The revised complete mitogenome sequence of the tree frog ...peerj.com/articles/7415.pdfphylogenetic analysis confirmed that the ND5 gene was located between two control regions. The

Submitted 3 January 2019Accepted 4 July 2019Published 1 August 2019

Corresponding authorsSong Li lismailkizaccnMingwang Zhang 99709978qqcom

Academic editorMarcial Escudero

Additional Information andDeclarations can be found onpage 13

DOI 107717peerj7415

Copyright2019 Huang et al

Distributed underCreative Commons CC-BY 40

OPEN ACCESS

The revised complete mitogenomesequence of the tree frog Polypedatesmegacephalus (Anura Rhacophoridae)by next-generation sequencing andphylogenetic analysisAn Huang12 Shuo Liu3 Haijun Li12 Hongdi Luo12 Qingyong Ni12Yongfang Yao4 Huailiang Xu4 Bo Zeng12 Ying Li12 Zhimin Wei5 Song Li3

and Mingwang Zhang12

1College of Animal Sciences and Technology Sichuan Agricultural University Chengdu Sichuan ProvinceChina

2 Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province SichuanAgricultural University Chengdu China

3Kunming Natural History Museum of Zoology Kunming Institute of Zoology Chinese Academy of SciencesKunming Yunnan Province China

4College of Life Science Sichuan Agricultural University Yaan China5 Institute of Millet Crops Hebei Academy of Agriculture and Forestry Sciences Shijiazhuang ChinaThese authors contributed equally to this work

ABSTRACTThe mitochondrial genome (mitogenome) sequence of the tree frog Polypedatesmegacephalus (16473 bp) was previously reported as having the unusual characteristicof lacking the ND5 gene In this study a new mitogenome of P megacephalus(19952 bp)was resequenced using the next-generation sequencing (NGS) and standardSanger sequencing technologies It was discovered that the ND5 gene was not lostbut translocated to the control region (CR) from its canonical location between theND4 and ND6 genes In addition a duplicated control region was found in the newmitogenome of this species Conservative region identification of the ND5 gene andphylogenetic analysis confirmed that the ND5 gene was located between two controlregions The phylogenetic relationship among 20 related species of anura revealed arearrangement of the ND5 gene during the evolutionary process These results alsohighlighted the advantages of next-generation sequencing It will not only decrease thetime and cost of sequencing but also will eliminate the errors in publishedmitogenomedatabases

Subjects Evolutionary Studies Genetics Genomics Molecular Biology ZoologyKeywords Mitochondrial gene rearrangement ND5 Phylogenetic relationships Polypedatesmegacephalus

INTRODUCTIONIn general most vertebrate mitochondrial genomes contain 37 genes including tworibosomal RNAs (12S and 16S rRNAs) 22 transfer RNAs (tRNAs) and 13 protein-codinggenes (PCGs) with a long non-coding control region (CR or D-loop region) The length

How to cite this article Huang A Liu S Li H Luo H Ni Q Yao Y Xu H Zeng B Li Y Wei Z Li S Zhang M 2019 The revised completemitogenome sequence of the tree frog Polypedates megacephalus (Anura Rhacophoridae) by next-generation sequencing and phylogeneticanalysis PeerJ 7e7415 httpdoiorg107717peerj7415

of this circular structure usually ranges from 15 to 22 kb (Boore 1999 Han amp Zhou 2005Kakehashi et al 2013 Zhang et al 2018) The gene order of the vertebrate mitogenomeis conserved for 37 genes and includes a control region (Boore 1999 Kurabayashi et al2008 Kumazawa et al 2014) However studies have increasingly provided experimentaland circumstantial evidence for mitogenomic gene rearrangement in invertebrates andvertebrates (Macey et al 1997 Lavrov Boore amp Brown 2002 Kumazawa amp Endo 2004Mabuchi et al 2004 San Mauro et al 2006 Xia et al 2014 Zhang et al 2018) The varietyin gene arrangement suggests that it can be used to estimate the number of divergenceevents that occur in speciation

With the rapid development of technology an increasing number of speciesrsquo genomeshave been sequenced using the next-generation sequencing (NGS) technology (Lloyd etal 2012 Yong et al 2016 Yuan et al 2016 Jiang et al 2017) This new method allows usto more accurately explore the details of gene rearrangements in frogs and compare theresults with the mitochondrial genome obtained by the conventional sequencing method(Sanger sequencing)

There are approximately 421 species of Rhacophoridae frogs around the world includingtwo subfamilies (Rhacophorinae and Buergeriinae) and 18 genera (Frost 2018) These frogsare widely distributed in the tropical and subtropical regions of Asia the southern part ofAfrica India Sri Lanka Japan the Philippines and the Greater Sunda Islands Althoughrecent studies have illustrated that mitochondrial gene rearrangements have been detectedin quite a few species of anura there is limited data available on the genome of tree frogsand what is available hardly represents the main lineages of Rhacophoridae (Sano et al2004 Sano et al 2005 Huang et al 2016)

The genus Polypedates is widely distributed across Southeast Asia Due to itsmorphologically cryptic lineages the taxonomic status of genus Polypedates is disputed(Brown et al 2010 Blair et al 2013 Kuraishi et al 2013 Pan et al 2013) Brown et al(2010) sequenced samples of 16S rRNA to investigate the theory that Polypedates is actuallycomplex of lineages Their results showed that the frogs are highly divergent especiallyin the mainland areas but they did not resolve the phylogenetic and taxonomic issues ofthe complex Kuraishi et al (2013) reported that in China Polypedates is a monophyleticgroup that encompasses three distinct taxa Pan et al (2013) defined five different lineagesin Polypedates and four clades which are distributed in the southern region of China Mostof the studies on this genus focus on phylogenetic analysis of only a few gene fragments(12S rRNA and 16S rRNA) Few scientists have considered the mitochondrial genome inrelation to the phylogeny of Polypedatesrsquos species

A previous study has shown that the length of the complete mitogenome ofP megacephalus is 16473 bp with one control region and it has been reported that theND5 gene has been lost (Zhang et al 2005b) Until recently however few attempts havebeen made to verify this unprecedented gene loss The alleged absence of the ND5 gene hasnot been reported in any vertebrate mitogenome aside from that of Pmegacephalus (Zhanget al 2005b) and tuatara (Rest et al 2003) NADH-ubiquinone oxidoreductase chain 5 isa protein subunit of NADH dehydrogenase located in the mitochondrial inner membraneThe ND5 protein is the largest of the five complexes of the electron transport chain encoded

Huang et al (2019) PeerJ DOI 107717peerj7415 220

by the ND5 gene (Voet Voet amp Pratt 2013) A mutant ND5 gene can damage the functionof COI and impair any brain or muscle tissue that requires energy input (Charlotte et al2010) It is unlikely therefore that the mitochondria would lose such an essential gene

In the present study we resequenced the complete mitogenome of Polypedatesmegacephalus using Illumina MiSeq sequencing and standard Sanger sequencing Wediscovered that the lsquolsquomissingrsquorsquo ND5 genewas not lost but has been translocated to the controlregion from its canonical location between the tRNAGlu and ND6 genes Accounting forthe ND5 gene and an additional control region the correct mitogenome of P megacephalusshould be 19952 bp in length instead of 16473 bp in length In combinationwith previouslypublished data from 19 other anuran species phylogenetic analysis of the newly sequencedmitogenome of P megacephalus suggests that similar ND5 gene rearrangements mighthave occurred in two distinct ranoid lineages Dicroglossidae and Rhacophoridae

