Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
The Role of Discoidin Domain Receptor 1 (Ddr1) on
Macrophages in Adhesion and Cytokine production
By
Karen Elma Britto, B.Sc.
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Department of Laboratory Medicine and Pathobiology
Faculty of Medicine
University of Toronto
© Copyright by Karen Britto. 2010.
ii
The Role of Discoidin Domain Receptor 1 (Ddr1) on Macrophages in
Adhesion and Cytokine production
Karen Elma Britto
Master of Science
Department of Laboratory Medicine and Pathobiology
University of Toronto
2010
Abstract
Atherosclerosis is an inflammatory disease of the cardiovascular system. Discoidin
domain receptor 1 is a receptor tyrosine kinase that binds collagens. Previous work in
our lab has shown that deleting DDR1 in a mouse model results in attenuation of
atherosclerosis, with fewer macrophages in the plaque. The aim of this study was to
determine what changes in macrophage behaviour due to the lack of DDR1 was
attenuating plaque development.
In order to carry out experiments, primary mouse peritoneal macrophages were used.
DDR1-deficient macrophages adhered significantly less to type IV collagen and
fibronectin compared to DDR1-expressing cells. In addition, when plated on type IV
collagen and fibronectin, DDR1-deficient macrophages produced decreased levels of
MCP-1 protein, a cytokine known to be important in plaque development, particularly in
leukocyte recruitment to plaque. These results suggest that DDR1 is an important
mediator in macrophage adhesion to matrix and macrophage cytokine production.
iii
Acknowledgments
This thesis and the work behind it would not have been possible without the
help of a great many people, and I take pleasure in this opportunity to acknowledge and
thank them for their contributions.
It is difficult to overstate my gratitude to my supervisor, Dr. Michelle Bendeck.
Her scientific training, enthusiasm and great patience helped to constantly provide
sound advice, guidance and encouragement, especially during times when hurdles
seemed insurmountable. Her confidence in me helped me cultivate confidence in
myself, and more than anything, I take that away from 2 years under her tutelage.
Particular thanks are also due to the members of my advisory committee – Dr.
Myron Cybulsky and Dr. Craig Simmons for their insightful comments, and hard
questions.
I am grateful to my many colleagues in the Bendeck lab for providing a
stimulating and enjoyable environment in which to learn and grow. Thanks in particular
to Dr. Guang Pei Hou for many long discussions, to Dan Trcka for his friendship and to
Dr. Antonio Rocca for unwaveringly trying to teach me what exactly a coffee break
entailed and so much more.
Technical assistance from Ms. Sarah Fodor from the Division of Comparative
Medicine was invaluable. Thanks also to Mr. Brent Steer for help with experimental
setup and troubleshooting.
Thanks are also due to members of the LMP department administrative staff, in
particular Louella D’Cunha, Rama Ponda and Ferzeen Dharas, for assistance in many
ways.
Thanks to Dr. Anja Lowrance for starting me on the path to research and to Dr.
Michael Arts for his supervision during my internship at his lab, without which I would
not have chosen to pursue graduate research.
Lastly and most importantly, I would like to thank my family, and in particular my
parents Malcolm and Eliza Britto for their constant encouragement, patience and
support during my studies. Without them, none of this would be possible.
iv
Table of Contents
Abstract ........................................................................................................................................... ii
Acknowledgments.......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Tables and Figures .............................................................................................................. vii
List of abbreviations and acronyms ............................................................................................... ix
1 Literature Review .......................................................................................................................1
1.1 Introduction .........................................................................................................................2
1.2 Atherosclerosis .....................................................................................................................2
1.2.1 Introduction .............................................................................................................2
1.2.2 Initiation of atherosclerosis .....................................................................................3
1.2.3 Progression ..............................................................................................................5
1.3 Extracellular matrix in atherosclerosis.................................................................................6
1.3.1 Proteoglycans ...........................................................................................................6
1.3.2 Fibronectin – an adhesive glycoprotein ...................................................................7
1.3.3 Collagens ..................................................................................................................8
1.4 Collagen Receptors ..............................................................................................................9
1.4.1 Integrins .................................................................................................................10
1.4.2 Discoidin Domain receptors ...................................................................................11
1.5 Discoidin Domain Receptor 1 ............................................................................................11
1.5.1 Structure ................................................................................................................11
1.5.2 Regulation and Signaling ........................................................................................12
1.5.3 Functions ................................................................................................................15
1.5.4 Role in atherosclerosis ...........................................................................................17
v
1.6 Major Mouse models of atherosclerosis ...........................................................................18
1.6.1 The Apolipoprotein E deficient mouse model .......................................................18
1.6.2 The Low Density Lipoprotein Receptor deficient mouse model ...........................18
1.7 Rationale ............................................................................................................................19
1.8 Hypotheses: .......................................................................................................................20
1.9 Figures ................................................................................................................................22
2 Materials and methods ............................................................................................................25
2.1 Generation of mice ............................................................................................................26
2.2 To obtain macrophages from the peritoneal cavity of mice .............................................26
2.3 Static adhesion assays........................................................................................................27
2.4 Flow adhesion experiments ...............................................................................................29
2.5 RT-PCR experiments ...........................................................................................................30
2.6 ELISA experiments..............................................................................................................31
2.7 Figures ................................................................................................................................33
3 Results .......................................................................................................................................36
3.1 Macrophage adhesion to collagen and fibronectin ...........................................................37
3.2 Macrophage adhesion to collagen and fibronectin in the presence of an
integrin β1 blocking antibody .............................................................................................38
3.3 Macrophage adhesion under shear stress ........................................................................39
3.4 mRNA levels for cytokines and growth factors involved in atherosclerosis .....................40
3.5 Figures ................................................................................................................................42
4 Discussion .................................................................................................................................58
4.1 Discussion...........................................................................................................................59
4.2 Limitations and Future directions ......................................................................................64
5 References ................................................................................................................................66
vi
6 Appendices ...............................................................................................................................75
6.1 Flow cytometry to determine if differences exist in macrophage recruitment
to the peritoneal cavity: .....................................................................................................76
6.1.1 Rationale ................................................................................................................77
6.1.2 Materials and Methods ..........................................................................................77
6.1.3 Results ....................................................................................................................78
6.1.4 Discussion...............................................................................................................78
6.1.5 Figure: ....................................................................................................................79
6.2 Attempts to immunoblot for DDR1 ...................................................................................80
