Submitted 30 January 2020Accepted 10 April 2020Published 13 May 2020

Corresponding authorJoong-Ki Park jkparkewhaackr

Academic editorJia-Yong Zhang

Additional Information andDeclarations can be found onpage 14

DOI 107717peerj9108

Copyright2020 Kim et al

Distributed underCreative Commons CC-BY 40

OPEN ACCESS

The mitochondrial genome of Acrobeloidesvarius (Cephalobomorpha) confirms non-monophyly of Tylenchina (Nematoda)Taeho Kim1 Yucheol Lee1 Hyun-Jong Kil2 and Joong-Ki Park1

1Division of EcoScience Ewha Womans University Seoul Republic of Korea2Animal Resources Division National Institute of Biological Resources Incheon Republic of Korea

ABSTRACTThe infraorder Cephalobomorpha is a diverse and ecologically important nematodegroup found in almost all terrestrial environments In a recent nematode classificationsystem based on SSU rDNA Cephalobomorpha was classified within the suborderTylenchina with Panagrolaimomorpha Tylenchomorpha and DrilonematomorphaHowever phylogenetic relationships among species within Tylenchina are not alwaysconsistent and the phylogenetic position of Cephalobomorpha is still uncertain Inthis study in order to examine phylogenetic relationships of Cephalobomorpha withother nematode groups we determined the complete mitochondrial genome sequenceof Acrobeloides varius the first sequenced representative of Cephalobomorpha andused this sequence for phylogenetic analyses along with 101 other nematode speciesPhylogenetic analyses using amino acid and nucleotide sequence data of 12 protein-coding genes strongly support a sister relationship between the two cephalobomor-pha species A varius and Acrobeles complexus (represented by a partial mt genomesequence) In thismitochondrial genome phylogeny Cephalobomorphawas sister to allchromadorean species (excluding Plectus acuminatus of Plectida) and separated fromPanagrolaimomorpha andTylenchomorpha renderingTylenchina non-monophyleticMitochondrial gene order among Tylenchina species is not conserved and gene clustersshared between A varius and A complexus are very limited Results from phylogeneticanalysis and gene order comparison confirms Tylenchina is not monophyletic Tobetter understand phylogenetic relationships among Tylenchina members additionalmitochondrial genome information is needed fromunderrepresented taxa representingPanagrolaimomorpha and Cephalobomorpha

Subjects Evolutionary Studies Molecular Biology TaxonomyKeywords Acrobeloides varius Cephalobomorpha Tylenchina Mitochondrial genome Phy-logeny

INTRODUCTIONThe suborder Tylenchina sensu De Ley amp Blaxter (2002) represents one of the mostmorphologically and ecologically diverse arrays of nematodes and contains manydifferent trophic types microbivores fungivores and plant- and animal-parasitic forms(Baldwin Ragsdale amp Bumbarger 2004 Bert et al 2008 Siddiqi 1980) In the SSU rDNA-based classification system for the phylum Nematoda the suborder Tylenchina wasinitially classified to include four infraorders (Cephalobomorpha Drilonematomorpha

How to cite this article Kim T Lee Y Kil H-J Park J-K 2020 The mitochondrial genome of Acrobeloides varius (Cephalobomorpha)confirms non-monophyly of Tylenchina (Nematoda) PeerJ 8e9108 httpdoiorg107717peerj9108

Panagrolaimomorpha and Tylenchomorpha) (De Ley amp Blaxter 2002 De Ley amp Blaxter2004)

Cephalobomorphs one of the infraordinal groups in Tylenchina are the dominantfauna together with other nematodes in nutrient-poor soil such as deserts and dry Antarcticvalleys and may play important roles in shaping ecological systems there (Andriuzzi et al2018 De Tomasel et al 2013 Freckman amp Mankau 1986 Freckman amp Virginia 1997 Leeet al 2019 Sylvain et al 2014) Additionally this group constitutes a microbivorousor saprophagous clade that is found in diverse terrestrial environments includingtropical rainforests and hot deserts (Nadler et al 2006 Timm 1971 Waceke et al 2005)Historically relationships between cephalobomorphs and other chromadorean nematodesinferred using morphology have produced considerably different hypotheses On thebasis of similarities in stoma and oesophagus features cephalobomorphs were consideredclosely related to rhabditomorphs in many previous nematode taxonomies (Chitwood ampChitwood 1977Maggenti 1981 Poinar 1983) On the other hand other authors proposedthat cephalobomorphs had a close relationship with parasitic fungivore and plantparasitic tylenchs (Siddiqi 1980 Siddiqi 2000) the entomopathogenic steinernematids(Poinar 1993) andor annelid-parasitic drilonematids (Coomans amp Goodey 1965 De Leyamp Coomans 1990 Spiridonov Ivanova amp Wilson 2005)

In the first phylum-wide molecular phylogeny of nematodes using nuclear smallsubunit ribosomal DNA (SSU rDNA) sequences cephalobs were placed in Clade IVwith panagrolaimids strongyloids steinernematids and tylenchs (Blaxter et al 1998) Ina further revised nematode classification system (De Ley amp Blaxter 2004) following theSSU phylogeny cephalobs were treated as the infraorder Cephalobomorpha and placedin the suborder Tylenchina along with Drilonematomorpha Panagrolaimomorpha andTylenchomorpha These relationships were supported in subsequent phylogenetic analysesusing SSU rDNA data with more extensive taxon sampling (Holterman et al 2006 VanMegen et al 2009) However relationships among subordinate taxa within Tylenchinawere not always consistent depending on the size of the datasets analyzed (Holterman etal 2006 Van Megen et al 2009) Thus alternative genetic markers are needed to elucidatethe relationships that SSU rDNA data are not sufficient to resolve

Complete mitochondrial genomes have been used for phylogenetic analyses ofdiverse animal groups and are a powerful molecular marker for resolving not onlydeep phylogeny but also relationships between groups with relatively recent commonancestry (Hegedusova et al 2014 Hu amp Gasser 2006 Littlewood et al 2006 Liu et al2013 Park et al 2007Waeschenbach et al 2006) In nematode phylogenetic analyses basedon complete mitochondrial genome sequences inferred relationships have been mostlysimilar to SSU rRNAormorphology-based phylogenies However amitochondrial genomeapproach has provided alternative hypotheses that differed from nuclear gene phylogenyin some cases such as non-monophyly of clade III (sensu Blaxter et al 1998) non-monophyly of Tylenchomorpha and strong support for a clade consisting of the infraordersRhabditomorpha Diplogasteromorpha Ascaridomorpha and Rhigonematomorpha (Kimet al 2017 Kim et al 2014)

Kim et al (2020) PeerJ DOI 107717peerj9108 220

Although available mt genome information for nematodes has been increasing in recentyears some nematode groups including free-living microbivores and insect-associatedtaxa are still underrepresented In fact among the 200 currently available nematode mtgenomes (in GenBank as of December 2019) no representatives from Cephalobomorphaare yet available only a partial fragment (contains cox1-cox3 nad2-nad6 nad4l and 15tRNA genes) of the Acrobeles complexus mt genome (see Kim et al 2015 for details) Inthis study we determined the complete mitochondrial genome sequence of Acrobeloidesvarius the first full representative of the infraorder Cephalobomorpha compared itsgenome structure and organization to other nematodes and used it to infer phylogeneticrelationships among chromadorean nematodes

MATERIAL AND METHODSSampling culturing and identification of specimensSpecimens were obtained from soil collected from agricultural (rice) farmland inHapcheon-gun Gyeongsangnam Province South Korea Species identification wasperformed by a careful examination of morphological characters and morphometricanalysis following the protocols of a recently published study (Kim Kim amp Park 2017)For culturing one individual nematode was transferred onto a soil agar plate (25 mgmlautoclaved soil 5 ugml cholesterol and 1 agar) at room temperature Specimens weresubsequently selected from the culture plate roughly half of all selected specimens wereused for species identification (see Kim Kim amp Park 2017) the other half were preservedin absolute ethanol and stored at minus80 C until total genomic DNA was extracted Toreconfirm species identification cox1 sequences from each individual were compared withcox1 sequences of the specimens published in Kim Kim amp Park (2017)