MATERIAL AND METHODSTaxon sampling and DNA extractionThe specimen P megacephalus was captured in the Shiwandashan National Forest ParkGuangxi Province of China A field permit (S2017-42) was granted by the Nature ReserveAdministration of Shiwandashan National Forest Park All animal care and experimentalprocedures were approved by the Committee of the Ethics onAnimal Care and Experimentsat Sichuan Agricultural University (CEACE) (Permit Number S20171001) and carriedout in accordance with the guidelines stated by CEACE Muscle tissue taken from thespecimen was preserved in 99 ethanol immediately after collection Total genomic DNAwas extracted from the tissue using an Ezup-type animal genomic DNA extraction kit(Sangon Shanghai) following the operation manual The extract was prepared for bothSanger sequencing and next-generation sequencing (NGS)

Library preparation and mitogenome sequencingOne part of the total DNA sample was sent to Personal Biotechnology (Shanghai China) forWGS (Whole Genome Shotgun) library construction Sequencing libraries were generatedusing the TruSeq DNA Sample Preparation Kit (Illumina San Diego CA USA) and theTemplate Prep Kit (Pacific Biosciences Menlo Park CA USA) Average insert sizes ofapproximately 400 bp were prepared with sequencing completed on the Illumina MiSeqsequencing platform producing 251 bp paired-end reads

To link the gaps where some regions (reads) were not assembled by NGS the remainingmtDNA was used to perform a long-range PCR (LA-PCR) amplification using two sets ofprimers F2 (CytbFow1 and FND512800H) and F3 (ND5F2 and R16M1) (Fig 1 Table 1)Additionally in order to verify the authenticity of the non-coding sequence betweentRNALys and ATP6 we used a set of primers F1 (COIIF and ATP6R) The primer setswere designed based on the mitogenome sequences obtained from the newly sequencedP megacephalus The PCR products were preliminarily confirmed on a 10 agarose gel(Fig 1) and cloned using the pEASY-T5 Zero Cloning Kit (TransGen Biotech BeijingChina) The recombinant plasmids were then sequenced with Sanger sequencing using


Figure 1 Sanger sequencing and next-generation sequencing coverage of P megacephalusmitogenome (A) The Illumina reads coverage of the mitogenome represented by sequencing depthThe reads of CR2 were mapped to CR1 as they are similar and caused the NGS results could not align intoa complete genome The red region shows the coverage of ND5 gene is similar to the average coverageon rest of the mitogenome (B) Schematic of fragment sizes based upon the sequence between COII andATP6 and the presence of a single mitochondrial control region The difference between this study andprevious study is highlighted by dashed box (C) A representative agarose gel of LA-PCR products sizesSingle letters C and M represent control and DNA marker respectively

Full-size DOI 107717peerj7415fig-1

Table 1 PCR primer pairs sequences used in this study

Fragment Primer name Nucleotide sequence (5prime-3prime) Location

F1 COIIFa GACTCACTCAAGCGTCTATTC 7734ATP6Ra TGTGGGCGGGTTTATT 9012

F2 CytbFow1b GTYCTMCCNTGRGGHCAAATATCHTTYTG 13510FND512800Hc CCTATTTTDCGRATRTCYTGYTC 16867

F3 ND5F2a CTCACCCCTCTATTACGACTT 15877R16M1d GGGTATCTAATCCCAGTTTG 701

NotesaRetrieved from this studybSano et al (2005)cZhang et al (2013)dSano et al (2004)

M13 universal primers The sequence obtained by Sanger sequencing was then spliced withcontigs or scaffolds using the ContigExpress software package

Sequence assembly and annotationThe quality of the raw Illumina data (in FASTQ format) was evaluated using FastQC(httpwwwbioinformaticsbabrahamacukprojectsfastqc) The raw data was cleaned


up filtered and assembled The workflow is described as follows AdapterRemoval v2(Schubert Lindgreen amp Orlando 2016) was used to remove low quality bases and discardthe contaminated adapters from the 3prime end of the reads Then the short reads were locallycorrected by the module SOAPec in SOAP de novo2 (httpssourceforgenetprojectssoapdenovo2) using the k-mer strategy We mapped the short reads using BWA software(Li amp Durbin 2009) and SAMtools (Li et al 2009) (Fig 1) The sequencing reads havebeen uploaded to NCBI SRA database (SRA accession number PRJNA516153)

The high quality data was then selected for de novo assembly by A5-miseq v20150522(Coil Jospin amp Darling 2015) and SPAdes v390 (Bankevich et al 2012) The contig ofmitogenome sequences was identified by the NT library on NCBI using BLASTn (BLASTC v2231+) and the draft assemblies were corrected by Pilon v118 (Walker et al 2014)to evaluate their accuracy and completeness The gaps between the ND5 and 12S rRNAby NGS were filled using Sanger sequences of the amplicon generated by the two sets ofprimers F2 and F3 (Fig 1 Table 1)

The assembled mitogenome sequence was annotated using the MITOS web server underthe genetic code for vertebrates (httpmitos2bioinfuni-leipzigdeindexpy) (Bernt etal 2013) The secondary structures of tRNAs were also predicted by this web server Thelocations of the PCGs and rRNA genes were manually examined by comparisons withthe corresponding genes from Polypedates megacephalus (AY458598) and Rhacophorusschlegelii (AB202078) in MEGA 60 (Tamura et al 2013) The PCG boundaries wereidentified by ORF Finder (httpwww ncbinlmnih govgorfgorfhtml) The conservedregions of ND5 proteins were identified by Interproscan (httpwwwebiacukinterpro)(Mitchell et al 2018) The mitogenome map was generated by the CGview Server(httpstothardafnsualbertacacgview_server) (Grant amp Stothard 2008) The A+Tcontent and relative synonymous codon usage (RSCU) of the protein-coding geneswas calculated byMEGA 60 (Tamura et al 2013) AT skews and GC skews were calculatedusing the following formulas AT skew = (A-T)(A+T) GC skew = (G-C)(G+C) (Pernaamp Kocher 1995)

Molecular phylogenetic analysesPhylogenetic analysis was performed using the data of 20 anura mitochondrial genomesincluding the one of P megacephalus generated in this study (Table S1) Another 19complete mtDNA sequences were retrieved from the GenBank Database which consistedof seven Dicroglossidae (Liu Wang amp Su 2005 Ren et al 2009 Alam et al 2010 Yu etal 2012 Li et al 2014a Huang amp Tu 2016) four Ranidae (Kakehashi et al 2013 Li etal 2014b) three Rhacophoridae (Sano et al 2004 Sano et al 2005 Huang et al 2016)two Hylidae (Zhang et al 2005a Igawa et al 2008) one Mantellinae (Kurabayashi et al2008) and two Bombinatoridae (Pabijan et al 2008) (Table S1) the latter two species(Bombina bombina and Bmaxima) were used as outgroups