6.2.1 Rationale: ...............................................................................................................81
6.2.2 Materials and Methods:.........................................................................................81
6.2.3 Results and Discussion ...........................................................................................82
6.2.4 Figure: ....................................................................................................................83
vii
List of Tables and Figures
Figure 1.9.1: The development of atherosclerosis. .......................................................... 23
Figure 1.9.2: Structure of DDR1 ........................................................................................ 24
Figure 2.7.1: Image of microfluidic channel device used in flow adhesion experiments 34
Table 2.7.2: Primer sequences used in RT-PCR experiments ........................................... 35
Figure 3.5.1: Peritoneal macrophages did not adhere to type I collagen ........................ 43
Figure 3.5.2: Ddr1-/-
macrophages adhered significantly less to type IV collagen ........... 44
Figure 3.5.3: Ddr1-/-
macrophages adhered significantly less to fibronectin ................... 45
Figure 3.5.4: Ddr1-/-
macrophages adhered significantly less to type IV collagen in the
presence of a β1-integrin blocking antibody ..................................................................... 46
Figure 3.5.5: There was no difference in adhesion seen on type IV collagen when using
MHC class II or IgM control antibodies. ............................................................................ 47
Figure 3.5.6: Ddr1-/-
macrophages adhered significantly less to fibronectin in the
presence of a β1-integrin blocking antibody ..................................................................... 48
Figure 3.5.7: There was no difference in adhesion seen on fibronectin when using MHC
class II or IgM control antibodies ...................................................................................... 49
Figure 3.5.8: Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages after shear
stress ................................................................................................................................. 50
Figure 3.5.9: Ddr1-/-
macrophages produced increased levels of mRNA for MCSF, TNF-α,
TGF-β and PDGF immediately following isolation from the peritoneal cavity ................. 51
viii
Figure 3.5.10: Ddr1-/-
macrophages produced increased levels of mRNA for MCP1, MCSF,
PDGF and decreased TGF-β after 3 days in culture with type I collagen ......................... 52
Figure 3.5.11: Ddr1-/-
macrophages produced increased levels of mRNA for inflammatory
cytokines after 7 days in culture with type I collagen ...................................................... 53
Figure 3.5.12: Ddr1-/-
macrophages produced decreased amounts of MCP-1, MCSF and
PDGF when cultured for 3 days on type IV collagen ........................................................ 54
Figure 3.5.13: Ddr1-/-
macrophages produced increased amounts of TGF-β and PDGF
when cultured for 3 days on fibronectin .......................................................................... 55
Figure 3.5.14: Ddr1-/-
macrophages produce decreased levels of MCP-1 on type I and
type IV collagen and fibronectin ....................................................................................... 56
Figure 3.5.15: Ddr1-/-
macrophages produce decreased levels of TGF-β on collagen and
increased TGF-β on fibronectin. ....................................................................................... 57
Figure 6.1.5.1: There is no difference in macrophage recruitment to the peritoneal cavity
1 day after thioglycollate injection ................................................................................... 79
Figure 6.2.4.1 The C-20 Santa Cruz DDR1 antibody is not specific for DDR1 .................. 83
ix
List of abbreviations and acronyms
APOE apolipoprotein E
ARP1 acidic ribosomal protein 1
BrdU bromodeoxyuridine
Cdc42 cell division cycle protein 42
DAPI 4',6-diamidino-2-phenylindole
DARPP-32 dopamine & cyclic AMP regulated phosphoprotein
DC dendritic cell
DDR discoidin domain receptor
ECM extracellular matrix
EC endothelial cells
EDTA ethylenediaminotetracetic acid
ELISA enzyme-linked immunosorbent assay
EMT epithelial to mesenchymal transition
ERK1/2 extracellular regulated kinase 1 and 2
FAK focal adhesion kinase
FBS fetal bovine serum
FITC fluorescein-5-isothiocyanate
GAG glycosaminoglycan
HRP horseradish peroxidase
ICAM-1 intercellular adhesion molecule 1
IL-6 interleukin-6
JNK c-jun N-terminal kinase
LDL low-density lipoprotein
LDLR low-density lipoprotein receptor
Ly6-C lymphocyte antigen complex 6 loci C
MAPK mitogen-activated protein kinase
MCSF macrophage colony stimulating factor
MCP-1 monocyte chemotactic protein 1
x
MMP matrix metalloprotease
NF-κB nuclear factor kappa B
oxLDL oxidized low-density lipoprotein
PBS phosphate-buffered saline
PCR polymerase chain reaction
PDGF platelet-derived growth factor
PDMS Polydimethylsiloxane
PECAM-1 platelet-endothelial cell adhesion molecule 1
PFA paraformaldehyde
PG proteoglycan
PI3K phosphitidylinositol 3 kinase
PS penicillin/streptomycin
Pyk2 proline-rich tyrosine kinase 2
RT-PCR real time – polymerase chain reaction
SDS sodium dodecyl sulfate
Shc-A Src homology 2 domain-containing protein A
SHP-2 Src homology 2 domain-containing tyrosine phosphatase
SMC smooth muscle cell
STAT signal transducer and activator of transcription
TGF-β transforming growth factor beta
TIMP tissue inhibitor of metalloprotease
TNF-α tumor necrosis factor alpha
VCAM-1 vascular cell adhesion molecule 1
VE-Cadherin vascular endothelial cell cadherin
VEGFR2 vascular endothelial cell growth factor receptor 2
Wnt wingless-related MMTV integration site
1
Chapter 1:
1 Literature Review
2
1.1 Introduction
The atherosclerotic plaque is a rich milieu of different cell types and extracellular
matrix (ECM) proteins that interact with each other to form a complex lesion. The ability
of cells to respond to changes in the extracellular environment, particularly to changes
in matrix composition, controls the development of the plaque. Cells are able to
respond to changes in their extracellular matrix environment though the action of
receptors like integrins and discoidin domain receptors. Over the course of this review,
the initiation and progression of atherosclerosis will be discussed, along with a review of
the major ECM proteins that are abundantly synthesized in the plaque. Next we will
review the two major classes of collagen receptors – Integrins and Discoidin Domain
Receptors (DDR’s), followed by a more in-depth look at what is known about Discoidin
Domain Receptor 1 (DDR1).
1.2 Atherosclerosis
1.2.1 Introduction
Atherosclerosis is an inflammatory disease of the vasculature. It usually affects
medium to large size arteries and can lead to several important human vascular
disorders, including coronary artery disease, cerebrovascular disease and diseases of the
peripheral arterial circulation (Ross, 1999). The underlying pathology of atherosclerosis,
described visually in figure 1.9.1, is the formation of a large neointimal lesion or plaque
that can eventually cause stenosis of the artery lumen, cause thrombosis, and impair
the ability of the vessel to respond to hemodynamic stresses. The mature plaque exists
in the arterial intima as a thickened protrusion of the intima into the lumen. Inside is a
core of lipid material known as the necrotic core, surrounded by lipid-laden
macrophages and smooth muscle cells (SMCs). The plaque itself is rich in oxidized lipid,
3
large amounts of cytokines and secreted growth factors and also contains abundant
amounts of extracellular matrix in the form of glycoproteins, fibronectin and collagens.
1.2.2 Initiation of atherosclerosis
The initiation of atherosclerosis usually begins in lesion-prone or ‘atheroprone’
areas of the vasculature like bifurcation sites, branch points and convex areas of
bending arteries where shear stresses are low or variable (Giddens et al., 1993). One
possible reason for this is the existence of a mechanosensory complex on endothelial
cells (ECs). On the luminal surface of blood vessels ECs form a trimolecular complex of
platelet-endothelial cell adhesion molecule 1 (PECAM1), vascular endothelial cell
cadherin (VE cadherin) and vascular endothelial cell growth factor receptor 2 (VEGFR2).
PECAM1 acts as the transmitter of mechanical force, VE cadherin serves as an adaptor
molecule, while VEGFR2, independent of its ligand, causes the activation of the
phosphotidylinositol 3 kinase (PI3K) pathway, causing integrin activation and
subsequent activation of nuclear factor kappa B (NF-κB) leading to inflammatory
pathway activation (Tzima et al., 2005).
In these atheroprone areas, the basement membrane of ECs is also modified –
under high flow; normal basement membrane is made up of a protein network
comprised mainly of type IV collagen and vascular laminins (laminin-8 and laminin-10),
connected by interactions with molecules like the heparin sulphate proteoglycan
perlecan (Costell, 1999). ECs under low or variable shear produce fibronectin and
fibrinogen in their basement membrane – integrin activation and binding to the
fibronectin further induces the activation of the NF-κB pathway in ECs (Orr et al., 2005),
downstream targets of which include multiple cytokines including monocyte
chemoattractant protein 1 ( MCP-1) and adhesion molecules like vascular cell adhesion
molecule 1 (VCAM1) and E-selectin (Collins et al., 1993) which together mediate
recruitment of leukocytes necessary for lesion formation. ‘Activated’ endothelium under
4
low shear also has increased cellular turnover and impaired alignment - this is thought
to be responsible for enhanced permeability (Hahn and Schwartz, 2008). This allows for
the infiltration of lipid in the form of low density lipoprotein (LDL) particles through the
endothelium into the subendothelial space (Iiyama et al., 1999), where it is sequestered
from plasma antioxidants and can undergo oxidative modifications. Thus, oxidized LDL
(ox-LDL) is formed in the subendothelial space. Oxidation also better enables the LDL to
remain associated with the artery wall through interacting with the ECM and in
particular the proteoglycans present in the intimal area (Hurt et al., 1990). These lipid
deposits form the initial lesions of atherosclerosis, called ‘fatty streaks’ because of their
gross morphological appearance.
