THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 267, No. 22, Issue of Auguet 5, pp. 15367-15374,1992 Q 1992 by The American Society for Biochemistry and Molecular Biology, Inc. Pnnted tn U.S.A.

Characterization of a Gene Family Encoding Abscisic Acid- and Environmental Stress-inducible Proteins of Alfalfa*

(Received for publication, August 23, 1991)

Ma Luos, Jin-Hao Lius, Subhra MohapatraQ, Robert D. Hills, and Shyam S . MohapatraSQn From the $Department of Plant Science and the $Department of Immunology, University of Manitoba, Winnipeg, Manitoba R3T 2N2, Canada

The phytohormone abscisic acid (ABA) has been pro- posed as a common mediator controlling adaptive plant responses to a variety of environmental stresses, in- cluding water deficit, salinity, wounding, and low tem- perature. We have recently isolated three cDNAs, pUM90-1, pUM90-2, and pUM91-4, from a cDNA li- brary of ABA-induced mRNAs of alfalfa. These cDNA clones exhibit a very high degree of sequence homology with one another and sequence similarities with cer- tain regions of several stress- and ABA-inducible genes. The polypeptides encoded by these cDNAs are very rich in glycine (35-40%), histidine (7-15%), as- paragine (8-14%), and tyrosine (5-10%) and have no tryptophan and proline. All of the encoded polypep- tides contain characteristic tandem repeats comprising glycine residues intercepted with histidine andfor ty- rosine. The RNAs corresponding to a representative cDNA, pUM90-1, were induced after treatment of seedlings with low temperature, drought, salt, and wounding stress, but not by heat; the induction was maximal under low temperature treatment. ABA and ABA analog rapidly induced the expression of these genes, whereas gibberellic acid treatment exhibited no induction whatsoever. These genes appear to be specif- ically induced in the shoot tissues. Analysis of ABA induction of genes corresponding to pUM9O-1 in al- falfa seedlings of different age groups demonstrated that these genes were inducible in seedlingsfplants of all age groups examined. Taken together these results suggest that these cDNA clones encode a group of pro- teins that are inducible by ABA and multiple environ- mental stresses and correspond to a new family of genes of plants, designated as ABA- and environmental stress-inducible genes.

The phytohormone abscisic acid (ABA)' plays a cardinal role in regulation of a number of physiological processes that include: (i) embryo morphogenesis and the development of seeds (Quatrano, 1987; Baker et al., 1988; Dure et al., 1989); (ii) seed dormancy and germination (Fong et al., 1983; Koor- neef et al., 1989); (iii) plant defense from invading pathogens

* This work was supported by the Natural Sciences and Engineer- ing Research Council of Canada. The costs of publication of this article were defrayed in part by the payment of page charges. This

ance with 18 U.S.C. Section 1734 solely to indicate this fact. article must therefore be hereby marked "advertisement" in accord-

1To whom correspondence should be addressed: Dept. of Plant Science, University of Manitoba, Winnipeg, Manitoba R3T 2N2, Canada. Tel.: 204-788-6254; Fax: 204-772-7924; E-mail: Mohapa@UofMcc.bitnet.

The abbreviations used are: ABA, abscisic acid; A/ES, ABA- and environmental stress-inducible; SDS, sodium dodecyl sulfate; ELISA, enzyme-linked immunosorbent assay; GA,, gibberellic acid.

(Richardson et al., 1987); and (iv) modulation of adaptive responses of plants at the genetic level when under adverse environmental conditions (Chen et al., 1983; Orr et al., 1986; Ramagopal, 1987; Singh et al., 1987a; Pena-Cortes et al., 1989). Physiological studies have shown that endogenous ABA levels increase in plant cells and tissues subjected to low temperature acclimation (Chen et al., 1983), water stress by high osmoti- cum, salt, drought (Zeevaart, 1980; Robertson et al., 1985; Singh et al., 1987a, 1987b; Bensen et al., 19881, or even wounding stress (Pena-Cortes et al., 1989). Most of these studies, however, have been with cultured plant cells and organs and not with intact plants.

Under these stress conditions specific mRNAs and proteins accumulate that can be categorized into three broad classes: (i) a set of mRNAs/proteins that are inducible by exposure to both stress and ABA; (ii) a set of mRNAs/proteins that are specifically inducible by stress but not by ABA; and (iii) another set of mRNAs/proteins that are only inducible by ABA but not by the stress imposed. Several investigators have reported the accumulation of specific gene products during low temperature acclimation (Meza-Basso et al., 1986; Guy and Haskell, 1987; Robertson et al., 1987; Mohapatra et al., 1987, 1989; Dhindsa and Mohapatra, 1990), water deficit (Mundy and Chua, 1988; Skriver and Mundy, 1990), dehydra- tion (Robertson et al., 1989; Close et al., 1989), salt stress (Ramagopal, 1987; Singh et al., 1987a, 1987b), or in response to wounding of plant tissues (Bradshaw et al., 1989; Palm et al., 1990). It has been proposed that all of the above or some of these gene products may affect intracellular osmolarity or have other protective functions (Ramagopal, 1987; Singh et al., 1987a, 1987b; Mohapatra et al., 1988a, 1988b Mundy and Chua, 1988; Ho and Sachs, 1989). The precise role of these proteins in adaptation to stress, and the interrelationships and sequence of expression of the above three classes of proteins at the level of gene regulation remains unknown. Recently, there has been impressive progress in the definition of the cis- and trans-acting factors involved in the control of gene expression by ABA and stress of a wheat embryo protein (Marcotte et al., 1989) and of rice ABA-responsive genes (Mundy et al., 1990). Whether these factors are also common to those proteins expressed in vegetative tissues in response to stress alone is still open to question.

In a previous report, using a cDNA library constructed of the RNA of ABA-treated alfalfa seedlings, a cDNA clone pSM2075 was identified (Luo et al., 1991). The expression of the gene corresponding to this clone was inducible in response to ABA treatment and a number of environmental stresses. In this study we have isolated and characterized three addi- tional cDNA clones identified by differential screening of the above cDNA library and have examined the expression of the corresponding gene(s) after exposure to different stresses, in

X5367

15368 Structure and Expression of AIES Genes

response to hormones, and at different tissue and develop- mental stages of the alfalfa seedlings.

MATERIALS AND METHODS

Plant Material and Administration of Stress-Alfalfa (Medicago sativa L.) seeds were planted in vermiculite soaked with Hoagland solution and presterilized. Seedlings were grown at 25 "C under a 16- h light to 8-h dark photoperiod. The plants were watered every other day and fertilized with Hoagland solution twice a week.