With the exception of the ATP8 gene the sequences from the 12 concatenated PCGsand 2 rRNAs were chosen for phylogenetic analysis The analysis was performed using theBayesian inference (BI) andmaximum likelihood (ML)methods The nucleotide sequencesof the 12 PCGs and 2 rRNAs were aligned using MAFFT version 7 (Karen Marc amp John


2008) and all termination codons were manually deleted The sequences were edited andtrimmed using BioEdit v7053 (Hall 1999) The best-fit nucleotide substitution modelswere calculated using PartitionFinder version 211 (Lanfear et al 2017) according to theBayesian information criterion (BIC)

With the appropriate models and partitioning schemes selected in each case (Table S2)a BI phylogenetic tree was constructed using MrBayes v32 (Ronquist et al 2012) In theBI analysis two independent runs were conducted for 1000000 Markov chain MonteCarlo (MCMC) generations with 4 chains (one cold and three heated) and sampling treesoccurring every 1000 generations The first 25 of trees were discarded as burn-in samplesand the remaining trees were used to generate Bayesian consensus trees For ML analysisthe branch support of ML phylogeny was obtained with 1000 bootstrap replications inRAxML software under the GTRGAMMA model (Alexandros 2014) with partitioningparameters similar to those in the BI analysis The same methods were used for the singlegene tree FigTree 142 (httpsbeastcommunityfigtree) was used to visualize and editthe results of the Bayesian and ML trees

RESULTS AND DISCUSSIONGenome composition and gene arrangementThe raw data obtained from the Illumina Pipeline was 52475 Mb The total length was18328 bp by NGS However the NGS results could not be aligned into a completegenome In order to link the gaps in the NGS sequence we used the primers Fragment 2(13510ndash16867) and Fragment 3 (15877ndash701) according to the P megacephalus referencemtDNA (GenBank accession no MH936677) to amplify the remaining sequence segments(Fig 1 Table 1) LA-PCR amplification and Sanger sequencing with two sets of primersresulted in two products with 3500-bp and 5000-bp (Fig 1 Table 1) Finally we obtainedthe complete mitogenome of the P megacephalus with 19952 bp by merging the sequenceswith overlapping alignments The complete mitogenome sequence was deposited in theGenBank databases under the accession number MH936677

The complete mitogenome of P megacephalus was 19952 bp in total length andcontained 22 tRNAs two rRNAs 12 PCGs and two control regions (Fig 2 Table S3)Consistentwith other typical amphibianmitogenomesmost of the genes ofP megacephaluswere coded on the H-strand except for ND6 and 8 tRNAs (Fig 2 Table S3) 22 tRNAswith sizes ranging from 65 to 74 bp were interspersed across the mitogenome Aside fromtRNACys and tRNASer(AGY) which cannot possess a perfect cloverleaf structure (Fig S1)these tRNAs (20 of 22) can fold into a complete secondary structure In addition there wasa notable noncoding region that was 862 bp in length between tRNALys and ATP6 genes inthe mitogenome This was consistent with the results from a previous study (Zhang et al2005b) (Table S3) The base compositions of the whole mitochondrial genome 2 rRNAgenes PCGs and control regions of P megacephalus are shown in Table S4 The A + Tcontent for the PCGs ranged from 544 (ND3) to 631 (ND2) Four PCGs (ND1 ND2ATP6 ND4) had an A+T content of over 60 The A +T content of the CR1 and CR2 were657 and 688 respectively The AT-skew value was negative for the entire mitogenome


Figure 2 Mitochondrial gene organization of P megacephalus Genes encoded by the L-strand are onthe inner side OL represents the replication original area of L-strand


as well as for most of the genes with the exception of positive values for 5 genes (12S rRNA16S rRNA ND2 COII ND5 ND6) The GC-skew values for the whole genome PCGs 2rRNA genes and control regions were negative (0113 to 0524) indicating a bias towardthe use of Cs over Gs

The gene arrangement of the P megacephalusmitogenome diverged from that of typicalvertebrates (Fig 2 Table S3) Impressively the ND5 gene (1779 bp) was detected andsubsequently located between two control regions (CRs) after the gene had been thoughtto be lost in this species (Zhang et al 2005b) The ND5 gene and two CRs (CR1 and CR2)accompanied by the tRNA gene cluster of tRNALeu(CUN)tRNAThrtRNAProtRNAPhe (LTPFcluster) were also identified in the Schlegelrsquos tree frog Rhacophorus schlegelii (Sano et al2005)

Protein-coding genesThe total length of all 12 PCGs was 11121 bp and the overall A+T content was 592Mostgenes were encoded by the H-strand except for ND6 The initiation codons of most of thePCGs were ATG except ND2 began with ATT ND4 with GTG and COI COII and ATP6with ATA Two genes (COI and ND6) ended with AGG as the stop codon three genes


(COII ND4L and ND5) used the TAA codon and the ND2 gene terminated with the TAGcodon The remaining six PCGs (ND1 ATP6 COIII ND3 ND4 and Cytb) ended with anincomplete stop codon Tndash This incomplete codon can be transformed into a completeone (TAA) through transcription (Ojala et al 1981)

The relative synonymous codon usage (RSCU) values are shown in Fig S2 Comparedto the other synonymous codons the RSCU analysis indicated that codons including A orT at the third position were always overused The most frequently encoded amino acidswere Leu (CUN) Ile and Ala (gt300) while the least frequently used amino acid was Cys(lt45)

In this study we discovered that the previously reported lsquolsquoabsentrsquorsquo ND5 gene was notactually absent but was instead translocated to the position between the CR1 and CR2 Tofurther confirm our results the ND5 gene of four other Polypedates frogs was also obtainedusing Sanger sequencing (Dataset S3) The translocated ND5 is an intact gene that has botha normal initiation and stop codon and can be translated into proteins The open readingframe was also identified by ORF Finder on the NCBI website and the membrane transportproteins of NADH-ubquinone oxidoreductase 5 were identified by Interproscan Amongthe aligned sequences of the ND5 gene from eight tree frogs the functionally conservedregion was the most prominent with respect to amino acid sequence similarity (Fig 3A)The phylogenetic results of the ND5 gene from eight tree frogs also revealed that the closelyrelated species were clustered into the correct clades (Fig 3B)

Gene rearrangement is generally attributed to a slipped-strand mispairing caused bythe stem loop structure of mitochondria that leads to gene duplication Due to naturalselection and the accumulation of naturalmutations the repeat gene sequences were excisedin subsequent random loss (Macey et al 1997) The hypothetical gene rearrangementprocesses of the tRNAs and ND5 as proposed by Sano (Sano et al 2005) are shown inFig S3 the first tandem duplication occurs in the ND5-CR After the repeat genes aredeleted the ND5 gene is transferred downstream of the CR The secondary tandemduplication occurs in the CR-ND5 two CRs appear after the deletion of the repeat ND5gene The third tandem duplication occurs in the LTPF cluster (tRNALeu(CUN)tRNAThrtRNAPro tRNAPhe)