The next stage in plaque development is the recruitment of circulating
monocytes into the fatty streak area – adhesion molecules like P-selectin and E-selectin
mediate initial ‘rolling’ of leukocytes along the endothelium by interacting with
glycosylated ligands on the monocyte surface (Berliner et al., 1990). Leukocyte rolling on
the endothelium allows for integrin activation, after which adhesion molecules like
intercellular adhesion molecule 1/2 and VCAM1 allow for the rapid arrest of rolling and
the diapedesis of monocytes / macrophages into the subendothelial space (Ley et al.,
2007). Activated ECs also secrete cytokines like MCP-1 which help to recruit
inflammatory cells to the fatty streak area (Gu et al., 1998). Once in the intimal area,
recruited monocytes can differentiate into macrophages through the action of
macrophage colony stimulating factor (MCSF) (Becker et al., 1987). In the initial stages
of atherosclerosis, the infiltration of macrophages plays a key role in plaque
development and it is known that the expression of cytokines plays a significant role –
lack of MCSF or MCP-1 in mouse models of atherosclerosis both resulted in significantly
attenuated plaque development, with reduced levels of macrophage accumulation to
the plaque area (Qiao et al., 1997; Gu et al., 1998).
More recently, reports have also implicated resident intimal dendritic cells (DCs),
present in atherosclerosis prone regions in the vasculature, as the initiators of
5
atherosclerosis. These cells can engulf lipid and contribute to the initial fatty streak,
characteristic as the initiating step in complex plaque development (Paulson et al.,
2010).
1.2.3 Progression
Activated macrophages now present in the intima can internalize and
accumulate ox-LDL via their scavenger receptors, forming large intracellular lipid filled
vesicles that cannot be broken down. The macrophages thus develop into characteristic
‘foam cells’ with accumulated lipid droplets (Gerrity, 1981). Foam cells can then secrete
large amounts of cytokines and growth factors which stimulate the migration of SMCs
from the medial layer of the artery into the intima, where they switch from a quiescent
phenotype characteristic in the uninjured vessel wall to a more synthetic phenotype
(Ross, 1993). Apart from the secreted factors, ox-LDL by itself is a known chemotactic
factor for SMCs (Autio et al., 1990) and also enhances proliferation (Augé et al.,
1995).These ‘synthetic’ SMCs secrete a matrix rich in elastin, various proteoglycans and
fibrillar collagens (particularly types I and III) which form a fibrous cap over the lesion
area and stabilize the plaque (Ross, 1999). Foam cells can also undergo apoptosis to
form extracellular deposits of lipid material, known as the lipid or necrotic core, which in
turn causes the recruitment of increasing numbers of inflammatory cells and SMCs in
what is a cyclical process (Seimon and Tabas, 2009).
The atherosclerotic lesion thus formed has a characteristic lipid / necrotic core
overlain by a fibrous cap of matrix proteins (mainly fibrillar collagens), with neo-intimal
SMC proliferation and continuing inflammatory cell recruitment that drives an increase
in lesion size. Thus macrophages play a vital role in the initiation and progression of
atherosclerosis.
6
1.3 Extracellular matrix in atherosclerosis
Apart from cellular recruitment to the developing plaque, a large part of lesion
volume is accounted for by the elaboration of extracellular matrix components in the
plaque, mainly through the action of synthetic SMCs. There is a continuing process of
matrix synthesis and degradation and the balance between these processes plays an
important role in influencing plaque development, particularly with regard to plaque
stability. Generally, the more organized the ECM in a plaque, particularly in the fibrous
cap, the more stable the lesion (Loree et al., 1992). There are two main classes of ECM
macromolecules that make up matrix – proteoglycans, which are polysaccharide chains
linked to protein, and fibrous proteins including the collagens, elastin, fibronectin and
laminin. Below is a short overview of the major ECM components found in the plaque.
1.3.1 Proteoglycans
Proteoglycans are made up of core proteins covalently linked to
glycoaminoglycans (GAGs) which are unbranched polysaccharide chains made up of a
repeating series of disaccharide units. Because of the sulphate or carboxyl groups on the
sugars, GAGs are highly negatively charged and highly hydrophillic, a property that
allows proteoglycans to occupy larger amounts of volume in the extracellular space
(Hardingham and Fosang, 1992). This highly negative charge also allows for the
association with and retention of ox-LDL in the plaque (Hurt et al., 1990). Proteoglycans
can also bind secreted signaling molecules like growth factors, proteases and protease
inhibitors and enhance or inhibit their activity (Evanko et al., 1998). Some proteoglycans
found in the plaque include chondroitin sulphates like verscian, dermatan sulphates like
decorin, and heparin sulphates like perlecan, which is an important component of the
vascular endothelial basement membrane (Evanko et al., 1998).
7
1.3.2 Fibronectin – an adhesive glycoprotein
Glycoproteins are made up of oligosaccharide chains (glycans) covalently
attached to a polypeptide side-chain. They can be important integral membrane
proteins. Glycoproteins can also be adhesive molecules – laminin, vitronectin and
fibronectin are all found in the atherosclerotic plaque.
Fibronectin is a large dimeric glycoprotein composed of two large subunits linked
at one end by disulphide bonding. There are several different forms of fibronectin, all
encoded by a single large gene containing 50 exons. Transcription produces a single
large molecule that can be alternatively spliced to produce different fibronectin
isoforms. The major repeating unit, called the type III fibronectin repeat, binds to
integrins. There is a specific tripeptide sequence – arginine- glycine- aspartic acid or RGD
which forms the central binding site. Excluding soluble plasma fibronectin, all other
forms assemble on the cell surface and are deposited in the ECM as fibronectin fibrils,
where fibronectin dimers are further cross linked by disulphide bonds to form the fibril
structure (Potts, 1994). Fibrils can only form on the surface of certain cells because of
the need of fibronectin binding integrins for assembly – tension exerted by the cell is
essential for fibril formation: stretching the fibrils allows for the exposure of cryptic
binding sites on these molecules that allow them to bind to each other (Hocking et al.,
1994).
In atherosclerosis, fibronectin is expressed at many stages in progression. Even
before initial stages, ‘activated’ endothelium modifies its basement membrane by
adding a fibronectin layer, which makes the endothelium more permissive to
atherosclerotic development (Orr et al., 2005). During the development of the plaque,
there is marked and sustained up regulation of fibronectin expression, often colocalized
with type III collagen (Shekhonin et al., 1987). Fibronectin is also known to promote the
synthetic phenotype of SMCs in the plaque, thus causing further matrix elaboration
(Hedin et al., 1989).
8
1.3.3 Collagens
Collagens are the major component of connective tissue and are the most
abundant protein found in mammals. They are mostly found in fibrous tissues like
tendons, ligaments and skin as well as being abundant in cartilage, cornea, bone and in
blood vessels. In the plaque, collagens are highly abundant and comprise up to 60% of
plaque area (Smith, 1965).
Collagen is a triple helical molecule made up of three alpha chains. Each chain is
about 1000 amino acids long and arranged as a left-handed helix, with 3 amino acids a
turn. Glycine is usually the third amino acid, and hence the sequence is often referred to
as Gly-X-Y where X is often proline and Y is hydroxyproline. Pro-alpha chains formed
within the cell associate to form a hydrogen-bonded triple helix called procollagen. After
secretion, through the action of proteolytic enzymes, procollagen is converted into
collagen molecules which self-assemble into fibrils. There are different types of
collagens. Types I, II, III, V and XI are the fibrillar collagens, so called because after being
secreted into the extracellular space, these helices assemble into collagen fibrils, which
can then aggregate into collagen fibers. Collagen types IX and XII are fibril-associated
collagens as they facilitate fibrillar collagen association and link to the other ECM
components. Type IV collagen is a network-forming collagen – it assembles into a mesh
that forms a major part of the basement membrane in the vasculature. It has a more
flexible structure than fibrillar collagen because the triple helix is interrupted, allowing
for multiple bends, allowing assembly into a flexible sheet-like network. (Gelse et al.,
2003)
During plaque development the expression of collagens is highly variable. In
early lesions (fatty streaks) there is very little collagen production while advanced
lesions are often called fibrous lesions because of the accumulation of large depositions
of collagens, particularly fibrillar collagens types I and III present in the fibrous cap, but
also of types IV and V (Shekhonin et al., 1987).