Molecular techniquesTotal genomic DNA was extracted from about 10 individuals using a lysis buffercontaining 02 M NaCl 02 M Tris-HCL (pH 80) 1 (vv) β-mercaptoethanol and800 microgml proteinase-K (Holterman et al 2006) Four partial fragments were initiallyamplified by polymerase chain reaction (PCR) for four different genes (cox1 cobrrnL and nad5) using nematode-specific primer sets (Cepha_CO1_FCepha_CO1_Rfor cox1 Chroma_Cob_FChroma_Cob_R for cob Nema_16S_FNema_16S_R forrrnL and Nema_ND5_FNema_ND5_R for nad5) designed from conserved regions ofother nematode mitochondrial gene sequences available on GenBank (Table 1) PCRamplification was carried out in total 50 microL-volume reactions consisting of 02 mM dNTPmixture 1XExTaq buffer containingMgCl2 10 pmol primers (for both forward and reverseprimers) 125 U Taq polymerase (TaKaRa Ex Taq) and 2 microL template with the followingamplification conditions one cycle of initial denaturing at 95 C for 1 min followed by 35cycles of denaturation at 95 C for 30 s annealing at 47 C for 30 s extension at 72 C for 1min and one cycle of final extension at 72 C for 10min The nucleotide sequences obtainedfrom respective partial DNA fragments were then used to design species-specific primersets (Table 1) for long PCR amplification PCR reactions were carried out in 50 microL totalvolumes consisting of 04 mM dNTP mixture 1X LA Taq buffer 25 mMMgCl2 10 pmol

Kim et al (2020) PeerJ DOI 107717peerj9108 320

Table 1 Primers used to sequence the complete mitochondrial genome of Acrobeloides varius

Primers Sequence (5primerarr3prime) Estimatedsize of PCRproducts

Cepha_CO1_F ATGATTTTTTTTATGGTGATGCCCepha_CO1_R ACTACAAAATATGTGTCATG

700 bp

Nema_16S_F WWTAAATGGCAGYCTTAGCGTGANema_16S_R TCTYMCRAYGAAYTAAACTAATATC

450 bp

Nema_ND5_F GTTCATAGAAGTACTTTGGTKACTGCTGNema_ND5_R AAGACGMWAACWATAAMHAAAAGT

500 bp

Chroma_Cob_F CARATRWSNTWTTGRGCChroma_Cob_R TAYCAYTCNGGNACAAYATG

370 bp

Acva_CO1_F GAGCGCATCATATGTATGTAACTGGAcva_16S_R CTACCCAAGGCGTCGTGTTCATCAC

6 kb

Acva _16S_F CTTAGCGTGCGGACTTTAATGTAGCAcva _ND5_R GAACCCACAGAATTTCACTTGCGTC

2 kb

Acva _ND5_F CATGTGGGTTCTAATCAACAAAATTGACGAcva _Cob_R ACACCTCTGTGAACGTAAAGCACAC

21 kb

Acva _Cob_F GGTTATTAATGATAATCCTTATTATAGGTGCAcva _CO1_R GATCTACAGAAGCTCCATAATGAC

85 kb

primers (both forward and reverse primers) 25 U Taq polymerase (TaKaRa LA Taq) and2 microL template with the following amplification conditions one cycle of initial denaturingat 95 C for 1 min followed by 35 cycles of denaturation at 95 C for 30 s annealingand extension at 55 C to 70 C for 2 min to 10 min and one cycle of final extension at68 C for 10 min The amplified PCR products were isolated on 1 agarose gels using aQIAquick Gel Extraction Kit (QIAGEN Co) following standard protocols Two long-PCRproducts (Acva_16S_FAcva_ND5_R and Acva_ND5_FAcva_Cob_R) were used directlyfor primer walking sequencing The other long-PCR products (Acva_CO1_FAcva_16S_Rand Acva_Cob_FAcva_CO1_R) were ligated into a pCR-XL-TOPO vector using a TOPOXL PCR Cloning Kit (Invitrogen Co) and then transformed into One Shot TOP10Electrocompetent E coli using electroporation (18 kV) Plasmid DNAs were extractedfrom competent cells using a QIAprep Spin Miniprep Kit (QIAGEN Co) followingstandard protocols Sequences of the PCR-amplified andor cloned DNA fragments weredetermined using a Big Dye Terminator Cycle-Sequencing kit and ABI PRISM 3730XLAnalyzer (Applied Biosystem Co) A complete strand of the entire mitochondrial DNAsequence was then assembled by reconfirming the sequences of the overlapping regions ofthe long PCR fragments and partial fragments

Gene annotation and phylogenetic analysesThe 12 protein-coding genes (PCGs) and two ribosomal RNA genes were identified usingthe web-based automatic annotation programs DOGMA (httpdogmaccbbutexasedu)(Wyman Jansen amp Boore 2004) and MITOS (httpmitosbioinfuni-leipzigdeindexpy)(Bernt et al 2013) The boundaries of each gene were confirmed by comparing nucleotide

Kim et al (2020) PeerJ DOI 107717peerj9108 420

sequences with those from closely related nematodes Putative secondary structures of24 tRNAs were inferred using tRNAscan-SE Search Server v121 (Lowe amp Eddy 1997)MITOS (Bernt et al 2013) and DOGMA (Wyman Jansen amp Boore 2004) and tRNAsecondary structures and anticodon sequences were then checked manually

For phylogenetic analysis a representative nematode species was chosen from eachgenus for which a complete mitochondrial genome was available fromGenBank (Table S1)Nucleotide and amino acid sequences of the 12 PCGs of 102 nematode species includingA varius and two arthropod species (outgroups) were concatenated for the analyses Inthe nucleotide (NT) dataset two datasets (3rd codon positions included and excludedwere prepared for the analysis to examine whether tree topology is affected by nucleotidesubstitution saturation which is most likely to occur in the third codon position Multiplealignments of amino acid sequences of 12 PCGs were done individually using MAFFTwith default options (Katoh amp Standley 2013) Nucleotide sequences of the 12 individualPCGs were also aligned with a scaffold of aligned amino acid sequences using RevTrans(Wernersson amp Pedersen 2003)

For phylogenetic analysis individual amino acid and nucleotide alignments of 12 PCGswere both concatenated using Geneious Pro 1023 (Biomatters Co) The phylogeneticanalyses utilizing each concatenated sequence dataset (amino acid (AA) sequences (4532AA residues) and nucleotide (NT) sequences with third codon position included (13596bp) or excluded (9064 bp)) were performed usingmaximum likelihood (ML) with RAxML8210 (Stamatakis 2014) and using Bayesian inference (BI) with MrBayes version 326(Huelsenbeck amp Ronquist 2001) both programs were run through the CIPRES portal(Miller Pfeiffer amp Schwartz 2010) The AA and NT sequence alignments were depositedin TreeBASE (httpswwwtreebaseorg (ID number 25588)) For phylogenetic analysesthe best-fit substitution model for each amino acid sequence dataset was estimated usingthe Akaike Information Criterion (AIC) as implemented in ProtTest 342 (Darriba et al2011) (Table S2) Substitution models for the two types of nucleotide sequence datasets(including versus excluding 3rd codon positions) were estimated separately for each geneusing the AIC as implemented in jModelTest (Darriba et al 2012) For the ML analysiseach of the 12 PCGs was treated as a separate partition and the best-fit substitution model(JTT LG MtArt or Vt) for the amino acid dataset was applied (Table S2) Similarly for theML analysis of the two nucleotide sequence datasets each of the 12 PCGs was also treated asa separate unlinked data partition for nucleotide datasets RAxML uses the GTR GAMMAmodel for finding the optimal tree with the shape of the gamma distribution estimatedseparately for each partition Bootstrap maximum likelihood analysis was performed usingthe rapid bootstrapping option with 1000 iterations For the BI analysis the LG+I+Gmodel of substitution (the closest fit model available for use in CIPRES) was used for theamino acid dataset and the best-fit models for each of the 12 PCGs were used for the twonucleotide datasets (Table S2) Bayesian analysis was performed using four MCMC chainsfor 1 times 106 generations sampled every 100 generations Bayesian posterior probability(BPP) values were estimated after discarding the initial 25 times 104 generations as burn-in