In some species of Dicroglossidae and Rhacophoridae the position of the ND5 geneshifts to a different locality For instance (1) in Fejervarya limnocharis (Liu Wang amp Su2005) and F cancrivora (Ren et al 2009) the ND5 gene shifts to the 3primeend of the CR Ren etal (2009) deduced that after a duplication of the ND5-CR region the ND5 gene which waslocated upstream of the CR was deleted and the downstream ND5 gene is preserved as theCR-ND5 arrangement in the genus Fejervarya (2) The ND5 gene of Rhacophorus schlegelii(Sano et al 2005) is translocated between two copied CRs confirming the evolutionarytrend of this unique gene order Therefore we infer that the ND5 gene of P megacephalusmight have experienced a similar gene rearrangement event

The ATP8 gene is a gene that encodes a subunit of mitochondrial ATP synthase (DoeringErmentrout amp Oster 1995) The published gene sequences of the P megacephalus (Zhanget al 2005b) and P braueri (Liu et al 2015) reflected a loss of the ATP8 gene in the


Figure 3 Evidences of the existence of ND5 gene in the mitogenome of P megacephalus (A) Compar-ison of amino acids of the ND5 with the corresponding amino acid sequences of seven other Rhacophori-dae species The highlighted section in yellow indicates an amino acid conserved in all eight sequencesan arrow indicates amino acids conserved in 78 sequences and dashes indicate indels The functionallyconserved regions of ND5 proteins are boxed (B) Phylogenetic results of BI and ML analysis among 24related frogs using single ND5 gene NCBI accession number P leucomystax (MK622898) P impresus(MK622901) P braueri (MK6 87567) P mutus (MK622900)


Polypedates species Our results also detected no ATP8 gene or ATP8-like sequence inP megacephalus

The ATP8 gene has a high mutation rate but still possesses the MPQL amino acids asthe conserved motif at the N-terminus of the typical metazoan ATP8 (Gissi Iannelli ampPesole 2008 Ulianosilva et al 2015) However the putative sequence of P megacephaluswas unable to be translated into its corresponding protein suggesting this gene mighthave lost its function The absence of ATP8 has been detected in several phylogeneticallydistant metazoan species Nematoda (Lavrov amp Brown 2001) Mollusca (Gissi Iannelli ampPesole 2008 Ulianosilva et al 2015) and Rotifera (Steinauer et al 2005 Suga et al 2008)


The majority of these are invertebrates Among the vertebrates however the absence wasonly found in the Polypedates species (Zhang et al 2005b Liu et al 2015) To verify theauthenticity of the lost ATP8 (in case of sequencing errors) we also sequenced this regionin four other species of the genus Polypedates finding that there was indeed a noncodingsequence between the tRNALys and ATP6 genes (Dataset S3) It is likely that the ATP8 genehas become a pseudogene as Zhang et al (2005b) inferred (Fig S4)

Noncoding regionsThe noncoding regions in P megacephalusmtDNA included the control regions and a fewintergenic spacers

Two major noncoding regions (CR1 and CR2) were found in the P megacephalusmitogenome (Fig 2 Table S3) CR1 which had a total length of 1574 bp was locatedbetween the Cytb and ND5 genes in a position homologous to that of the CR in theBuergeria buergeri mitogenome (Sano et al 2004) and CR1 in the Rhacophorus schlegelii(Sano et al 2005) CR2 which was 2330 bp was located between the ND5 and tRNAThr

genes (Fig 2) Two CRs were separated by the ND5 gene with a nucleotide sequencesimilarity of 99 over 1571bp Six tandem repeat units of 38 bp were detected in the 5prime

side of CR1 and CR2 but the 3prime side of CR2 had more 760 bp repeat sequences than CR1(Fig 4) These regions are characterized by lower conservation a high degree of variationtranscription regulation and the replication of mtDNA Duplicated control regions havebeen reported in several metazoan lineages in species such as the tree frog Rhacophorusschlegelii (Sano et al 2005) several major snake families (Kumazawa et al 1998 Dong ampKumazawa 2005) Reptile tuatara (Rest et al 2003) Thalassarche albatrosses (Abbott et al2005) Australasian ixodes ticks (Shao et al 2005) and Antarctic notothenioids (Zhuangamp Cheng 2010) Two CR copies can improve the transcription and translation efficiency ofmitochondrial encoded respiratory chain proteins (Zhuang amp Cheng 2010) Some studiesreport that the two CR sequences are quite similar suggesting that they may be undergoingconcerted evolution (Kumazawa et al 1998 Forcada et al 2003 Peng Nie amp Pu 2006)

However consistent with Zhangrsquos experimental results (Zhang et al 2005b) an 862 bpnoncoding sequence (NC) was observed between the tRNALys and ATP6 genes This NCmight have replaced the original position of the ATP8 gene (Fig 2 and Fig S4)

Phylogenetic analysesThe BI and ML methods of phylogenetic reconstruction yielded fully congruent treetopologies which supported the previous classification (Fig 5) (Frost et al 2006 Kakehashiet al 2013 Kurabayashi amp Sumida 2013 Zhang et al 2013 Li et al 2014a Xia et al2014 Yuan et al 2016)

20 species of anura in the phylogenetic trees were clustered into 6 branches In thisstudy phylogenetic trees based on 12 PCGs and 2 rRNAs strongly supported monophyly ofRhacophoridae and Dicroglossidae (BPP= 1 and bootstrap value= 100) Additionally therelationships among the three ranid families (Mantellidae Rhacophoridae and Ranidae)were well resolved in BI analysis (BPP = 1) Some previous studies have suggested thefamily Ranidae is a paraphyletic group with respect to Mantellidae and Rhacophoridae


Figure 4 Structures of P megacephalus control regions (A) These regions consist of tandem repeatunits termination-associated sequences (TAS) H-stand origin of replication (OH ) and conserve sequenceblock 1 2 3 (CSB1 CSB2 CSB3) (B) The putative secondary structures of the replication original area ofL-strand The 5prime-GCCGG-3prime sequence motif as the base of the stem within the tRNACys (C) Nucleotide se-quences of conserved elements


(Igawa et al 2008 Kurabayashi et al 2008 Ren et al 2009) and supported Dicroglossidaeas being in a sister clade relationship with (Ranidae (Mantellidae Rhacophoridae)) (Zhanget al 2013 Li et al 2014a Chen et al 2017)

The tRNALeu(CUN)tRNAThr tRNAPro tRNAPhe (LTPF cluster) was arranged like thetypical gene sequence of Babina in Ranidae but in two Rana species (Rana amurensisand R kunyuensis) the tRNALeu(CUN) moved downstream of one of the CRs (Fig 5) TheND5 genes of the species of these two genera had both moved Kurabayashi et al (2008)sequenced the complete mitogenome of Mantella madagascariensis and partial fragmentsof the CytbndashND2 region in other Mantellidae-related frogs and also determined thatthe ND5 gene had shifted downstream of the CR The LTPF clusters of some species ofRhacophoridae are arranged in the order of TLPF (tRNAThr tRNALeu(CUN) tRNAProtRNAPhe) moreover the ND5 gene is again located downstream of the CR (Fig 5)