9
The presence of collagens in the native vessel wall can cause activation of
macrophages during the early stages of lesion development. Type I collagen stimulates
the differentiation of monocytes into macrophages, and also increases the ability of
macrophages to take up lipid, as well as increasing the lipid load the individual cell is
capable of carrying (Wesley et al., 1998). Adhesion to collagen can also increase
phagocytotic uptake of LDL, as well as the production of matrix degrading enzymes like
matrix metalloproteinases (MMPs), which allow the macrophages and SMCs that
produce them to remodel the matrix they are imbedded in (Wesley et al., 1998).
Collagen degradation, particularly type I and type III degradation is also important to
plaque stability- high risk or rupture-prone plaques are characterized by a large lipid /
necrotic core under a thin fibrous cap, usually with high macrophage content,
particularly in the shoulder region on the plaques (Loree et al., 1992). The proteolytic
activity of macrophages in the plaque, particularly by the action of MMPs acting on
collagens causes the weakening and degradation of the fibrous cap, making it more
prone to rupture and hence thrombotic events (Galis et al., 1994).
1.4 Collagen Receptors
Being one of the most common proteins in the body, cellular interactions with
collagens are fittingly extremely diverse, and as expected, there are a number of
collagen receptors that regulate cellular interaction with collagens. In this review, I will
discuss two important types of collagen receptors – the integrin family of receptors and
the discoidin domain family of collagen receptors.
10
1.4.1 Integrins
The main receptors on animal cells for binding ECM are integrins. Integrins are a
family of transmembrane glycoproteins. They are heterodimeric, made up of non-
covalently associated α and β subunits. These receptors are adhesive in nature –they
have a large extracellular domain with which they interact with matrix proteins and a
short intracellular domain via which they link the matrix to the cell cytoskeleton via
cytoskeletal proteins. Different combinations of α and β subunits make up integrins with
different matrix molecule specificity – there are 9 beta subunits and 24 types of alpha
subunits. However, integrin selectivity has considerable overlap – many ECM proteins
such as fibronectin and type I collagen can be bound by more than one type of integrin
receptor – conversely many integrins can bind to more than one matrix type. (Hynes,
1992)
The binding of integrins to ligand also depends on the availability of extracellular
divalent cations – there are divalent cation-binding domains in the extracellular regions
of the α and β subunits, affecting the affinity and specificity of ligand binding (Hynes,
1992). Some common integrin ligands and their receptors are α5β1 for fibronectin, α2β1
for type I collagen and α1β1 for type IV collagen.
Integrins bind their ligands with low affinity – adhesion strength is controlled by
clustering of integrins. Integrins are connected to actin filament bundles – after ligand
binding, the cytoplasmic domains of the receptor bind several intracellular proteins like
talin and filamin which can then bind directly to actin or other anchor proteins linking
the integrin receptor to the cytoskeleton (Danen and Sonnenberg, 2003). This linking
can lead to a clustering of integrins causing the formation of focal adhesions in the cell,
thus mediating cell-matrix adhesion. Integrins also activate a variety of downstream
signaling pathways – during clustering, a tyrosine kinase protein Focal Adhesion Kinase
(FAK) is recruited by the integrin receptor. The FAK molecules cross-phosphorylate each
other creating docking sites for Src, which continue to phosphorylate FAK and other
recruited signaling proteins (Danen and Sonnenberg, 2003)
11
1.4.2 Discoidin Domain receptors
Discoidin domain receptors (DDRs) are a class of collagen-binding receptor
tyrosine kinases that contain an extracellular domain homologous to the Discoidin 1
protein of the slime mould Dictyostelium discoideum (Vogel et al., 1997). In mammals
there are 2 known genes encoding DDRs – Ddr1 and Ddr2. Ddr2 encodes a single gene
product, while Ddr1 in humans can produce 5 different isoforms (Alves et al., 2001). The
general structure of the protein includes an N-terminal discoidin domain, a stalk region,
a transmembrane domain, a juxtamembrane domain and a C-terminal catalytic kinase
domain (Figure 1.9.2). DDR1 and DDR2 exhibit different specificity in their collagen
binding ability – DDR1 has been shown to bind to collagen types I – V and VIII, while
DDR2 can bind to collagen types I, II, III and X (Vogel et al., 1997; Hou et al., 2001;
Leitinger and Kwan, 2006). Collagen binding has been shown to trigger activation of the
kinase domain and further downstream signaling events (Vogel et al., 1997). The focus
of this thesis is the effect of the deletion of Ddr1 on macrophages and a more complete
review of Ddr1 is presented in the following section.
1.5 Discoidin Domain Receptor 1
1.5.1 Structure
The Ddr1 gene is located on human chromosome 6 and mouse chromosome 17
(Valent et al., 1996; Perez et al., 1994). There are 5 known isoforms of DDR1 produced
via alternative splicing, described in figure 1.9.2 – DDR1d and e are kinase dead due to
lack of the kinase domain in DDR1d and the lack of the ATP binding site in DDR1e (Alves
et al., 2001). DDR1 a is the shortest functional isoform at 876 amino acids – DDR1b and c
have a 37 amino acid insertion in the juxtamembrane region, while DDR1c at 919 amino
acids has an additional 6 amino acid insertion in the kinase domain (Alves et al., 2001).
Dimerization of the DDR1 receptor is known to be essential for collagen binding
12
(Leitinger, 2003) and distinct from other tyrosine kinase receptors, dimerization occurs
prior to localization of the protein to the cell surface (Noordeen et al., 2006)
Dimerization is facilitated by disulphide bridges in the stalk regions or a leucine zipper
motif in the transmembrane domain (Noordeen et al., 2006; Abdulhussein et al., 2008).
The stalk region is known to be essential for receptor activation and may depend on
glycosylation (Curat et al., 2001). The exact crystallized structure of DDR1 has not yet
been resolved - models predict an 8-stranded beta barrel stabilized by disulphide
bridging similar to the structure of DDR2 (Ichikawa et al., 2007). The exact collagen
binding sequence of DDR1 has also not been determined to date, though for the DDR2
receptor, collagen recognition was independent of the integrin collagen recognition
sequence (Konitsiotis et al., 2008).
1.5.2 Regulation and Signaling
Not much is known about the transcriptional control of DDR1 expression.
Previous work has shown that culture of cells in the presence of serum is sufficient to up
regulate the expression of DDR1 (Kamohara et al., 2001). Also, treatment with
inflammatory cytokines such as tumor necrosis factor α (TNFα), interleukin 1α and MCSF
all increased the level of DDR1 expression (Kamohara et al., 2001) . DDR1 expression has
also been linked to the DNA-binding protein p53, and a feed-forward mechanism
whereby DDR1 signaling through the mitogen-activated protein kinase (MAPK) pathway
causes an up regulation of p53 has been proposed (Ongusaha et al., 2003). DDR1 is
different from most receptor tyrosine kinases (RTKs) in terms of its unusual signaling
kinetics. While most RTKs are activated within seconds to minutes after ligand binding,
DDR1 activation peaked 90 – 120 minutes after DDR1 stimulation with collagen in 293T
fibroblast cells, and activation was maintained for up to 18 hours post-stimulation
(Vogel et al., 1997). Phosphorylation of DDR1 has also been shown to be anchorage
dependent, where cells grown in suspension are activated more rapidly than cells
adherent to collagen (L'hote et al., 2001). The authors of this work point to the action of
13
phosphatases on DDR1 in the adherent state as being responsible for the delay in
activation – robust DDR1 phosphorylation even in the absence of collagen was observed
in cells treated with a phosphatase inhibitor, suggesting a mechanism of regulation
whereby DDR1 is activated in the unstimulated condition, but signaling is kept in check
by the action of phosphatases until the binding to collagen inhibits phosphatase action
on DDR1.
