematic activity,
seedlings were grown in the presence of both sucrose and SMX, and expression of
the cell-cycle reporters was observed. Surprisingly, SMX enhanced the expression
of both the cycD2::GUS and cycB1;1::GUS reporters (Figure 3.6A,C). The action of
SMX on the cell cycle reporters was sucrose-dependent, as SMX exerted no effect
on the reporters when administered in the absence of sucrose. The sucrose-
dependent effect of SMX on the expression of the cell markers is reminiscent of
previous reports of synergy between auxin, cytokinin, and sucrose in the regulation
of cyclin gene expression (Riou-Khamlichi et al., 1999; Riou-Khamlichi et al., 2000;
Richard et al., 2002). In many cases, the induction of gene expression by hormone
treatments was dependent on the presence of sucrose, with little response to the
hormone observed when sucrose was not present (Riou-Khamlichi et al., 1999;
Riou-Khamlichi et al., 2000; Richard et al., 2002).
3.3.6 Meristem size increases in sucrose, but differentiates in response
to folate deprivation
Meristem size was measured by counting the number of unexpanded cortex cells at
the root tip (Figure 3.7A-B; black arrows)(Dello Ioio et al., 2008). Sucrose increased
meristem size in a concentration-dependent manner, consistent with the sucrose-
induced changes in root elongation and cell-cycle progression. By contrast, SMX
decreased meristem size, leading to a complete loss of meristematic cells at higher
concentrations (Figure 3.7). As in earlier experiments, SMX only had an effect in the
presence of sucrose, and induced no change in the meristem when applied on its
own. The disruptive effect of SMX on meristem organisation became more
pronounced as seedlings matured, and resulted in approximately 80% of individuals
91
Figure 3.7. Sucrose increases meristem size, yet cotreatment with SMX results in complete differentiation. (A) Meristem size determined by counting cortex files in cleared root tips of fourteen-day-old dark grown seedlings. Data represent mean ±SD of a representative experiment (p<0.01, ANOVA followed by Tukey’s b). (B) DIC images of cleared root tips of fourteen-day-old dark-grown seedlings treated with sucrose and SMX, as indicated. (C) Cleared root tips visualised using confocal microscopy. Scale bar, 25 µm.
92
Figure 3.8. Meristem integrity diminishes across time. Dark-grown seedlings presence of 30mM sucrose and 1µM SMX were sampled at indicated time points. Meristems assessed using brightfield microscopy. Values represent mean±SD of three independent experiments, each with at least thirty individuals.
93
exhibiting differentiated meristems by fourteen days of growth (Figure 3.8). The
cellular organisation of the root meristem, which usually follows a well-defined
pattern (Scheres et al., 2005; Scheres, 2007), appeared to be lost in these
seedlings.
Seedlings grown in presence of 30mM sucrose and 1µM SMX had differentiated
meristems that appeared to lack a quiescent centre (QC; Figure 3.7C). The QC is
established and maintained by the auxin maxima at the root tip (Aida et al., 2004),
and provides positional information to neighbouring stem cells to maintain them in an
undifferentiated state (van den Berg et al., 1995; Scheres, 2007). The expression of
WUSCHEL-RELATED HOMEOBOX5 (WOX5) is confined to the QC, and can be
used as a marker to assess QC specification (Sarkar et al., 2007; Sena et al., 2009).
The loss of WOX5 expression indicates differentiation of the QC and loss of the
stem cell niche (Sena et al., 2009; Hernandez-Barrera et al., 2011).
The differentiation state of the QC in roots treated with SMX was tracked using the
WOX5::GFP reporter gene. After seven days of growth, WOX5::GFP was
consistently expressed in the QC of all individuals (Figure 3.9). Higher
concentrations of sucrose and SMX, which caused some individuals to appear
disrupted when observed using bright field microscopy, still maintained WOX5::GFP
expression at the QC. This suggests that despite their appearance, these meristems
maintained QC specification. After fourteen days of growth, a higher proportion of
meristems appeared differentiated, and the effect of folate deprivation on the
meristems was more prominent. In these individuals, sucrose and SMX diminished
WOX5::GFP expression, indicating differentiation of the stem cell niche. Meristems
that maintained organised structure had elevated levels of WOX5::GFP expression,
which was observed in a broader domain than in the non-treated samples (Figure
3.9).
94
Figure 3.9. Differentiated meristems lose QC specification. WOX5::GFP seedlings grown in the dark for either seven or fourteen days, in the presence of sucrose and SMX, as indicated. After seven days of growth, some individuals appeared disrupted when viewed under the brightfield microscope (5/20). After fourteen days of growth, a far greater proportion appeared disrupted (21/24). Scale bar, 50µM.
95
Figure 3.10
96
Figure 3.10. Blocking cell division with aphidicolin partially phenocopiesSMX. (A) Seven-day-old dark-grown cycD2::GUS seedlings were raised in the presence of sucrose and aphidicolin (APH), as indicated. Scale bar, 50µM. (B-C) Fourteen-day-old seedlings grown in 30mM sucrose and 1µM SMX and seven-day-old seedlings grown 30mM sucrose and 8mg/mL aphidicolin exhibited root hair development at the distal root tip (black arrows). (D) TCS::GFP grown for seven days in dark in presence of sucrose and aphidicolin, as indicated. Aphidicolin caused the intake of PI into some cells (white arrows).
97
3.3.7 Phenotypic responses to SMX may be due to restricted cell
division
As folates are necessary for purine biosynthesis (Bertino, 2009), it is possible that
SMX restricts cell division. Cell division was inhibited with aphidicolin to assess
similarities to SMX treatments. Aphidicolin is an inhibitor of DNA replicase that
blocks cell-cycle progression at the G1-S transition (Ikegami et al., 1978; Planchais
et al., 2000). Similar to SMX, aphidicolin induced the cycD2::GUS reporter, and
caused severe morphological defects at the root meristem only when administered
in the presence of sucrose (Figure 3.10A-D). Cells at the meristem were swollen and
differentiated, as evidenced by the development of root hairs at the distal root tip.
This effect of aphidicolin on meristem organisation was similar to fourteen-day-old
seedlings grown in the presence of 30mM sucrose and 1µM SMX (Figure 3.10C-D).
Despite the similarities in phenotype, some important differences suggested the
effect of SMX is not strictly related to the inhibition of cell division. Propidium iodide
(PI) does not pass the membrane of living cells, and can be used as a vital stain
(Truernit and Haseloff, 2008). Treatment with aphidicolin caused the accumulation of
PI into the cytosol of some cells in the meristem, indicating cell death (Figure 3.10B).
In response to DNA damage, mitotic checkpoints invoke nonapoptotic programmed
cell death destroy the cell (Fulcher and Sablowski, 2009). By blocking replication
rather than continue with mitosis, this mechanism ensures stability of the genome
(Fulcher and Sablowski, 2009). Prolonged exposure to aphidicolin caused cell death
in the meristem at concentrations that did not induce differentiation (4mg/mL), as
indicated by the entry of PI into the dead cells (Figure 3.10D). In contrast, cell death
has not been observed in response to high concentrations of SMX. Multiple
pathways exist that sense genome integrity, and they converge to induce the
expression of WEE1
98
Figure 3.11. Sucrose and SMX does not promote WEE1 transcript abundance. WEE1 transcript abundance in seven-day-old dark grown seedlings was measured using qPCR. Data represent mean±SD of three independent experiments.
99
(De Schutter et al., 2007; Fulcher and Sablowski, 2009). WEE1 is a kinase that
arrests cell division in response to DNA damage (De Schutter et al., 2007). While
aphidicolin induced expression of WEE1 (De Schutter et al., 2007), no change in
transcript abundance was observed in response to SMX (Figure 3.11). From these
observations it was concluded that SMX does not invoke DNA repair pathways that
inhibit cell division and cause cell death.
To determine if aphidicolin induced similar hormone signalling pathways as SMX,
the TCS::GFP reporter was grown in the presence of aphidicolin. In contrast to
treatment with SMX, aphidicolin did not broaden the expression domain of the
cytokinin reporter, and instead inhibited its expression (Figure 3.10B). This suggests
that despite the fact that both treatments result in differentiated meristems, the
mechanism through which this occurs is different. There is a signalling response to
SMX that does not mediate responses to aphidicolin.
3.3.8 Stabilising IAA3/SHY2 signalling rescues meristem disruption
The complex interplay between auxin and cytokinin converges on IAA3/SHY2 (Dello
Ioio et al., 2008; Moubayidin et al., 2010), a canonical Aux/IAA repressor of auxin
signalling (Tian and Reed, 1999; Tian et al., 2002; Tiwari et al., 2004). Aux/IAAs are
degraded in the presence of auxin to allow the expression of early auxin-responsive
genes (Tiwari et al., 2001; Liscum and Reed, 2002). Aux/IAAs are themselves auxin
induced, forming a negative feedback loop (Liscum and Reed, 2002). By promoting
the expression of IAA3/SHY2 in the transition zone, cytokinin can influence auxin
sensitivity and enable crosstalk between the two hormone signalling pathways (Dello
Ioio et al., 2008; Moubayidin et al., 2009). The current model meristem development
proposes that IAA3/SHY2 inhibits PIN expression in the transition zone to restrict
auxin transport to the root apex (Dello Ioio et al., 2008; Perilli et al., 2012).
Transcript accumulation of four Aux/IAAs is perturbed by the interplay between
sucrose and SMX, including IAA3/SHY2 (Stokes, 2013). Given the importance of
100
Figure 3.12. IAA3/SHY2 signalling mediates responses to sucrose and SMX. (A) Seven-day-old dark-grown IAA3::GUS seedlings raised in the presence of sucrose and SMX. (B) DIC microscopy images of shy meristems after fourteen days of growth in 30mM sucrose and 1µM SMX. Scale bar, 50µM. (C) Proportion of shy seedlings grown in 30mM sucrose and 1µM SMX that exhibit intact meristems after fourteen days of growth.
101
IAA3/SHY2 in regulating meristem activity, an IAA3::GUS transcriptional reporter
was used to explore the regulation of IAA3/SHY2 in response to sucrose and SMX in
the root. In contrast with previous reports that IAA3/SHY2 is expressed in the
transition zone (Dello Ioio et al., 2008; Moubayidin et al., 2010), IAA3::GUS
expression was observed throughout the meristem (Figure 3.12A). Sucrose
promoted IAA3::GUS expression, likely the result of increased auxin abundance at
the root. SMX inhibited IAA3::GUS expression throughout the meristem, resulting in
complete inhibition at 1µM SMX when sucrose was present. SMX induced no effect
on IAA3::GUS expression when administered in the absence of sucrose.
Mutants have been isolated in which the signalling capacity IAA3/SHY2 is impaired
(Tian and Reed, 1999; Tian et al., 2002). The shy2-2 allele is stable in the presence
of auxin, shutting down the IAA3/SHY2-dependent pathway (Tian and Reed, 1999;
Tian et al., 2002). Consistent with the role of IAA3/SHY3 in repressing auxin
signalling, shy2-2 mutants exhibit smaller meristems, whereas the meristems of the
null shy2-31 alleles are enlarged (Dello Ioio et al., 2008; Moubayidin et al., 2010).
These mutants were used to test whether IAA3/SHY2 mediates responses to
sucrose and SMX at the meristem.
If reduction in auxin abundance underpins the meristem differentiation, then the
shy2-2 mutant should be hypersensitive to SMX. Contrary to this hypothesis, a
greater proportion of shy2-2 mutants exhibited normal meristem morphology
compared to WT (Figure 3.12B-C). The shy2-31 alleles responded similarly to WT.
By shutting down the IAA3/SHY2 pathway, meristem organisation was rescued,
implicating IAA3/SHY2 in the response to folate deprivation. The nature of this role is
unclear, as the presumed role of IAA3/SHY2 during meristem development is to
reduce PIN abundance and restrict auxin flow to the root tip. SMX induced both a
reduction in PIN expression as well as a reduction in IAA3/SHY2 expression, an
anomaly that requires further investigation.
102
3.4 DISCUSSION
A growing body of evidence reveals a crucial interplay between metabolic and
hormone signalling in the control of plant growth and development. In the current
study, sucrose and folates interact with two hormone signalling pathways,
suggesting that sugars lie upstream of hormones in the regulation of root cell
division and differentiation. This mechanism may ensure that adequate metabolic
energy and structural molecules are available to support growth of the root tissues.
SMX application highlights the importance of folates during this proliferation of
tissues. Inputs from primary metabolism support growth, and in their absence, cell
proliferation is restricted. SMX uncovered a relationship between folates and the
maintenance of hormonal interactions at the meristem.
Based on these findings, a model of meristem regulation by metabolism is proposed
(Figure 3.13). During etiolated growth, basal levels of hormone signalling maintain
the root meristem in a dormant state. Sucrose induced both auxin and cytokinin
signalling at the root tip, leading to increased division and differentiation at the root
apex (Figure 3.13A-B). Together, these two processes drive primary root elongation.
Treatment with SMX uncovered the importance of folates in balancing hormone
signalling at the root meristem. Folate deprivation inhibited PIN expression and
restricted auxin accumulation at the root apex (Figure 3.13C). This decrease in auxin
abundance may have impinged on division rates at the meristem. Ectopic cytokinin
signalling was also observed in the lateral root cap. As cytokinin promotes cellular
differentiation at the root meristem (Dello Ioio et al., 2007; Dello Ioio et al., 2008;
Perilli et al., 2012), it is possible that this induction of cytokinin contributed to the
differentiated meristems observed in response to SMX and sucrose.
Fluctuations in metabolite pools can induce signalling pathways and regulate gene
expression to influence growth. For example, sucrose is believed to induce root
elongation by acting as a proxy indicator for favourable above-ground conditions
103
Figure 3.13. Model: Sucrose and folates promote hormone signalling at the meristem to drive root growth. (A) In the absence of sucrose, basal hormone signalling maintains limited rates of division and differentiation. (B) Sucrose induces hormone networks that promote growth. (C) Maintenance of the hormone balance is dependent on folates, as the addition of SMX resulted in reduced auxin transport and ectopic cytokinin signalling at the lateral root cap.
104
(Kircher and Schopfer, 2012). In this manner, metabolite signalling can act
analogously to hormone pathways by enabling plants to respond to changes in their
environment. It is possible that metabolite signalling is integrated into hormone
pathways as a form of crosstalk. Plant growth and development is orchestrated
through hormone signalling, and though it is accepted that metabolism is necessary
to support growth, there are but a few known instances where metabolism inputs
directly into hormone networks. To this end, progress has been made toward an
understanding of how hormone and metabolic cross-talk influences meristem
productivity, offering insight into meristem function in a fluctuating environment.