Four tRNA genes were arranged as TPLF (tRNAThrtRNAPro tRNALeu(CUN) tRNAPhe)in some species of Dicroglossidae (F cancrivora F limnocharis and F multistriata) andhere the ND5 gene was also translocated downstream of the CR (Fig 5) Notably theduplicated ND5 gene was detected in two species (H rugulosus and H tigerinus) furtherconfirming the hypothesis of mitochondrial tandem duplication Therefore it seems thatthe translocation of the ND5 gene took place in the common lineage of these Dicroglossidaegenera ancestors (Alam et al 2010 Chen et al 2017) Based on the phylogenetic results it


Figure 5 Phylogenetic tree constructed based on the nucleotide dataset of 12 PCGs and 2 rRNAs usingBayesian inference andMLmethod The PCGs are shown in abbreviations tRNA genes are representedby the standard single amino acid code the rearranged ND5 and CR are in shed boxes


appears that the same translocation of the ND5 gene occurred in the common ancestorof Mantellidae as well as Rhacophoridae as well as the common ancestral lineage of fourgenera of Dicroglossidae (Occidozyga Fejervarya Hoplobatrachus and Euphlyctis) (Chenet al 2017) As discussed above the same gene rearrangements probably occurred in twodistinct ranoid lineages as convergent genetic evolutionary events (Ren et al 2009 Chen etal 2017)

Possible causes for misdiagnosis of an ldquoabsentrdquo ND5 geneIt was previously reported that the ND5 gene was absent in the mitogenome ofP megacephalus (16473 bp) (Zhang et al 2005b) which conflicts with the present studyThe presence of the ND5 gene was observed in the mitogenome of the same species(19952 bp) with an extra CR In reanalyzing Zhangrsquos data three factors could explain thewhy Zhangrsquos results contradict the present study (1) Two primer sets (LX16S1LX11932H[sim7 kb] and LX9844LX16S1R [sim9 kb]) for their long-range PCR amplifications


were designed to amplify the entire mitogenome Each sequence of the two long PCRfragments overlapped by about 3 kb However location verification of the primer pair(LX9844LX16S1R [sim9 kb]) showed that the fragment size should be 14 kb rather than9 kb (2) It was previously inferred that the ND5 gene was absent based on the amplifiedsequence of the mtDNA region from tRNALys to Cytb from P megacephalus and otherrelated frogs (Zhang et al 2005b) It was also reported that the amplified fragments fromthese tree frogs were apparently shorter than those of other frogs suggesting the absenceof the ND5 gene from its original position However this study indicates that this evidencecould be attributed to translocation instead of gene loss (3) In addition it was found thatthe copied CRs in P megacephalusrsquos mitogenome exhibited highly similar sequences to oneanother at the 5prime region (100 across 38times6= 228 bp) (Fig 4 and Fig S5) which mayhave resulted in assembly error (ie the 5prime region of CR1 and CR2 were misassembled orcombined as a single CR) Thus only one CR was observed and the absence of the ND5gene was reported (Zhang et al 2005b) The misdiagnosis of an lsquolsquoabsentrsquorsquo ND5 gene couldbe attributed to the errors in the estimation of long-range PCR fragment size assemblyand alignment

CONCLUSIONWe successfully resequenced and revised the entire mitochondrial genome sequence ofPolypedates megacephalus and found the ND5 gene located between two control regionsalthough a previous study had suggested this gene to be absent Our experiments indicatedthat more accurate results can be obtained using Sanger sequencing in combinationwith next-generation sequencing Our subsequent experiments suggest that all speciesof genus Polypedates might have the same mitochondrial gene arrangement Furtherinvestigations focusing on the mitochondrial gene arrangement of other tree frogs willenhance the understanding of the molecular mechanisms and evolutionary history behindthe phylogenetic pathway

ACKNOWLEDGEMENTSWe thank Biao Li and Ming Zhou for analytical advice We also thank Zhiyuan Zhou forhis technical support We are grateful to Han Ming Gan and other anonymous reviewersfor their valuable comments

ADDITIONAL INFORMATION AND DECLARATIONS

FundingThis work was supported by the National Natural Science Foundation of China (NSFC)to MingWang Zhang (No 31470444) and the Innovative Research Team in University ofSichuan Bureau of Education (No 14TD0002) The funders had no role in study designdata collection and analysis decision to publish or preparation of the manuscript


Grant DisclosuresThe following grant information was disclosed by the authorsNational Natural Science Foundation of China (NSFC) 31470444Innovative Research Team in University of Sichuan Bureau of Education 14TD0002

Competing InterestsThe authors declare there are no competing interests

Author Contributionsbull AnHuang conceived anddesigned the experiments performed the experiments analyzedthe data contributed reagentsmaterialsanalysis tools prepared figures andor tablesapproved the final draftbull Shuo Liu Haijun Li and Hongdi Luo performed the experiments contributedreagentsmaterialsanalysis toolsbull Qingyong Ni Yongfang Yao Huailiang Xu Bo Zeng Ying Li and Zhimin Wei authoredor reviewed drafts of the paperbull Song Li conceived and designed the experiments authored or reviewed drafts of thepaper approved the final draftbull Mingwang Zhang authored or reviewed drafts of the paper approved the final draft

Animal EthicsThe following information was supplied relating to ethical approvals (ie approving bodyand any reference numbers)

This study about P megacephalus was approved by the Committee of the Ethics onAnimal Care and Experiments at Sichuan Agricultural University (CEACE) and wascarried out in accordance with the guidelines stated by CEACE (S20171001)

Field Study PermissionsThe following information was supplied relating to field study approvals (ie approvingbody and any reference numbers)

Field permit S2017-42 was granted by the Nature Reserve Administration ofShiwandashan National Forest Park

Data AvailabilityThe following information was supplied regarding the deposition of DNA sequences

The mitochondrial sequence of Polypedates megacephalus described here are accessiblevia GenBank accession number MH936677 and the Sequence Read Archive (SRA) isPRJNA516153

Raw data of the complete mitogenome sequence of tree frog Polypedates megacephalusis available at Figshare Huang An (2019) Polypedates megacephalus_PE400fastqgzfigshare Dataset httpsdoiorg106084m9figshare7935194v1

Supplemental InformationSupplemental information for this article can be found online at httpdxdoiorg107717peerj7415supplemental-information


REFERENCESAbbott CL Double MC Trueman JW Robinson A Cockburn A 2005 An un-

usual source of apparent mitochondrial heteroplasmy duplicate mitochondrialcontrol regions in Thalassarche albatrossesMolecular Ecology 143605ndash3613DOI 101111j1365-294X200502672x

AlamMS Kurabayashi A Hayashi Y Sano N KhanMMR Fujii T SumidaM 2010Complete mitochondrial genomes and novel gene rearrangements in two dicroglos-sid frogs Hoplobatrachus tigerinus and Euphlyctis hexadactylus from BangladeshGenes amp Genetic Systems 85219ndash232 DOI 101266ggs85219

Alexandros S 2014 RAxML version 8 a tool for phylogenetic analysis and post-analysisof large phylogenies Bioinformatics 301312ndash1313DOI 101093bioinformaticsbtu033

Bankevich A Nurk S Antipov D Gurevich AA DvorkinM Kulikov AS Lesin VMNikolenko SI Pham S Prjibelski AD 2012 SPAdes a new genome assemblyalgorithm and its applications to single-cell sequencing Journal of ComputationalBiology 19455ndash477 DOI 101089cmb20120021