Much of the work with DDR1 has focused on elucidating downstream signaling
pathways. One of the first proteins identified to be involved in DDR1 signalling was the
Src homology 2 domain-containing protein A (Shc-A) adaptor protein in 293T cells (Vogel
et al., 1997), which was later confirmed in a human monocytic leukemic cell line (THP-1
cells), where binding of the Shc-A protein was implicated in the downstream activation
of NF-κB and p38α signaling pathways (Matsuyama et al., 2003, 2004). A complicating
factor in these studies has been the apparent isoform-specific downstream signaling
involving DDR1: activation of the different isoforms produces different responses in
THP-1 cells (Kamohara et al., 2001). One possible reason for this is that the 37 amino
acid insertion in DDR1b contains a Shc-A binding domain. DDR1 activation in human
macrophages causes the up-regulation of interleukin 8, macrophage migration
inhibitory factor-1-alpha (MIF α) and MCP-1 in a p38, NF-κB-dependent manner. p38
activation is dependent on the recruitment of the Shc-A adaptor protein to DDR1 again
suggesting that DDR1a cannot mediate this effect (Matsuyama et al., 2004). In
mammary epithelial cells, signaling through Wnt activated DDR1 via G protein-coupled
receptors and DDR1 signaling promoted adhesion to collagen as well as a reduction in
migration through the action of PI3K (Jonsson and Andersson, 2001; Dejmek et al.,
2003). More recent work has pinpointed the tyrosine kinase Src as being an essential
regulator of DDR1-controlled smooth muscle cell migration (Lu et al. in press).
DDR1 has also been shown to modulate integrin signaling pathways in the cell,
both cooperatively and antagonistically. DDR1 inhibits phosphorylation of signal
transducers and activators of transcription (STAT 1/3) and hence cell migration, acting
14
antagonistically to the α2β1 receptor. When cells are plated on type I collagen, a docking
sequence on unactivated DDR1 allows SHP2 - the src homology 2 domain-containing
phosphotyrosine phosphatase - to be sequestered in the inactive state. Upon ligand
binding, DDR1 activation activates SHP2, allowing it to act on STAT 1/3 (which has been
activated by integrin signaling) and inactivate it (Wang et al., 2006). More recently, it
has been demonstrated that α2β1 integrin signaling and DDR1 signaling, acting through
separate pathways, both converge to up regulate the cell-cell adhesion molecule N
cadherin. FAK downstream of integrins and FAK-related protein tyrosine kinase (Pyk2)
downstream of DDR1 together signal through the c-jun N-terminal kinase (JNK) to
upregulate N-cadherin causing epithelial to meschenchymal transformation in
pancreatic epithelial tumor cells (Shintani et al., 2008). In kidney epithelial cells, when
cultured on type I collagen, DDR1 inhibited the small G protein cell division cycle protein
42 (Cdc42) and hence inhibited cell spreading, acting in opposition to the α2β1 receptor
which activates Cdc42 by the action of FAK (Yeh et al., 2009).
Some scaffolding and adaptor proteins involved in DDR1 signaling have also been
identified. Apart from Shc-A, mentioned above, DDR1 interacts with p130Cas (Shintani
et al., 2008), dopamine and cAMP-regulated neuronal phosphoprotein (DARPP-32)
(Hansen et al., 2006) and KIBRA (Hilton et al., 2008). While Shc-A and p130Cas associate
with DDR1 only upon collagen stimulation, DARPP-32 and KIBRA are found to be basally
associated with unactivated DDR1 and are released upon stimulation with collagen.
Activation of DDR1 releases the scaffold proteins, freeing them to participate in the
upregulation of MAPK activation with KIBRA (Hilton et al., 2008) or to inhibit cell
migration, as is the case with DARPP-32 (Hansen et al., 2006). These are all examples of
how unstimulated DDR1, through the sequestering of scaffolding proteins, can affect
other signaling pathways.
15
1.5.3 Functions
The DDR1 receptor has been shown to mediate cell adhesion – DDR1-deficient
smooth muscles and mesanglial cells adhered significantly less to type I collagen when
compared to wild type cells (Hou et al., 2001; Curat and Vogel, 2002). In the THP-1
monocytic leukemic cell line, overexpression of DDR1a or DDR1b enhanced adhesion to
collagen– blocking integrins in these cells did not affect the ability of DDR1 to promote
adherence to collagen, and adhesion was also shown to require active downstream
signaling (Kamohara et al., 2001). DDR1 in mammary epithelial cells, downstream of the
Wnt signaling pathway caused increased adhesion and decreased migration (Jonsson
and Andersson, 2001).
DDR1 has been shown to play an essential role in cell migration. Overexpression
of DDR1a in THP-1 cells resulted in the enhanced ability to invade 3-D collagen gels
(Kamohara et al., 2001). One of the phenotypes of Ddr1-/-
mice is aberrant mammary
gland development, where mammary epithelial cells fail to invade the fat pad (Vogel et
al., 2001). In kidney epithelial cells, DDR1 inhibits cell migration, acting antagonistically
to the migration signaling of the integrin receptors (Wang et al., 2006). DDR1 has
recently been shown to interact with the non-muscle myosin IIA heavy chain, and this
interaction is dependent on the kinase domain – DDR1 was important in inhibiting cell
spreading and promoting cell migration in fibroblasts (Huang et al., 2009).
DDR1 is also known to have effects on cell proliferation: DDR1-deficient
mammary epithelial cells (Vogel et al., 2001) and mesanglial cells (Curat and Vogel,
2002) exhibited increased proliferation compared to wild type controls and DDR1
overexpressing kidney epithelial cells had attenuated proliferation compared to wild
type cells (Wang et al., 2005) – these results point to a role for DDR1 in inhibiting
proliferation. DDR1 can also affect cell differentiation – in mouse myoblasts, DDR1
inhibition reduces cell differentiation (Curat and Vogel, 2002) and in mesenchymal stem
cells, DDR1 inhibition in a 3D collagen gel inhibited osteogenic differention (Lund et al.,
16
2009). DDR1 is also thought to be anti-apoptotic – Ongusaha et al. in 2003 showed that
DDR1 expression protected against p53 mediated apoptosis in osteosarcoma cells and
Wang et al. in 2005 demonstrated that kidney epithelial cells expressing a dominant
negative form of DDR1 experienced increased rates of apoptosis when plated on type I
collagen.
DDR1 is also thought to play an important role in inflammation: activation of
DDR1 in human macrophages causes the upregulation of interleukin 8, MIF α and MCP1
in a p38, NFkB-dependent manner (Matsuyama et al., 2004). NFkB is also known to be
an important transcription factor controlling the expression of many cytokines and
growth factors (Blackwell and Christman, 1997). Other work with DDR1 in renal disease
suggests that the absence of DDR1 reduced leukocyte recruitment as well as reduced
LPS-induced MCP-1 expression (Flamant et al., 2006), and work with DDR1 knockouts in
a model of lung fibrosis suggested that deletion of DDR1 reduced inflammatory cell
recruitment as well as decreased the expression of inflammatory cytokines like MCP-1
and IL-6 (Avivi-Green et al., 2006).
Relevant to atherosclerosis, the process of matrix remodelling is essential to the
process of invasion and cell migration. One important class of matrix-degrading enzymes
produced by cells are the MMPs – DDR1-deficient smooth muscle cells have been shown
to have reduced levels of MMP 2 and 9 (Hou et al., 2001; Bendeck et al., 2004), while
DDR1-deficient macrophages express reduced levels of MMPs 2, 9 and 14 (Franco et al.,
2008).