Kim et al (2020) PeerJ DOI 107717peerj9108 520

RESULTS AND DISCUSSIONThe mitochondrial genome of A variusThe complete mitochondrial genome of A varius (GenBank accession no MK559448) iscomposed of 17650 bp and contains 12 PCGs (atp6 cob cox1-3 nad1-6 and nad4L) 22tRNA genes and 2 rRNA genes (Fig 1 and Table 2) The overall nucleotide compositionof the A varius mitochondrial DNA is 457 T 88 C 309 A and 146 G and theoverall A+T content is 766 (Table S3) The overall A+T content is similar to that of otherchromadorean nematodes which ranges from 670 (Ascaridia sp GHL-2013 (Liu et al2013) to 854 (Radopholus similis (Jacob et al 2009)) In the 12 protein-coding mtDNAgenes (PCGs) the most commonly used start codon is ATT which is used for five genes(atp6 cob nad1 nad4 and nad6) (Table 2) Two genes (cox2 and nad3) start with ATAwhereas nad2 and nad4l are inferred to initiate with ATG and cox1 with GTG while cox3starts with TTG The gene nad5 uses TTT as the start codon For termination codons eightgenes (cob cox2 cox3 nad2 nad3 nad4l nad5 and nad6) appear to use TAA and fourgenes (atp6 cox1 nad1 and nad4) use TAG The codon usage of A variusmtDNA is biasedtowards T-rich codons similar to other nematode species The four most frequently usedcodons are all T-rich (more than 2 Ts per triplet) TTT (106) TTA (112) ATT (75)and TAT (54) accounting for 347 of all PCGs (Table S4) In contrast the frequencyof C-rich codons (more than 2 Cs per triplet) is very low (29)

The tRNA predicted secondary structures ranging from 55 bp (trnH ) to 63 bp (trnItrnK and trnM ) in size are similar to those found in other nematode species (Fig S1and Table 2 See Kim et al 2017 for details) 22 tRNAs lack a T9C arm which is insteadreplaced by a TV-replacement loop whereas trnS1 and trnS2 lack a dihydrouridine arm(DHU) and instead have a T9C structure Note that tRNAs encoding trnE and trnK areinferred to be duplicated two nucleotide sequence regions with respective sizes of 58 bp(trnE-1) and 62 bp (trnE-2) are inferred for trnE (Fig S1 and Table 2) In addition twotrnK gene copies (consisting of 57 bp (trnK -1) and 63 bp (trnK -2)) are inferred Theseduplicated tRNA copies are assumed to be functional since they are predicted to formtypical nematode tRNA secondary structures (Fig S1) Duplication of tRNA genes has beenoccasionally reported from other nematode mitochondrial genomes such as Camallanuscotti (Zou et al 2017) Dracunculus medinensis (Genbank accession no NC_016019 Clarket al 2016) and Ruizia karukerae (Kim et al 2018)

The small ribosomal RNA (rrnS) is located between NCR3 and cox2 with a length of907 bp and the large ribosomal RNA (rrnL) is located between trnH and nad3 with alength of 1183 bp (Table 2) These two rRNA genes are among the largest in nematodemtDNA thus far reported The predicted secondary structures of rrnS and rrnL of Avarius (Figs S2 and S3) were inferred based on secondary structures of the rRNAs ofother nematodes (Caenorhabditids elegans and Ascaris suum (Okimoto et al 1992) andSteinernema carpocapsae (Montiel et al 2006)) the 16S and 23S rRNAs of Escherichiacoli (Dams et al 1988 Gutell 1994 Gutell Gray amp Schnare 1993) and the LSU rRNA ofTetrahymena pyriformis (De Rijk et al 1999) The secondary structures of the two rRNAsare generally conserved in nematode mitochondrial genomes but some elements differ

Kim et al (2020) PeerJ DOI 107717peerj9108 620

Acrobeloides varius17650 bp

Figure 1 Representation of circular mitochondrial genome of Acrobeloides varius All genes are en-coded in the clockwise direction and 22 tRNA genes are marked by a single-letter amino acid code basedon the International Union of Pure and Applied Chemistry (IUPAC) code The two leucine and two ser-ine tRNA genes are labeled according to their individual anticodon sequence as L1 (trnL1-uag) L2 (trnL2-uaa) S1 (trnS1-ucu) and S2 (trnS2-uga) respectively

Full-size DOI 107717peerj9108fig-1

among nematode species For example helices 5 and 16 are absent from rrnS in Dirofilariaimmitis and Strongyloides stercoralis (Hu Chilton amp Gasser 2003 Hu et al 2003) andhelices C1 D6-10 D21 H3 and H4 are absent from rrnL in Xiphinema americanum (He etal 2005) The predicted secondary structures of both rRNAs in theA variusmt genome aresimilar to those reported from other nematodes such as C elegans and A suum Howeverhelices 35 and 39 and helices G9-G14 are predicted in rrnS and rrnL respectively (Figs S2and S3) These elements are found in the 16S and 23S rRNAs of E coli but have not yetbeen reported from any other nematode species

Three non-coding regions (NCRs) (ranging from 564 bp to 1449 bp in size) are presentin the A variusmt genome with high A+T content ranging from 805 (NCR1) to 837(NCR3) (Fig 1 and Table 2) Stem-and-loop structures formed by tandemly repeatedsequences are found in all NCRs (Fig S4)

Kim et al (2020) PeerJ DOI 107717peerj9108 720

Table 2 Mitochondrial genome organization of Acrobeloides varius

Gene region Position Size Codons Intergenicsequence

Start Finish No of nta No of aaa Initiation Termination

cox1 1 1575 1575 524 GTG TAG 48trnG 1624 1680 57 0trnL1 1681 1738 58 2nad1 1741 2613 873 290 ATT TAG minus1trnY 2613 2668 56 9atp6 2678 3238 561 186 ATT TAG 11trnV 3250 3305 56 3trnL2 3309 3365 57 32trnT 3398 3458 61 22nad4 3481 4671 1191 396 ATT TAG 49nad2 4721 5545 825 274 ATG TAA 0trnI 5546 5608 63 13trnH 5622 5676 55 0rrnL 5677 6859 1183 0nad3 6860 7204 345 114 ATA TAA 18trnC 7223 7280 58 17trnA 7298 7353 56 4nad5 7358 8950 1593 530 TTT TAA 12nad6 8963 9400 438 145 ATT TAA minus1nad4l 9400 9633 234 77 ATG TAA 7trnW 9641 9699 59 47trnS1 9747 9804 58 1cob 9806 10900 1095 364 ATT TAA 40trnN 10941 10997 57 10trnF 11008 11067 60 3cox3 11071 11844 774 257 TTG TAA 0NCR1 11845 12408 564 0trnE 12409 12466 58 61trnE 12528 12589 62 12trnK 12602 12658 57 0NCR2 12659 13906 1248 0trnD 13907 13963 57 124trnS2 14088 14144 57 28trnQ 14173 14231 59 11trnP 14243 14303 61 5trnM 14309 14371 63 0NCR3 14372 15820 1449 0rrnS 15821 16727 907 0cox2 16728 17429 702 233 ATA TAA 2trnR 17432 17487 56 58trnK 17546 17608 63 42

NotesaStop codons were not includednt nucleotide aa amino acid

Kim et al (2020) PeerJ DOI 107717peerj9108 820

Mitochondrial genome phylogenyPhylogenetic analyses involved two tree-building methods (ML and BI) for three differentdatasets (amino acid (AA) sequences and nucleotide (NT) sequences with third codonpositions either included or excluded) for all 12 PCGs from 102 nematode species In allphylogenetic analyses the respectivemonophyly of chromadorean and enoplean nematodeswas strongly supported (Fig 2 and Figs S5ndashS9) Although supporting values among somechromadorean infraordinal groups were low and some relationships varied depending ontree building methods and datasets many elements of previously published mitogenomephylogenies were robustly supported the non-monophyly of the suborder Spirurinanon-monophyly of Tylenchomorpha and the nested position of Diplogasteromorphawithin Rhabditomorpha (see Kim et al 2017 for more details)