In the established model of meristem development, IAA3/SHY2 is transcription is
regulated by cytokinin in the transition zone to inhibit auxin flow to the root tip (Dello
Ioio et al., 2008; Perilli et al., 2012). Though shy2-2 has reduced meristem size
(Dello Ioio et al., 2008; Moubayidin et al., 2010), suppressing the pathway by
stabilising IAA3/SHY2 increased resistance to SMX. It is unclear how SMX induced
ectopic cytokinin signalling and yet inhibited IAA3/SHY2 expression to disrupt
meristem potential. Current models are based on observations made in the transition
zone, and it is not uncommon for hormones to have distinct effects based on tissue
type and developmental context. If ectopic cytokinin signalling is causing the
differentiated phenotype, it is possible that cytokinin is acting in the LRC through
uncharacterised pathways. Tissue-specific hormone signalling can influence the
activity of the entire root meristem (Ubeda-Tomas et al., 2008; Ubeda-Tomas et al.,
2009; Hacham et al., 2011). The lateral root cap is not typically associated with
cytokinin signalling, and future work will address whether these changes to cytokinin
signalling are necessary for the phenotypes observed at the meristem in response to
sucrose and SMX.
Meristem collapse may be caused by the reduced auxin accumulation at the root tip
(Benjamins et al., 2001; Friml et al., 2004). Inhibition of PIN expression was
observed in response to SMX, which was also associated with a reduction in auxin
accumulation at the root tip. The inability to focus auxin at the tip, as evidenced by
105
the changes in DII-VENUS distribution, may cause the loss of QC specification at
the stem cell niche. The diminished auxin signalling at the apex may also be the
cause the reduction in IAA3/SHY2 expression, as the transcription of Aux/IAAs is
induced by auxin. Rescuing meristem potential by shutting down IAA3/SHY2 is in
contradiction to this hypothesis, in that the shy2-2 mutant should be hypersensitive
to SMX. Further experimentation using auxin signalling and biosynthesis mutants
can explore this hypothesis further.
In support of the hypothesis that reduced auxin activity at the root tip resulted in a
loss of meristem potential, this phenotype is also seen in mutants with reduced auxin
signalling and accumulation at the root apex (Aida et al., 2004; Hernandez-Barrera
et al., 2011). Loss of the auxin-responsive PLETHORA (PLT) transcription factors,
which help establish and maintain the stem cell niche (Aida et al., 2004), resulted in
differentiated meristems that closely resemble the meristems of seedlings treated
with SMX. The inability to transduce auxin signals in the plt1;plt2 double mutants
resulted in stem cell differentiation (Aida et al., 2004). This effect has also been
observed in mutants with reduced auxin accumulation at the distal root tip
(Hernandez-Barrera et al., 2011). The moots koom1 mutation causes a decrease in
meristem potential that appears to be the result of reduced auxin maxima. Similar to
SMX-treated seedlings, the expression of WOX5 is became diminished well after the
meristems exhibited the differentiated phenotype (Hernandez-Barrera et al., 2011).
Folates are involved in many different metabolic processes, and a specific branch of
metabolism that is important for meristem growth remains unknown. The inhibition of
folate synthesis, or the downstream products of this pathway, may become limiting
for the replication capacity of rapidly dividing meristem tissues. It is possible that an
inhibition of division occurs as a result of metabolic deficiency, and that this is the
cause of the differentiated meristem. This notion is supported by the fact that the
disrupted meristems could be rescued by the application of folic acid, indicating that
folates are required to maintain meristematic potential (Figure 3.14).
The phenotypic response of the meristem was also partially phenocopied by the cell-
106
Figure 3.14. Folic acid rescues disrupted meristem and promotes cell-cycle progression. Dark-grown seedlings treated with sucrose and SMX were grown in media supplemented with 25µM folic acid (FA). FA rescued the effect of SMX on meristem organisation, as all individuals exhibited intact meristems when FA present. Ratios indicate proportion of individuals exhibiting the phenotype shown. Scale bar, 50µm.
107
cycle inhibitor aphidicolin. In both cases, complete differentiation of the meristem
was induced by the chemical treatment. The experiments using aphidicolin
supported the hypothesis that a reduction in cell division relative to the rate of
differentiation resulted in complete differentiation of the meristem. The dependency
of the cell-division inhibitor on sucrose highlights the role of sucrose in inducing both
division and differentiation as two distinct processes. It is noteworthy that aphidicolin
did not perturb the hormone signalling pathways that SMX induced, suggesting that
the signalling effects of SMX at the meristem are not related solely to the inhibition of
cell division. This finding also supports the notion that there are perception pathways
that sense folate metabolism and input into canonical hormone signalling networks
that govern meristem development.
3.5 CONCLUSION
By integrating metabolic pathways with hormone signalling at the meristem, plants
can coordinate growth to match resource availability. Rapidly-dividing tissues require
investment of energy and nutrients; metabolite sensing at the meristem ensures
resources are available to support growth. Metabolite accumulation can be detected
by plants and acts as a signal to induce changes in plant behaviour. In this capacity,
it is likely that metabolite signalling is integrated with other developmental and
environmental cues. Crosstalk such as this would enable plants to fine-tune
responsiveness to a fluctuating environment. That SMX perturbs plant sugar
responses at the root highlights a role for folates in supporting meristematic
potential, and suggests that this metabolic pathway feeds into hormone signalling in
the control of meristem productivity.
3.6 MATERIALS AND METHODS
3.6.1 Plant Material and Growth Conditions
Wild-type Arabidopsis thaliana, ecotype Columbia-0 (Col-0), seeds were obtained
from the Nottingham Arabidopsis Stock Centre (NASC); all transgenic lines and
108
mutants are of the Columbia ecotype. Plant materials were grown in Conviron
growth cabinets (Conviron, Winnipeg, Canada) at 21ºC in a 16/8hr photoperiod at
135µmol m-2 s-1. Plants harbouring the auxin reporter DR5::GUS (Sabatini et al.,
1999) and DII-VENUS (Brunoud et al., 2012) were described previously, as were the
PIN translational fusions: PIN1-GFP (Benkova et al., 2003), PIN3-GFP (Zadnikova
et al., 2010), PIN7-GFP (Blilou et al., 2005).
Seeds were surface sterilized using a 10% bleach, 1% Triton X-100 solution and
sown in 1X Murashige and Skoog (MS) liquid growth medium (Murashige and
Skoog, 1962), in 24-well microtiter plates as previously described (Stokes, 2013).
Filter-sterilized stock solutions of SMX dissolved in dimethyl sulfoxide (DMSO) were
added to the growth media after the media was autoclaved. Equivalent volumes of
DMSO were added to control treatments to ensure equal addition of DMSO across
all treatments. Plates were wrapped in light-blocking foil, and cold stratified at 4ºC for
three days. After cold treatment, plates were exposed to light for six hours to
promote germination. The plates were then wrapped again in foil and transferred to
a growth cabinet (Conviron, Winnipeg, Canada) at 21ºC.
3.6.2 Root elongation measurements
After seven days of growth, seedlings were fixed by submersion in 70% Ethanol,
10% Acetic acid solution at 4ºC overnight. Fixed seedlings were rehydrated by
submersion in autoclaved water for 24 hours, after which seedlings were aligned on
agarose plates and photographed using a Canon Rebel SLR camera. Photographed
roots were measured using ImageJ software (rsbweb.nih.gov/ij/).
3.6.3 Histochemical assay of GUS reporter activity
Seedlings harboring transgenic GUS reporters were sown in liquid growth media and
grown in the dark for specified periods of time, as described above. Upon
harvesting, seedlings were permeabilised by submersion in ice-cold 90% acetone
and incubated at -20ºC for 20 minutes. Seedlings were rinsed twice for ten minutes
in 50mM sodium phosphate buffer, then infiltrated with GUS buffer containing 50mM
109
sodium phosphate, pH7, 1mg/mL (w/v) 5-bromo-4-chloro-3-indolyl-β-D-glucoronide
(X-GLUC), 5mM K3Fe(CN)6, 5mM K4Fe(CN)6, 10mM EDTA. Staining times vary
between constructs. DR5::GUS and cycB1;1::GUS were incubated for 2hrs;
cycD2::GUS was incubated for 16hrs. After staining, seedlings were rinsed in
autoclaved dH20, followed by fixation in FAA (50% ethanol, 10% acetic acid, 10%
formaldehyde). Tissues were cleared using a chloral hydrate solution (125g chloral
hydrate in 50mL 30% glycerol solution) as described previously (Willemsen et al.,
1998). Seedlings were observed using an Olympus BX5 microscope (Olympus,
Tokyo, Japan), and images were captured with a QImaging MicroPublisher 3.3RTV
digital camera using QCapture version 2.7 software, as described previously
(Stokes, 2013).
3.6.4 Quantitative real-time PCR (qPCR)
Seedlings were germinated and grown in liquid culture as described above. After
seven days of growth, seedlings were collected and rinsed with sterile distilled water
under a green safe light before being snap frozen in liquid nitrogen. Frozen tissue
was ground with a mortar and pestle to a fine powder, and total RNA was extracted
using an RNeasy kit from Qiagen, following the manufacturer’s instructions (Qiagen,
Mississauga, Canada). RNA quality was determined spectrophotometrically, and
1µg RNA was used for cDNA synthesis using the iSELECT cDNA synthesis kit
following the manufacturer’s instruction (Bio-Rad, Mississauga, Canada). Real-time
quantitative PCR (qRT-PCR) was performed using the iCycler iQ real-time PCR
detection system (Bio-Rad, Mississauga, Canada). The relative transcript
abundance was determined by the Pfaffl method (Pfaffl, 2001), using UBQ10 as a
reference gene. A melting curve was performed to assess primer specificity. The
primers used were as follows: UBQ10 (At4g05320)
FW5’GGCCTTGTATAATCCCTGATGAATAA3’,
RV5’AAAGAGATAACAGGAACGGAAACATA3’; PIN1 (At1g73590),
FW5’AAACCACCACGCCGATTACT3’, RV5’
TTCCCCTGAGGTACAGAGATCTTAAC3’; PIN3 (At1g70940),
110
FW5’TCCGATCACGCTGGTTTACTAC3’, RV5’GGCATCAGCATTCCTTAAATCA3’;
PIN7 (At1g23080) FW5’CGGTGAGATTCTTTACTGGACCA3’,
RV5’CGGTGAGATTCTTTACTGGACCA3’; CYCB1;1 (At4g37490)
FW5’CTGATCCTGGTGGAGTGGTT3’, RV5’CTGTGGTGGCCAAATTTCTT3’;
CYCD2 (At2g22490) FW5’GCTGCTGCAGTGTCTGTTTC3’,
RV5’ACAGCTCTTACCGCAACTCG3’; WOX5 (At3g11260)
FW5’GCGAAGAAGATTGTCAAGAGGA3’, RV5’GATGTTCCATTTCAGCTCCACA3’;
WEE1 (At1g02970) FW5’CAAGAGCTTGCACTTCCATCATAG3’,
RV5’TGGTGCTGGACATTTCAGTCGG3’.
3.6.5 Confocal microscopy
PIN-GFP and DII-VENUS reporter lines were visualized using a Leica SP5 confocal
microscope (Leica, Mannheim, Germany). Seedlings were counterstained with
propidium iodide (PI) as described previously (Stokes, 2013). To visualize GFP,
fluorophores were excited using an argon laser at 488nm; emission was measured
between 500nm and 550nm (green channel/GFP), and between 600nm and 710nm
(red channel/PI). To visualise VENUS, excitation was accomplished using an argon
laser at 514nm; emission was measured between 518nm and 560nm (yellow
channel/VENUS) and between 595nm and 690nm (red channel/PI), as previously
described (Stokes, 2013). Gain and laser intensity were kept constant between
treatment groups to allow equal comparison across the experiment.
3.6.6 Root meristem measurements
After seven days of growth, seedlings were fixed, rehydrated, and tissues were
cleared as described above. Seedlings were mounted in clearing solution and
imaged using differential interference contrast (DIC) microscopy on a Zeiss Axio
Imager AX10 microscope.
111
Chapter 4
General conclusions and future directions
112
4 General Conclusions and Future Directions
4.1 GENERAL CONCLUSIONS
Sugars provide energy and carbohydrate resources that support plant growth, yet
also inform development. For example, sucrose is transported throughout the plant
where it is used in the production of new cellular components. The sugar molecules
themselves function as signals that regulate gene expression to capitalize on these
resources, allowing the plant to balance carbon supply with demand. There are
regulatory factors that respond directly to sugar, enabling sugars to influence gene
expression (Cho et al., 2006; Hummel et al., 2009). Changes in gene expression
that allow the cell to respond to sugars may not be sufficient themselves to regulate
the development of new organs. The induction of hormone signalling networks may
be necessary to orchestrate development on a whole-organ level, such as during
root elongation and leaf production.
Sugars promote the development of traits typically associated with
photomorphogenesis, such as true leaves, and hypocotyl inhibition, and the
induction of primary root elongation. This developmental state represents a form of
“glycomorphogenesis”, a term coined here to describe the developmental traits
induced by sugars. These changes result in plant morphology that is distinct from
either skoto- or photomorphogenic developmental patterns. Glycomorphogenic
development can describe not only the developmental state of dark-grown seedlings
treated to sugars, but rather to encapsulate the total contributions sugar metabolism
and signalling on plant morphology.
It is believed that sugars are perceived through a metabolite sensing mechanism
that results in changes to hormone signalling networks (Figure 4.1). Other
metabolites likely share similar functions as signalling molecules that inform plant
development. Blocking folate biosynthesis with SMX has uncovered such a role for
folates. By restricting the effects of sugars on morphology, SMX treatment revealed
113
that these processes are not only dependent on folates, but that folates provide
signalling information related to the state of metabolism. It is also possible that
folates are synthesized in response to sucrose, and constitute part of the
glycomorphogenic response. These metabolic cues manage the balance between
auxin and cytokinin that drives development. In this manner, folates act not only as
rate-limiting metabolites, but as “checkpoint” molecules during plant development,
ensuring that sufficient metabolic support is available for the proliferation of new
tissues.
Two lines of investigation were used to explore the role of folates in shaping
developmental responses to sucrose. The inhibitory effect of sucrose on hypocotyl
elongation was enhanced by SMX, suggesting that folates temper this effect of
sucrose (Figure 4.1B). A different form of interaction was observed at the root apex,
in which folates acted in concert with sucrose to promote root growth. Folate
deprivation resulted in an imbalance in hormone activity that ultimately resulted in
meristem differentiation (Figure 4.1C). Together, these studies highlight the role of
sucrose and folates in promoting seedling development through hormone signalling.