DDR1 also undergoes receptor shedding after collagen stimulation (Vogel, 2002).
Cleavage occurs in the extracellular region causing the formation of a shed ectodomain
and leaving part of the receptor in the cell surface – the exact function of these shed
domains has yet to be determined. The cleaved receptors on the cell surfaces were
shown to remain active up to 4 days following stimulation suggesting continual receptor
17
signaling (Vogel, 2002). Shedding is known to be Src-kinase dependent and possibly due
to the action of MMPs (Slack et al., 2006).
From this review it is apparent that the long term activation of DDR1 and the
extensive signaling pathways that it activates indicate an important and essential role
for the DDR1 receptor in the responses of cells to extracellular matrix cues under both
normal and diseased conditions.
1.5.4 Role in atherosclerosis
DDR1 has been identified on both macrophages (Kamohara et al., 2001) and
smooth muscle cells (Hou et al., 2001), both cells types are essential and major
components of the atherosclerotic plaque. DDR1 protein has also been found in the
plaques of non human primates (Ferri et al., 2004). Studies have shown that DDR1 is up
regulated during inflammation – DDR1 can regulate dendritic cell antigen presentation
(Matsuyama et al., 2003) as well as nitric oxide production (Kim et al., 2007) and MMP
expression (Franco et al., 2008). In macrophages, DDR1 has been implicated as being
important for adhesion to type I collagen, a matrix molecule highly up =regulated in the
plaque (Kamohara et al., 2001). DDR1-deficient smooth muscle cells have reduced
migration and proliferation rates – both important behaviours in the development of
atherosclerosis (Hou et al., 2001). Previous work in our lab with a Ddr1-/-
; Ldlr-/-
mouse
model demonstrated that DDR1-deficient animals have reduced plaque burden with
smaller overall lesion area (Franco et al., 2008). This points to a significant role for DDR1
in the development of atherosclerosis - more detailed results of the DDR1 systemic
knockout atherosclerosis studies are presented in section 1.7.
18
1.6 Major Mouse models of atherosclerosis
There are two main mouse models of atherosclerosis currently in widespread
use – the apolipoprotein E (Apo E)-deficient mouse model and the low density
lipoprotein receptor (LDLR) deficient mouse model. These mice develop lesions similar
to human plaques with similar areas of predisposition in the vasculature, thus providing
an efficient way of monitoring the development of atherosclerosis in a mammalian
model.
1.6.1 The Apolipoprotein E deficient mouse model
Apolipoprotein E is a class of apolipoprotein found in chylomicrons, very low
density lipoproteins and intermediate density lipoproteins. ApoE can bind to specific
receptors on liver and peripheral cells including the low density lipoprotein receptor
(LDLR) which helps clear ApoE lipoproteins from the circulation (Brown and Goldstein,
1986). Developed by (Zhang et al., 1992), ApoE-deficient mice are spontaneously
hypercholesterolemic, leading to the formation of atherosclerosis. However, since
hypercholesterolemia is spontaneous, there is no control over the initiation of plaque
development
1.6.2 The Low Density Lipoprotein Receptor deficient mouse model
The LDLR is a receptor for ApoE-expressing lipoproteins and ApoB100-expressing
lipoproteins, which aids in the clearance of these lipoproteins from the circulation. The
LDLR mouse model was developed by Ishibashi et al (1993). LDLR -/-
mice on a regular
chow diet developed only a 2-fold increase in plasma cholesterol levels and did not
develop lesions, while APOE-/-
mice develop hypercholesterolemia and lesions on a
regular chow diet. This makes it possible to pinpoint the start of lesion development in
19
the LDLR knockouts, but not in APOE-deficient mice. Using this mouse model thus allows
for the control of the onset of plaque formation as well as the ability to analyze the early
development of atherosclerosis.
1.7 Rationale
Our lab has characterized the development of atherosclerotic lesions in a DDR1-
deficient animal model using the Ldlr-/-
mouse model of atherosclerosis – where, as
previously discussed in section 1.1.5.2, the absence of the LDL receptor allows for an
animal model in which atherosclerosis is inducible by feeding a high fat diet. By crossing
Ddr1-/-
mice with an Ldlr-/-
strain, the lab has established lines of mice that are either
Ddr1+/+
; Ldlr-/-
or Ddr1-/-
; Ldlr-/-
on a mixed C57Bl6 / SV129 background.
When these mice were fed a high fat diet, Ddr1-/-
; Ldlr-/-
mice developed smaller
plaques, with a reduced proportion of macrophages but the same proportion of smooth
muscle cells and increased matrix deposition when compared to Ddr1+/+
; Ldlr-/-
mice
(Franco et al., 2008). With this observation as the stimulus, bone marrow transplant
experiments were carried out in order to understand the contribution of DDR1
expressed on bone marrow derived cells to the development of atherosclerosis. Ddr1-/-
;
Ldlr-/-
bone marrow was transplanted into Ddr1+/+
; Ldlr-/-
mice (Ddr1-/-
→+/+
: bone
marrow deletion group). These mice now had the Ddr1 deletion only in bone marrow-
derived cells, including macrophages, whereas the vessel wall cells, including smooth
muscle cells remained Ddr1+/+
. Compared with control transplants of Ddr1+/+
; Ldlr-/-
marrow into Ddr1+/+
; Ldlr-/-
animals (Ddr1+/+
→+/+
: control group), the Ddr1-/-
→+/+
transplant animals had significantly smaller lesions with fewer macrophages and no
change in matrix accumulation (Franco et al., 2009). The reciprocal experiment was also
performed where Ddr1+/+
; Ldlr-/-
bone marrow was transplanted into Ddr1-/-
; Ldlr-/-
mice
(Ddr1+/+
→-/-
: vessel wall deletion group).These mice now had the Ddr1 deletion in vessel
wall cells, while macrophages remained Ddr1 replete. Compared with control
20
transplants of Ddr1+/+
; Ldlr-/-
marrow into Ddr1+/+
; Ldlr-/-
animals (Ddr1+/+
→+/+
: control
group), the Ddr1+/+
→-/-
transplant animals had significantly larger plaques with
pronounced increases in matrix accumulation. A model was proposed where deletion of
DDR1 on macrophages caused decreased infiltration into the plaque and deletion of
DDR1 on smooth muscle cells promoted migration and synthesis of matrix by SMCs.
Our lab has also measured the early recruitment of monocytes to the plaque in
Ldlr-/-
mice. Bromodeoxyuridine (BrdU) is a synthetic thymine analog and is used to
detect proliferating cells in tissue – BrdU is incorporated into DNA during replication,
and can be detected using immunostaining. A single pulse injection of BrdU into Ddr1+/+
;
Ldlr-/-
and Ddr1-/-
; Ldlr-/-
mice that had been fat fed for two weeks was used to label
proliferating cells. Mice were sacrificed at 2 hours after injection to measure baseline
proliferation rate in the plaque, or at 24 hours to measure the number of bone marrow-
derived cells recruited into the plaque. Ddr1-/-
; Ldlr-/-
mice had significantly fewer BrdU-
positive cells accumulated in the plaque 24 hours after labeling (Franco et al., 2009).
Taken together, this data suggests that macrophage behavior in atherosclerosis
was altered in the absence of DDR1 receptor, resulting in the reduced accumulation of
macrophages in the atherosclerotic plaque. In our investigation, we focus on two
macrophage behaviors particularly important in the development of atherosclerosis –
macrophage adhesion to matrix and macrophage cytokine production. Any perturbation
in either of these might be expected to significantly affect plaque development.
1.8 Hypotheses:
1. DDR1 mediates macrophage adhesion to matrix
In order to test this hypothesis, the adhesion of macrophages from Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
mice to type I collagen, type IV collagen and fibronectin were
tested to determine whether Ddr1-/-
; Ldlr-/-
macrophages were deficient in
21
adhesion to important matrix components found within the atherosclerotic
plaque.