One-week-old seedlings were subjected to either low temperature acclimation or exposed to various stresses, namely water stress, salt stress, and heat shock, using methods described previously (Moha- patra et al., 1988a). Briefly, for low temperature acclimation, the seedlings were placed at 4 "C for 1 week. Water stress was imposed by placing the alfalfa seedlings in 20% polyethylene glycol 6000 in Hoagland solution for 3 h. Salt stress was applied by putting the seedlings in Hoagland solution with 2% NaCl for 3 h at room temperature. Wounding was administered by damaging the roots and cutting the leaves of the seedlings. For treatment with phytohormones ABA or GA3, 1-3-week-old seedlings were used. The seedlings were placed in 0.5 X Hoagland solution containing hormone for 1 and 3 h, and solution was sprayed on the seedlings at the beginning of the treatment.

Isolation of the cDNA Clones-Total and poly(A+) RNA were isolated by using procedures described previously (Mohapatra et al., 1988a, 1989). A cDNA library was constructed in pBR322 vector from poly(A+) RNA prepared from ABA-treated seedlings of alfalfa cv. Vernal by the method of Gubler and Hoffman (1983). This cDNA library was screened differentially using single-stranded cDNA probes prepared from RNAs of control and ABA-treated seedlings. A total of 19 positive clones were analyzed for their insert sizes. The cDNA clones pUM9O-1, pUM90-2, and pUM91-4 were used in this study.

Plasmid DNA Preparation and Subcloning-DNA was prepared from three cDNA clones, pUM9O-1, pUM90-2, and pUM91-4, using the alkaline lysis procedure. The plasmid DNAs were digested with PstI, and the purified inserts were ligated into the multiple cloning sites of pT7TJ8U and pT,TJ9U (Pharmacia LKB Biotechnology Inc.). Further subclones necessary for sequencing were generated by the shotgun approach. The cDNA inserts were digested separately with restriction enzymes HindIII, Sau3A1, HaeIII, and Hinil, and subcloned into multiple cloning sites of pT7T318U and pT7T319U, respectively, by standard methods. These recombinant plasmids were transformed in Escherichia coli DH5aF' (Bethesda Research Labo- ratories).

Sequencing cDNA Inserts-All sequencing of cDNA inserts was done using single-stranded plasmid templates. Single-stranded DNAs were prepared according to the manufacturer's instructions, except E. coli DH5aF' was used instead of E. coli NM522. The DNA sequence was determined according to the dideoxy chain termination method (Tabor and Richardson, 1987) using M13 universal primer, T3 pro- moter primer, and modified or unmodified T7 DNA polymerase (U. S. Biochemical Corp.; Promega; Pharmacia). Each of the cDNAs presented here was sequenced at least twice using different start points. Due to the high GC content of the insert DNA, all sequencing reactions were done in duplicate using dGTP and dITP labeling and termination mixes.

Sequence Analysis-The sequencing data were analyzed with the aid of a standard software (Pustell and International Biotechnologies Inc.). Other software such as Fasta, Tfasta, Lfasta, and Plhom (Pearson and Lipman, 1988) were used for sequence homology searches with the sequences in GenBank (GenBank release 66) and in the PIR protein sequence bank (release 25 and new protein data base).

RNA Blotting and Northern Hybridization-The agarose gel elec- trophoresis of RNA followed the methods described by Maniatis and co-workers (Sambrook et al., 1989). Fifteen pg of the total RNAs isolated from stress-treated seedlings were separated by electropho- resis through a 1.5% denaturing agarose gel containing 2.2 M form- aldehyde, 0.5 pg/ml ethidium bromide, and the separated RNAs were blotted onto Hybond-N nylon membrane (Amersham Corp.). The separated RNAs were fixed by exposing the nylon membrane to UV light at 364 nm for 5 min. The membrane was hybridized to an oligolabeled cDNA insert of clone pUM9O-1. The hybridizations were carried out at 68 "C overnight in 6 X SSC buffer, 0.5% SDS containing 100 pg/ml denatured, sheared herring sperm DNA and the radiola- beled probe at 0.2 pg per hybridization. The filters were washed once with 2 X SSC, 0.1% SDS at room temperature for 15 min, followed

by washing once with the same buffer at 68 "C for 30 min, and finally by washing twice with 0.2 X SSC, 0.1% SDS at 68 "C for 20-30 min each.

Oligolabeling-For oligolabeling, plasmid DNAs were prepared and digested with PstI, and the cDNA inserts were purified. Oligolabeling was carried out according to the instructions from the oligolabeling kit (Pharmacia). The 200-ng DNA insert was radiolabeled with [a- 32P]dCTP.

Determination of ABA Concentrations in Plant Tissue-The con- centration of ABA in shoot and root tissues of alfalfa was measured by indirect ELISA as described by Walker-Simmons (1987). Briefly, the shoot and root tissues of the seedlings were sampled separately at different time intervals before and after treatment with stress or ABA. The samples were quickly frozen in liquid nitrogen, lyophilized, powdered, and then extracted in methanol containing 100 mg/liter butylated hydroxytoluene and 0.5 g/liter citric acid monohydrate at a ratio of 0.01 g of dry tissue to 1.0 ml of extracting methanol. Extracts were stirred overnight a t 4 "C, then spun at 2500 X g, and the supernatants were dried under a flow of nitrogen gas. For ELISA the dried samples were resuspended in 1 ml of 10% methanol, and before immunoassay, the resuspended samples were spun at 2000 X g, if necessary to remove the insoluble material. Three serial dilutions of each sample extract in Tris-buffered saline were assayed for ABA content by indirect ELISA. The absorbance values within the linear range of the ABA standard curve were used for the determination of the ABA concentrations in the samples. Each experiment was re- peated twice, and each sample was assayed in three replicates.

RESULTS

Isolation and Sequencing of the cDNA Clones-Differential screening of the pBR322 library led to identification of a total of 19 cDNA clones. These clones were purified, and analyzed for their insert sizes and homology with pSM2075 by hybrid- ization. Three clones, pUM9O-1, pUM90-2, and pUM91-4, were investigated further. Fig. 1 shows the sequences of the three cDNAs that are aligned for the maximum homology with pUM9O-1. The absence of an ATG start codon in two of the three cDNAs indicates that they do not contain a complete sequence. The 3' end untranslated regions of the four cDNAs differ in length, a consensus sequence of "AATAAA" for polyadenylation is found in pUM91-4, and a consensus se- quence of "TATAAA is found in pUM9O-1 and pUM90-2. Another unique character of the 3' end untranslated regions of all the cDNAs is that they contain several poly(A+) sites. The nucleotide sequences of these three cDNAs and pSM2075 (Luo et al., 1991) share very high homology ranging from 62 to 68%, which indicates that these clones belong to one family of genes.