The first line of experimentation explored the interaction between folates and
sucrose during hypocotyl elongation. Synergy between SMX and sucrose indicated
pathway interaction, and was used to interrogate the interplay between signalling
pathways (Lehar et al., 2007; Yeh and Kishony, 2007). Transcriptome analysis
uncovered that the interaction between sucrose and SMX resulted in changes to
auxin signalling, as a number of Aux/IAA transcripts exhibited changes in transcript
abundance in response to cotreatment of sucrose and SMX. The interaction
between sucrose and SMX acted through an Aux/IAA19 – ARF7 signalling pathway
to regulate hypocotyl growth, as evidenced by attenuated responses to SMX in the
mutants. Changes in the expression profiles of auxin-responsive reporters indicated
that auxin distribution was affected by sucrose and SMX. This hypothesis was
supported when blocking polar auxin transport attenuated the interaction between
sucrose and SMX. Taken together, is concluded that:
114
Figure 4.1. Metabolite sensing modulates hormone interactions during seedling development. (A) Metabolite sensing integrates signals from sucrose and folates to mediate hormone and developmental cues. These signalling events result in “glycomorphogenesis”, a term used here to describe the effects of sugars on plant morphology. (B) The interplay between folates and sucrose mediates hypocotyl development. SMX enhanced the effect of sucrose on hypocotyl elongation, suggesting that folates temper the inhibitory effect of sucrose. (C) Sucrose promotes hormone signalling at the root apex, with folates acting as “checkpoint” molecules. In the absence of folates, auxin flow is inhibited resulting in meristem differentiation.
115
The interplay between sucrose and folates fine-tune auxin signalling during
hypocotyl development, a process that is mediated through changes in auxin
distribution.
The aim of this second line of experimentation was to explore the effect of sucrose
on the meristem, and how this regulation may be integrated with other metabolic
signals to dictate plant growth. In the absence of a carbon source, dark-grown
seedlings exhibit minimal root elongation, and very little meristematic activity is
observed. Treatment with sucrose promoted root growth and meristem activity, as
indicated by cell-cycle reporters and increases in meristem size. These changes in
activity are likely the result of hormone signalling, as treatment with sucrose
promoted auxin and cytokinin signalling at the root tip. These hormones regulate cell
division and differentiation at the root apex (Perilli et al., 2012). Following on from
the first line of investigation, work outlined in the latter half of this thesis explored the
extent to which folates are integrated into sucrose signalling at the root tip. SMX
disrupted hormone signalling and inhibited PIN expression, restricting auxin
accumulation at the root apex. Growth in the presence of sucrose and SMX also led
to ectopic cytokinin signalling throughout the lateral root cap. Together, these
changes in hormone signalling likely contributed to a disruption in meristem integrity
and complete differentiation of the meristem. These findings suggest that:
Sucrose promotes root growth by inducing hormone signalling networks that
govern meristem activity. This is dependent on folates, as SMX disrupted
hormone signalling and caused meristem collapse.
Together, these two lines of investigation uncover a connection between folates and
sucrose that modulates hormone signalling during seedling development.
Metabolism is fundamental to the growth of the living plant, yet there are few
instances where metabolic cues feed into signalling pathways that regulate growth
rates. This thesis sought to understand how metabolism can shape the growth
behaviour of the developing plant by influencing hormone signalling pathways.
116
The approach used in this study highlights the utility of the chemical genetic
approach in uncovering biological function. Treatment with SMX inhibited DHPS
activity to highlight the role of folates during seedling development. The presence of
multiple DHPS isoforms likely masked this phenotype in other forward-genetic
screens aimed at dissecting the effects of sugars on plant development (Mehrshahi
et al., 2010). In this way, chemical inhibition was able to overcome genetic
redundancy and highlight a role for folates in balancing hormone signalling during
development.
Finding this interaction in disparate organs suggests that the interplay between
folates and sucrose is a general theme across plant development. These metabolic
pathways converge to shape plant growth through auxin distribution. In both studies,
tissue-specific changes in hormone signalling were observed. In the hypocotyl, auxin
distribution shifted to become more concentrated in the vascular region, where auxin
signalling restricted hypocotyl elongation. In the root, auxin became less focused at
the tip and it appeared that diffuse auxin signalling occurred in the vasculature.
Changes in auxin distribution have a profound impact on plant development (Blilou
et al., 2005; Grieneisen et al., 2007; Vanneste and Friml, 2009), and may enable
metabolism to exert an influence on plant growth.
4.2 FUTURE DIRECTIONS
This thesis made inroads into an understanding of how metabolic processes inform
plant development. Despite these initial steps toward characterising this interaction,
an understanding of how these pathways regulate seedling growth is far from
complete. There are a number of research endeavours that could illuminate the
mechanism through which these pathways interact. These efforts may provide
insight into the manner in which metabolic pathways influence hormone signalling
and plant growth.
117
4.2.1 Exploring the role of other hormone signalling pathways in
mediating responses to sucrose and SMX at the meristem
Current models of root meristem development emphasise the interaction between
auxin and cytokinin (Dello Ioio et al., 2007; Dello Ioio et al., 2008; Moubayidin et al.,
2009; Moubayidin et al., 2010; Perilli and Sabatini, 2010; Dello Ioio et al., 2012;
Perilli et al., 2012). This, along with earlier findings that SMX perturbed auxin
signalling in the hypocotyl, encouraged a focus on these two hormones in the study
of SMX on root meristem activity. This view of hormonal interactions at the meristem
is incomplete, as gibberellins (GA) and brassinosteroid (BR) have also been
implicated in regulating the root meristem (Achard et al., 2009; Ubeda-Tomas et al.,
2009; Gonzalez-Garcia et al., 2011; Hacham et al., 2011). Exploring the role of
these other hormones in mediating responses to sugars and SMX may provide a
more fulsome understanding of the intricate signalling network that integrates
metabolism into developmental cues.
Tools are available that can be used to dissect the functional role of GA and BR at
the meristem. These can be used to assess the extent of their involvement in
response to sucrose and SMX. For example, GA signalling in the endodermis
regulates cell expansion that is believed to influence division rates in neighbouring
tissues (Ubeda-Tomas et al., 2008; Ubeda-Tomas et al., 2009). The gibberellic acid
insensitive (gai) mutant shuts down GA signalling (Ubeda-Tomas et al., 2008), and
exhibits decreased root meristem size (Ubeda-Tomas et al., 2008; Ubeda-Tomas et
al., 2009). It would be interesting to explore the role of GA in the response to
sucrose, and whether the mutant is hypersensitive to SMX. Whether de novo
biosynthesis of GA is necessary for sucrose to promote growth can be tested by
treating seedlings to sucrose in the presence of paclobutrazol (PAC), a chemical
inhibitor of GA biosynthesis (Olszewski et al., 2002). Through chemical and genetic
inhibition of GA, the role of this hormone in developmental responses to sugars can
be explored.
Similar tools are available to dissect BR signalling during plant development.
118
Mutants that are deficient in BA perception and signal transduction have been
isolated, which can be used to study BR signal transduction during root development
(Belkhadir and Chory, 2006). For example, the brassinosteroid insensitive1 (bri1)
mutant is deficient in BR perception and exhibits smaller root meristems due to
reduced cell division (Clouse et al., 1996; Li and Chory, 1997; Gonzalez-Garcia et
al., 2011; Hacham et al., 2011). Auxotrophic BR mutants can also be used to
explore the necessity of BR biosynthesis in responses to sucrose and SMX (Chory
et al., 1991; Noguchi et al., 1999). Seedlings can be hypersensitised to BR through
chemical treatments that inhibit negative regulators signal transduction (De Rybel et
al., 2009). Exposing plants to bikinin inhibits the GLYCOGEN SYNTHASE KINASE
(GSK) family of negative regulators, and caused heightened responses to BR (De
Rybel et al., 2009). A combination of chemical and genetic approaches can assess
the role of BR in mediating responses to sucrose and SMX during meristem
development.
4.2.2 Exploring tissue-specific hormone signalling in response to
sucrose and SMX
Recent studies highlight the role of tissue-specific hormone signalling in governing
root meristem activity (Dello Ioio et al., 2007; Ubeda-Tomas et al., 2008; Ubeda-
Tomas et al., 2009; Hacham et al., 2011). By expressing a dominant mutant allele
under the control of a tissue-specific promoter, signalling pathways can be inhibited
exclusively in that tissue (Ubeda-Tomas et al., 2009; Hacham et al., 2011). Similarly,
by expressing hormone metabolism enzymes, hormone abundance can be changed
in specific tissue types (Dello Ioio et al., 2007). For example, by expressing the
cytokinin oxidase-dehydrogenase1 (CKX1) gene under a transition zone-specific
promoter, the activity of cytokinin in promoting differentiation was uncovered
(Werner et al., 2003; Dello Ioio et al., 2007). This approach to tissue-specific
hormone activity is facilitated by the identification of promoter elements that confer
tissue-specific gene expression.
Treatment with sucrose and SMX induced tissue-specific hormone responses. The
119
TCS::GFP reporter exhibited elevated levels of expression in the lateral root cap
(LRC) and epidermis in response to SMX. Whether this signalling in the LRC plays a
role in mediating responses to SMX is a hypothesis that would be interesting to
address. To this end, it should be possible to reduce cytokinin abundance in the
LRC and epidermis by expressing CKX1 under the control of the GL2 promoter (Lin
and Schiefelbein, 2001). The GL2 promoter expresses exclusively in the epidermis
and LRC, and has previously been used to activate signalling pathways specifically
in those tissues (Lin and Schiefelbein, 2001; Hacham et al., 2011). As a control, this
construct could be transformed into the TCS::GFP background to confirm the
reduction in cytokinin activity at the LRC. In this way, the dependence of cytokinin
signalling in the LRC in response to SMX can be investigated.
Stabilising the IAA3/SHY2 pathway with the dominant shy2-2 allele conferred
resistance to the differentiating effect of sucrose and SMX. The specificity of this
response could also be explored by using tissue-specific promoters driving
expression of the shy2-2 allele. This would allow hypotheses related to specific
auxin signalling pathways to be addressed. Changes in DR5::GUS expression
indicate that auxin signalling was occurring in throughout the meristem in response
to SMX. By shutting down IAA3/SHY2-dependent signalling in single tissue types,
the role of this ectopic auxin signalling can be explored further.
4.2.3 Assessing the oxidative state of the meristem
Reactive oxygen species (ROS) are produced as a by-product of metabolism, and
can have profound implications for cellular behaviour (Mittler et al., 2004). Redox
signalling has been implicated as a regulator of cell cycle progression in both plants
and animals (Mittler et al., 2004). ROS signalling plays an important role in root
growth and development, influencing the rates of cellular proliferation and
differentiation at the meristem (Tsukagoshi et al., 2011; Tsukagoshi, 2012). It could
be that ROS proliferation occurs as a result of sucrose metabolism, which helps
drive root growth. This may explain why little meristematic activity occurs in the
absence of sucrose. To test this hypothesis, the proliferation of ROS can be
120
observed in roots using staining techniques that discriminate between different types
of redox signals (Dunand et al., 2007; Tsukagoshi et al., 2011). Mutants that are
deficient in cellular redox regulators or in metabolising ROS could also be tested to
see whether responses to sucrose are impaired by an inability to manage ROS
accumulation. If folates are required as antioxidants, or to buffer ROS signalling,
then that might explain the sucrose-dependent effect of SMX on the meristem. An
excess of ROS proliferation results in senescence and cell death (Mittler et al.,
2004), which is not observed in response to SMX, therefore the likelihood of ROS
signalling mediating responses to SMX is questionable.
4.2.4 Genetic screening to identify novel components of metabolite
signalling
Though auxin signalling is perturbed by SMX, the precise cause of this effect is
unknown. Folates are metabolised into secondary products, and one-carbon
metabolism influences a wide range of secondary processes (Ravanel et al., 2011).
It is unclear as to which downstream process is affecting sucrose and hormone
signalling. Screening for mutants with altered sensitivity to SMX may uncover
pathways that modify auxin signalling in response to metabolic cues. A study such
as this may shed light on the branch of metabolism that is necessary, or on
signalling proteins that mediate the cross talk. To this end, an M2 population of ethyl
methanesulfonate (ems)-mutagenised seedlings was grown in the presence of
sucrose and SMX at concentrations that inhibit hypocotyl elongation (10mM and
1µM, respectively). Mutant seedlings that exhibited hypocotyls longer than wild type
were identified. Twenty-two sucrose-and-sulfonamide resistant (ssr) mutant lines
were isolated (Figure 4.2A).
This screen can also be used to identify signalling components involved in
maintaining meristem integrity. These mutants were rescreened at concentrations of
sucrose and SMX that induce meristem collapse (30mM and 1µM, respectively).
This screen identified nine lines that exhibit higher proportions of intact meristems
compared to WT (Figure 4.2B). Future work will characterise these mutants in hopes
121
Figure 4.2. Forward-genetic screen identifies SMX-resistant mutants. (A) Hypocotyl measurements of twenty-two sucrose and sulfonamide resistant (ssr) mutants grown in the dark for seven days in the presence of 10mM sucrose and 1µM SMX. (B) Brightfield images of ssr meristems after seven days of etiolated growth in the presence of 30mM sucrose and 1µM SMX.
122
of identifying novel genetic elements that govern meristem activity in response to
metabolic cues.
Alternatively, chemical complementation could be used to assess which aspect of
folate metabolism is causal for sucrose interactions. Downstream products of the
folate metabolic pathway could be supplemented into the growth medium, similar to
experiments presented in Chapter 2. These experiments would address hypotheses
related to the role of specific metabolites in the interaction with sucrose. Negative
results would need to be viewed with caution, and controls are necessary to show
that the added compounds are reaching sufficient levels in the seedlings. For
example, ethylene biosynthesis is a downstream product in one branch of folate
metabolism (Figure 2.2A). Blocking ethylene perception with 20µM silver thiosulfate
(Ag+) did not rescue hypocotyl elongation, suggesting ethylene production was not
causing the inhibition of hypocotyl elongation (Figure 4.3). Rescuing hypocotyl
elongation of the ethylene overexproducer2 (eto2) mutant verified that the chemical
treatment was effective at blocking ethylene perception (Kieber et al., 1993).
Chemical complementation experiments, in conjunction with proper controls, will test
hypotheses related to the influence of specific metabolite pools during hypocotyl
elongation.
4.2.5 Uncovering regulators of shoot meristem responses to sucrose
Leaf development at the shoot apical meristem (SAM) is mediated by auxin and
cytokinin (Shani et al., 2006; Barton, 2010). The hormones have reversed roles at
the SAM compared to the root; auxin promotes differentiation, and cytokinin
promotes division (Shani et al., 2006; Barton, 2010). As treating aerial tissues of the
etiolated seedling with sucrose is sufficient to induce the development of true leaves
(Roldan et al., 1999), there are likely hormonal responses mediating sugar signalling
at the SAM. The extent to which sugars influence hormone signalling during leaf
growth is not known.