Bernt M Donath A Juumlhling F Externbrink F Florentz C Fritzsch G Puumltz J Mid-dendorf M Stadler PF 2013MITOS improved de novo metazoan mitochon-drial genome annotationMolecular Phylogenetics amp Evolution 69313ndash319DOI 101016jympev201208023

Blair C Davy CM Ngo A Orlov NL Shi HT Lu SQ Gao L Rao DQMurphy RW2013 Genealogy and demographic history of a widespread amphibian throughoutindochina Journal of Heredity 10472ndash85 DOI 101093jheredess079

Boore JL 1999 Animal mitochondrial genomes Nucleic Acids Research 271767ndash1780DOI 101093nar2781767

Brown RM Linkem CW Siler CD Sukumaran J Esselstyn JA Diesmos AC IskandarDT Bickford D Evans BJ McGuire JA Grismer L Supriatna J Andayani N2010 Phylogeography and historical demography of Polypedates leucomystaxin the islands of Indonesia and the Philippines evidence for recent human-mediated range expansionMolecular Phylogenetics and Evolution 57598ndash619DOI 101016jympev201006015

Charlotte LA MonikaM Christopher R Iain PH Simon ASP JohnML Simon JHRita H HelenM RobertWT 2010 A novel mitochondrial MTND5 frameshiftmutation causing isolated complex I deficiency renal failure and myopathyNeuromuscular Disorders NMD 20(2)131ndash135 DOI 101016jnmd200910010

Chen Z Li H Zhu Y Feng Q He Y Chen X 2017Molecular phylogeny of the familyDicroglossidae (Amphibia Anura) inferred from complete mitochondrial genomesBiochemical Systematics and Ecology 711ndash9 DOI 101016jbse201701006

Coil D Jospin G Darling AE 2015 A5-miseq an updated pipeline to assemblemicrobial genomes from Illumina MiSeq data Bioinformatics 31587ndash589DOI 101093bioinformaticsbtu661


Doering C Ermentrout B Oster G 1995 Rotary DNA motors Biophysical Journal692256ndash2267 DOI 101016S0006-3495(95)80096-2

Dong S Kumazawa Y 2005 Complete mitochondrial DNA sequences of six snakesphylogenetic relationships and molecular evolution of genomic features Journal ofMolecular Evolution 6112ndash22 DOI 101007s00239-004-0190-9

Forcada I MurMMora E Vieta E Bartreacutes-Faz D Portella MJ 2003 Evolutionof the deep-sea gulper Eel mitochondrial genomes large-scale gene rearrange-ments originated within the EelsMolecular Biology and Evolution 201917ndash1924DOI 101093molbevmsg206

Frost DR 2018 Amphibian species of the world an online reference version 60 (20September 2018) New York American Museum of Natural History Available athttp researchamnhorgherpetologyamphibia indexhtml

Frost DR Grant T Faivovich J Bain RH Haas A Haddad C RO de SAacute Channing AWilkinsonM Donnellan SC 2006 The amphibian tree of life Bullammusnatlhist2971ndash291 DOI 1012060003-0090(2006)297[0001TATOL]20CO2

Gissi C Iannelli F Pesole G 2008 Evolution of the mitochondrial genome of Meta-zoa as exemplified by comparison of congeneric species Heredity 101301ndash320DOI 101038hdy200862

Grant JR Stothard P 2008 The CGView server a comparative genomics tool forcircular genomes Nucleic Acids Research 36181ndash184 DOI 101093nargkn179

Hall TA 1999 BioEdit a user-friendly biological sequence alignment editor and analysisprogram for Windows 9598NT Nucleic Acids Symposium Series 4195ndash98

HanDM Zhou KY 2005 Complete sequence and gene organization of the mito-chondrial genome of Tokay (Gekko gecko) Zoological Research 26123ndash128DOI 103321jissn0254-5853200502003

HuangM Tong L Duan R Zhang S Li H 2016 The complete mitochondrial genomeof Rhacophorus dennysi (Anura Rhacophoridae) and phylogenetic analysisMitochondrial DNA Part A DNA Mapping Sequencing amp Analysis 273719ndash3720DOI 1031091940173620151079873

Huang ZH Tu FY 2016Mitogenome of Fejervarya multistriata a novel gene ar-rangement and its evolutionary implications Genetics and Molecular Research15(3)gmr15038302 DOI 104238gmr15038302

Igawa T Kurabayashi A Usuki C Fujii T SumidaM 2008 Complete mitochon-drial genomes of three neobatrachian anurans a case study of divergence timeestimation using different data and calibration settings Gene 407116ndash129DOI 101016jgene200710001

Jiang L Zhao L Cheng D Zhu L ZhangM Ruan Q ChenW 2017 The completemitochondrial genome sequence of the Sichuan Digging Frog Kaloula rugifera(Anura Microhylidae) and its phylogenetic implications Gene 626367ndash375DOI 101016jgene201705039

Kakehashi R Kurabayashi A Oumi S Katsuren S HosoM SumidaM 2013Mi-tochondrial genomes of Japanese Babina frogs (Ranidae Anura) unique gene


arrangements and the phylogenetic position of genus Babina Genes amp GeneticSystems 8859ndash67 DOI 101266ggs8859

KarenMWMarc AS John PH 2008 Alignment uncertainty and genomic analysisScience 319473ndash476 DOI 101126science1151532

Kumazawa Y Endo H 2004Mitochondrial genome of the Komodo dragon efficientsequencing method with reptile-oriented primers and novel gene rearrangementsDNA Research 11115ndash125 DOI 101093dnares112115

Kumazawa Y Miura S Yamada C Hashiguchi Y 2014 Gene rearrangements ingekkonid mitochondrial genomes with shuffling loss and reassignment of tRNAgenes BMC Genomics 15930 DOI 1011861471-2164-15-930

Kumazawa Y Ota H NishidaM Ozawa T 1998 The complete nucleotide sequence ofa snake (Dinodon semicarinatus) mitochondrial genome with two identical controlregions Genetics 150313ndash329

Kurabayashi A SumidaM 2013 Afrobatrachian mitochondrial genomes genome reor-ganization gene rearrangement mechanisms and evolutionary trends of duplicatedand rearranged genes BMC Genomics 14633ndash633 DOI 1011861471-2164-14-633

Kurabayashi A SumidaM Yonekawa H Glaw F Vences M HasegawaM 2008Phylogeny recombination and mechanisms of stepwise mitochondrial genomereorganization in mantellid frogs from MadagascarMolecular Biology and Evolution25874ndash891 DOI 101093molbevmsn031

Kuraishi N Matsui M Hamidy A Belabut DM Ahmad N Panha S Sudin A YongHS Jiang J-P Ota H Thong HT Nishikawa K 2013 Phylogenetic and taxonomicrelationships of the Polypedates leucomystaxcomplex (Amphibia) Zoologica Scripta4254ndash70 DOI 101111j1463-6409201200562x

Lanfear R Frandsen PBWright AM Senfeld T Calcott B 2017 PartitionFinder2 new methods for selecting partitioned models of evolution for molecular andmorphological phylogenetic analysesMolecular Biology amp Evolution 34772ndash773DOI 101093molbevmsw260