Deduced Amino Acid Sequences-The deduced amino acid sequences of the three cDNAs also show a very high sequence similarity among each other (Fig. 2). The similarity between these sequences is restricted to certain regions, and for clones pUM9O-1, pUM90-2, and pUM91-4 ranged from 73 to 80%. Similar to the nucleotide sequence comparisons, the degree of identity at the amino acid level was found to be low, ranging from 47 to 59%, when the encoded polypeptides were com- pared with the encoded polypeptides of pSM2075 (LUO et al., 1991). All cDNAs encode polypeptides that are very rich in glycine (Fig. 2). The deduced polypeptides possess high per- centages of glycine (35-40%), followed by histidine (7-15%), asparagine (8-13%), and tyrosine (5-10%). The deduced poly- peptide of pUM9O-1 contains 5.3% glutamic acid and 4.1% aspartic acid. No tryptophan or proline is found in the deduced polypeptides of all cDNAs. Another important feature of the deduced polypeptides of the cDNAs is that they all contain one or more fragments consisting of tandemly repeated units. The deduced polypeptide of pSM2075 contains seven almost identical fragments of GGGYNHGGGGYNN (LUO et al., 1991). The deduced polypeptide of pUM90-2 contains two GGGGYNGGGGH fragments and two GGTYH repeated se-

Structure and Expression of A/ES Genes 15369

90-1 1 CAC GGT GGT CAC GGT GGA GGT GGT TAC AAT GGT GGT GGA GGA

91-4 I ACCCAATCCTCATCCTA

90-1 43 CAC GGT GGT CAC GGT GGA GGT GGT TAC AAT GGT GGT GGA CGT

91-4 18 GCCCTCTTGCCA ATG .TT GT. CT. GTG TCA .C. A.G .AC TTA

90-1 8 5 CAC GGT GGT CAT GGC GGT GCT GAA TGT GTT GCT GTG CAA AGA

91-4 60 ACT .AA AC. TCC TCT .A. ..C A.. AAG .AG .T. ..T ......

90-1 127 GAG CAA AAG ACT AAT GAA GTA AAT GAT CCC AAA TAT GGA GGT

91-4 96 - - - . . . . . . . . . . . . . . . . . . ..c . . . . . . . . . . . . ..c ...

90-2 1 . . .

90-1 169 GGT AGT AAT TAC AAC GAT GGT AGA GGT GGA TAC AAC CAC GGT

91.4 135 _ _ _ ..- --. .. . C.. A.. . . . G.T ... AAT . . . C.. A.T ... 90.2 4 .” ...... ... ..T ,G. ... G.. ..A CAC GGT GGT . . . . . .

90-1 211 GGA GGT GGT CAC GGT GGA CAG GGT GGA CAT GGT GGT CAC GGT

91-4 168 ..T ..A CA. T.. TA. ... GGT ... TCT ..C . . . ..A - - - ...

90-2 37 . . . . . . . . . T.. AA. ..T GGT ..A ... ..C . . . . . . T.. ...

90-1 253 GGA GGT GGT TAC AAT CGT GGT GGA GGT CAC - - - - - - - - - GGT

91-4 207 ..T TC. GAC C . . GG. ..A ... ..T T.C ..T CAC TAT TGC CAC 90-2 79 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... .........

90-1 286 GGT CAT - - - - - - GGC GGT GCT CAA TCT GTT GGC GTG CAA ACT

91-4 249 ..C . . . TGC TGC TCA TA. ..C ..G .T. . . . . . . . . . . . . G..

90-2 112 . . . . . . _ - - - - - . . . . . . . . . . . . . . . . . . ..T . . . . . . ..A

90-1 322 GAG GAA AAG ACT AAT GAA GTA AAT GAT GCC AAA TAT GCA GGT

91-4 291 . . . . . . . . . . . . . . . . . . . . . ..C . . . . . . . . . . . . ..T ... 90-2 148 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 364 GGT AGT AAT TAC AAC GAT GGT AGA GGT GGC TAC AAC CAC CGT

91-4 333 . . . . . . . . . . . . CG. A.. ... G.T ..A CAT ...... T.T ..A

9 0 - 2 190 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 406 GGA GGT GGT TAC AAG CAC GGT GCA CGT GGT CAC GGT GGA CAC

91:4 369 ..T . . . TC. C.. C.. GGT ..A ..T . . . TC. . . . CA. ..T GGA

90-2 232 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 448 GGT GCA - - - - - - - - - - - - - - - CAT GGT GGC CAT GGT GGT CAC

91-4 411 _ . _ ..T TGC CAT TAC TAT TGC ..C ..C CAT TGC T.C TCA ..T 90.2 274 ..................... . . . . . . . . . . . . . . . . . . ACG

FIG. 1. cDNA sequence of alfalfa clones pUM90-1 (90-l), pUM90-2 (90-2). and pUM91-4 (91-4). Sequences have gaps inserted and are aligned to show maximum similarity. The translated region was broken into codons. Dots represent homology with clone pUM9O-I. Boldface indicates the translated region. Numericat values a t the start of each line refer to the clone and the number of nucleotide residues. The shaded areas indicate the stop codon. The polyadenyl- ation signal of each sequence is underlined.

90-1 475 GGT GGA CAC GGT GCT CAC CAA ACT GAG GAC AAC AGT CAA AAC

91-4 4 5 3 .C, .A. TTT .T. ..C .TG . . . G.. . . . . . . ..A ... ..G ...

90-2 301 .TC .AC ACG .TG CTG AC, A.. CTG AG. ACA .CA CTC A.. .CT

90- 1 51 I GAT -CAT AAT GAT ATC ATC ATG CAC CAT GCA CAC TIT CTC AGT

91-4 495 TGA T . . . . . . . . .

90-2 343 ... . . . . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . . . .

90-1 559 AAT ATA TGT CAT GAA T A A A A A T A A T C T T - C T G T C T T C A ~ ~ G G

91-4 538 T.. ..................... T...A.......A......--..

90-2 385 .....-....... . ” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 609 GATACATAGATGTCCAGCAGTTTCAC-TGTGCTCCTCTCT-TATCTATCTTGC-CACTA

91-4 585 . . . . . . . . . . . AGA . . A..A.C....T..AT. . . A . C . . . . . . . G..... . . . . .

90-2 432 . . . . . . . . . . . . . . . . . . . . . . . . . T.A . . . . . A: . . . . . . . . A.........

90-1 662 TATAGTATAGATAGATATTTCATCAGTGGAAATCTTGTATAAATTTGCATCAGACT

91-4 6 3 6 C . . . . . . . . . A......... . . . . . . . . . . . . . . . . . . . . . . . . . . T....C...

90-2 486 . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 718 ATGTATTTGTAACGATGACAAGCTTTTCCAAAAAAATGATGAGTGTCTTATTATCA

91-4 6 7 2 _ , . . _ G . .

90-2 542 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

90-1 774 T G T G T A T T C G A T T A T T A C ~ C A T T T C T ~ T T A T ~

90-1 830 AAAAAAA

FIG. l-continwd

quences. In the deduced polypeptide of cDNApUM9O-1, there are two f r a ~ e n t s of GGHGGGGYNGGGGHGGHGGAES- VAVQTEEKTNEVNDAKYGGGSNYNDGRGGYNH, each consisting of 55 amino acids, beginning at amino acids 15 and 75. These results suggested that the encoded proteins repre- sent an unique class of proteins.