123
Figure 4.3. Ethylene perception does not mediate interaction between sucrose and SMX. Seven-day-old dark-grown seedlings raised in the presence of sucrose and SMX, as indicated. Media supplemented with Ag+ to inhibit ethylene perception. The ethylene overproducer2 (eto2) mutant was used as a control (inset). Data represent the mean ± SE of three biological replicates from a representative experiment; each data point represents at least 36 individuals.
124
To test whether auxin and cytokinin mediate responses to sucrose at the meristem,
some preliminary experiments made use of mutant and pharmacogenic analyses.
The cytokinin hypersensitive arr3;4;5;6 quadruple mutant is deficient in four Type A
ARRs, negative regulators of cytokinin signalling (To et al., 2004). Dark-grown
arr3;4;5;6 do not induce SAM activation when treated with sucrose, suggesting that
cytokinin inhibits sucrose signalling at the SAM (Figure 4.4B). To test whether auxin
is necessary for sucrose effects at the SAM, seedlings were grown in sucrose and
NPA (Morgan, 1964). Seedlings treated with NPA were impaired in the ability to
produce true leaves in response to sucrose (Figure 4.4C). Taken together, these
preliminary experiments hint that interplay between cytokinin and auxin mediates the
induction of leaf development by sucrose.
It would be interesting to explore the interaction of folates and sucrose at the SAM
by performing a set of experiments similar to those used to explore root
development. Hormone markers and mutant lines are available to test hypotheses
related to the interplay between folates and sucrose at the SAM. Given that the cell
proliferation was inhibited at the root apex by SMX, it is likely that similar effects will
be observed at the SAM.
The principles that were used to identify the interaction between sucrose and folates
could be employed to uncover novel regulators of sugar signalling at the SAM. The
activation of the SAM causes seedlings to grow too large for high-throughput
chemical screening in 96-well plates. Since the arr3;4;5;6 mutant does not induce
true leaf development, the mutant can be used to screen for chemicals that suppress
this phenotype. Screening for chemicals that induce true leaf development in the
arr3;4;5;6 mutant in response to sucrose may identify compounds that antagonize
cytokinin signalling during sucrose treatment. A similar screen could be performed in
search of chemicals that negate the inhibitory effect of NPA. In this way, modulators
of the crosstalk between sugars and hormones can be identified.
125
Figure 4.4. Auxin and cytokinin mediate shoot meristem activation by sucrose. (A) As a reference, two-week-old dark-grown seedlings grown in liquid media supplemented with 30mM sucrose, as indicated. (B) Wild-type and the cytokinin-hypersensitive mutant arr3;4;5;6 grown for two weeks in media supplemented with 30mM sucrose. (C) Wild-type seedlings grown in presence of 30mM sucrose supplemented with NPA, as indicated.
126
4.3 Closing Remarks
The work presented in this thesis uncovered a previously-unknown relationship
between sucrose and folates that direct plant development. Metabolites such as
sucrose and folates are sensed, and these signalling cues are integrated to
modulate hormone signalling during seedling development. By restricting
tetrahydrofolate biosynthesis with SMX, a role for folates as a metabolic checkpoint
was discovered. The importance of metabolism in supporting plant growth is well
established and accepted as a fundamental aspect of plant biology. It is less clear,
however, how metabolites are sensed and the mechanisms through which
metabolite signalling influences development. The nature of such a metabolite-
sensing pathway remains to be elucidated, and future efforts will explore signalling
pathways that regulate development in response to metabolic cues.
127
Appendix
A novel F-box that mediates galactose sensitivity
128
5 Appendix: A novel F-box that mediates galactose
sensitivity
5.1 INTRODUCTION
Sugars play key roles as structural molecules, sources of energy, and signaling
molecules in plants (Rolland et al., 2006). As products of photosynthesis, sugar
levels rise and fall throughout the day in response to light (Blasing et al., 2005). The
daily flux of carbohydrate pools has profound impacts on plant biology (Blasing et
al., 2005; Osuna et al., 2007). It is important for plants to detect the availability of
carbohydrates before activating carbon-rich developmental processes, such as cell-
wall biosynthesis (Koch, 1996). To accomplish this, plants have evolved multiple
sugar-perception pathways that enable them to coordinate growth and development
in response to resource availability (Smith and Stitt, 2007).
Sugar-sensing pathways can be integrated with developmental cues through bi-
functional proteins that possess catalytic and signalling functions (Moore et al.,
2003; Cho et al., 2006; Cho et al., 2012). For example, the metabolic function of
HEXOKINASE1 (HXK1) is to phosphorylate glucose during the initial steps of
glycolysis. Upon binding glucose HXK1 undergoes a conformational change that
causes the protein to translocate to the nucleus to direct gene expression (Cho et
al., 2006). By coupling the catalytic function of HXK1 with a signalling role, HXK1
acts as a glucose sensor to coordinate transcriptional responses to glucose (Moore
et al., 2003; Cho et al., 2006).
Other sugars are sensed through coupled metabolic and signalling mechanisms. For
example, FRUCTOSE-1,6-BISPHOSPHATASE (FBP) is involved in fructose
metabolism, and mediates developmental responses to the sugar (Cho and Yoo,
2011). By rescuing fbp mutants with catalytically-inactive FBP constructs, the
metabolic and signalling functions of FBP were uncoupled (Cho and Yoo, 2011). The
parallels between glucose and fructose perception suggests that coupling of catalytic
129
and signalling functions may be a conserved mechanism through which
development can be coordinated with resource availability.
Upon sensing sugars, pathways that utilise these resources are induced at the
transcriptional level (Koch, 1996). For example, lignin biosynthesis is a carbon-
intensive process regulated by sugar signalling (Amthor, 2003; Rogers et al., 2005).
Lignin is a rigid structural polymer found in the secondary cell walls of specialised
cell types (Sederoff et al., 1999; Rogers and Campbell, 2004). The deposition of
lignin provides strength to the plant to support vegetative structures (Boerjan et al.,
2003), guards against pathogen attack (Uppalapati et al., 2009; Bi et al., 2011), and
endows hydrophobic properties to the cell wall (Hose et al., 2001). Lignin deposition
is under strict developmental and environmental control, as lignification restricts
further cell expansion (Rogers et al., 2005). Genes encoding lignin biosynthetic
enzymes are induced by sugars, enabling the activation of this carbon-intensive
process only when the resources are available to support it (Rogers et al., 2005).
A wide variety of developmental responses are induced by sugars (Rolland et al.,
2006), highlighting the important role that carbohydrates play in shaping plant
development. Some sugars, such as galactose, are associated with detrimental
effects on seedling growth (Rosti et al., 2007; Grossmann et al., 2011). The “toxic”
effect of has been known for a long time (Knudson, 1917; Burstrom, 1948; Hughes
and Street, 1974); however, the molecular underpinnings and the biological
significance of these responses remain unknown. Here, the inhibitory effect of
galactose was used as the basis for a genetic screen to uncover the mechanism
through which plants detect galactose, and to explore the implication of this sugar
signalling pathway during seedling development.
5.2 RESULTS AND DISCUSSION
5.2.1 Galactose induces pleiotropic effects on seedling development
Dark-grown seedlings were treated with exogenous galactose to explore the effect of
130
the sugar on seedling development. Consistent with earlier reports, galactose
inhibited root and hypocotyl elongation, and induced a stunted morphology (Figure
5.1, A and B). Vegetative tissues were dwarfed, and leaf expansion was restricted in
seedlings grown in the presence of galactose.
Some sugars induce lignification in dark grown seedlings (Rogers et al., 2005).
Since lignin deposition restricts cell expansion, it was hypothesised that changes in
cell wall composition may occur in response to galactose. To test this hypothesis,
seedlings were stained with phloroglucinol to assess changes in lignin distribution. In
the absence of galactose, mild phloroglucinol staining was observed along the
vascular cells of the hypocotyl (Figure 5.1E), indicating the presence of lignin.
Treatment with galactose induced ectopic lignification throughout the vascular
cylinder, as indicated by intense red staining (Figure 5.1H).
It was hypothesised that the changes in lignin distribution may be associated with
abnormalities in the cellular organisation of the hypocotyl. To explore the effect of
galactose on vascular development, cellular organisation was examined using semi-
thin cross-sections of hypocotyl tissues stained with toluidine blue. Treatment with
galactose disrupted vascular cellular organisation (Figure 5.1C-F). The vasculature
of galactose-treated seedlings had enlarged, densely stained cells. Dark clusters
were also observed in cortex cells of seedlings treated with galactose, which may
have been starch granules (Figure 5.1C,F).
5.2.2 Forward genetic screen identifies a galactose-insensitive mutant
To uncover the genetic basis for galactose sensitivity, a population of randomly-
inserted T-DNA mutants was screened for resistance to galactose. Mutants were
screened on the basis of root morphology, and several mutants were identified that
exhibit resistance to galactose during root growth. A second, high-throughput mutant
screen took advantage of the autofluorescent properties of lignin. Seedlings were
examined under fluorescent light to identify mutants that had a lignification pattern
that was equivalent to untreated seedlings, even in the presence of galactose
131
Figure 5.1. Galactose inhibits root elongation and vascular development. (A-B) Light-grown seedlings exhibit reduced elongation when growing on media supplemented with galactose. (C, F) Galactose induces the formation of dark clusters in the cortical layer of the hypocotyl. (D, G) When viewed at higher magnification, defects in vascular development can be observed. (E-H) Lignification observed throughout the hypocotyl vasculature cylinder in response to galactose, whereas normally lignin restricted to the xylem.
132
(Figure 5.2).
This screen identified a galactose-insensitive mutant (gim1) with reduced lignification
in the presence of galactose. The mutant was identified based on reduced
autofluorecence in the hypocotyl compared to wild type (Figure 5.2). The reduction
in lignin fluorescence was confirmed with phloroglucinol staining, which showed
lignin deposition in the hypocotyl akin to untreated controls, even in the presence of
galactose (Figure 5.3A). Root elongation was also rescued in this mutant, which was
resistant to galactose-mediated inhibition of root growth (Figure 5.3C). When the
root tissues were stained with phloroglucinol, gim1 exhibited a drastic reduction in
lignin content compared to WT (Figure 5.3B).
The galactose-induced changes to lignin deposition were confirmed by quantifying
lignin abundance. Consistent with the phloroglucinol staining, galactose caused an
increase in lignin abundance in wild-type seedlings that was not observed in the
gim1 mutant (Figure 5.3D). The effect of galactose on lignin production is not related
to the osmotic potential of the medium, as adding equivalent amounts of the non-
metabolisable sugar mannitol induced no change in lignin abundance or distribution.
The inhibition of root elongation by galactose has been known for decades (Endo et
al., 1968; Hughes and Street, 1974), but the underlying cause of this effect is
unclear. Given that lignin restricts cell expansion, it may be that premature
lignification of cells restricts their ability to elongate. In support of this hypothesis, the
gim1 mutant had a reduction in lignification in the root tissues, and exhibited greater
elongation than WT.
5.2.3 gim1 disrupts the activity of an F-box with galactose-oxidase
activity
The gim1 mutant was isolated from a population of randomly-inserted T-DNA
mutants, each of which could contain multiple DNA insertion events (Alonso et al.,
2003). The gim1 genome was sequenced to locate any T-DNA insertions that may
133
Figure 5.2. Genetic screen identifies a galactose insensitive mutant1 (gim1). Using fluorescence microscopy, lignin deposition can be viewed in vivo. Lignin observed along the hypocotyl vasculature in seedlings treated with galactose. Screening for mutants with reduced lignin deposition identified a galactose-insensitive mutant1 (gim1).
134
Figure 5.3. Galactose resistance of the gim1 mutant. (A-B) The gim1 mutant was isolated based on reduced lignification of the hypocotyl vasculature, yet exhibits resistance in root tissues as well. (C) Roots of gim1 are resistant to galactose, exhibiting greater elongation compared to WT. (D) Treatment with galactose induces lignin biosynthesis, which did not occur in the gim1 mutant.
135
Figure 5.4: gim1 deficient in At4g39560, encoding a putative galactose oxidase/F-box. (A) Sequenceing gim1 genome identified one T-DNA insertion between two genes encoding galactose oxidases with F-box motifs. (B) Only an insertional mutation in At4g39560 phenocopied gim1.
136
be responsible for the mutant phenotype. This approach successfully identified a
single T-DNA sequence on chromosome 4, located between two loci annotated as
having galactose oxidase activity, as well as containing canonical F-box motifs
(Figure 5.4A). Genome analysis identified three other F-box-containing galactose
oxidases neighbouring these two, totaling five paralogous genes in tandem. These
F-box-containing galactose oxidases are members of a large gene family in
Arabidopsis (Andrade et al., 2001), comprising 131 members that share at least 76%
similarity at the genetic level.
As the gim1 mutant contains a T-DNA insertion that resides between two distinct
loci, it may be that the phenotype was related to altered expression of either, or both,
of the two neighbouring genes. To test whether a loss of either neighbouring gene
was sufficient to phenocopy gim1, T-DNA insertion lines corresponding to each of
the two genes were tested for resistance to galactose in a root elongation assay
(Figure 5.4B). The insertion line disrupted at At4g39550 responded to galactose like
WT, suggesting that this locus was not responsible for the gim1 phenotype. Contrary
to this, an insertion in At4g39560 conferred resistance to galactose, similar to gim1.
It is likely that the gim1 phenotype is caused by a disruption to At4g39560 activity,
despite the insertion not residing in the coding region of the gene.
5.3 FUTURE DIRECTIONS
5.3.1 Confirming the Galactose oxidase and F-box activity of At4g39560
The At4g39560 locus has been annotated as a kelch-repeat galactose oxidase/F-
box (Andrade et al., 2001), but this functional activity remains to be confirmed. It is
important to test whether this gene product is involved in galactose metabolism,
which can be confirmed in vitro. Assays are commercially available that couple
galactose oxidation with the creation of a colorful product, which can be used to
verify galactose-oxidase activity.
Galactose-oxidase/F-boxes comprise a large gene family in Arabidopsis (Andrade et
137
al., 2001). Early studies into the function of this family used truncated versions of the
protein in which the N-terminal F-box domain had been removed. These truncated
versions of the protein lost the ability to interact with ASK1 (Andrade et al., 2001),
and orthologous SKP1 protein that forms part of the SCF ubiquitin ligase complex
(Gray et al., 1999). This supports the functional significance of the motif, suggesting
that the F-box is still functional. Using a truncated version of At4g39560, hypotheses
related to the importance of the F-box motif in galactose signalling can be tested.