Lavrov DV Boore JL BrownWM 2002 Complete mtDNA sequences of twomillipedes suggest a new model for mitochondrial gene rearrangements du-plication and nonrandom lossMolecular Biology amp Evolution 19163ndash169DOI 101093oxfordjournalsmolbeva004068

Lavrov DV BrownWM 2001 Trichinella spiralis mtDNA a nematode mitochondrialgenome that encodes a putative ATP8 and normally structured tRNAS and has agene arrangement relatable to those of coelomate metazoans Genetics 157621ndash637

Li H Durbin R 2009 Fast and accurate short read alignment with Burrows-Wheelertransform Bioinformatics 251754ndash1760 DOI 101093bioinformaticsbtp324

Li H Handsaker BWysoker A Fennell T Ruan J Homer N Marth G Abecasis GDurbin R Genome project data processings 2009 The sequence alignmentmapformat and SAMtools Bioinformatics 252078ndash2079DOI 101093bioinformaticsbtp352


Li E Li XWu X Feng G ZhangM Shi HWang L Jiang J 2014a Complete nucleotidesequence and gene rearrangement of the mitochondrial genome of Occidozygamartensii Journal of Genetics 93631ndash641 DOI 101007s12041-014-0418-4

Li J YinW Xia R Lei G Fu C 2014b Complete mitochondrial genome of a brown frog(Anura Ranidae)Mitochondrial DNA 2734ndash35 DOI 103109194017362013869681

Liu ZQWang YQ Su B 2005 The mitochondrial genome organization of the ricefrog Fejervarya limnocharis (Amphibia Anura) a new gene order in the vertebratemtDNA Gene 346145ndash151 DOI 101016jgene200410013

Liu Y YangM Jiang Y Han F Li Y Ni Q Yao Y Xu H ZhangM 2015 The near com-plete mitochondrial genome of white-lipped Treefrog Polypedates braueri (AnuraRhacophoridae) DNA Sequence 28271ndash272 DOI 1031091940173620151118075

Lloyd RE Foster PG Matthew G Littlewood DTJ 2012 Next generation sequencingand comparative analyses of Xenopus mitogenomes BMC Genomics 13496ndash496DOI 1011861471-2164-13-496

Mabuchi K MiyaM Satoh TPWestneat MW NishidaM 2004 Gene rearrangementsand evolution of tRNA Pseudogenes in the mitochondrial genome of the Parrotfish(Teleostei Perciformes Scaridae) Journal of Molecular Evolution 59287ndash297DOI 101007s00239-004-2621-z

Macey JR Larson A Ananjeva NB Fang Z Papenfuss TJ 1997 Two novel geneorders and the role of light-strand replication in rearrangement of the ver-tebrate mitochondrial genomeMolecular Biology amp Evolution 1491ndash104DOI 101093oxfordjournalsmolbeva025706

Mitchell AL Sangrador-Vegas A Luciani A Madeira F Nuka G Salazar GA ChangH-Y Richardson LJ Qureshi MA Fraser MI BlumM Rawlings ND Lopez R El-Gebali S Pesseat S Yong S-Y Potter SC Paysan-Lafosse T Finn RD Marchler-Bauer A Thanki N Mi H Thomas PD Natale DA Tosatto SCE Necci M OrengoC Sillitoe I Attwood TK Babbitt PC Brown SD Bork P Bridge A RivoireC Sigrist CJA Redaschi N Pandurangan AP Gough J Haft DR Sutton GGHuang H Letunic I 2018 InterPro in 2019 improving coverage classificationand access to protein sequence annotations Nucleic Acids Research 47D351ndashD360DOI 101093nargky1100

Ojala D Montoya J amp Attardi G 1981 TRNA punctuation model of RNA processingin human mitochondrial Nature 290470ndash474 DOI 101038290470a0

PabijanM Spolsky C Uzzell T Szymura JM 2008 Comparative analysis of mitochon-drial genomes in Bombina (Anura Bombinatoridae) Journal of Molecular Evolution67246ndash256 DOI 101007s00239-008-9123-3

Pan S Dang NWang J Zheng Y Rao D Jiatang LI 2013Molecular phylogenysupports the validity of polypedates impresus Yang 2008 Asian HerpetologicalResearch 4124ndash133 DOI 103724SPJ1245201300124

Peng QL Nie LW Pu YG 2006 Complete mitochondrial genome of Chinese big-headedturtle Platysternon megacephalum with a novel gene organization in vertebratemtDNA Gene 38014ndash20 DOI 101016jgene200604001


Perna NT Kocher TD 1995 Patterns of nucleotide composition at fourfold de-generate sites of animal mitochondrial genomes Journal of Molecular Evolution41(3)353ndash358 DOI 101007bf01215182

Ren Z Zhu B Ma EWen J Tu T Cao Y HasegawaM Zhong Y 2009 Completenucleotide sequence and gene arrangement of the mitochondrial genome of the crab-eating frog Fejervarya cancrivora and evolutionary implications Gene 441148ndash155DOI 101016jgene200809010

Rest JS Ast JC Austin CCWaddell PJ Tibbetts EA Hay JM Mindell DP 2003Molec-ular systematics of primary reptilian lineages and the tuatara mitochondrial genomeMolecular Phylogenetics amp Evolution 29289ndash297 DOI 101016s1055-7903(03)00108-8

Ronquist F TeslenkoMMark PVD Ayres DL Darling A Houmlhna S Larget B LiuL SuchardMA Huelsenbeck JP 2012MrBayes 32 efficient Bayesian phyloge-netic inference and model choice across a large model space Systematic Biology61539ndash542 DOI 101093sysbiosys029

SanMauro D Gower DJ Zardoya RWilkinsonM 2006 A hotspot of gene order rear-rangement by tandem duplication and random loss in the vertebrate mitochondrialgenomeMolecular Biology and Evolution 23227ndash234 DOI 101093molbevmsj025

Sano N Kurabayashi A Fujii T Yonekawa H SumidaM 2004 Complete nucleotidesequence and gene rearrangement of the mitochondrial genome of the bell-ring frogBuergeria buergeri (family Rhacophoridae) Genes amp Genetic Systems 79151ndash163DOI 101266ggs79151

Sano N Kurabayashi A Fujii T Yonekawa H SumidaM 2005 Complete nucleotidesequence of the mitochondrial genome of Schlegelrsquos tree frog Rhacophorus schlegelii(family Rhacophoridae) duplicated control regions and gene rearrangements Genesamp Genetic Systems 80213ndash224 DOI 101266ggs80213

Schubert M Lindgreen S Orlando L 2016 AdapterRemoval v2 rapid adapter trim-ming identification and read merging BMC Research Notes 988DOI 101186s13104-016-1900-2

Shao R Barker SC Mitani H Aoki Y FukunagaM 2005 Evolution of duplicate controlregions in the mitochondrial genomes of metazoa a case study with australasianixodes ticksMolecular Biology amp Evolution 22620ndash629 DOI 101093molbevmsi047

Steinauer ML Nickol BB Broughton R Ortiacute G 2005 First sequenced mitochondrialgenome from the phylum Acanthocephala (Leptorhynchoides thecatus) and itsphylogenetic position within Metazoa Journal of Molecular Evolution 60706ndash715DOI 101007s00239-004-0159-8