Similarities between the ABA- and Environmental Stress- induced Proteins and Other Known Sequences-The nucleo- tide sequences and the encoded polypeptides of the four cDNAs were also compared with those in GenBank and the protein data bank (GenBank release 66 and PIR protein data base release 25 and new protein data base) using Lfasta, Tfasta, and Fasta computer programs (Pearson and Lipman, 1988). Very high sequence similarity was found with certain regions of several ABA- and stress-inducible glycine-rich plant proteins (Fig. 3a). These include a light-inducible gly- cine-rich protein from Chenopodium rubrum (Kaldenhoff and Richter, 1989), a maize gene induced by ABA, water stress, and wounding (Gomez et al., 1988), the glycine-rich cell wail proteins inducible by wounding (Keller et ai., 1988), a dehy- dration-induced protein in barley (Close et al., 1989), and a glycine-rich structural protein of petunia (Condit and Meagher, 1986). They also share relatively high sequence similarity with glycine-rich proteins from invertebrates and mammals, such as a Drosophila cDNA (Haynes et ai., 1987) and human keratin (Hanukoglu and Fuchs, 1983).

Furthermore, alignment of the above glycine-rich sequences with A/ES cDNAs revealed that all of these proteins contain tandemly repeated units (Fig. 3b) organized as “Gly,-X,,”

15370

90-1 1

91-4 1

90-1 56

91-4 35

90-2 1

90-1 106

91-4 86

90-2 48

90-1 157

91-4 140

90-2 98

Structure and Expression of AIES Genes HGGHGGGGYNGGGGHGGHGGGCINGGGGGHGGHGGAESVAV~E~~~~G

MVLLVSARDLTETSsd . k . . . . ............

G G S N m D G R G G R Y H G G G G G H G G H G G H G G H G G G C I N G G G G H "

..... hn.G.n.hn ... HvY.G.s sHhe . . . C.HYCH..CCsY..F..,

. . . ." e.G.HG ~ . . . . . Yn.G . . . . . Y ...........................

gTEEKllJEVNDAKYGGGSNYNDGRGGRYHGGGGGRYHGGGGGHGGHGG..... HGGH

.a . . . . . . . . . . . . . . . . . . ~ n . G . H .. v...ShhG...s.H.G..C.C.. HC

GGHGGHGADQTEDNTQNDHNDIIMHHAHFLSNICHE

- Cs.aeFV.V.a . . k...

. . TVDTVLTKIRTTUT . . . . . . . . . . L . . . . . . . . - FIG. 2. Translated sequences of cDNA pUM9O-1, pUM9O-

2, and pUM91-4. Sequences are aligned and have gaps aligned to show maximum similarity between the clones. The alignments are similar to those in Fig. 1. Double underlined regions show internal repeat. Numbers at the start of each line refer to the clone and the position of amino acid residues.

pUM90-1 2 GGHGGGGYN---GGGGHGGHGGGGYN-GGGG-HGGHGGAESVAVQTEE-KTNE~DAKYGGG-SNY CHEHC 42 N...y-Hn.. .... n...-yHnG..y-----Ynnq-GqYhNqqqG."".-qq. BLYDHN 45 . a A a . H q---PMRdeHQT.R ILhRS.55-S55SsrddgmgGTRkk-Glk.KIke.LP..HqdQ PHYGRP 1 8 1 ..dH . Q A..Ga....g~...e-...G..ygQGyGaggy-YgayGehyGGa..-yqG DROPEN 211 . G. .RFdRGG. ..n. G...R.d-R.. -G..G..ggn.qPrdy.W.C.sC.ntnfaWR-nec PHVGRl 95 . . . . . . . G G..Ad....y-..a -k .Ge.YqqGyangqq-YqggGqsgGG...-gaG PETGCR 125 ..Ga. I,--- . . . . L..G. . Ay- . . . . VG .A 5qqYfyaGqqV-GgYaGaYYGV qqf

( = I

PUM9G-1 61 NDGRG-GYNHGGG-GHG~nGGHGONGGGGYNGG-GGHGGHGGAES"AVQTEEKTNE~DAKYGGG CHEHC 89 hn.G.-.. H.n.G . . y"nn . . . . h ..-..SC Y. MZEGRP 94 .: G .G .YG . . r.....g...RRd..y..yyqYqGr-----r.GqqqG.... BLYDHN 106 qhnA.-t.qy.QQ-.T.MA.tG.ty.QQ ht.M-t.M.aTd tYgQsGh.qMnqtgahqtRnt.. PHVGRP 245 ooaG.-..aA .eH.G.aG .o..Ga . aa e...Ga.aoOGoGa~claY4a4GehocGa.. _ _ DROPEN 213 .RCkt-PKydde.-IS G..Y....Gy..-Ydr.ndR.sggGyYhnRdrYq"Sqgq"...

PETGCR 187 qy G: GVG..s-.. .GF.A..2Y...Aq..L .GV.G..qqqSqGGyyIGqq5GhqyGf.a.

__. ~ _ _ _ ~ . ~

..... PHVGRl 1 5 4 ya.s.Y.Gqe.s . - aG . . y..An.G....Nq..-..G.sG.aHqyGAaGqy.GayqGaqqG....

pUM9G-1 124 S N Y N O G R G G Y N H G G G G Y N H G G G G H G G H G G ~ G G H MZEGRP I 4 1 99 yqRRe.--- gG. BLYDHN 167 t Y G q q ht.MtGt.---M .t .T'f,qQ..t Mt.T.M..tgG YGqhg.dtqekkG..d

DROPEN 331 q"-g.G ..SrFn---dnn. . I r . G .n PHVGRP 308 qqGqgaG ..qA . e H G g G . . . q . . - . d G . . y a a V . e . . q g Y g ~ ~ g y q g G q .