5.3.2 Uncoupling catalytic activity from signalling function
Provided that At4g39560 retains both metabolic function and signalling capacity, it
would be interesting to explore whether the galactose sensitivity is mediated through
metabolism or signalling. To test this, catalytically-dead alleles with reduced
galactose-oxidase activity would be generated and transformed into gim1. If the
catalytically-dead allele restores wild-type phenotype, than the signalling function of
At4g39560 is necessary for galactose sensitivity. Additionally, truncated versions of
At4g39650 that lack the functional F-box can be transformed into gim1to assess
whether the signalling role of the protein is necessary for galactose sensitivity. In
both cases, the mutant allele needs to be checked to confirm that the secondary
function has not been affected. For example, the truncated protein that lacks an F-
box will still be tested to ensure that the galactose oxidase activity is still present
prior to transformation.
5.4 MATERIALS AND METHODS
5.4.1 Plant materials and growth conditions
Wild-type Arabidopsis thaliana, ecotype Columbia-0 (Col-0) and T-DNA insertion
lines were obtained from the Arabidopsis biological resource centre (ABRC). Plants
were grown in Conviron growth cabinets (Conviron, Winnipeg, Canada) at 21ºC in a
16/8hr photoperiod at 135µmol m-2 s-1. For growth assays and morphological
studies, seedlings were grown in full strength liquid MS growth media containing
138
30mM sucrose (Murashige and Skoog, 1962). Galactose or mannitol was added to
the media prior to filter sterilization, after which Gamborg’s vitamins were added to
the media. After the indicated period of growth, seedlings were fixed by submersion
in FAA solution (50% ethanol, 5% formaldehyde, 10% acetic acid) for overnight.
After rinsing with autoclaved distilled H2O to remove fixative, seedlings were aligned
on agar plates and and photographed using a Canon EOS Rebel XT EF-S 18-55
digital camera, as previously described (Stokes et al., Submitted). Root and
hypocotyl measurements were generated using ImageJ software
(rsbweb.nih.gov/ij/).
5.4.2 Microscopy and staining techniques
Prior to staining, full tissues were cleared using a chloral hydrate solution (125g
chloral hydrate in 50mL 30% glycerol solution) as described previously (Willemsen
et al., 1998). Phloroglucinol stain was prepared by dissolving 20mg/mL
phloroglucinol in 16% ethanol, 10% hydrochloric acid solution. To facilitate
phloroglucinol staining, tissues were submerged in staining solution for 10 minutes in
darkness, after which they were observed under an Olympus BX5 microscope
(Olympus). Images were captured with a QImaging MicroPublisher 3.3RTV digital
camera using QCapture version 2.7 software.
Semi-thin sections were created by fixing dissected hypocotyls in 4%
paraformaldehyde in 0.1M Sorensen’s phosphate buffer, and rotating overnight.
Tissues were washed twice with Sorensen’s phosphate buffer to remove
paraformaldehyde, then dehydrated through a graded ethanol series. After three ten
minute incubations with 100% EtOH to ensure complete dehydration, the hypocotyl
tissues were infiltrated with Spurr’s epoxy resin. Infiltration was accomplished by
incubating in 3:1 ethanol:Spurr’s for 30 minutes, followed by 1:1 ethanol:Spurr’s for
30 minutes, 1:3 ethanol:Spurr’s for 30 minutes, then incubation in 100% Spurr’s
resin overnight on a rotator. The following day, tissues were infiltrated with fresh
resin three times for sixty minutes each. Hypocotyls were embedded in a flat mold
and polymerized in an oven. Semi-thin sections were cut 0.5µm thick on an
139
ultramicrotime, then transferred and heat fixed to a glass slide. Toluidine blue
staining was performed by submersion for ten minutes.
5.4.3 Lignin quantification
The rapid extraction by washing and microscale lignin extraction method was
adapted from Change et al, 2008. Briefly, air-dried Arabidopsis seedlings were
ground using a mortar and pestle and sieved to 150-mesh. The ground samples
were heated in MilliQ water at 65°C for 30 min with occasional mixing. The residues
were filtered through a 0.45 μm nylon membrane and were washed with MilliQ
water, acetone, ethanol, and diethyl ether. The extracted samples were dried in a
vacuum oven at 40°C for 48 h followed by an overnight incubation over P2O5 in a
vacuum dessicator. The extracted Arabidopsis samples (5 ± 0.1 mg) were incubated
with 1 mL of 25% acetyl bromide in acetic acid in a tube with Teflon-sealed cap at
70°C for 30 min with shaking at 10 min intervals. The solution was then cooled in
ice-cold water for 120 min. During the cooling, 5 mL of acetic acid was added to
each tube. After cooling, 30 μL of the mixture, 40 μL of 1.5 M NaOH, 30 μL of 0.5 M
hydroxylamine hydrochloride, and 150 μL of acetic acid were sequentially added to a
96-well quartz plate. The absorbance at 280 nm was measured and the extinction
coefficient of 23.29 g-1 L cm-1 (Chang et al., 2008) was used to calculate the lignin
content.
140
6 LITERATURE CITED
Abel S, Nguyen MD, Theologis A (1995) The PS-IAA4/5-like family of early auxin-inducible mRNAs in Arabidopsis thaliana. J Mol Biol 251: 533-549
Achard P, Gusti A, Cheminant S, Alioua M, Dhondt S, Coppens F, Beemster GT, Genschik P (2009) Gibberellin signaling controls cell proliferation rate in Arabidopsis. Curr Biol 19: 1188-1193
Aida M, Beis D, Heidstra R, Willemsen V, Blilou I, Galinha C, Nussaume L, Noh YS, Amasino R, Scheres B (2004) The PLETHORA genes mediate patterning of the Arabidopsis root stem cell niche. Cell 119: 109-120
Aida M, Beis D, Scheres B (2004) PLETHORA1 and PLETHORA2 are involved in the formation and maintenance of Arabidopsis root stem cells. Plant and Cell Physiology 45: S16-S16
Akhtar TA, Orsomando G, Mehrshahi P, Lara-Nunez A, Bennett MJ, Gregory JF, 3rd, Hanson AD (2010) A central role for gamma-glutamyl hydrolases in plant folate homeostasis. Plant J 64: 256-266
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker JR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653-657
Amthor JS (2003) Efficiency of lignin biosynthesis: a quantitative analysis. Ann Bot 91: 673-695
Andrade MA, Gonzalez-Guzman M, Serrano R, Rodriguez PL (2001) A combination of the F-box motif and kelch repeats defines a large Arabidopsis family of F-box proteins. Plant Mol Biol 46: 603-614
Arenas-Huertero F, Arroyo A, Zhou L, Sheen J, Leon P (2000) Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev 14: 2085-2096
Baier M, Hemmann G, Holman R, Corke F, Card R, Smith C, Rook F, Bevan MW (2004) Characterization of mutants in Arabidopsis showing increased sugar-specific gene expression, growth, and developmental responses. Plant Physiol 134: 81-91
Barker L, Kuhn C, Weise A, Schulz A, Gebhardt C, Hirner B, Hellmann H, Schulze W, Ward JM, Frommer WB (2000) SUT2, a putative sucrose sensor in sieve elements. Plant Cell 12: 1153-1164
Barton MK (2010) Twenty years on: the inner workings of the shoot apical meristem, a developmental dynamo. Dev Biol 341: 95-113
Baskin TI, Remillong EL, Wilson JE (2001) The impact of mannose and other carbon sources on the elongation and diameter of the primary root of Arabidopsis thaliana. Australian Journal of Plant Physiology 28: 481-488
141
Beemster GT, Baskin TI (1998) Analysis of cell division and elongation underlying the developmental acceleration of root growth in Arabidopsis thaliana. Plant Physiol 116: 1515-1526
Belkhadir Y, Chory J (2006) Brassinosteroid signaling: a paradigm for steroid hormone signaling from the cell surface. Science 314: 1410-1411
Benjamini Y, Hochberg Y (1995) Controlling the False Discovery Rate - a Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B-Methodological 57: 289-300
Benjamins R, Quint A, Weijers D, Hooykaas P, Offringa R (2001) The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development 128: 4057-4067
Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jurgens G, Friml J (2003) Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115: 591-602
Bennett T, Scheres B (2010) Root Development-Two Meristems for the Price of One? Plant Development 91: 67-102
Bertino JR (2009) Cancer research: from folate antagonism to molecular targets. Best Pract Res Clin Haematol 22: 577-582
Bi CL, Chen F, Jackson L, Gill BS, Li WL (2011) Expression of Lignin Biosynthetic Genes in Wheat during Development and upon Infection by Fungal Pathogens. Plant Molecular Biology Reporter 29: 149-161
Blasing OE, Gibon Y, Gunther M, Hohne M, Morcuende R, Osuna D, Thimm O, Usadel B, Scheible WR, Stitt M (2005) Sugars and circadian regulation make major contributions to the global regulation of diurnal gene expression in Arabidopsis. Plant Cell 17: 3257-3281
Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, Scheres B (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433: 39-44
Bliss CI (1939) The toxicity of poisons applied jointly. Annals of Applied Biology 26: 585-615
Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu Rev Plant Biol 54: 519-546
Bouche N, Fromm H (2004) GABA in plants: just a metabolite? Trends Plant Sci 9: 110-115
Brown GM (1962) The biosynthesis of folic acid. II. Inhibition by sulfonamides. J Biol Chem 237: 536-540
Brunoud G, Wells DM, Oliva M, Larrieu A, Mirabet V, Burrow AH, Beeckman T, Kepinski S, Traas J, Bennett MJ, Vernoux T (2012) A novel sensor to map auxin response and distribution at high spatio-temporal resolution. Nature 482: 103-106
Burstrom H (1948) OBSERVATIONS ON THE INFLUENCE OF GALACTOSE ON WHEAT ROOTS. Physiologia Plantarum 1: 209-215
Candela H, Perez-Perez JM, Micol JL (2011) Uncovering the post-embryonic functions of gametophytic- and embryonic-lethal genes. Trends Plant Sci 16: 336-345
Caspar T, Huber SC, Somerville C (1985) Alterations in Growth, Photosynthesis,
142
and Respiration in a Starchless Mutant of Arabidopsis thaliana (L.) Deficient in Chloroplast Phosphoglucomutase Activity. Plant Physiol 79: 11-17
Casson SA, Lindsey K (2006) The turnip mutant of Arabidopsis reveals that LEAFY COTYLEDON1 expression mediates the effects of auxin and sugars to promote embryonic cell identity. Plant Physiol 142: 526-541
Chang XF, Chandra R, Berleth T, Beatson RP (2008) Rapid, microscale, acetyl bromide-based method for high-throughput determination of lignin content in Arabidopsis thaliana. J Agric Food Chem 56: 6825-6834
Cho MH, Jang A, Bhoo SH, Jeon JS, Hahn TR (2012) Manipulation of triose phosphate/phosphate translocator and cytosolic fructose-1,6-bisphosphatase, the key components in photosynthetic sucrose synthesis, enhances the source capacity of transgenic Arabidopsis plants. Photosynth Res 111: 261-268
Cho YH, Yoo SD (2011) Signaling role of fructose mediated by FINS1/FBP in Arabidopsis thaliana. PLoS Genet 7: e1001263
Cho YH, Yoo SD, Sheen J (2006) Regulatory functions of nuclear hexokinase1 complex in glucose signaling. Cell 127: 579-589
Chory J (1994) Plant phototransduction. Phytochrome signal transduction. Curr Biol 4: 844-846
Chory J, Nagpal P, Peto CA (1991) Phenotypic and Genetic Analysis of det2, a New Mutant That Affects Light-Regulated Seedling Development in Arabidopsis. Plant Cell 3: 445-459
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743
Clouse SD, Langford M, McMorris TC (1996) A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development. Plant Physiol 111: 671-678
Coneva V, Guevara D, Rothstein SJ, Colasanti J (2012) Transcript and metabolite signature of maize source leaves suggests a link between transitory starch to sucrose balance and the autonomous floral transition. J Exp Bot 63: 5079-5092
Corbesier L, Bernier G, Perilleux C (2002) C : N ratio increases in the phloem sap during floral transition of the long-day plants Sinapis alba and Arabidopsis thaliana. Plant Cell Physiol 43: 684-688
Dai X, Hayashi K, Nozaki H, Cheng Y, Zhao Y (2005) Genetic and chemical analyses of the action mechanisms of sirtinol in Arabidopsis. Proc Natl Acad Sci U S A 102: 3129-3134
Dalchau N, Baek SJ, Briggs HM, Robertson FC, Dodd AN, Gardner MJ, Stancombe MA, Haydon MJ, Stan GB, Goncalves JM, Webb AA (2011) The circadian oscillator gene GIGANTEA mediates a long-term response of the Arabidopsis thaliana circadian clock to sucrose. Proc Natl Acad Sci U S A 108: 5104-5109
De Kroon H, Visser EJ, Huber H, Mommer L, Hutchings MJ (2009) A modular concept of plant foraging behaviour: the interplay between local responses and systemic control. Plant Cell Environ 32: 704-712
De Rybel B, Audenaert D, Vert G, Rozhon W, Mayerhofer J, Peelman F,
143
Coutuer S, Denayer T, Jansen L, Nguyen L, Vanhoutte I, Beemster GT, Vleminckx K, Jonak C, Chory J, Inze D, Russinova E, Beeckman T (2009) Chemical inhibition of a subset of Arabidopsis thaliana GSK3-like kinases activates brassinosteroid signaling. Chem Biol 16: 594-604
De Schutter K, Joubes J, Cools T, Verkest A, Corellou F, Babiychuk E, Van Der Schueren E, Beeckman T, Kushnir S, Inze D, De Veylder L (2007) Arabidopsis WEE1 kinase controls cell cycle arrest in response to activation of the DNA integrity checkpoint. Plant Cell 19: 211-225
De Veylder L, Beeckman T, Inze D (2007) The ins and outs of the plant cell cycle. Nat Rev Mol Cell Biol 8: 655-665