In this study mitochondrial genome trees depicted the monophyly of two cephalobs(A varius and A complexus) with high branch support value (100 Bayesian posteriorprobability (BPP) in the BI tree and 100 bootstrap percentage (BP) in the ML tree) inall phylogenetic analyses (Fig 2 and Figs S5ndashS9) Cephalobomorpha represented by thetwo cephalob species (one partial and one complete sequence) was found to be basal toall chromadorean species (excluding Plectus acuminatus of Plectida) and separated fromPanagrolaimomorpha and Tylenchomorpha rendering Tylenchina non-monophyleticIn addition we recently recognized that the Panagrellus redivivus mitochondrial genomesequence (GenBank accession KM192364) published in an earlier article (Kim et al2015) was incorrect possibly due to PCR contamination with a different nematode speciesIn order to check itsmisidentificationwe compared themtDNA cox1 andnuclear 28S rDNAsequences of the P redivivus specimens used in Kim et al (2015) with previously publishedandor unpublished sequences of some Tylenchina species the 28S rDNA sequence of theP redivivus specimen of Kim et al (2015) is very different (773 sequence identity) fromthe P redivivus sequence (GenBank accession DQ145695 Nadler et al 2006) but it isvery similar to A complexus (GenBank accession DQ145668 Nadler et al 2006) (955sequence identity) and A varius sequence (995 sequence identity GenBank accession MT233103 (this study)) The mtDNA cox1 sequences between and A varius (this study)and the P redivivus specimens of Kim et al (2015) differed by 96 Based on this sequencecomparison the P redivivus specimen reported in Kim et al (2015) is assumed to be someCephalobidae species likely to be close toAcrobeloides species Therefore themitochondrialgenome sequence labelled as P redivivus (sensu Kim et al 2015) was retracted fromGenbank and we replaced it with other P redivivus sequence that is newly available onGenBank (GenBank accession no AP0174641 Clark et al 2016) Unlike the non-sisterrelationship between P redivivus and Halicephalobus gingivalis representing one of thePanagrolaimomorpha families (ie Panagrolaimidae) depicted from Kim et al (2015)phylogenetic trees grouped the new P redivivus sequence with H gingivalis as a sisterspecies (Fig 2 and Figs S5ndashS9) These relationships received high support values (100 BPPin BI tree and 93ndash100 BP in the ML tree) In previous phylogenetic studies relationshipsamong major groups within Tylenchina including the position of Cephalobomorphawithin Tylenchina varied depending on the data source (ie morphology vs moleculardata) and taxon sampling used for phylogenetic inference Traditional morphology-based

Kim et al (2020) PeerJ DOI 107717peerj9108 920

01 substitutionssite

Cylicostephanus goldiCyathostomum catinatumCylicocyclus insignisPoteriostomum imparidentatumTriodontophorus brevicaudaStrongylus vulgarisMacropicola ocydromiHypodontus macropiChabertia ovina

Oesophagostomum dentatumAncylostoma duodenale

Uncinaria sanguinisNecator americanusBunostomum phlebotomumSyngamus tracheaTeladorsagia circumcincta

Marshallagia marshalliCooperia oncophora

Mecistocirrus digitatusHaemonchus contortus

Trichostrongylus axeiHeligmosomoides polygyrusNippostrongylus brasiliensisNematodirus oiratianus

Aelurostrongylus abstrususAngiostrongylus vasorum

Protostrongylus rufescensParafilaroides normaniMetastrongylus pudendotectus

Dictyocaulus viviparusOscheius chongmingensisLitoditis marinaCaenorhabditis elegansHeterorhabditis bacteriophora

Pristionchus pacificusKoerneria sudhausi

Ascaris lumbricoidesParascaris univalens

Baylisascaris procyonisToxascaris leoninaToxocara malaysiensisAnisakis simplexPseudoterranova azarasiContracaecum rudolphii

Ortleppascaris sinensisRhigonema thysanophora

Ruizia karukeraeHeterakis gallinarumAscaridia columbae

Cucullanus robustusGnathostoma spinigerum

Steinernema carpocapsaeRhabditophanes sp KR3021Parastrongyloides trichosuriHalicephalobus gingivalis

Aphelenchoides besseyiBursaphelenchus xylophilus

Aphelenchus avenaeStrongyloides stercoralis

Dracunculus medinensisPhilometroides sanguineus

Camallanus cottiLoa loa

Chandlerella quiscaliBrugia malayiWuchereria bancroftiAcanthocheilonema viteae

Litomosoides sigmodontisOnchocerca volvulus

Dirofilaria immitisSetaria digitata

Gongylonema pulchrumSpirocerca lupi

Thelazia callipaedaHeliconema longissimum

Oxyuris equiAspiculuris tetraptera

Passalurus ambiguus

Wellcomia siamensisEnterobius vermicularis

Syphacia obvelata

Heterodera glycinesGlobodera ellingtonae

Radopholus similisMeloidogyne chitwoodi

Pratylenchus vulnus

Panagrellus redivivus

Acrobeloides varius

Plectus acuminatusHexamermis agrotis

Agamermis sp BH-2006Thaumamermis cosgroveiRomanomermis culicivorax

Strelkovimermis spiculatusLongidorus vineacolaParalongidorus litoralis

Xiphinema americanumTrichinella spiralis

Trichuris trichiuraLimulus polyphemus

Lithobius forficatus

Acrobeles complexus

Coronocyclus labiatusCylicodontophorus bicoronatus

Physalopteridae

Ascarididae

Onchocercidae

Oxyuridae

Angiostrongylidae

Cucullanidae

Ancylostomatidae

PanagrolaimidaeAphelenchoididae

Heteroderidae

Steinernematidae

Syngamidae

Heterorhabditidae

Rhigonematidae

Thelaziidae

Dracunculidae

Haemonchidae

Dictyocaulidae

ToxocaridaeAnisakidae

Setariidae

Ascaridiidae

Cloacinidae

Protostrongylidae

Strongyloididae

Neodiplogasteridae

Aphelenchidae

Chabertiidae

Trichostrongylidae

MeloidogynidaePratylenchidae

Metastrongylidae

Cooperiidae

Gnathostomatidae

Philometridae

Gongylonematidae

Rhabditidae

Strongylidae

Molineidae

Pratylenchidae

Heterakidae

Alloionematidae

HeteroxynematidaeOxyuridae

Plectidae

Cloacinidae

Filaroididae

HeligmosomatidaeHeligmonellidae

Strongyloididae

Ascarididae

Camallanidae

Cephalobidae

Trichostrongylidae

Tylenchomorpha

Rhabditomorpha

Spiruromorpha

Oxyuridomorpha

Ascaridomorpha

Diplogasteromorpha

Rhigonematomorpha

Dracunculoidea

Mermithida

Dorylaimida

TrichinellidaArthropodoutgroups

Tylenchomorpha

Gnathostomatomorpha

Plectida

Panagrolaimomorpha

Ascaridomorpha

Cephalobomorpha

Panagrolaimomorpha

Rhabditina Tylenchina

TylenchinaSpirurina

Spirurina

Chromadorea

Enoplea100

10099

10098

74

100

93

98

8698

99

99

79

79

95

82

93

99

99 7895

95

100100

82

100 87

100

99

100 91

90

85

85

77

99100

100100

10078

98100

100

99

98100

100

100

100

75100

74

76

100

100100

98

100

100

100

100 100

10084

98

100100

100

98

98

100

94

95

100

93(Aphelenchoidea)

(Tylenchoidea)

Figure 2 Maximum likelihood (ML) tree based on the amino acid sequences of 12 protein-codinggenes from the mitochondrial genomes of 102 nematodes and two outgroups Bootstrap percentages(BP) were calculated using the rapid bootstrapping method BP values lt70 are not shown

Full-size DOI 107717peerj9108fig-2

hypotheses depicted a close relationship between cephalobomorphs and rhabditomorphsbased on similarities in stoma and oesophagus features (Chitwood amp Chitwood 1977Maggenti 1981 Poinar 1983) On the other hand cephalobomorphs were inferred to beclosely allied to tylenchs based on some morphological characters (Siddiqi 1980 Siddiqi2000) a thickened internal cuticle with irregular basal bulb lumen of some tylenchomorphswas considered as a degenerate form of the valve in the basal bulb of cephalobomorphs a