PHVGRl 216 aaGgq.. 5GgG.. . . g G . aRGs.y . . G..S.eG....99 PETGCR 2 4 9 qqvqq V..GaA... -qC....G..G..L..Gs . . . (b)

pUMPO-I GGGGYNGGGGIIGGHGGGGYNGGGGHGGHGG 2075 GGGYNHGGGGYNGGGYNHGGGGYNNGGG~~~GGGGYNNGGGYN~GGGGYNNGGGGYNHGGGGYNN

CHEHCl pUM90-2 GGGGYNGGGGIICGYGGGGYNGGGGHGGHGG

GGGGINN~QOYNHCGGG~NNGGGYNHGriGOYNNGGGYNHGGGGYNNGGGYNli .~ MZEGRP GGGRGGGGYGGURRDGGYGGGGGYGG~~~GGGGGYGGGGG~GGRREGGGGGY PHYGRPl8 GGG~GG(.QGAGGGRGGGrGGGGEHGGGGGGGQGGGAGGGYGAGGEliGGGAGGGQGGGAGGGYGAGGEH

~~~ ~

PtwGRP1o GGHGGGGGNGGGGGGGADGGGYGGGAGKGGGEGYGGGGRNGGGYGGGGGSGGGGGGGA PETGCRl GGGAGGGLGGGGGLGGGGGGGAGGGGGVGGGAGSGGGfGAGGGVGGGAGAGGGVGGGGGF DROPENFSB GGGGGGRFDRGGGGGGNGGGGGGRYDRGGGGGGGGGGN

FIG. 3. Sequence similarity between pUM9O-1 and other known sequences. a, amino acid sequence comparison between pUM9O-1 and seven other ABA- and stress-inducible genes. The sequences are aligned with pUM9O-1 to show maximum similarity. Numerical values at the beginning of each sequence refer to the residue number. Dots represent homology with clone pUM9O-1. The lower case letters represent the semi-conserved region. CHEHCl, light-induced glycine-rich protein from C. rubrum. MZEGRP, a maize gene induced by ABA and water stress; PHVGRP and PHVGRl, glycine-rich cell wall protein inducible by wounding; BLYDHN, de- hydration-induced protein in barley; PETGCR, a glycine-rich struc- tural protein of petunia; DROPEN, a Drosophila cDNA. b, the con- served repeat sequences of three cDNAs (pUM9O-1, pUM90-2, and pSM2075) and some other ABA- and stress-inducible proteins.

where the X is tyrosine, asparagine, histidine, phenylalanine, leucine, alanine, glutamine, aspartic acid, glutamic acid, va- line, or serine. However, the reported glycine-rich cell wall

proteins are arranged head-to-tail in tandem (Keller et al., 1988; Condit and Meagher, 1986), whereas the encoded poly- peptides of four A/ES cDNAs contain fragments consisting of tandemly repeated units. Similar to other stress-induced proteins, e.g. dehydrin (Close et al., 1989) or light-inducible glycine-rich proteins from C. rubrum (Kaldenhoff and Richter, 1989), the deduced polypeptides of the four cDNAs are extremely hydrophilic with one or more short hydrophobic inserts, a pattern that is different from the glycine-rich struc- tural protein of petunia (Condit and Meagher, 1986). The sequence comparisons indicate that the proteins coded by these cDNAs belong to a larger family of glycine-rich proteins, yet they appear to be unique in their structures.

Expression of AIES Genes-To investigate the gene expres- sion in response to different stresses, we used the insert DNA of clone pUM9O-1 (900 base pairs) as probe. RNA isolated from one-week-old seedlings was blotted and hybridized with the above probes (Fig. 4a) . Transcripts corresponding to these cDNAs were found in abundance in RNA isolated from seed- lings treated with low temperature, salt, or ABA, whereas wounding or drought treatment induced a weaker but clearly detectable expression of these genes. No transcript was de- tectable in RNA of seedlings subjected to heat shock. With low temperature-induced RNA, a stronger signal was seen with pUM9O-1 as a probe.

Since treatment with different stress conditions led to a differential increase in the endogenous levels of ABA and a concomitant induction of the transcripts corresponding to pUM9O-1, we were prompted to examine whether these genes from alfalfa can be induced by ABA and GA3. Hybridization of RNA from 2- and 3-week-old alfalfa seedlings (treated with plant hormones) with radiolabeled pUM9O-1 insert is shown in Fig. 46. At a concentration of 75 p ~ , ABA rapidly induced the corresponding transcripts in alfalfa seedlings. However, at a lower concentration of 0.1 p ~ , ABA analog PBI-11 did not induce the transcripts either in 2-week-old alfalfa seed- lings that had been treated for 3 h or in 3-week-old alfalfa seedlings that had been treated for 1 h, but the genes were induced in 3-week-old alfalfa seedlings after 3 h of treatment (Fig. 4c). No hybridizable transcripts were induced in 2- or 3- week-old alfalfa seedlings after 2-3 h treatment with GA3 (Fig. 4c). These results indicated that the environmental stress-inducible genes encoding these transcripts are also inducible by ABA, and therefore these genes were designated as A/ES genes.

Organ-specific Expression of A/ES Genes-In order to ex- amine whether A/ES genes are expressed specifically in dif- ferent parts of alfalfa seedlings, RNA was prepared from shoot and root tissues, separated by electrophoresis, blotted, and hybridized to pUM9O-1 (Fig. 5a) . Transcripts were found in the RNA of shoot tissues of seedlings subjected to various stresses. No transcript was detectable in RNA of root tissue from these seedlings. To confirm this result, 30 pg of RNA from the roots were compared with 15 pg of RNAs from the shoot tissues (data not shown). Essentially identical results were obtained when the seedlings were treated with ABA or its analog instead of the stress (Fig. 56). These results dem- onstrate that the transcripts corresponding to pUM9O-1 are indeed exclusively expressed in the shoot tissues of the seed- lings.

Induction of AIES Transcripts in Seedlings of Different Age Groups-To determine if the expression of the genes corre- sponding to pUM9O-1 is specific to seedlings, ABA induction of these genes was examined in plants of different age groups. For this purpose, RNA was isolated from the shoot tissues of alfalfa seedlings at different time intervals. The level of the

Structure and Expression of AIES Genes 15371

a 1 2 3 4 5 6 7 8 9 10111213 a 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Is 19

1.1 Kb-

1.1 Kb-

b 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1617

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

1.1 K b-

11 Kb -

1.1 Kb -