Dekkers BJ, Schuurmans JA, Smeekens SC (2004) Glucose delays seed germination in Arabidopsis thaliana. Planta 218: 579-588
Dello Ioio R, Galinha C, Fletcher AG, Grigg SP, Molnar A, Willemsen V, Scheres B, Sabatini S, Baulcombe D, Maini PK, Tsiantis M (2012) A PHABULOSA/cytokinin feedback loop controls root growth in Arabidopsis. Curr Biol 22: 1699-1704
Dello Ioio R, Linhares FS, Scacchi E, Casamitjana-Martinez E, Heidstra R, Costantino P, Sabatini S (2007) Cytokinins determine Arabidopsis root-meristem size by controlling cell differentiation. Curr Biol 17: 678-682
Dello Ioio R, Nakamura K, Moubayidin L, Perilli S, Taniguchi M, Morita MT, Aoyama T, Costantino P, Sabatini S (2008) A genetic framework for the control of cell division and differentiation in the root meristem. Science 322: 1380-1384
Depuydt S, Hardtke CS (2011) Hormone signalling crosstalk in plant growth regulation. Curr Biol 21: R365-373
Dewitte W, Murray JA (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235-264 Dharmasiri N, Dharmasiri S, Estelle M (2005) The F-box protein TIR1 is an auxin
receptor. Nature 435: 441-445 Dharmasiri N, Dharmasiri S, Weijers D, Lechner E, Yamada M, Hobbie L,
Ehrismann JS, Jurgens G, Estelle M (2005) Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell 9: 109-119
Dharmasiri N, Estelle M (2004) Auxin signaling and regulated protein degradation. Trends Plant Sci 9: 302-308
Ding Z, Galvan-Ampudia CS, Demarsy E, Langowski L, Kleine-Vehn J, Fan Y, Morita MT, Tasaka M, Fankhauser C, Offringa R, Friml J (2011) Light-mediated polarization of the PIN3 auxin transporter for the phototropic response in Arabidopsis. Nat Cell Biol 13: 447-452
Donnelly PM, Bonetta D, Tsukaya H, Dengler RE, Dengler NG (1999) Cell cycling and cell enlargement in developing leaves of Arabidopsis. Dev Biol 215: 407-419
Dubrovsky JG, Sauer M, Napsucialy-Mendivil S, Ivanchenko MG, Friml J, Shishkova S, Celenza J, Benkova E (2008) Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. Proc Natl Acad Sci U S A 105: 8790-8794
Dunand C, Crevecoeur M, Penel C (2007) Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible
144
interaction with peroxidases. New Phytol 174: 332-341 Dyachok J, Zhu L, Liao F, He J, Huq E, Blancaflor EB (2011) SCAR mediates
light-induced root elongation in Arabidopsis through photoreceptors and proteasomes. Plant Cell 23: 3610-3626
Eichelbaum M, Burk O (2001) CYP3A genetics in drug metabolism. Nat Med 7: 285-287
Endo RM, Thomson WW, Krausman EM (1968) EFFECTS OF D-GALACTOSE ON ULTRASTRUCTURE OF BENTGRASS ROOT APICES. Canadian Journal of Botany 46: 391-&
Esmon CA, Pedmale UV, Liscum E (2005) Plant tropisms: providing the power of movement to a sessile organism. Int J Dev Biol 49: 665-674
Falconer SB, Czarny TL, Brown ED (2011) Antibiotics as probes of biological complexity. Nat Chem Biol 7: 415-423
Falkenberg B, Witt I, Zanor MI, Steinhauser D, Mueller-Roeber B, Hesse H, Hoefgen R (2008) Transcription factors relevant to auxin signalling coordinate broad-spectrum metabolic shifts including sulphur metabolism. J Exp Bot 59: 2831-2846
Farha MA, Brown ED (2010) Chemical probes of Escherichia coli uncovered through chemical-chemical interaction profiling with compounds of known biological activity. Chem Biol 17: 852-862
Feraru E, Friml J (2008) PIN polar targeting. Plant Physiol 147: 1553-1559 Francis D, Halford NG (2006) Nutrient sensing in plant meristems. Plant Mol Biol
60: 981-993 Freixes S, Thibaud MC, Tardieu F, Muller B (2002) Root elongation and branching
is related to local hexose concentration in Arabidopsis thaliana seedlings. Plant Cell and Environment 25: 1357-1366
Friml J, Yang X, Michniewicz M, Weijers D, Quint A, Tietz O, Benjamins R, Ouwerkerk PB, Ljung K, Sandberg G, Hooykaas PJ, Palme K, Offringa R (2004) A PINOID-dependent binary switch in apical-basal PIN polar targeting directs auxin efflux. Science 306: 862-865
Fulcher N, Sablowski R (2009) Hypersensitivity to DNA damage in plant stem cell niches. Proc Natl Acad Sci U S A 106: 20984-20988
Galinha C, Hofhuis H, Luijten M, Willemsen V, Blilou I, Heidstra R, Scheres B (2007) PLETHORA proteins as dose-dependent master regulators of Arabidopsis root development. Nature 449: 1053-1057
Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 151-158
Gautier L, Cope L, Bolstad BM, Irizarry RA (2004) affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20: 307-315
Gazzarrini S, McCourt P (2001) Genetic interactions between ABA, ethylene and sugar signaling pathways. Curr Opin Plant Biol 4: 387-391
Geiger DR, Servaites JC (1994) DIURNAL REGULATION OF PHOTOSYNTHETIC CARBON METABOLISM IN C-3 PLANTS. Annual Review of Plant Physiology and Plant Molecular Biology 45: 235-256
Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge YC, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S,
145
Irizarry R, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JYH, Zhang JH (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biology 5: -
Gibon Y, Usadel B, Blaesing OE, Kamlage B, Hoehne M, Trethewey R, Stitt M (2006) Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes. Genome Biol 7: R76
Gibson SI (2005) Control of plant development and gene expression by sugar signaling. Curr Opin Plant Biol 8: 93-102
Gibson SI, Laby RJ, Kim D (2001) The sugar-insensitive1 (sis1) mutant of Arabidopsis is allelic to ctr1. Biochem Biophys Res Commun 280: 196-203
Gonzalez-Garcia MP, Vilarrasa-Blasi J, Zhiponova M, Divol F, Mora-Garcia S, Russinova E, Cano-Delgado AI (2011) Brassinosteroids control meristem size by promoting cell cycle progression in Arabidopsis roots. Development 138: 849-859
Goyer A, Collakova E, Diaz de la Garza R, Quinlivan EP, Williamson J, Gregory JF, 3rd, Shachar-Hill Y, Hanson AD (2005) 5-Formyltetrahydrofolate is an inhibitory but well tolerated metabolite in Arabidopsis leaves. J Biol Chem 280: 26137-26142
Gray WM, del Pozo JC, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby WL, Yang M, Ma H, Estelle M (1999) Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13: 1678-1691
Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature 414: 271-276
Grieneisen VA, Xu J, Maree AF, Hogeweg P, Scheres B (2007) Auxin transport is sufficient to generate a maximum and gradient guiding root growth. Nature 449: 1008-1013
Grieneisen VA, Xu J, Maree AFM, Hogeweg P, Scheres B (2007) Auxin transport is sufficient to generate a maximum and gradient guiding root growth. Nature 449: 1008-1013
Grossmann G, Guo WJ, Ehrhardt DW, Frommer WB, Sit RV, Quake SR, Meier M (2011) The RootChip: an integrated microfluidic chip for plant science. Plant Cell 23: 4234-4240
Guerineau F, Brooks L, Meadows J, Lucy A, Robinson C, Mullineaux P (1990) Sulfonamide Resistance Gene for Plant Transformation. Plant Molecular Biology 15: 127-136
Hacham Y, Holland N, Butterfield C, Ubeda-Tomas S, Bennett MJ, Chory J, Savaldi-Goldstein S (2011) Brassinosteroid perception in the epidermis controls root meristem size. Development 138: 839-848
Hadi MZ, Kemper E, Wendeler E, Reiss B (2002) Simple and versatile selection of Arabidopsis transformants. Plant Cell Reports 21: 130-135
Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49: 373-385
Hanson AD, Gregory JF, 3rd (2002) Synthesis and turnover of folates in plants. Curr Opin Plant Biol 5: 244-249
146
Hanson AD, Roje S (2001) One-carbon metabolism in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology 52: 119-137
Harmer SL (2009) The circadian system in higher plants. Annu Rev Plant Biol 60: 357-377
He SM, Zhou ZW, Li XT, Zhou SF (2011) Clinical drugs undergoing polymorphic metabolism by human cytochrome P450 2C9 and the implication in drug development. Curr Med Chem 18: 667-713
Hernandez-Barrera A, Ugartechea-Chirino Y, Shishkova S, Napsucialy-Mendivil S, Soukup A, Reyes-Hernandez BJ, Lira-Ruan V, Dong G, Dubrovsky JG (2011) Apical meristem exhaustion during determinate primary root growth in the moots koom 1 mutant of Arabidopsis thaliana. Planta 234: 1163-1177
Hicks GR, Raikhel NV (2012) Small molecules present large opportunities in plant biology. Annu Rev Plant Biol 63: 261-282
Hirai MY, Fujiwara T, Awazuhara M, Kimura T, Noji M, Saito K (2003) Global expression profiling of sulfur-starved Arabidopsis by DNA macroarray reveals the role of O-acetyl-l-serine as a general regulator of gene expression in response to sulfur nutrition. Plant J 33: 651-663
Hopkins AL, Groom CR (2002) The druggable genome. Nat Rev Drug Discov 1: 727-730
Hose E, Clarkson DT, Steudle E, Schreiber L, Hartung W (2001) The exodermis: a variable apoplastic barrier. J Exp Bot 52: 2245-2264
Hotta CT, Gardner MJ, Hubbard KE, Baek SJ, Dalchau N, Suhita D, Dodd AN, Webb AA (2007) Modulation of environmental responses of plants by circadian clocks. Plant Cell Environ 30: 333-349
Hughes R, Street HE (1974) GALACTOSE AS AN INHIBITOR OF EXPANSION OF ROOT CELLS. Annals of Botany 38: 555-564
Huijser C, Kortstee A, Pego J, Weisbeek P, Wisman E, Smeekens S (2000) The Arabidopsis SUCROSE UNCOUPLED-6 gene is identical to ABSCISIC ACID INSENSITIVE-4: involvement of abscisic acid in sugar responses. Plant J 23: 577-585
Hummel M, Rahmani F, Smeekens S, Hanson J (2009) Sucrose-mediated translational control. Ann Bot 104: 1-7
Ikegami S, Taguchi T, Ohashi M, Oguro M, Nagano H, Mano Y (1978) Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature 275: 458-460
Jang JC, Leon P, Zhou L, Sheen J (1997) Hexokinase as a sugar sensor in higher plants. Plant Cell 9: 5-19
Jensen PJ, Hangarter RP, Estelle M (1998) Auxin transport is required for hypocotyl elongation in light-grown but not dark-grown Arabidopsis. Plant Physiol 116: 455-462
Jeong SW, Das PK, Jeoung SC, Song JY, Lee HK, Kim YK, Kim WJ, Park YI, Yoo SD, Choi SB, Choi G (2010) Ethylene suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. Plant Physiol 154: 1514-1531
Jimonet P, Jager R (2004) Strategies for designing GPCR-focused libraries and screening sets. Curr Opin Drug Discov Devel 7: 325-333
Keith CT, Borisy AA, Stockwell BR (2005) Multicomponent therapeutics for
147
networked systems. Nat Rev Drug Discov 4: 71-78 Kepinski S, Leyser O (2005) The Arabidopsis F-box protein TIR1 is an auxin
receptor. Nature 435: 446-451 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a
negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72: 427-441
Kim BC, Soh MC, Kang BJ, Furuya M, Nam HG (1996) Two dominant photomorphogenic mutations of Arabidopsis thaliana identified as suppressor mutations of hy2. Plant J 9: 441-456
Kim BC, Soh MS, Hong SH, Furuya M, Nam HG (1998) Photomorphogenic development of the Arabidopsis shy2-1D mutation and its interaction with phytochromes in darkness. Plant Journal 15: 61-68
Kim H, Hirai MY, Hayashi H, Chino M, Naito S, Fujiwara T (1999) Role of O-acetyl-l-serine in the coordinated regulation of the expression of a soybean seed storage-protein gene by sulfur and nitrogen nutrition. Planta 209: 282-289
Kircher S, Schopfer P (2012) Photosynthetic sucrose acts as cotyledon-derived long-distance signal to control root growth during early seedling development in Arabidopsis. Proc Natl Acad Sci U S A 109: 11217-11221
Knudson L (1917) The toxicity of galactose and mannose for green plants and the antagonistic action of other sugars toward these. American Journal of Botany 4: 430-437
Koch K (2004) Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Current Opinion in Plant Biology 7: 235-246
Koch KE (1996) Carbohydrate-Modulated Gene Expression in Plants. Annu Rev Plant Physiol Plant Mol Biol 47: 509-540
Koini MA, Alvey L, Allen T, Tilley CA, Harberd NP, Whitelam GC, Franklin KA (2009) High Temperature-Medated Adaptations in Plant Architecture Require the bHLH Transcription Factor PIF4. Current Biology 19: 408-413
Laby RJ, Kincaid MS, Kim D, Gibson SI (2000) The Arabidopsis sugar-insensitive mutants sis4 and sis5 are defective in abscisic acid synthesis and response. Plant J 23: 587-596
Lehar J, Stockwell BR, Giaever G, Nislow C (2008) Combination chemical genetics. Nat Chem Biol 4: 674-681
Lehar J, Zimmermann GR, Krueger AS, Molnar RA, Ledell JT, Heilbut AM, Short GF, 3rd, Giusti LC, Nolan GP, Magid OA, Lee MS, Borisy AA, Stockwell BR, Keith CT (2007) Chemical combination effects predict connectivity in biological systems. Mol Syst Biol 3: 80
Lejay L, Wirth J, Pervent M, Cross JMF, Tillard P, Gojon A (2008) Oxidative pentose phosphate pathway-dependent sugar sensing as a mechanism for regulation of root ion transporters by photosynthesis. Plant Physiology 146: 2036-2053
Li J, Chory J (1997) A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. Cell 90: 929-938
Lilley JL, Gee CW, Sairanen I, Ljung K, Nemhauser JL (2012) An endogenous
148
carbon-sensing pathway triggers increased auxin flux and hypocotyl elongation. Plant Physiol 160: 2261-2270
Lin Y, Schiefelbein J (2001) Embryonic control of epidermal cell patterning in the root and hypocotyl of Arabidopsis. Development 128: 3697-3705
Lipinski CA (2000) Drug-like properties and the causes of poor solubility and poor permeability. J Pharmacol Toxicol Methods 44: 235-249
Liscum E, Reed JW (2002) Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol Biol 49: 387-400