Kim et al (2020) PeerJ DOI 107717peerj9108 1020

common origin of the inverted U-shaped excretory system of cephalobomorphs and theasymmetrical system of tylenchomorphs morphological similarity between phasmid-likestructure in Tylenchidae species and hypodermal pores of some Nothacrobeles speciessimilarity of cuticle and lateral field in their structure prodelphic reproductive systemreduction of papillae on the male tail Moreover in previous analyses of SSU rDNArelationships among cephalobomorphs and other Tylenchina nematodes varied dependingon dataset size (Blaxter et al 1998 Holterman et al 2006 Van Megen et al 2009) Thefirst phylum-wide nematode molecular phylogenies (Blaxter et al 1998 Holterman et al2006) depicted Cephalobomorpha as sister to a Tylenchoidea + Aphelenchidae cladeIn contrast phylogenetic analysis with extended taxon coverage (van Megen et al 2009)depicted Cephalobomorpha was sister to all Tylenchina species except Steinernematidae(Strongyloidoidea) Inconsistency in relationships among the groups within Tylenchinawas interpreted as an artifact of long-branch attraction due to the high A+T contents ofsome aphelenchoids (Aphelenchoididae Parasitaphelenchidae and Seinuridae) and thePanagrolaimomorpha (ca 54 and 57 respectively Holterman et al 2006) (Holtermanet al 2006 Van Megen et al 2009) Meanwhile a molecular phylogenetic study of thesuborder Cephalobina sensu (Andraacutessy 1974) using LSU rDNA data (Nadler et al 2006)depicted different relationships depending on analysis methods a parsimonious treeshowed a sister relationship between cephalobs and tylenchs whereas an ML tree depicteda sister relationship between cephalobs and Panagrolaimidae (excluding Brevibucca sp)Minimum evolution analysis found chambersiellids (infraorder Panagrolaimomorpha) tobe the sister group of cephalobs Such inconsistent relationships from different methodswere assumed due to nucleotide compositional bias andor long-branch attraction in LSUphylogeny (Nadler et al 2006) thus these relationships have needed validation usingindependent molecular markers and broader taxon sampling

In the present study mitochondrial genome trees from different methods stronglysupported a paraphyletic relationship between Cephalobomorpha and Tylenchoidea ofTylenchomorpha separate from Panagrolaimomorpha and Aphelenchoidea (anotherbranch of Tylenchomorpha) rendering Tylenchina non-monophyletic This result isnot consistent with earlier studies including molecular phylogenies (SSU rDNA Blaxteret al 1998 Holterman et al 2006) and morphology-based phylogenies (Siddiqi 1980Siddiqi 2000) that supported close relationship between cephalobomorphs and tylenchsThe non-monophyly of Tylenchina inferred from mt genome trees contradicts previousSSU rDNA phylogenies that supported monophyly of Tylenchina members (Blaxteret al 1998 Holterman et al 2006 Van Megen et al 2009) Although the present studystrongly indicated non-monophyly of Tylenchina relationships within Tylenchina arenot fully resolved due to the instability of some non-monophyletic groups includingTylenchomorpha and Panagrolaimomorpha Phylogenetic algorithms are not able to easilyhandle compositional heterogeneity across lineages which may exist in both rDNA andmitochondrial genome markers (Liu et al 2018 Yang et al 2018) This factor limits thepotential implications of phylogenetic estimation using mitochondrial genomes Howeverit has been shown that mitochondrial genome composition across chromadorean speciesis not very heterogeneous (Kim et al 2014) For better resolution of the phylogenetic

Kim et al (2020) PeerJ DOI 107717peerj9108 1120

relationships among Cephalobomorpha Tylenchomorpha and Panagrolaimomorphaadditional mitochondrial genome sequences from underrepresented taxa andor furtherphylogenetic analyses using additional genetic markers are needed

Comparison of mitochondrial gene arrangementCompared to enoplean species the mitochondrial gene order of chromadorean nematodesis relatively conserved and gene order similarity among certain groups has been interpretedas additional supporting evidence for their phylogenetic affinity although an idiosyncraticpattern has also been reported in some species (Kim et al 2014 Kim et al 2017)Among nematode mt genomes reported thus far gene arrangement patterns in mostmembers of Rhabditomorpha (70 of 72 species) Ascaridomorpha (24 of 28 species)Diplogasteromorpha (one of two species) Aphelenchoididae (all three species except fortrnN ) and Steinernema (2 out of 4 species) are identical except for some idiosyncratic genearrangements and a few minor translocations of tRNAs in some species (Jex et al 2010Kim et al 2018 Liu et al 2013Montiel et al 2006Wang et al 2016)

A sister relationship between A varius and A complexus is recovered in phylogeneticanalyses but gene clusters shared between these two cephalobomorpha species (althoughthe mtDNA of A complexus is a partial sequence) are very limited nad5+nad6+nad4land cox2+trnR The gene arrangement of A varius is also very different from otherTylenchomorpha (Tylenchina) species with very limited shared gene clusters (Fig 3)nad2+trnI trnH+rrnL+nad3 and nad6+nad4l are shared with Meloidogyne spp(Besnard et al 2014 Humphreys-Pereira amp Elling 2014 Humphreys-Pereira amp Elling2015) nad2+trnI rrnL+nad3 nad6+nad4l and trnS2+trnQ with Pratylenchus vulnus(Sultana et al 2013) trnL1+nad1 and trnT+nad4 with Globodera ellingtonae (Phillipset al 2016) trnT+nad4 and rrnL+nad3 with Heterodera glycines (Gibson et al 2011)and nad6+nad4l trnT+nad4 nad2+trnI and trnH+rrnL+nad3 with R similis (Jacobet al 2009) Shared gene clusters between A varius and Panagrolaimomorpha speciesare also very limited trnT+nad4 trnH+rrnL+nad3 trnP+trnM nad6+nad4L+trnWnad2+trnI and trnN+trnF are shared with Rhabditophanes sp KR3021 (Hunt et al2016) nad4L+trnW trnH+rrnL+nad3 nad2+trnI cox3+trnE and trnT+nad4 are sharedwith Parastrongyloides trichosuri (Hunt et al 2016) trnH+rrnL+nad3 nad4L+trnWnad2+trnI and trnT+nad4 are shared with S carpocapsae (Montiel et al 2006) andtrnH+rrnL+nad3 nad6+nad4L+trnW nad2+trnI and trnT+nad4 are sharedwith S glaseriS litorale S kushidai (Kikuchi Afrin amp Yoshida 2016) H gingivalis (Kim et al 2015)and P redivivus (GenBank accession no AP0174641 Clark et al 2016) Although genearrangement of Tylenchina species is not conserved the most common gene arrangementpattern of Rhabditomorpha Ascaridomorpha and Diplogasteromorpha is also found insome Tylenchina species (Fig 3) Aphelenchoides besseyi Bursaphelenchus xylophilus Bmuronatus (Tylenchomorpha) P redivivus H gingivalis and four Steinernema species(Panagrolaimomorpha) where gene order is almost identical andor very similar to themost common gene arrangement type Further mitochondrial genome survey of gene orderinformation is needed to understand whether the gene order data can be useful to estimatephylogenetic relationships among Tylenchina species

Kim et al (2020) PeerJ DOI 107717peerj9108 1220

Meloidogyne chitwoodi

Pratylenchus vulnus

Heterodera glycines

Radopholus similis

Panagrellus redivivus

Acrobeloides varius

Globodera ellingtonae

Meloidogyne arenaria Meloidogyne enterolobii Meloidogyne incognita and Meloidogyne javanica

Meloidogyne graminicola

Steinernema carpocapsae

Rhabditophanes sp KR3021

Parastrongyloides trichosuri

Strongyloides venezuelensis

Halicephalobus gingivalis

Steinernema glaseri and Steinernema litorale

Steinernema kushidai

Strongyloides stercoralis

Strongyloides papillosus

Strongyloides ratti

Aphelenchoides besseyi Bursaphelenchus xylophilus and Bursaphelenchus mucronatus

Aphelenchus avenae

Acrobeles complexus

Plectus acuminatus

Plectus aquatilis

Chromosome I Chromosome II

Chromosome I Chromosome II

S2 K RS1WGM E TYN L2VPC FH QID A L1cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3

cox1 nad4Lcox3 atp6nad2 nad3nad1rrnScob cox2 rrnLnad6nad4 nad5S2K P S1WG M ET YN L2V R CFH QI DL1 A

cox1 nad4Lcox3 atp6nad2 nad3nad1rrnS cobcox2 rrnLnad6 nad4 nad5S2K R S1W G M ET Y NL2 VPC F H QI D AL1

cox1 nad4Lcox3 atp6nad2nad3 nad1rrnScob cox2rrnL nad6 nad4 nad5 S2K RS1W G M ETY NL2 VPC FH QI D AL1

cox1 nad4L cox3 atp6nad2 nad3nad1rrnScob cox2 rrnLnad6 nad4 nad5S2KR S1 WGM ET YNL2VP C F HQID A L1

cox1 nad4L atp6 nad2nad3 nad1rrnS cobcox2 rrnL nad6 nad4nad5 cox3S2 KR S1WGM E TY NL2VPC FH QID A L1

cox1 nad4Latp6 nad2 nad3nad1 rrnScob cox2rrnL nad6nad4 nad5 cox3 S2K RS1WG METY NL2V PC FH QI DAL1 E

cox1 nad4Lcox3 atp6nad2nad3 nad1rrnScobcox2 rrnLnad6nad4 nad5 S2KR S1WGM ET Y N L2 V PC FH Q IDA L1

cox1 nad4Lcox3 atp6nad2 nad3nad1rrnS cobcox2 rrnLnad6 nad4 nad5S2K R S1W G M ET Y NL2 VPC F H QI D AL1

cox1 nad4Lcox3 atp6nad2 nad3nad1rrnS cobcox2 rrnLnad6 nad4 nad5S2K R S1W G M ET Y NL2 VPCF H QI D AL1