2. DDR1 affects the ability of macrophages to produce cytokines and growth factors.
In order to test this hypothesis, macrophages from Ddr1+/+
; Ldlr-/-
and Ddr1-/-
;
Ldlr-/-
mice were stimulated with type I collagen, type IV collagen and fibronectin
and then assayed for differences in the production of cytokines known to be
involved in atherosclerosis.
22
1.9 Figures
23
Figure 1.9.1: The development of atherosclerosis.
A) Migrating smooth muscle cells from the medial layer. B) Foam cells. C) Necrotic core
D) Fibrous cap development E) Adhesion and migration of leukocytes into plaque area.
(Adapted from Ross,R. NEJM 1999)
24
Figure 1.9.2: Structure of DDR1
a) General structure of DDR1. b) isoforms of DDR1: DDR1b and DDR1c have an
additional 37 aa insertion in the juxtamembrane domain, DDR1c has a 6 aa insertion in
the tyrosine kinase domain. DDR1d lacks the kinase domain and DDR1e is kinase dead
due to the lack of an ATP-binding domain
a)
b)
25
Chapter 2:
2 Materials and methods
26
2.1 Generation of mice
Male DDR1-/-
mice on a C57Bl6 background (backcrossed at least 5 times, a
donation from Dr. Wolfgang Vogel) were crossed with female Ldlr-/-
mice that were also
on a C57Bl6 background (backcrossed greater than 10 times) to generate mice that
were Ddr1+/-
;Ldlr +/-
, with a combined genetic background that was >97% C57Bl6. These
heterozygous mice were then mated to produce mice that were Ddr1-/-
; Ldlr-/-
and
control mice that were Ddr1+/+
; Ldlr-/-
.
2.2 To obtain macrophages from the peritoneal cavity of mice
One ml of sterile 4% thioglycollate solution (Becton, Dickinson and Company:
Brewers modified thioglycollate) was injected into the peritoneal cavity of Ddr1+/+
; Ldlr-/-
or Ddr1-/-
; Ldlr-/-
mice. The 4% thioglycollate solution was aged for at least 3 months at
room temperature and protected from light, prior to the start of experiments. The
thioglycollate acts as a sterile irritant and elicits an immune response that recruits
macrophages from the circulation into the peritoneal cavity. Three - four days after
thioglycollate injection, mice were sacrificed by CO2 inhalation and the peritoneal cavity
was exposed by removing the abdominal skin. Using a 10 ml syringe with a 25 gauge
needle the peritoneal cavity was flushed forcefully with ice cold RPMI-1640, a type of
media used for the culture of lymphocytes. The force of the fluid helped detach cells
that were bound to the peritoneal wall and organs. Using the same syringe with a 23
gauge needle, as much fluid as possible was aspirated out. The fluid was centrifuged at
1500 rpm for 5 minutes and if the presence of red blood cells was detected, as
evidenced by a red streak or clump in the cell pellet, the cells were re-suspended in 5 ml
cold red blood cell lysis buffer for 5 minutes. Cells were then centrifuged again and
washed with 5 ml Hanks Balanced Salt Solution, following which they were re-
suspended in RPMI + 10% Fetal Bovine Serum (FBS) + 2% Penicillin-streptomycin (RPMI-
10%FBS-2%PS). Total cell number isolated was quantified using a haemocytometer after
27
staining a small aliquot of cell solution with a 1:1 volume of Trypan blue, following which
cells were immediately used for experiments, or plated on 10 cm tissue culture dishes at
a density of 6x106 cells per plate.
To determine the percentage of cells in the peritoneal lavage that were
macrophages, immunostaining for the Mac-2 macrophage antigen was carried out.
Peritoneal lavage cells were allowed to adhere to glass cover slips for 2 hours, following
which cover slips were washed in PBS and fixed for 10 minutes in 4 % PFA at room
temperature. After washing, cells were permeabilized with 0.1 % Triton-X in PBS and
then blocked for 30 minutes in 2% milk in PBS with normal goat serum (1:100. Vector,
Q1018). Cover slips were then incubated for 1 hour at room temperature with either
1:100 rat anti-mouse mac-2 (Cedar Lane Labs, CL8942AP) or normal rat IgG (1:1100.
Jackson Labs, 012-000-003) diluted in blocking solution. After this, cover slips were
incubated in Cy3 donkey anti-rat IgG (1:500 Jackson Labs, 712-165-153) in PBS with
1:1000 Hoechst 33258 at room temperature in the dark. After washing in PBS, cover
slips were air dried and mounted onto slides with Prolong Gold Antifade (Invitrogen, P-
7481). Cells were found to be greater than 95 % macrophages.
2.3 Static adhesion assays
For all experiments, substrate protein solution was prepared at the required
concentrations by dilution of stock solutions of type I collagen (PurCol bovine type I
collagen– 3 mg/ml), type IV collagen (Sigma – 1 mg/ml) and fibronectin (Sigma – 1
mg/ml) in sterile Phosphate buffered saline (PBS). Type I collagen was plated at 100 nM,
200 nM, 300 nM, 400 nM, 600 nM, 800 nM and 1000 nM, type IV collagen was plated at
100 nM, 200 nM, 300 nM, 400 Nm and 600 nM, and fibronectin was plated at 5nM, 10
nM, 15 Nm, 20 nM and 25 nM. 50 µl of each solution was added to wells in a 96 well
plate. Plates were incubated at 37° C, 5 % CO2 for 1 hour to coat wells and then used
immediately or left overnight at 4°C. The protein solution was then suctioned out and
28
wells were washed with 100 µl PBS solution per well. Harvested peritoneal macrophages
were counted using a haemocytometer, centrifuged at 1500 rpm fpr 5 minutes and the
cell pellet was resuspended in an appropriate volume of RPMI-10%FBS-2%PS, such that
100 µl of media contained 100,000 cells. 100 µl of RPMI-10%FBS-2%PS was added to
each well, after which 100 µl of cell suspension was added, such that 100,000 cells were
plated per well. Cells were incubated for 2 hours at 37° C, 5 % CO2. For experiments
where β1 integrin was blocked, cells were incubated in the 96 well plates with an anti
CD29 antibody (Becton, Dickinson and Company, 555002) as well as with a no antibody
control, a IgM antibody control (Biolegend, 401002) and an anti major
histocompatability complex type II antibody control (Ebiosciences, 14-5980), all at
concentrations of 20 µg/ml for 30 minutes. The time allowed for adhesion was shorter
in these experiments in order to measure adhesion at an earlier time point. After this,
wells were flooded with PBS to remove non-adherent cells. The PBS wash was repeated
and cells were then fixed by adding 100 µl of 4% paraformaldehyde (PFA) for 5 minutes.
PFA was aspirated out and 50 µl of 0.5% toluidine blue in PFA was added and left for 5
minutes to stain adherent cells. The plate was then washed twice with dH20 to remove
excess stain, and 100 µl of 1% SDS was added to lyse the cells, thus releasing the
toluidine blue. The plate was then read on a Molecular Devices Vmax kinetic microplate
reader for absorbance reading at 595 nm, where the absorbance was proportional to
the number of adherent cells. The experiments were performed in triplicate and
repeated three times. Comparisons were performed by Student’s t-test or one way
ANOVA using SigmaPlot 11.0. For t-test, data that did not fit a normal distribution were
analyzed by the non-parametric Mann-Whitney U test. For ANOVA, comparisons made
were between genotype or between antibody treatment, with group means compared
using the Holm-Sidak method.