Loizeau K, De Brouwer V, Gambonnet B, Yu A, Renou JP, Van Der Straeten D, Lambert WE, Rebeille F, Ravanel S (2008) A genome-wide and metabolic analysis determined the adaptive response of Arabidopsis cells to folate depletion induced by methotrexate. Plant Physiol 148: 2083-2095
Loreti E, Alpi A, Perata P (2000) Glucose and disaccharide-sensing mechanisms modulate the expression of alpha-amylase in barley embryos. Plant Physiol 123: 939-948
Loreti E, Povero G, Novi G, Solfanelli C, Alpi A, Perata P (2008) Gibberellins, jasmonate and abscisic acid modulate the sucrose-induced expression of anthocyanin biosynthetic genes in Arabidopsis. New Phytol 179: 1004-1016
Mason MG, Mathews DE, Argyros DA, Maxwell BB, Kieber JJ, Alonso JM, Ecker JR, Schaller GE (2005) Multiple type-B response regulators mediate cytokinin signal transduction in Arabidopsis. Plant Cell 17: 3007-3018
Masubelele NH, Dewitte W, Menges M, Maughan S, Collins C, Huntley R, Nieuwland J, Scofield S, Murray JA (2005) D-type cyclins activate division in the root apex to promote seed germination in Arabidopsis. Proc Natl Acad Sci U S A 102: 15694-15699
McClung CR (2006) Plant circadian rhythms. Plant Cell 18: 792-803 McCourt P, Desveaux D (2010) Plant chemical genetics. New Phytol 185: 15-26 Mehrshahi P, Gonzalez-Jorge S, Akhtar TA, Ward JL, Santoyo-Castelazo A,
Marcus SE, Lara-Nunez A, Ravanel S, Hawkins ND, Beale MH, Barrett DA, Knox JP, Gregory JF, 3rd, Hanson AD, Bennett MJ, Dellapenna D (2010) Functional analysis of folate polyglutamylation and its essential role in plant metabolism and development. Plant J 64: 267-279
Mishra BS, Singh M, Aggrawal P, Laxmi A (2009) Glucose and auxin signaling interaction in controlling Arabidopsis thaliana seedlings root growth and development. PLoS One 4: e4502
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9: 490-498
Moore B, Zhou L, Rolland F, Hall Q, Cheng WH, Liu YX, Hwang I, Jones T, Sheen J (2003) Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science 300: 332-336
Morgan DG (1964) Influence of Alpha-Naphthylphthalamic Acid on the Movement of Indolyl-3-Acetic Acid in Plants. Nature 201: 476-477
Moubayidin L, Di Mambro R, Sabatini S (2009) Cytokinin-auxin crosstalk. Trends Plant Sci 14: 557-562
Moubayidin L, Perilli S, Dello Ioio R, Di Mambro R, Costantino P, Sabatini S (2010) The rate of cell differentiation controls the Arabidopsis root meristem
149
growth phase. Curr Biol 20: 1138-1143 Mudgil Y, Uhrig JF, Zhou J, Temple B, Jiang K, Jones AM (2009) Arabidopsis N-
MYC DOWNREGULATED-LIKE1, a positive regulator of auxin transport in a G protein-mediated pathway. Plant Cell 21: 3591-3609
Muller B, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification during early embryogenesis. Nature 453: 1094-1097
Muller R, Morant M, Jarmer H, Nilsson L, Nielsen TH (2007) Genome-wide analysis of the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar metabolism. Plant Physiology 143: 156-171
Muller R, Nilsson L, Nielsen LK, Nielsen TH (2005) Interaction between phosphate starvation signalling and hexokinase-independent sugar sensing in Arabidopsis leaves. Physiologia Plantarum 124: 81-90
Muraro D, Byrne H, King J, Bennett M (2013) The role of auxin and cytokinin signalling in specifying the root architecture of Arabidopsis thaliana. J Theor Biol 317: 71-86
Murashige T, Skoog F (1962) A REVISED MEDIUM FOR RAPID GROWTH AND BIO ASSAYS WITH TOBACCO TISSUE CULTURES. Physiologia plantarum 15: 473-497
Nakamura A, Higuchi K, Goda H, Fujiwara MT, Sawa S, Koshiba T, Shimada Y, Yoshida S (2003) Brassinolide induces IAA5, IAA19, and DR5, a synthetic auxin response element in Arabidopsis, implying a cross talk point of brassinosteroid and auxin signaling. Plant Physiol 133: 1843-1853
Nieuwland J, Maughan S, Dewitte W, Scofield S, Sanz L, Murray JA (2009) The D-type cyclin CYCD4;1 modulates lateral root density in Arabidopsis by affecting the basal meristem region. Proc Natl Acad Sci U S A 106: 22528-22533
Noguchi T, Fujioka S, Takatsuto S, Sakurai A, Yoshida S, Li J, Chory J (1999) Arabidopsis det2 is defective in the conversion of (24R)-24-methylcholest-4-En-3-one to (24R)-24-methyl-5alpha-cholestan-3-one in brassinosteroid biosynthesis. Plant Physiol 120: 833-840
Noutoshi Y, Ikeda M, Saito T, Osada H, Shirasu K (2012) Sulfonamides identified as plant immune-priming compounds in high-throughput chemical screening increase disease resistance in Arabidopsis thaliana. Front Plant Sci 3: 245
Ohto M, Onai K, Furukawa Y, Aoki E, Araki T, Nakamura K (2001) Effects of sugar on vegetative development and floral transition in Arabidopsis. Plant Physiol 127: 252-261
Okushima Y, Overvoorde PJ, Arima K, Alonso JM, Chan A, Chang C, Ecker JR, Hughes B, Lui A, Nguyen D, Onodera C, Quach H, Smith A, Yu G, Theologis A (2005) Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19. Plant Cell 17: 444-463
Olszewski N, Sun TP, Gubler F (2002) Gibberellin signaling: biosynthesis, catabolism, and response pathways. Plant Cell 14 Suppl: S61-80
Osuna D, Usadel B, Morcuende R, Gibon Y, Blasing OE, Hohne M, Gunter M, Kamlage B, Trethewey R, Scheible WR, Stitt M (2007) Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to
150
carbon-deprived Arabidopsis seedlings. Plant Journal 49: 463-491 Overvoorde PJ, Okushima Y, Alonso JM, Chan A, Chang C, Ecker JR, Hughes
B, Liu A, Onodera C, Quach H, Smith A, Yu G, Theologis A (2005) Functional genomic analysis of the AUXIN/INDOLE-3-ACETIC ACID gene family members in Arabidopsis thaliana. Plant Cell 17: 3282-3300
Owens CM, Mawhinney C, Grenier JM, Altmeyer R, Lee MS, Borisy AA, Lehar J, Johansen LM (2010) Chemical combinations elucidate pathway interactions and regulation relevant to Hepatitis C replication. Mol Syst Biol 6: 375
Park SY, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, Lumba S, Santiago J, Rodrigues A, Chow TF, Alfred SE, Bonetta D, Finkelstein R, Provart NJ, Desveaux D, Rodriguez PL, McCourt P, Zhu JK, Schroeder JI, Volkman BF, Cutler SR (2009) Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 324: 1068-1071
Parrott D, Yang L, Shama L, Fischer AM (2005) Senescence is accelerated, and several proteases are induced by carbon "feast" conditions in barley (Hordeum vulgare L.) leaves. Planta 222: 989-1000
Pego JV, Smeekens SC (2000) Plant fructokinases: a sweet family get-together. Trends Plant Sci 5: 531-536
Perilli S, Di Mambro R, Sabatini S (2012) Growth and development of the root apical meristem. Curr Opin Plant Biol 15: 17-23
Perilli S, Sabatini S (2010) Analysis of root meristem size development. Methods Mol Biol 655: 177-187
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45
Piotrowski JS, Ho CH, Boone C (2010) The awesome power of synergy from chemical-chemical profiling. Chem Biol 17: 789-790
Planchais S, Glab N, Inze D, Bergounioux C (2000) Chemical inhibitors: a tool for plant cell cycle studies. FEBS Lett 476: 78-83
Prabhu V, Chatson BK, Abrams GD, King J (1997) C-13 NMR studies of the effects of sulfanilamide and methotrexate on mitochondrial glycine metabolism in Arabidopsis. Plant Physiology 114: 688-688
Prabhu V, Chatson KB, Lui H, Abrams GD, King J (1998) Effects of sulfanilamide and methotrexate on 13C fluxes through the glycine decarboxylase/serine hydroxymethyltransferase enzyme system in arabidopsis. Plant Physiol 116: 137-144
Prabhu V, Chatson KB, Lui H, Abrams GD, King J (1998) Effects of sulfanilamide and methotrexate on C-13 fluxes through the glycine decarboxylase/serine hydroxymethyltransferase enzyme system in Arabidopsis. Plant Physiology 116: 137-144
Prabhu V, Lui H, King J (1997) Arabidopsis dihydropteroate synthase: general properties and inhibition by reaction product and sulfonamides. Phytochemistry 45: 23-27
Preston J, Tatematsu K, Kanno Y, Hobo T, Kimura M, Jikumaru Y, Yano R, Kamiya Y, Nambara E (2009) Temporal expression patterns of hormone
151
metabolism genes during imbibition of Arabidopsis thaliana seeds: a comparative study on dormant and non-dormant accessions. Plant Cell Physiol 50: 1786-1800
Price J, Laxmi A, St Martin SK, Jang JC (2004) Global transcription profiling reveals multiple sugar signal transduction mechanisms in Arabidopsis. Plant Cell 16: 2128-2150
Quail PH (1998) The phytochrome family: dissection of functional roles and signalling pathways among family members. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 353: 1399-1403
Quail PH (2007) Phytochrome-regulated gene expression. Journal of Integrative Plant Biology 49: 11-20
Quirino BF, Noh YS, Himelblau E, Amasino RM (2000) Molecular aspects of leaf senescence. Trends Plant Sci 5: 278-282
Ravanel S, Cherest H, Jabrin S, Grunwald D, Surdin-Kerjan Y, Douce R, Rebeille F (2001) Tetrahydrofolate biosynthesis in plants: molecular and functional characterization of dihydrofolate synthetase and three isoforms of folylpolyglutamate synthetase in Arabidopsis thaliana. Proc Natl Acad Sci U S A 98: 15360-15365
Ravanel S, Douce R, Rebeille F (2011) Metabolism of Folates in Plants. In F Rebeille, ed, Biosynthesis of Vitamins in Plants: Vitamins B6, B8, B9, C, E, K - Pt B, Vol 59. Academic Press Ltd-Elsevier Science Ltd, London, pp 67-106
Reed JW, Elumalai RP, Chory J (1998) Suppressors of an Arabidopsis thaliana phyB mutation identify genes that control light signaling and hypocotyl elongation. Genetics 148: 1295-1310
Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C (2003) Regulation of phyllotaxis by polar auxin transport. Nature 426: 255-260
Richard C, Lescot M, Inze D, De Veylder L (2002) Effect of auxin, cytokinin, and sucrose on cell cycle gene expression in Arabidopsis thaliana cell suspension cultures. Plant Cell Tissue and Organ Culture 69: 167-176
Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JA (1999) Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283: 1541-1544
Riou-Khamlichi C, Menges M, Healy JM, Murray JA (2000) Sugar control of the plant cell cycle: differential regulation of Arabidopsis D-type cyclin gene expression. Mol Cell Biol 20: 4513-4521
Robert HS, Friml J (2009) Auxin and other signals on the move in plants. Nat Chem Biol 5: 325-332
Robert S, Raikhel NV, Hicks GR (2009) Powerful partners: Arabidopsis and chemical genomics. Arabidopsis Book 7: e0109
Rogers LA, Campbell MM (2004) The genetic control of lignin deposition during plant growth and development. New Phytologist 164: 17-30
Rogers LA, Dubos C, Cullis IF, Surman C, Poole M, Willment J, Mansfield SD, Campbell MM (2005) Light, the circadian clock, and sugar perception in the control of lignin biosynthesis. J Exp Bot 56: 1651-1663
Rognoni S, Teng S, Arru L, Smeekens SCM, Perata P (2007) Sugar effects on early seedling development in Arabidopsis. Plant Growth Regulation 52: 217-
152
228 Roldan M, Gomez-Mena C, Ruiz-Garcia L, Salinas J, Martinez-Zapater JM
(1999) Sucrose availability on the aerial part of the plant promotes morphogenesis and flowering of Arabidopsis in the dark. Plant Journal 20: 581-590
Rolland F, Baena-Gonzalez E, Sheen J (2006) Sugar sensing and signaling in plants: conserved and novel mechanisms. Annu Rev Plant Biol 57: 675-709
Rook F, Bevan MW (2003) Genetic approaches to understanding sugar-response pathways. J Exp Bot 54: 495-501
Rook F, Corke F, Baier M, Holman R, May AG, Bevan MW (2006) Impaired sucrose induction1 encodes a conserved plant-specific protein that couples carbohydrate availability to gene expression and plant growth. Plant J 46: 1045-1058
Rook F, Corke F, Card R, Munz G, Smith C, Bevan MW (2001) Impaired sucrose-induction mutants reveal the modulation of sugar-induced starch biosynthetic gene expression by abscisic acid signalling. Plant J 26: 421-433
Rook F, Hadingham SA, Li Y, Bevan MW (2006) Sugar and ABA response pathways and the control of gene expression. Plant Cell Environ 29: 426-434
Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B (2003) An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53: 247-259
Rosti J, Barton CJ, Albrecht S, Dupree P, Pauly M, Findlay K, Roberts K, Seifert GJ (2007) UDP-glucose 4-epimerase isoforms UGE2 and UGE4 cooperate in providing UDP-galactose for cell wall biosynthesis and growth of Arabidopsis thaliana. Plant Cell 19: 1565-1579
Sabatini S, Beis D, Wolkenfelt H, Murfett J, Guilfoyle T, Malamy J, Benfey P, Leyser O, Bechtold N, Weisbeek P, Scheres B (1999) An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 99: 463-472
Sahr T, Ravanel S, Rebeille F (2005) Tetrahydrofolate biosynthesis and distribution in higher plants. Biochem Soc Trans 33: 758-762
Sairanen I, Novak O, Pencik A, Ikeda Y, Jones B, Sandberg G, Ljung K (2012) Soluble Carbohydrates Regulate Auxin Biosynthesis via PIF Proteins in Arabidopsis. Plant Cell 24: 4907-4916
Saito K, Watahiki M, Yamamoto K (2007) Differential expression of the auxin primary response gene MASSUGU2/IAA19during tropic responses of Arabidopsis hypocotyls. Physiologia plantarum 130: 148-156
Santner A, Calderon-Villalobos LI, Estelle M (2009) Plant hormones are versatile chemical regulators of plant growth. Nat Chem Biol 5: 301-307