K

cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3 S2 K RS1WGM E TYN L2VPC FH QID A L1

cox1 rrnScob cox2 rrnL nad6nad5 nad3 S2 KR S1W GM ET Y NL2VPC FHQ ID AL1 nad4 nad1 atp6 nad2nad4Lcox3

cox1 rrnScobcox2 rrnLnad6nad5 nad3 S2K R S1W GM E TYN L2V P CF HQ I DA L1 nad4nad1 atp6 nad2nad4L cox3

cox1 nad4L cox3atp6nad2nad3 nad1rrnS cobcox2 rrnL nad6 nad4nad5 RS1 WGME T YNL2 PCFHQ IDA L1S2 K

cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3 S2 K RS1WGM E TY NL2VPC FH QID A L1

cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3 S2 K RS1WGM E TYN L2VPC FH QID A L1

cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3 S2 K RS1WGM E TYN L2VPC FH QID A L1

cox1 nad4L cox3 atp6 nad2 nad3 nad1 rrnS cob cox2 rrnL nad6nad4nad5 R S1W GM E TYN L2VP C FH Q I D A L1S2K

cox1 nad4L cox3 atp6nad2 nad3nad1 rrnScobcox2 rrnL nad6nad4nad5 R S1W GM ET YN L2V PC F HQ ID A L1S2KM

cox1 nad4L cox3 atp6 nad2 nad3 nad1rrnScob cox2rrnL nad6 nad4 nad5R S1W GE T YN L2PC F HQ I DA L1 S2K M

cox1 nad4L cox3atp6 nad2nad1rrnS cobcox2 rrnL nad6 nad4nad5nad3 S2 K RS1WGM E TY NL2VPC FH QID A L1

cox1 nad4L cox3atp6nad2 nad3 nad1rrnS cobcox2 rrnL nad6nad4nad5 S2 K R S1 WG M ET Y NL2 VP C FH QID A L1

cox1 nad4L nad2nad3 cox2nad6nad4 nad5cox3S2 K RS1W GYN L2 FI DA L1 E

cox1 nad4L cox3atp6nad2 nad3nad1 rrnS cobcox2 rrnLnad6 nad4 nad5S2 KP S1W G METY N L2V RC FHQ I DL1 A

cox1 nad4L cox3atp6nad2 nad3nad1 rrnS cobcox2 rrnLnad6 nad4 nad5S2 KP S1W G METY N L2V RC FHQ I DL1 A

Rhabditomorpha AscaridomorphaDiplogasteromorpha

Panagrolaimomorpha

Tylenchomorpha

Cephalobomorpha

Plectida

Figure 3 Linearized comparison of the gene arrangement of chromadorean nematode species includ-ing Acrobeloides varius the first sequenced representative of Cephalobomorpha All genes are encodedin the same direction and are not to scale 22 tRNA genes are designated by a single letter amino acid codebased on the International Union of Pure and Applied Chemistry code The two leucine and two serinetRNA genes are labeled according to their distinct anticodon sequences as L1 (trnL1-uag) L2 (trnL2-uaa)S1 (trnS1-ucu) and S2 (trnS2-uga) The non-coding regions are not included Genes underlined in black(eg nad2 in Plectus species) indicate the genes that are transcribed in a reverse direction Bipartite mi-tochondrial genomes of Rhabditophanes sp KR3021 and Globodera ellingtonae are presented as two splitgene clusters respectively

Full-size DOI 107717peerj9108fig-3

Kim et al (2020) PeerJ DOI 107717peerj9108 1320

In conclusion phylogenetic trees based on mitochondrial genome sequences indicatenon-monophyly of Tylenchina (and a basal position of Cephalobomorpha to allchromadorean species excluding Plectus separated from other Tylenchina membersPanagrolaimomorpha and Tylenchomorpha) Nevertheless phylogenetic relationshipsamong Tylenchina nematodes are not clearly established due to inconsistent placementof some taxa including panagrolaimomorphs and aphelenchids Along with employingindependent molecular markers further mitochondrial genome information from theunderrepresented taxa of Panagrolaimomorpha and Cephalobomorpha needs to beobtained to clarify unresolved relationships within Tylenchina

ADDITIONAL INFORMATION AND DECLARATIONS

FundingThis research was supported by the Basic Science Research Program through the NationalResearch Foundation of Korea (NRF) funded by the Ministry of Education Science andTechnology (NRF-2013R1A1A2005898) the Basic Science Research Program throughthe National Research Foundation of Korea (NRF) funded by the Ministry of Education(NRF-2019R1I1A1A01041191) the Marine Biotechnology Program of the Korea Instituteof Marine Science and Technology Promotion (KIMST) funded by the Ministry ofOceans and Fisheries (MOF) (No 20170431) and the National Institute of BiologicalResources (NIBR) funded by the Ministry of Environment (MOE) of the Republic ofKorea (NIBR202002109) The funders had no role in study design data collection andanalysis decision to publish or preparation of the manuscript

Grant DisclosuresThe following grant information was disclosed by the authorsBasic Science Research Program NRF-2013R1A1A2005898Ministry of Education NRF-2019R1I1A1A01041191Ministry of Oceans and Fisheries (MOF) 20170431Ministry of Environment (MOE) of the Republic of Korea NIBR202002109

Competing InterestsThe authors declare there are no competing interests

Author Contributionsbull Taeho Kim conceived and designed the experiments performed the experimentsanalyzed the data prepared figures andor tables authored or reviewed drafts of thepaper and approved the final draft

bull Yucheol Lee analyzed the data authored or reviewed drafts of the paper and approvedthe final draft

bull Hyun-Jong Kil analyzed the data authored or reviewed drafts of the paper and approvedthe final draft

Kim et al (2020) PeerJ DOI 107717peerj9108 1420

bull Joong-Ki Park conceived and designed the experiments performed the experimentsanalyzed the data prepared figures andor tables authored or reviewed drafts of thepaper and approved the final draft

Data AvailabilityThe following information was supplied regarding data availability

The mt genome sequence and the 28S sequence of Acrobeloides varius are available atGenBank MK559448 and MT233103

Supplemental InformationSupplemental information for this article can be found online at httpdxdoiorg107717peerj9108supplemental-information

REFERENCESAndraacutessy I 1974 A nematodaacutek evoluacutecioacuteja eacutes rendszerezeacutese A Magyar Tudomanyos

Akadeacutemia Bioloacutegiai Tudomaacutenyok Osztaacutelyaacutenak koumlzlemeacutenyei 1713ndash58Andriuzzi WS Adams BJ Barrett JE Virginia RAWall DH 2018 Observed trends of

soil fauna in the Antarctic Dry Valleys early signs of shifts predicted under climatechange Ecology 99312ndash321 DOI 101002ecy2090

Baldwin JG Ragsdale EJ Bumbarger D 2004 Revised hypotheses for phylogenetichomology of the stomatostylet in tylenchid nematodes Nematology 6623ndash632DOI 1011631568541042843559

Bernt M Donath A Juumlhling F Externbrink F Florentz C Fritzsch G Puumltz J Mid-dendorf M Stadler PF 2013MITOS improved de novo metazoan mitochon-drial genome annotationMolecular Phylogenetics and Evolution 69313ndash319DOI 101016jympev201208023