FIG. 4. a, the effect of administration of different stress on the expression of A/ES transcripts. cDNA pUM9O-1 was used as the probe. Total RNA was isolated from controls (lanes 1, 3, 7, 8, 10, and 12), from cold-acclimated seedlings (lane 2), from wounded seedlings (lane 4 ) , from heat-shocked seedlings (lane 5), from drought-treated seedlings (lane 6 ) . from 2% NaC1-treated seedlings (lane 9 ) , and from ABA-treated seedlings (lanes 11 and 13). The ABA concentration is 75 pM. Fifteen pg of the total RNAs from each sample was analyzed. b, effect of ABA and ABA analog PBI-11 and GAS on the expression of the A/ES transcripts. Total RNA was isolated from control leaves (lanes 1, 4, 7, and IO), 2-week-old seedlings treated for 1 h with ABA (lane 2), 2-week-old seedlings treated for 1 h with PBI-11 (lane 3 ) , 2-week-old seedlings treated for 3 h with ABA (lane 5), 2-week-old seedlings treated for 3 h with PBI-11 (lane 6 ) , 3-week-old seedlings treated for 1 h with ABA (lane 8 ) , 3-week-old seedlings treated for 1 h with PBI-11 (lane 9), 3-week-old seedlings treated for 3 h with ABA (lane 11), and 3-week-old seedlings treated for 3 h with PBI-11 (lane 12). The concentrations of ABA and PBI-11 were 75 p ~ . c, total RNA was isolated from controls (lanes I , 5, and 8 ) , 2-week-old seedlings treated for 3 h with ABA (lane 2), 2-week-old seedlings treated for 3 h with PBI-11 (lane 3), 2-week-old seedlings treated for 3 h with GAs (lane 4 ) , 3-week-old seedlings treated for 1 h with ABA (lane 6 ) , 3-week-old seedlings treated for 1 h with PBI-11 (lane 7) , 3-week-old seedlings treated for 3 h with ABA (lane 9), 3-week-old seedlings treated for 3 h with PBI-11 (lane IO), and 3-week-old seedlings treated for 3 h with GAs (lane 11 ). The concentrations of PBI-11 and gibberellic acid were 0.1 pM. The ABA concentration is the same as in b. Kb, kilobases.

induction of the transcripts by ABA treatment was higher in older alfalfa seedlings than in younger ones (Fig. 6). The longer treatment with ABA also elevated the level of specific transcripts in the alfalfa seedlings/plants. These results in-

FIG. 5. Organ-specific expression of A/ES transcripts. a, total RNA was isolated from roots (lanes 1-10) and from the shoot tissues (lanes 11-19), from controls (lanes 1, 6, and II), 2-week-old seedlings treated for 1 h with ABA (lanes 2 and 12), 3-week-old seedlings treated for 1 h with ABA (lanes 7 and 16), 2-week-old seedlings treated for 3 h with ABA (lanes 4 and 14), 3-week-old seedlings treated for 3 h with ABA (lanes 9 and 18), 2-week-old seedlings treated for 1 h with PBI-11 (lanes 3 and 13), 3-week-old seedlings treated for 1 h with PBI-11 (lanes 8 and 17), 2-week-old seedlings treated for 3 h with PBI-11 (lanes 5 and 15). and 3-week- old seedlings treated for 3 h with PBI-11 (lanes 10 and 19). Fifteen pg of the total RNAs was analyzed. b, total RNA was isolated from roots (lanes 1-6), and from shoot tissues (lanes 7-17), from controls (lanes 1, 3, 5, 7, 9, 12, 14, and 16), from cold acclimated seedlings (lanes 2 and 8) , from wounded seedlings (lanes 4 and IO), from NaC1- treated seedlings (lanes 6 and 13), from drought-treated seedlings (lane 15), from heat shocked seedlings (lane I I ) , and from ABA- treated seedlings (lane 17). Thirty pg of the total RNAs from the roots, and 15 pg of the total RNAs from the shoot tissues were analyzed. Kb, kilobases.

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

1.1 Kb-

FIG. 6. ABA induction of the A/ES transcripts in seedlings of different age groups. Total RNA was isolated from controls (lanes 1, 3, 5, 7, 9, and I I ) , I-week-old seedlings treated for 1 h with ABA (lane 2), 2-week-old seedlings treated for 1 h with ABA (lane 6 ) , 3-week-old seedlings treated for 1 h with ABA (lane IO), l-week- old seedlings treated for 3 h with ABA (lane 4 ) , 2-week-old seedlings treated for 3 h with ABA (lane 8), and 3-week-old seedlings treated for 3 h with ABA (lane 12). Kb, kilobases.

dicate that the observed expression of A/ES genes is not confined to the seedlings and is inducible in older plants.

Synthesis of ABA by Seedlings Exposed to Stress-To de- termine whether exposure to stress leads to a detectable increase in ABA in our seedling model, the level of ABA was examined in shoot and root tissues sampled separately using an indirect ELISA procedure, and the results are shown in Fig. 7. With the exception of heat shock, the exposure to all other treatments examined, namely low temperature, salt,

15372 Structure and

""I I

2504 0.0 0.5 1 .o 1.5 2.0 2.5

hours

10501 hours

1

Expression of AIES Genes

0 2 4 6 days

m l m 0.0 0.5 1.0 1.5 2.0 2.5

hours Time

FIG. 7. Endogenous ABA levels in the shoot (solid line) and root (broken line) tissues of alfalfa seedlings under different stress conditions and after treatment with exogenous ABA. A, 20% polyethylene glycol 6000 (A) and wounding (m); B, 2% NaCI; C, low temperature; D, exogenous ABA (A) and heat (W). Bars show the standard errors of the mean of three replicates. dw, dry weight.

drought, wounding, and the exogenous application of ABA, led to an increase in ABA concentration in the shoots of the seedlings. The extent of the increase varied depending on the stress. Exogenous ABA and low temperature treatments re- sulted in the maximal increase, up to a 2-%fold increase over

the base level. Salt, drought, and wounding treatments re- sulted in a slight increase over the base level yet represented significant amounts ranging from about 200 to 300 ng/g of plant tissues (dry weight). Furthermore, the pattern of in- crease differed with the type of stress applied. By contrast, the root tissues showed little detectable change in their ABA content following the administration of the stress. The ap- plication of the exogenous ABA, however, resulted in a 600- fold increase in the level of endogenous ABA in roots. It is concluded that the levels of ABA increase primarily in the shoot tissues of alfalfa seedlings in response to various stresses.

DISCUSSION

We describe here the structures and important repeat do- mains of four cDNAs that were isolated from ABA-induced mRNA of alfalfa. Sequence analysis of these cDNA clones revealed that despite their distinctiveness, these clones share a very high sequence similarity among themselves. Because of the similarity in expression of the corresponding transcripts under a number of environmental stresses and after ABA treatment (Luo et al., 1991), these genes can be ascribed to a large multigene family or related multigene families, which we have designated as A/ES genes. As a continuation of the above studies on the characterization of the cDNAs corre- sponding to the A/ES genes, our results demonstrate that: (i) the transcripts homologous with the cDNA pUM9O-1 are inducible identically by low temperature acclimation, salt, wounding, drought, ABA, and ABA analog PBI-11; these cDNAs thus belong to one or more related gene families; (ii) the A/ES genes are induced in an organ-specific manner, i.e. they are expressed specifically in the shoot tissues; and (iii) the expression of these genes is not developmentally stage- specific, i.e. restricted to the seedlings, but is inducible also in the older plants.