Sanz L, Dewitte W, Forzani C, Patell F, Nieuwland J, Wen B, Quelhas P, De Jager S, Titmus C, Campilho A, Ren H, Estelle M, Wang H, Murray JA (2011) The Arabidopsis D-type cyclin CYCD2;1 and the inhibitor ICK2/KRP2 modulate auxin-induced lateral root formation. Plant Cell 23: 641-660
Sarkar AK, Luijten M, Miyashima S, Lenhard M, Hashimoto T, Nakajima K, Scheres B, Heidstra R, Laux T (2007) Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature 446: 811-
153
814 Scheres B (2007) Stem-cell niches: nursery rhymes across kingdoms. Nature
Reviews Molecular Cell Biology 8: 345-354 Scheres B, Bauch M, Campilho A, Galinha C, Heidstra R, Perez-Perez JM,
Wildwater M, Willemsen V, Wolkenfelt H (2005) Establishment and function of the Arabidopsis root stem cell organizer. Mechanisms of Development 122: S24-S25
Schreiber K, Ckurshumova W, Peek J, Desveaux D (2008) A high-throughput chemical screen for resistance to Pseudomonas syringae in Arabidopsis. Plant J 54: 522-531
Sederoff RR, MacKay JJ, Ralph J, Hatfield RD (1999) Unexpected variation in lignin. Curr Opin Plant Biol 2: 145-152
Segre D, Deluna A, Church GM, Kishony R (2005) Modular epistasis in yeast metabolism. Nat Genet 37: 77-83
Sena G, Wang X, Liu HY, Hofhuis H, Birnbaum KD (2009) Organ regeneration does not require a functional stem cell niche in plants. Nature 457: 1150-1153
Shani E, Yanai O, Ori N (2006) The role of hormones in shoot apical meristem function. Curr Opin Plant Biol 9: 484-489
Shelat AA, Guy RK (2007) The interdependence between screening methods and screening libraries. Curr Opin Chem Biol 11: 244-251
Shin J, Kim K, Kang H, Zulfugarov IS, Bae G, Lee CH, Lee D, Choi G (2009) Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors. Proc Natl Acad Sci U S A 106: 7660-7665
Skylar A, Sung F, Hong F, Chory J, Wu X (2011) Metabolic sugar signal promotes Arabidopsis meristematic proliferation via G2. Dev Biol 351: 82-89
Smeekens S, Ma J, Hanson J, Rolland F (2010) Sugar signals and molecular networks controlling plant growth. Curr Opin Plant Biol 13: 274-279
Smith AM, Stitt M (2007) Coordination of carbon supply and plant growth. Plant Cell and Environment 30: 1126-1149
Smukste I, Stockwell BR (2005) Advances in chemical genetics. Annu Rev Genomics Hum Genet 6: 261-286
Sodeoka M, Sampe R, Kojima S, Baba Y, Usui T, Ueda K, Osada H (2001) Synthesis of a tetronic acid library focused on inhibitors of tyrosine and dual-specificity protein phosphatases and its evaluation regarding VHR and cdc25B inhibition. J Med Chem 44: 3216-3222
Sokolov LN, Dejardin A, Kleczkowski LA (1998) Sugars and light/dark exposure trigger differential regulation of ADP-glucose pyrophosphorylase genes in Arabidopsis thaliana (thale cress). Biochem J 336 ( Pt 3): 681-687
Solfanelli C, Poggi A, Loreti E, Alpi A, Perata P (2006) Sucrose-specific induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiol 140: 637-646
Srivastava AC, Ramos-Parra PA, Bedair M, Robledo-Hernandez AL, Tang Y, Sumner LW, Diaz de la Garza RI, Blancaflor EB (2011) The folylpolyglutamate synthetase plastidial isoform is required for postembryonic root development in Arabidopsis. Plant Physiol 155: 1237-1251
154
Srivastava AC, Tang Y, Diaz de la Garza RI, Blancaflor EB (2011) The plastidial folylpolyglutamate synthetase and root apical meristem maintenance. Plant Signal Behav 6
Stahura FL, Xue L, Godden JW, Bajorath J (1999) Molecular scaffold-based design and comparison of combinatorial libraries focused on the ATP-binding site of protein kinases. J Mol Graph Model 17: 1-9, 51-52
Stevenson CC, Harrington GN (2009) The impact of supplemental carbon sources on Arabidopsis thaliana growth, chlorophyll content and anthocyanin accumulation. Plant Growth Regulation 59: 255-271
Stevenson JM, Perera IY, Heilmann I, Persson S, Boss WF (2000) Inositol signaling and plant growth. Trends Plant Sci 5: 252-258
Stockwell BR (2000) Chemical genetics: ligand-based discovery of gene function. Nat Rev Genet 1: 116-125
Stockwell BR (2004) Exploring biology with small organic molecules. Nature 432: 846-854
Stokes ME, Chattopadhyay, A., Wilkins, O., Nambara, E., Campbell, M.M. (2013) Interplay between sucrose and folate modulates auxin signalling in Arabidopsis. Doctoral Thesis
Storozhenko S, De Brouwer V, Volckaert M, Navarrete O, Blancquaert D, Zhang GF, Lambert W, Van Der Straeten D (2007) Folate fortification of rice by metabolic engineering. Nat Biotechnol 25: 1277-1279
Storozhenko S, Navarrete O, Ravanel S, De Brouwer V, Chaerle P, Zhang GF, Bastien O, Lambert W, Rebeille F, Van Der Straeten D (2007) Cytosolic hydroxymethyldihydropterin pyrophosphokinase/dihydropteroate synthase from Arabidopsis thaliana: a specific role in early development and stress response. J Biol Chem 282: 10749-10761
Tatematsu K, Kumagai S, Muto H, Sato A, Watahiki MK, Harper RM, Liscum E, Yamamoto KT (2004) MASSUGU2 encodes Aux/IAA19, an auxin-regulated protein that functions together with the transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and formation of lateral roots in Arabidopsis thaliana. Plant Cell 16: 379-393
Teale WD, Ditengou FA, Dovzhenko AD, Li X, Molendijk AM, Ruperti B, Paponov I, Palme K (2008) Auxin as a model for the integration of hormonal signal processing and transduction. Mol Plant 1: 229-237
ten Tusscher K, Scheres B (2011) Joining forces: feedback and integration in plant development. Curr Opin Genet Dev 21: 799-805
Tian Q, Reed JW (1999) Control of auxin-regulated root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126: 711-721
Tian Q, Uhlir NJ, Reed JW (2002) Arabidopsis SHY2/IAA3 inhibits auxin-regulated gene expression. Plant Cell 14: 301-319
Tiwari SB, Hagen G, Guilfoyle T (2003) The roles of auxin response factor domains in auxin-responsive transcription. Plant Cell 15: 533-543
Tiwari SB, Hagen G, Guilfoyle TJ (2004) Aux/IAA proteins contain a potent transcriptional repression domain. Plant Cell 16: 533-543
Tiwari SB, Wang XJ, Hagen G, Guilfoyle TJ (2001) AUX/IAA proteins are active repressors, and their stability and activity are modulated by auxin. Plant Cell
155
13: 2809-2822 To JP, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM,
Ecker JR, Kieber JJ (2004) Type-A Arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell 16: 658-671
Toth R, van der Hoorn RA (2010) Emerging principles in plant chemical genetics. Trends Plant Sci 15: 81-88
Truernit E, Haseloff J (2008) A simple way to identify non-viable cells within living plant tissue using confocal microscopy. Plant Methods 4: 15
Tsukagoshi H (2012) Defective root growth triggered by oxidative stress is controlled through the expression of cell cycle-related genes. Plant Sci 197: 30-39
Tsukagoshi H, Busch W, Benfey PN (2011) Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell 143: 606-616
Ubeda-Tomas S, Bennett MJ (2010) Plant development: size matters, and it's all down to hormones. Curr Biol 20: R511-513
Ubeda-Tomas S, Federici F, Casimiro I, Beemster GT, Bhalerao R, Swarup R, Doerner P, Haseloff J, Bennett MJ (2009) Gibberellin signaling in the endodermis controls Arabidopsis root meristem size. Curr Biol 19: 1194-1199
Ubeda-Tomas S, Swarup R, Coates J, Swarup K, Laplaze L, Beemster GT, Hedden P, Bhalerao R, Bennett MJ (2008) Root growth in Arabidopsis requires gibberellin/DELLA signalling in the endodermis. Nat Cell Biol 10: 625-628
Ulmasov T, Hagen G, Guilfoyle TJ (1997) ARF1, a transcription factor that binds to auxin response elements. Science 276: 1865-1868
Ulmasov T, Hagen G, Guilfoyle TJ (1999) Dimerization and DNA binding of auxin response factors. Plant J 19: 309-319
Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9: 1963-1971
Uppalapati S, Li W, Yasuhiro I, Sumner LW, Dixon RA, Mysore KS (2009) Targeted lignin modification confers tolerance to fungal pathogens in alfalfa. Phytopathology 99: S132-S132
Usadel B, Blasing OE, Gibon Y, Retzlaff K, Hohne M, Gunther M, Stitt M (2008) Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. Plant Physiol 146: 1834-1861
van den Berg C, Willemsen V, Hage W, Weisbeek P, Scheres B (1995) Cell fate in the Arabidopsis root meristem determined by directional signalling. Nature 378: 62-65
van Doorn WG (2008) Is the onset of senescence in leaf cells of intact plants due to low or high sugar levels? J Exp Bot 59: 1963-1972
Van Wilder V, De Brouwer V, Loizeau K, Gambonnet B, Albrieux C, Van Der Straeten D, Lambert WE, Douce R, Block MA, Rebeille F, Ravanel S (2009) C1 metabolism and chlorophyll synthesis: the Mg-protoporphyrin IX
156
methyltransferase activity is dependent on the folate status. New Phytol 182: 137-145
vandenBerg C, Willemsen V, Hendriks G, Weisbeek P, Scheres B (1997) Short-range control of cell differentiation in the Arabidopsis root meristem. Nature 390: 287-289
Vanneste S, Friml J (2009) Auxin: a trigger for change in plant development. Cell 136: 1005-1016
Vergara R, Parada F, Rubio S, Perez FJ (2012) Hypoxia induces H2O2 production and activates antioxidant defence system in grapevine buds through mediation of H2O2 and ethylene. J Exp Bot 63: 4123-4131
Walters WP, Namchuk M (2003) Designing screens: how to make your hits a hit. Nat Rev Drug Discov 2: 259-266
Wang R, Guegler K, LaBrie ST, Crawford NM (2000) Genomic analysis of a nutrient response in Arabidopsis reveals diverse expression patterns and novel metabolic and potential regulatory genes induced by nitrate. Plant Cell 12: 1491-1509
Wang R, Okamoto M, Xing X, Crawford NM (2003) Microarray analysis of the nitrate response in Arabidopsis roots and shoots reveals over 1,000 rapidly responding genes and new linkages to glucose, trehalose-6-phosphate, iron, and sulfate metabolism. Plant Physiol 132: 556-567
Welsch ME, Snyder SA, Stockwell BR (2010) Privileged scaffolds for library design and drug discovery. Curr Opin Chem Biol 14: 347-361
Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H, Schmulling T (2003) Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell 15: 2532-2550
Wiese A, Elzinga N, Wobbes B, Smeekens S (2005) Sucrose-induced translational repression of plant bZIP-type transcription factors. Biochem Soc Trans 33: 272-275
Wilkins O, Brautigam K, Campbell MM (2010) Time of day shapes Arabidopsis drought transcriptomes. Plant J 63: 715-727
Willemsen V, Wolkenfelt H, de Vrieze G, Weisbeek P, Scheres B (1998) The HOBBIT gene is required for formation of the root meristem in the Arabidopsis embryo. Development 125: 521-531
Wingler A, Roitsch T (2008) Metabolic regulation of leaf senescence: interactions of sugar signalling with biotic and abiotic stress responses. Plant Biol (Stuttg) 10 Suppl 1: 50-62
Wise EM, Jr., Abou-Donia MM (1975) Sulfonamide resistance mechanism in Escherichia coli: R plasmids can determine sulfonamide-resistant dihydropteroate synthases. Proc Natl Acad Sci U S A 72: 2621-2625
Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction. Ann Bot 95: 707-735
Wu ZJ, Irizarry RA, Gentleman R, Martinez-Murillo F, Spencer F (2004) A model-based background adjustment for oligonucleotide expression arrays. Journal of the American Statistical Association 99: 909-917
Xiao W, Sheen J, Jang JC (2000) The role of hexokinase in plant sugar signal
157
transduction and growth and development. Plant Mol Biol 44: 451-461 Yazdanbakhsh N, Sulpice R, Graf A, Stitt M, Fisahn J (2011) Circadian control of
root elongation and C partitioning in Arabidopsis thaliana. Plant Cell Environ 34: 877-894
Yeh P, Kishony R (2007) Networks from drug-drug surfaces. Mol Syst Biol 3: 85 Yeh P, Tschumi AI, Kishony R (2006) Functional classification of drugs by
properties of their pairwise interactions. Nat Genet 38: 489-494 Yuan K, Wysocka-Diller J (2006) Phytohormone signalling pathways interact with
sugars during seed germination and seedling development. J Exp Bot 57: 3359-3367
Zadnikova P, Petrasek J, Marhavy P, Raz V, Vandenbussche F, Ding Z, Schwarzerova K, Morita MT, Tasaka M, Hejatko J, Van Der Straeten D, Friml J, Benkova E (2010) Role of PIN-mediated auxin efflux in apical hook development of Arabidopsis thaliana. Development 137: 607-617
Zhang HM, Deng XY, Miki D, Cutler S, La HG, Hou YJ, Oh J, Zhu JK (2012) Sulfamethazine Suppresses Epigenetic Silencing in Arabidopsis by Impairing Folate Synthesis. Plant Cell 24: 1230-1241
Zhao Y, Chow TF, Puckrin RS, Alfred SE, Korir AK, Larive CK, Cutler SR (2007) Chemical genetic interrogation of natural variation uncovers a molecule that is glycoactivated. Nat Chem Biol 3: 716-721
Zheng W, Zhai Q, Sun J, Li CB, Zhang L, Li H, Zhang X, Li S, Xu Y, Jiang H, Wu X, Li C (2006) Bestatin, an inhibitor of aminopeptidases, provides a chemical genetics approach to dissect jasmonate signaling in Arabidopsis. Plant Physiol 141: 1400-1413
Zhou L, Jang JC, Jones TL, Sheen J (1998) Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Natl Acad Sci U S A 95: 10294-10299
158
Copyright Acknowledgements
Statement of Publications
The research presented in this thesis has appeared or has been submitted as a
series of original publications in refereed journals.
Chapter 2
Stokes ME, Chattopadhyay A, Wilkins O, Nambara E, and Campbell MM. (2013).
Interplay between sucrose and folates modulates auxin signalling in Arabidopsis.
Plant Physiology. DOI: http://dx.doi.org/10.1104/pp.113.215095