BertW Leliaert F Vierstraete AR Vanfleteren JR Borgonie G 2008Molecu-lar phylogeny of the Tylenchina and evolution of the female gonoduct (Ne-matoda Rhabditida)Molecular Phylogenetics and Evolution 48728ndash744DOI 101016jympev200804011

Besnard G Juumlhling F Chapuis Eacute Zedane L Lhuillier Eacute Mateille T Bellafiore S2014 Fast assembly of the mitochondrial genome of a plant parasitic nematode(Meloidogyne graminicola) using next generation sequencing Comptes RendusBiologies 337295ndash301 DOI 101016jcrvi201403003

Blaxter ML De Ley P Garey JR Liu LX Scheldeman P Vierstraete A VanfleterenJR Mackey LY Dorris M Frisse LM Vida JT ThomasWK 1998 A molec-ular evolutionary framework for the phylum Nematoda Nature 39271ndash75DOI 10103832160

Chitwood BG ChitwoodMB 1977 Introduction to nematology Baltimore UniversityPark Press

Clark K Karsch-Mizrachi I Lipman DJ Ostell J Sayers EW 2016 GenBank NucleicAcids Research 44D67ndashD72 DOI 101093nargkv1276

Kim et al (2020) PeerJ DOI 107717peerj9108 1520

Coomans A Goodey JB 1965 Drilocephalobus congoensis ng n sp Nematologica11116ndash120 DOI 101163187529265X00546

Dams E Hendriks L Van de Peer Y Neefs J-M Smits G Vandenbempt I DeWachterR 1988 Compilation of small ribosomal subunit RNA sequences Nucleic AcidsResearch 1687ndash173 DOI 101093nar16supplr87

Darriba D Taboada GL Doallo R Posada D 2011 ProtTest 3 fast selection of best-fitmodels of protein evolution Bioinformatics 271164ndash1165DOI 101093bioinformaticsbtr088

Darriba D Taboada GL Doallo R Posada D 2012 jModelTest 2 more models newheuristics and parallel computing Nature Methods 9772 DOI 101038nmeth2109

De Ley P Blaxter ML 2002 Systematic position and phylogeny In Lee DL ed TheBiology of Nematodes New York Taylor amp Francis 1ndash30

De Ley P Blaxter ML 2004 A new system for Nematoda combining morphologicalcharacters with molecular trees and translating clades into ranks and taxa Nema-tology Monographs and Perspectives 2633ndash653

De Ley P Coomans A 1990 Drilocephalobus moldavicus Lisetskaya 1968 from Senegalan odd nematode adds to its reputation under the scanning electron microscope(Nematoda Rhabditida) Revue de Nematologie 1337ndash43

De Rijk P Robbrecht E De Hoog S Caers A Van de Peer Y DeWachter R 1999Database on the structure of large subunit ribosomal RNA Nucleic Acids Research27174ndash178 DOI 101093nar271174

De Tomasel CM Adams BJ Tomasel FGWall DH 2013 The life cycle of the Antarcticnematode Plectus murrayi under laboratory conditions Journal of Nematology 4539

Freckman DWMankau R 1986 Abundance distribution biomass and energetics ofsoil nematodes in a northern Mojave Desert ecosystem Pedobiologia 29129ndash142

Freckman DW Virginia RA 1997 Low-diversity Antarctic soil nematode com-munities distribution and response to disturbance Ecology 78363ndash369DOI 1018900012-9658(1997)078[0363LDASNC]20CO2

Gibson T Farrugia D Barrett J Chitwood DJ Rowe J Subbotin S DowtonM BonenL 2011 The mitochondrial genome of the soybean cyst nematode Heteroderaglycines Genome 54565ndash574 DOI 101139g11-024

Gutell RR 1994 Collection of small subunit (16S-and 16S-like) ribosomal RNAstructures 1994 Nucleic Acids Research 223502ndash3507 DOI 101093nar22173502

Gutell RR GrayMW Schnare MN 1993 A compilation of large subunit (23S and23S-like) ribosomal RNA structures 1993 Nucleic Acids Research 213055ndash3074DOI 101093nar21133055

He Y Jones J ArmstrongM Lamberti F MoensM 2005 The mitochondrial genomeof Xiphinema americanum sensu stricto (Nematoda Enoplea) considerable econo-mization in the length and structural features of encoded genes Journal of MolecularEvolution 61819ndash833 DOI 101007s00239-005-0102-7

Hegedusova E Brejova B Tomaska L Sipiczki M Nosek J 2014Mitochondrial genomeof the basidiomycetous yeast Jaminaea angkorensis Current Genetics 6049ndash59DOI 101007s00294-013-0410-1

Kim et al (2020) PeerJ DOI 107717peerj9108 1620

HoltermanM Van derWurff A Van Den Elsen S VanMegen H Bongers THolovachov O Bakker J Helder J 2006 Phylum-wide analysis of SSU rDNAreveals deep phylogenetic relationships among nematodes and accelerated evo-lution toward crown cladesMolecular Biology and Evolution 231792ndash1800DOI 101093molbevmsl044

HuM Chilton NB Gasser RB 2003 The mitochondrial genome of Strongyloides sterco-ralis (Nematoda) ndashidiosyncratic gene order and evolutionary implications Interna-tional Journal for Parasitology 331393ndash1408 DOI 101016S0020-7519(03)00130-9

HuM Gasser RB 2006Mitochondrial genomes of parasitic nematodesmdashprogress andperspectives Trends in Parasitology 2278ndash84 DOI 101016jpt200512003

HuM Gasser RB El-Osta YGA Chilton NB 2003 Structure and organization of themitochondrial genome of the canine heartworm Dirofilaria immitis Parasitology12737ndash51 DOI 101017S0031182003003275

Huelsenbeck JP Ronquist F 2001MRBAYES Bayesian inference of phylogenetic treesBioinformatics 17754ndash755 DOI 101093bioinformatics178754

Humphreys-Pereira DA Elling AA 2014Mitochondrial genomes ofMeloidogyne chit-woodi and M incognita (Nematoda Tylenchina) comparative analysis gene orderand phylogenetic relationships with other nematodesMolecular and BiochemicalParasitology 19420ndash32 DOI 101016jmolbiopara201404003

Humphreys-Pereira DA Elling AA 2015Mitochondrial genome plasticity amongspecies of the nematode genusMeloidogyne (Nematoda Tylenchina) Gene560173ndash183 DOI 101016jgene201501065

Hunt VL Tsai IJ Coghlan A Reid AJ Holroyd N Foth BJ Tracey A Cotton JA StanleyEJ Beasley H Bennett HM Brooks K Harsha B Kajitani R Kulkarni A HarbeckeD Nagayasu E Nichol S Ogura Y Quail MA Randle N Xia D Brattig NWSoblik H Ribeiro DM Sanchez-Flores A Hayashi T Itoh T Denver DR GrantW Stoltzfus JD Lok JB Murayama HWastling J Streit A Kikuchi T VineyMBerrimanM 2016 The genomic basis of parasitism in the Strongyloides clade ofnematodes Nature Genetics 48299ndash309 DOI 101038ng3495

Jacob JE Vanholme B Van Leeuwen T Gheysen G 2009 A unique genetic code changein the mitochondrial genome of the parasitic nematode Radopholus similis BMCResearch Notes 2192 DOI 1011861756-0500-2-192

Jex AR Hall RS Littlewood DTJ Gasser RB 2010 An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes Nucleic AcidsResearch 38522ndash533 DOI 101093nargkp883

Katoh K Standley DM 2013MAFFT multiple sequence alignment software version7 improvements in performance and usabilityMolecular Biology and Evolution30772ndash780 DOI 101093molbevmst010

Kikuchi T Afrin T YoshidaM 2016 Complete mitochondrial genomes of fourentomopathogenic nematode species of the genus Steinernema Parasites and Vectors9430 DOI 101186s13071-016-1730-z

Kim J Kern E Kim T SimM Kim J Kim Y Park C Nadler SA Park J-K 2017Phylogenetic analysis of two Plectusmitochondrial genomes (Nematoda

Kim et al (2020) PeerJ DOI 107717peerj9108 1720

Plectida) supports a sister group relationship between Plectida and Rhabdi-tida within ChromadoreaMolecular Phylogenetics and Evolution 10790ndash102DOI 101016jympev201610010