The unique feature of the 3' end untranslated region of all the cDNAs is that they contain several poly(A+) sites. Indeed, not only the cleavage/polyadenylation signal but also the required terminal C(A) and the downstream G/T clusters (Birnstiel et al., 1985) are repeated. These A/ES genes have homology with certain regions of a diverse array of proteins, which include (i) proteins induced by several environmental stresses such as water deficit, drought, salt, wounding, and light; most of these are also induced by ABA; (ii) structural cell wall proteins of plants; and (iii) storage proteins of seeds. Unequivocally, however, the sequence similarity was confined to the glycine-rich repeat domains, with little or no similarity in the nonglycine regions. On the other hand, the clone pSM2075, which exhibited less homology with the three other cDNAs, showed striking similarity with a blue light-inducible protein. Therefore it is probable that all these genes are related by common ancestry. No homology was found in amino acid sequences between the A/ES genes and many other ABA- and stress-induced genes. This is not surprising because when subjected to environmental stresses, plants are known to synthesize a number of proteins (Mohapatra et al., 1987, 1988a, 1988b; Ramagopal, 1987; Singh et al., 1987a, 1987b). These proteins are hypothesized to either work alone or act in concert to protect plants against adverse environ- ments.

Recently, a number of studies addressed the issue of ABA induction of genes in stress response (Mundy and Chua, 1988; Singh et al., 1987a, 1987b; Pena-Cortes et al., 1989). To our knowledge, however, no study examined the response of a particular ABA-inducible gene(s) to a number of environmen- tal stresses. This study has clearly demonstrated for the first

Structure and Expression of AIES Genes 15373

time the existence of gene(s) that is (are) inducible by a number of different stresses including cold, salt, drought, wounding, as well as by ABA. Interestingly, the highest expression of the A/ES gene was seen under low temperature acclimation. Although the precise reason for this is as yet unknown, it is likely that acclimation constitutes a collective stimulus of several stresses, all of them at least partly me- diated by ABA. This postulate is supported by the observation that the maximal amount of ABA was produced during the acclimation treatment. Alternatively, a higher level of tran- scripts seen during acclimation may be a reflection of in- creased transcription due to the production of possible DNA- binding cold shock proteins as seen in E. coli (Wistow, 1990) or increased stability of the transcripts due to the low tem- perature per se to which the seedlings are exposed. Neverthe- less the induction of these transcripts under other stress conditions suggests that this gene product may function as a housekeeping gene under environmental stress conditions.

Exogenous application of ABA rapidly induced the A/ES gene(s), whereas GA3 showed no effect. This is consistent with the finding that GA3 counteracts all ABA effects inves- tigated in barley aleurone cell layers (Jacobsen and Chandler, 1988) and in the gene expression in germinating castor beans (Dommes and Northcote, 1985). The expression of A/ES transcripts induced by low and high concentrations of ABA analog PBI-11 observed in our study is not unlike its effects on the expression of a-amylase,' a protein which is down- regulated by ABA in barley aleurone tissue. This similarity in regulation of two unrelated genes in different tissues by PBI-11 perhaps reflects an ubiquitous role of ABA in plant growth and development.

Although it is clear that ABA and gibberellic acid regulate different sets of proteins and have different functions affect- ing plant development and adaptation to the adverse environ- ment (Jacobsen and Chandler, 1988), the precise regulatory mechanisms are unclear at present. The correlation between the amounts of ABA produced and the level of transcripts found for each stress suggests ABA is involved in the stress induction of the A B S gene(s). However, the results presented here do not permit us to discern whether the induction of the A/ES gene(s) is (are) due to ABA and/or stress response(s). The current model suggests that under any of the above stresses, the first signal perceived by the cells is the loss of turgor pressure (Guerrero and Mullet, 1988), which leads to the rapid induction of a set of genes that are involved in the synthesis of ABA. This de novo synthesis of ABA accom- panied by the release of ABA sequestered in organelles (Zee- vaart and Creelman, 1988) results in an increase in the cytosolic and apoplastic ABA and the concomitant induction of another set of stress-specific genes. From the characteristic expression of the A/ES transcripts, it appears that they belong to a family of this latter category of genes.

Our results also clearly demonstrated that the A/ES genes are expressed at the highest levels in the shoot tissues of alfalfa seedlings, in particular in the leaf tissue. Interestingly, treatment with exogenous ABA led to a definite increase in the endogenous ABA levels in the root tissue, yet no mRNA of A/ES genes was detectable in this tissue. This indicates that organ-specific element(s) in addition to ABA and/or stress treatments are required for the transcription of the A/ ES genes. The organ-specific expression of ABA- and stress- inducible genes has been reported in other plants, e.g. the ABA- and wound-induced expression of proteinase inhibitor I1 gene of potato and tomato was limited to the aerial part of the plants (Pena-Cortes et al., 1989); wound-inducible glycine-

' R. D. Hill, unpublished data.

rich protein in bean was markedly expressed in roots and young ovaries (Keller et al., 1988); and an ABA-, water- stress-, and wound-inducible glycine-rich protein of maize was expressed mainly in embryo and leaves (Gomez et al., 1988).

The foregoing results prompted us to test if the expression of the A/ES genes is developmentally stage-specific, i.e. con- fined to the young seedlings. Since most of our studies to date have focused on the 1-week-old seedlings and the ABA induc- tion of A/ES transcripts is rapid in these seedlings, we ex- tended this analysis to older seedlings/plants. It is noteworthy that the 3-week-old seedlings exhibited a higher level of A/ ES transcripts, clearly indicating that the induction of these genes is not restricted to the young seedlings. The evidence has thus established the contrary. This finding is not trivial because of the significance of the presumed function of these genes in the adaptation of the alfalfa plants to the charac- teristic freezing temperatures in the environment of tempe- rate climates.