Suga K MarkWelch DB Tanaka Y Sakakura Y Hagiwara A 2008 Two circularchromosomes of unequal copy number make up the mitochondrial genome ofthe rotifer Brachionus plicatilisMolecular Biology amp Evolution 251129ndash1137DOI 101093molbevmsn058

Tamura K Stecher G Peterson D Filipski A Kumar S 2013MEGA6 molecular evolu-tionary genetics analysis version 60Molecular Biology and Evolution 302725ndash2729DOI 101093molbevmst197


Ulianosilva M Americo JA Costa I Schomakerbastos A Rebelo MDF ProsdocimiF 2015 The complete mitochondrial genome of the golden mussel Limnopernafortunei and comparative mitogenomics of Mytilidae Gene 577202ndash208DOI 101016jgene201511043

Voet D Voet JG Pratt CW 2013 Fundamentals of biochemistry life at the molecular level4th edition Hoboken Wiley 581ndash620

Walker BJ Abeel T Shea T Priest M Abouelliel A Sakthikumar S Cuomo CA Zeng QWortman J Young SK 2014 Pilon an integrated tool for comprehensive microbialvariant detection and genome assembly improvement PLOS ONE 9e112963DOI 101371journalpone0112963

Xia Y Zheng Y Miura I Wong PB Murphy RW Zeng X 2014 The evolutionof mitochondrial genomes in modern frogs (Neobatrachia) nonadaptiveevolution of mitochondrial genome reorganization BMC Genomics 15691DOI 1011861471-2164-15-691

Yong HS Song SL Lim PE Eamsobhana P Tan J 2016 Complete mitochondrialgenome and phylogeny of Microhyla butleri (Amphibia Anura Microhylidae)Biochemical Systematics amp Ecology 66243ndash253 DOI 101016jbse201604004

Yu D Zhang J Zheng R Shao C 2012 The complete mitochondrial genome of Ho-plobatrachus rugulosus (Anura Dicroglossidae)Mitochondrial DNA 23336ndash337DOI 103109194017362012690748

Yuan S Xia Y Zheng Y Zeng X 2016 Next-generation sequencing of mixed genomicDNA allows efficient assembly of rearranged mitochondrial genomes in Amolopschunganensis and Quasipaa boulengeri PeerJ 4e2786 DOI 107717peerj2786

Zhang P Liang D Mao RL Hillis DMWake DB Cannatella DC 2013 Efficientsequencing of Anuran mtDNAs and a mitogenomic exploration of the phy-logeny and evolution of frogsMolecular Biology amp Evolution 301899ndash1915DOI 101093molbevmst091

Zhang JY Zhang LP Yu DN Storey KB Zheng RQ 2018 Complete mitochondrialgenomes of Nanorana taihangnica and N yunnanensis (Anura Dicroglossidae)with novel gene arrangements and phylogenetic relationship of Dicroglossidae BMCEvolutionary Biology 1826 DOI 101186s12862-018-1140-2

Zhang P Zhou H Chen YQ Liu YF Qu LH 2005aMitogenomic perspectives onthe origin and phylogeny of living amphibians Systematic Biology 54391ndash400DOI 10108010635150590945278

Zhang P Zhou H Liang D Liu YF Chen YQ Qu LH 2005b The complete mitochon-drial genome of a tree frog Polypedates megacephalus (Amphibia Anura Rha-cophoridae) and a novel gene organization in living amphibians Gene 346133ndash143DOI 101016jgene200410012

Zhuang X Cheng CHC 2010 ND6 gene lost and found evolution of mitochondrialgene rearrangement in antarctic notothenioidsMolecular Biology amp Evolution271391ndash1403 DOI 101093molbevmsq026


of this circular structure usually ranges from 15 to 22 kb (Boore 1999 Han amp Zhou 2005Kakehashi et al 2013 Zhang et al 2018) The gene order of the vertebrate mitogenomeis conserved for 37 genes and includes a control region (Boore 1999 Kurabayashi et al2008 Kumazawa et al 2014) However studies have increasingly provided experimentaland circumstantial evidence for mitogenomic gene rearrangement in invertebrates andvertebrates (Macey et al 1997 Lavrov Boore amp Brown 2002 Kumazawa amp Endo 2004Mabuchi et al 2004 San Mauro et al 2006 Xia et al 2014 Zhang et al 2018) The varietyin gene arrangement suggests that it can be used to estimate the number of divergenceevents that occur in speciation

With the rapid development of technology an increasing number of speciesrsquo genomeshave been sequenced using the next-generation sequencing (NGS) technology (Lloyd etal 2012 Yong et al 2016 Yuan et al 2016 Jiang et al 2017) This new method allows usto more accurately explore the details of gene rearrangements in frogs and compare theresults with the mitochondrial genome obtained by the conventional sequencing method(Sanger sequencing)

There are approximately 421 species of Rhacophoridae frogs around the world includingtwo subfamilies (Rhacophorinae and Buergeriinae) and 18 genera (Frost 2018) These frogsare widely distributed in the tropical and subtropical regions of Asia the southern part ofAfrica India Sri Lanka Japan the Philippines and the Greater Sunda Islands Althoughrecent studies have illustrated that mitochondrial gene rearrangements have been detectedin quite a few species of anura there is limited data available on the genome of tree frogsand what is available hardly represents the main lineages of Rhacophoridae (Sano et al2004 Sano et al 2005 Huang et al 2016)

The genus Polypedates is widely distributed across Southeast Asia Due to itsmorphologically cryptic lineages the taxonomic status of genus Polypedates is disputed(Brown et al 2010 Blair et al 2013 Kuraishi et al 2013 Pan et al 2013) Brown et al(2010) sequenced samples of 16S rRNA to investigate the theory that Polypedates is actuallycomplex of lineages Their results showed that the frogs are highly divergent especiallyin the mainland areas but they did not resolve the phylogenetic and taxonomic issues ofthe complex Kuraishi et al (2013) reported that in China Polypedates is a monophyleticgroup that encompasses three distinct taxa Pan et al (2013) defined five different lineagesin Polypedates and four clades which are distributed in the southern region of China Mostof the studies on this genus focus on phylogenetic analysis of only a few gene fragments(12S rRNA and 16S rRNA) Few scientists have considered the mitochondrial genome inrelation to the phylogeny of Polypedatesrsquos species

A previous study has shown that the length of the complete mitogenome ofP megacephalus is 16473 bp with one control region and it has been reported that theND5 gene has been lost (Zhang et al 2005b) Until recently however few attempts havebeen made to verify this unprecedented gene loss The alleged absence of the ND5 gene hasnot been reported in any vertebrate mitogenome aside from that of Pmegacephalus (Zhanget al 2005b) and tuatara (Rest et al 2003) NADH-ubiquinone oxidoreductase chain 5 isa protein subunit of NADH dehydrogenase located in the mitochondrial inner membraneThe ND5 protein is the largest of the five complexes of the electron transport chain encoded


























































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































Documents

The revised complete mitogenome sequence of the tree frog ...peerj.com/articles/7415.pdfphylogenetic analysis confirmed that the ND5 gene was located between two control regions. The