Kim T Kern E Park C Nadler SA Bae YJ Park J-K 2018 The bipartite mitochondrialgenome of Ruizia karukerae (Rhigonematomorpha Nematoda) Scientific Reports87482 DOI 101038s41598-018-25759-0

Kim T Kim J Cho S Min GS Park C Carreno RA Nadler SA Park JK 2014 Phy-logeny of Rhigonematomorpha based on the complete mitochondrial genome ofRhigonema thysanophora (Nematoda Chromadorea) Zoologica Scripta 43289ndash303DOI 101111zsc12047

Kim T Kim J Park J-K 2017 Acrobeloides varius sp n (Rhabditida Cephalobidae) fromSouth Korea Nematology 19489ndash496 DOI 10116315685411-00003064

Kim J Lee SH Gazi M Kim T Jung D Chun JY Kim S Seo TK Park C Baldwin JG2015Mitochondrial genomes advance phylogenetic hypotheses for Tylenchina(Nematoda Chromadorea) Zoologica Scripta 44446ndash462 DOI 101111zsc12112

Lee CK Laughlin DC Bottos EM Caruso T Joy K Barrett JE Brabyn L Nielsen UNAdams BJ Wall DH Hopkins DW Pointing SB McDonald IR Cowan DA BanksJC Stichbury GA Jones I Zawar-Reza P Katurji M Hogg ID Sparrow AD StoreyBC Green TGA Cary SC 2019 Biotic interactions are an unexpected yet criticalcontrol on the complexity of an abiotically driven polar ecosystem CommunicationsBiology 262 DOI 101038s42003-018-0274-5

Littlewood DTJ Lockyer AEWebster BL Johnston DA Le TH 2006 The complete mi-tochondrial genomes of Schistosoma haematobium and Schistosoma spindale and theevolutionary history of mitochondrial genome changes among parasitic flatwormsMolecular Phylogenetics and Evolution 39452ndash467 DOI 101016jympev200512012

Liu G-H Shao R Li J-Y Zhou D-H Li H Zhu X-Q 2013 The complete mitochondrialgenomes of three parasitic nematodes of birds a unique gene order and insights intonematode phylogeny BMC Genomics 14414 DOI 1011861471-2164-14-414

Liu Y Song F Jiang PWilson J-J CaiW Li H 2018 Compositional heterogeneityin true bug mitochondrial phylogenomicsMolecular Phylogenetics and Evolution118135ndash144 DOI 101016jympev201709025

Lowe TM Eddy SR 1997 tRNAscan-SE a program for improved detection oftransfer RNA genes in genomic sequence Nucleic Acids Research 25955ndash964DOI 101093nar255955

Maggenti A 1981General nematology New York Springer-VerlagMiller MA PfeifferW Schwartz T 2010 Creating the CIPRES Science Gateway for

inference of large phylogenetic trees In Gateway Computing Environments Workshop(GCE) IEEE 1ndash8

Montiel R LucenaMAMedeiros J Simotildees N 2006 The complete mitochondrialgenome of the entomopathogenic nematode Steinernema carpocapsae insightsinto nematode mitochondrial DNA evolution and phylogeny Journal of MolecularEvolution 62211ndash225 DOI 101007s00239-005-0072-9

Kim et al (2020) PeerJ DOI 107717peerj9108 1820

Nadler SA De Ley P Mundo-OcampoM Smythe AB Stock SP Bumbarger D AdamsBJ De Ley IT Holovachov O Baldwin JG 2006 Phylogeny of Cephalobina (Ne-matoda) molecular evidence for recurrent evolution of probolae and incongruencewith traditional classificationsMolecular Phylogenetics and Evolution 40696ndash711DOI 101016jympev200604005

Okimoto R Macfarlane JL Clary DOWolstenholme DR 1992 The mitochondrialgenomes of two nematodes Caenorhabditis elegans and Ascaris suum Genetics130471ndash498

Park J-K Kim K-H Kang S KimW EomKS Littlewood D 2007 A common origin ofcomplex life cycles in parasitic flatworms evidence from the complete mitochondrialgenome ofMicrocotyle sebastis (Monogenea Platyhelminthes) BMC EvolutionaryBiology 711 DOI 1011861471-2148-7-11

PhillipsWS Brown AMV Howe DK Peetz AB Blok VC Denver DR Zasada IA 2016The mitochondrial genome of Globodera ellingtonae is composed of two circles withsegregated gene content and differential copy numbers BMC Genomics 17706DOI 101186s12864-016-3047-x

Poinar GO 1983 The natural history of nematodes Englewood Cliffs Prentice-HallPoinar GO 1993 Origins and phylogenetic relationships of the entomophilic rhabditids

Heterorhabditis and Steinernema Fundamental and Applied Nematology 16333ndash338Siddiqi MR 1980 The origin and phylogeny of the nematode orders Tylenchida Thorne

1949 and Aphelenchida n ord Helminthological Abstracts Series B 49143ndash170Siddiqi MR 2000 Tylenchida parasites of plants and insects 2nd edition Wallingford

CABI PublishingSpiridonov SE Ivanova ESWilsonMJ 2005 The nematodes of the genus Dicelis

Dujardin 1845 parasitic in earthworms the interrelationships of four Eurasianpopulations Russian Journal of Nematology 1361ndash81

Stamatakis A 2014 RAxML version 8 a tool for phylogenetic analysis and post-analysisof large phylogenies Bioinformatics 301312ndash1313DOI 101093bioinformaticsbtu033

Sultana T Kim J Lee S-H Han H Kim S Min G-S Nadler SA Park J-K 2013Comparative analysis of complete mitochondrial genome sequences confirmsindependent origins of plant-parasitic nematodes BMC Evolutionary Biology 1312DOI 1011861471-2148-13-12

Sylvain ZAWall DH Cherwin KL Peters DPC Reichmann LG Sala OE 2014Soil animal responses to moisture availability are largely scale not ecosystemdependent insight from a cross-site study Global Change Biology 202631ndash2643DOI 101111gcb12522

TimmRW 1971 Antarctic soil and freshwater nematodes from the McMurdo Soundregion Proceedings of the Helminthological Society of Washington 3842ndash52

VanMegen H Van den Elsen S HoltermanM Karssen G Mooyman P Bongers THolovachov O Bakker J Helder J 2009 A phylogenetic tree of nematodes basedon about 1200 full-length small subunit ribosomal DNA sequences Nematology11927ndash950 DOI 101163156854109X456862

Kim et al (2020) PeerJ DOI 107717peerj9108 1920

Waceke JW Bumbarger DJ Mundo-OcampoM Subbotin SA Baldwin JG 2005 Zeldiaspannata sp n (Nematoda Cephalobidae) from the Mojave Desert CaliforniaJournal of Nematode Morphology and Systematics 857ndash67

Waeschenbach A TelfordMJ Porter JS Littlewood DTJ 2006 The complete mi-tochondrial genome of Flustrellidra hispida and the phylogenetic position ofBryozoa among the MetazoaMolecular Phylogenetics and Evolution 40195ndash207DOI 101016jympev200603007

Wang B-J Gu X-B Yang G-YWang T LaiW-M Zhong Z-J Liu G-H 2016Mito-chondrial genomes of Heterakis gallinae and Heterakis beramporia support thatthey belong to the infraorder Ascaridomorpha Infection Genetics and Evolution40228ndash235 DOI 101016jmeegid201603012

Wernersson R Pedersen AG 2003 RevTrans multiple alignment of coding DNAfrom aligned amino acid sequences Nucleic Acids Research 313537ndash3539DOI 101093nargkg609

Wyman SK Jansen RK Boore JL 2004 Automatic annotation of organellar genomeswith DOGMA Bioinformatics 203252ndash3255 DOI 101093bioinformaticsbth352

Yang H Li T Dang K BuW 2018 Compositional and mutational rate hetero-geneity in mitochondrial genomes and its effect on the phylogenetic infer-ences of Cimicomorpha (Hemiptera Heteroptera) BMC Genomics 19264DOI 101186s12864-018-4650-9

Zou H Jakovlić I Chen R Zhang D Zhang J Li W-XWang G-T 2017 The completemitochondrial genome of parasitic nematode Camallanus cotti extreme discontinu-ity in the rate of mitogenomic architecture evolution within the Chromadorea classBMC Genomics 18840 DOI 101186s12864-017-4237-x

Kim et al (2020) PeerJ DOI 107717peerj9108 2020