With respect to the low temperature acclimation- and ABA- inducible expression of these genes in plants, one such protein was recently characterized from Arabidopsis and was shown to resemble the antifreeze proteins of fish (Kurkela and Frank, 1990). In addition, a small, cold-protection protein has also been described in E. coli (Goldstein et al., 1990). Although these stress-protective proteins are not structurally related to the proteins reported here, a distinct feature of all of these proteins is that they contain a high proportion of hydrophilic residues. The A/ES proteins appear to be even more hydro- philic than the others. Furthermore, the genomic Southern data indicate that the A/ES genes are present in tandem repeats. The finding that the number of A/ES genes present in freezing-tolerant alfalfa cultivars is higher than the number in freezing-sensitive alfalfa cultivars, suggests that these genes may be involved in the adaptation of these plants to freezing temperatures. Whether the relationship among various stress- and ABA-induced genes described above reflects a true evolutionary convergence to a required common function during acclimation remains to be resolved.

Acknowledgments-We thank Dr. Brian Fristensky for assistance in using computer software for sequence analysis, Lihua Lin for screening the cDNA library, Sandra Kolisnyk for secretarial assist- ance, and Dr. Susan Abrams for providing the ABA analog PBI-11.

REFERENCES

Baker, J., Steele, C., and Dure, L., I11 (1988) Plant Mol. Biol. 11, 277-291 Bensen, R. J., Boyer, J. S., and Mullet, J. E. (1988) Plant Physiol. (Bethesda)

Birnstiel, M. L., Busslinger, M., and Strub, K. (1985) Cell 4 1 , 349-359 Bradshaw, H. D., Jr., Hollick, J. B., Parsons, T. J., Clarke, H. R. G., and

Chen, H.-H., Li, P. H., and Brenner, M. L. (1983) Plant Physiol. (Bethesda)

Close, T. J., Kortt, A. A., and Chandler, P. M. (1989) Plant Mol. Biol. 13,95-

Condit, C. M., and Meagher, R. B. (1986) Nature 323 , 178-181 Dhindsa, R. S., and Mohapatra, S. S. (1990) in Proceedings of the Symposium

on Light and Temperature Stress, International Congress of Plant Physiology (Sinha, S. K., et al., eds) pp. 377-383, Vedam Books Int., New Delhi

Dommes, J., and Northcote, D. H. (1985) Planta (Heidelb.) 165,513-521 Dure, L., 111, Crouch, M., Harada, J., Ho, T-H. D., Mundy, J., Quatrano, R.,

Fong, F., Smith, J. D., and Koehler, D. E. (1983) Plant Physiol. (Bethesda) 73 ,

Goldstein, J., Pollitt, N. S., and Inouye, M. (1990) Proc. Natl. Acad. Sci. U. S. A.

Gomez, J., Sanchez-Martinez, D., Stiefel, V., Rigau, J., Puigdomenech, P., and

Gubler, U., and Hoffman, B. J. (1983) Gene (Amst.) 26,263-269 Guerrero, F. D., and Mullet, G. E. (1988) Plant Physiol. (Bethesda) 8 0 , 401-

Guy, C. L., and Haskell, D. (1987) Plant Physiol. (Bethesda) 84,872-878 Hanukoglu, I., and Fuchs, E. (1983) Cell 33,915-924 Haynes, S. R., Rebhert, M. L., Mozer, B. A., Forquignon, F., and David, I. B.

Ho, T.-H. D., and Sachs, M. M. (1989) in The Biochemistry of Plants, Vol. 15,

8 8 , 289-294

Gordon, M. P. (1989) Plant Mol. Biol. 14,51-59

71,362-365

108

Thomas, T., and Sung, 2. R. (1989) Plant Mol. Biol. 12,475-486

899-901

8 7 , 283-287

Pages, M. (1988) Nature 3 3 4 , 262-264

408

(1987) Proc. Natl. Acad. Sci. U. S. A. 8 4 , 1819-1823

pp. 347-378, Academic Press, Inc., Orlando, FL

15374 Structure and Expression of AIES Genes Jacobsen, J. V., and Chandler, P. M. (1987) in Plant Hormones and Their Role

in Plant Growth and Development (Davies, P. J., ed) pp. 164-193, Kluwer Academic Publishers, Dordrecht, The Netherlands

Kaldenhoff, R., and Richter, G. (1989) Nucleic Acids Res. 17,2853 Keller, B., Sauer, N., and Lamb, C. J. (1988) EMBO J. 7,3625-3633 Koorneef, M., Hanhart, C. J., Hihorst, H. W. M., and Karssen, C. M. (1989)

Kurkela, S., and Frank, M. (1990) Plant Mol. Biol. 15,137-144 Luo, M., Lin, L., Hill, R. D., and Mohapatra, S. S. (1991) Plant Mol. Biol. 1 7 ,

Marcotte, W. R., Jr., Russel, S. H., and Quatrano, R. S. (1989) Plant Cell 1 ,

Meza-Basso, L., Alberdi, M., Raynal, M., Ferrero-Cadinanos, M.-L., and Del-

Mohapatra, S. S., Poole, R. J., and Dhindsa, R. S. (1987) Plant Physiol.

Mohapatra, S. S., Poole, R. J., and Dhindsa, R. S. (1988a) Plant Physiol.

Mohapatra, S. S., Poole, R. J., and Dhindsa, R. S. (1988b) Plant Cell Physiol.

Mohauatra. S. S.. Wolfraim. L.. Poole. R. J.. and Dhindsa. R. S. (1989) Plant

Plant Physiol. (Bethesda) 90,462-469

1267-1269

969-976

seny, M. (1986) Plant Physiol. (Bethesda) 82,733-738

(Bethesda) 84,1172-1176

(Bethesda) 87,468-473

2 9 , 727-730

Ph&ol. (Beth&) 89,375-380 , , . ,

Mundy, J., and Chua, N.-H. (1988) EMBO J. 7,2279-2286 Mundv. J.. Yamarmchi-Shinozaki. K., and Chua. N-H. (1990) Proc. Natl. Acad.

Sci.-o. 3. A. 87; 1406-1410 . .

Orr, W., Keller, W. A., and Singh, J. (1986) J. Plant Physiol. 126,23-32 Palm, C. J., Costa, M. A., An, G., and Ryan, C. A. (1990) Proc. Natl. Acad. Sci.

Pearson, W. R., and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 8 5 , U. S. A. 87,603-607

2444-2448

Pena-Corks, H., Sanchez-Serrano, J. J., Mertens, R., Willmitzer, L., and Prat, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,9851-9855

Quatrano, R. S. (1987) in Plant Hormones and Their Role in Plant Growth and Deuelopment (Davies P. J., ed) pp. 494-514, Kluwer Academic Publishers, Dordrecht, The Netherlands

Ramagopal, S. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,94-98 Richardson, M., Valdes-Rodriguez, S., and Blanco-Labra, A. (1987) Nature

Robertson, J. M., Pharis, R. P., Huang, Y. Y., Reid, D. M., and Yeung, E. C.

Robertson, A. J., Gusta, L. V., Reaney, M. J. T., and Ishikawa, M. (1987) Plant

Robertson. M.. Walker-Simmons. M.. Munro. D.. and Hill. R. D. (1989) Plant

327,432-434

(1985) Plant Physiol. (Bethesda) 79,1086-1089

Physiol. (Bethesda) 84,1331-1336

Physiol.’(Bethesda) 91,415-420 ’ Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloni A

Laboratow Manual. DD. 7.43-7.45. Cold Surine Harbor Laboratorv.yold

I , . .

Spring Harbor, NY’ . ~

Singh, N. K., LaRosa, P. C., Han,da, A. K., Hasegawa, P. M., and Bressan, R. A. (1987a) Proc. Natl. Acad. Set. U. S. A. 84, 739-743

Singh, N. K., Bracker, C. A., Hasegawa, P. M., Handa, A. K., Buckel, S., Hermodson, M. A., Pfankoch, E., Regnier, F. E., and Bressan, R. A. (198713) Plant Physiol. (Bethesda) 85,529-536

~I _ .

Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, Skriver, K., and Mundy, J. (1990) Plant Cell 2,503-512

Walker-Simmons, M. (1987) Plant Physiol. (Bethesda) 84,61-66 Wistow, G. (1990) Nature 344,823-824 Zeevaart, J. A. (1980) Plant Physiol. (Bethesda) 66,672-678 Zeevaart, J. A. D., and Creelman, R. A. (1988) Annu. Reu. Plant Physiol. Plant

4767-4771

Mol. Biol. 39,439-473