29
2.4 Flow adhesion experiments
Microfluidic shear devices constructed from Polydimethylsiloxane (PDMS) and
glass were obtained from the lab of Dr. Craig Simmons – glass permitted attachment of
cells and protein, as well as ease of imaging, while the PDMS allowed for gas exchange
while the cells were being cultured. Devices were made using a modified protocol from
(Young et al., 2007) – channels were 500 µm wide x 100 µm high x 50,000 µm long. An
image of the device is pictured in Figure 2.7.1
Fluid was injected into the channels via inlet ports, using a 1 ml plastic syringe
with a 20 gauge needle. Channels were rinsed twice with 70% ethanol for 5 minutes
each time, then washed twice with PBS without calcium or magnesium for 5 minutes
each wash. 200 µl of Matrix protein solution was then loaded into the channels at the
desired concentration – 15 nM fibronectin, 500 nM type I collagen and 500 nM type IV
collagen and the matrix was allowed to coat channels for 30 minutes at room
temperature. The channels were then flushed clear using RPMI. 10 million peritoneal
lavage cells were incubated in a test tube with Hoechst dye (1:5000) in 10 ml of RPMI
for 30 minutes, after which cells were checked for fluorescence by imaging a small
aliquot of cells in a 96 well plate under a fluorescent microscope. Stained cells were
then washed with PBS and allowed to recover in RPMI-10%FBS-2%PS for 30 minutes at
37°C, following which they were resuspended in RPMI-10%FBS-2%PS at a seeding
density of 10 million cells /ml and then injected into the channels using a 1 ml plastic
syringe with a 20 gauge needle (about 200 µl cell solution /channel). Cells were then
allowed to adhere in the channels for 2 hours at 37°C. Following this, the channels were
connected to a syringe pump (Cole-Parmer® ten-syringe infusion/withdrawal pump EW-
74900-45) loaded with six 10 ml syringes filled with RPMI-10%FBS-2%PS and cells were
subjected to an initial shear of 1 dyne / cm2 for 3 minutes to remove non-adherent cells
and debris. Channels were then imaged at 3 different finite points along the length using
an Olympus IX71, under DAPI at 10x; image positions were selected based on etchings in
the glass made during the manufacturing of the devices, and cells were subjected to
30
increasing shear forces of 5, 10 and 100 dynes / cm2 for 3 minutes each time, with
channels being imaged at each interval after shear at the same 3 initial locations. The
total number of cells remaining in all three view fields after each shear ramp was
counted. The experiment was performed three times.
2.5 RT-PCR experiments
Harvested peritoneal lavage cells were either used immediately after isolation or
plated on 10 cm dishes that were uncoated or coated with 15 nM fibronectin or on 6 cm
dishes coated with 100 nM type IV collagen, at a seeding density of 4 million cells per 10
cm dish and 2 million cells per 6 cm dish. Cells were incubated for 2 hrs at 37° C, 5% CO2,
following which non-adherent cells were aspirated off, leaving macrophages adherent
on the plate. Adherent macrophages on uncoated plates were then stimulated with 50
ng/ml of soluble type I collagen. Cells were cultured for 3 days in 10 ml of RPMI-10%FBS-
2%PS 2 hrs at 37° C, 5% CO2. In addition, plates treated with soluble type I collagen were
cultured for 7 days.
At the appropriate time point (immediately after isolation, 3 days after isolation
or 7 days after isolation) RNA was harvested from cells using the Ambion RNeasy Midi
Kit and RNA quantity and quality were assessed using a spectrophotometer to read the
A260/A280 absorbance ratio. 1 μg of RNA was then treated with DNase 1 (Fermentas)
and used in a reverse transcription reaction (Invirtogen SuperScript II First-Strand
Synthesis System for RT-PCR) to obtain cDNA. cDNA obtained was diluted 1:2 in
DNase/RNase free water and subjected to real time quantitative PCR on an ABI Prism
7900HT sequence detection system (Applied Biosystems) and using primers listed in
Table 2.7.2. The final volume of each PCR reaction was 10 μl and contained the
indicated concentration of forward and reverse primer (Table 2.5.2) and 1X SYBR green
master mix reagent (Clontech).
The PCR reaction steps were: step 1: 10 minutes at 95 °C, step 2: cycle 40 times
at 95 °C for 15 seconds, then 60 °C for 1 minute. Following PCR, amplified DNA was
31
denatured and data collected determined the melting temperature of the amplicon,
allowing verification that a single product was formed. Acidic ribosomal protein (ARP)
mRNA was used as an endogenous control. Cycle threshold number, Ct, for the real-time
quantification was defined to be in the exponential phase of the PCR amplification and
was determined using SDS 2.1 software (Applied Biosystems). Relative gene copy
number was assessed using the ΔΔCt method, where the relative expression of the gene
of interest in a sample is expressed as a fold change over the control sample.
The data for each gene analyzed was normalized to the control gene ARP and
changes in Ddr1-/-
; Ldlr-/-
macrophage gene expression are expressed as fold change
relative to Ddr1+/+
; Ldlr-/-
and cells. Experiments were done in triplicate and repeated 3
times. Comparisons between genotypes were performed by Student’s t-test using
SigmaPlot 11.
2.6 ELISA experiments
Harvested peritoneal lavage cells were plated on 10 cm dishes that were
uncoated or coated with 15 nM fibronectin or on 6 cm dishes coated with 100 nM type
IV collagen, at a seeding density of 4 million cells per 10 cm dish and 2 million cells per 6
cm dish. The cells were incubated for 2 hrs at 37°C with 5% CO2, following which non-
adherent cells were aspirated off, leaving macrophages adherent on the plate. Adherent
macrophages on uncoated plates were stimulated with 50 ng/ml of soluble type I
collagen. Cells were cultured for 3 days in 10 ml of RPMI-10%FBS-2%PS. At 3 days, 2 ml
of conditioned media was aspirated off the cells and stored at -80 °C till used in
experiments.
MCP-1 and TGF-β Enzyme-linked immunosorbent assay (ELISA) kits were
obtained from EBiosciences (88-7391 and 88-7344), and assays were done according to
manufacturer’s instructions. 96 well plates were coated with capture antibody (1:2500)
diluted in coating buffer overnight at 4 °C. Plates were then washed with wash buffer (1
32
x PBS, 0.05% Tween-20) and blocked for one hour in blocking solution (Assay Dilutent
solution), after which standards and samples were added to the plate (100 µl /well). For
the TGF-β ELISA, media samples were acid-activated with 20 µl of 1N HCl, incubated for
10 minutes and then neutralized with 20 µl of 1N NaOH. This was done to inactivate
latent TGF-β present in the media. Plates were incubated for 16 hours at 4 °C then
washed with wash buffer. 100 µl /well of detection antibody (1:1000) was added and
incubated for 1 hour at room temperature. After washing with wash buffer, 100 µl /well
of Avidin-HRP was added and left at room temperature for 30 minutes. After another
wash cycle, 100 µl /well of substrate solution was added and incubated at room
temperature for 15 minutes. Finally, 50 µl / well of stop solution (2 M H2SO4) was added
and plates were read on a Molecular Devices Vmax kinetic microplate reader for
absorbance reading at 450 nm. Experiments were done in duplicate and repeated 3
times. Comparisons between genotypes were performed by Student’s t-test using
SigmaStat 11. Data that did not fit a normal distribution were analyzed by the non-
parametric Mann-Whitney U test.
33
2.7 Figures
34
Figure 2.7.1: Image of microfluidic channel device used in flow adhesion experiments
A) Inlet / outlet to channel: Openings for introduction of flow through the chambers.
Matrix and cell solutions are introduced into the channels through these inlets. After
adhesion, syringe pumps are attached to one side of the channel and liquid is injected
through at calculated shear forces. B) Channels are 500 µm wide x 100 µm high x 50,000
µm long
B) Channel
A) Inlet /
Outlet
35
gene Forward Sequence Reverse Sequence Source
DDR1 CTGCTCTTTACTGAAGGCTC TCCATAGACCAGAGGGATC (Franco, 2009)
ARP AGACCTCCTTCTTCCAGGCTTT CCCACCTTGTCTCCAGTCTTTATC (Franco, 2009)
MCP-1 CAGCCAGATGCAGTTAACGC GCCTACTCATTGGGATCATCTTG (Franco, 2009)
MCSF CACATGATTGGGAATGGACA CAGCTGTTCAGGTTATTGGA (Ezure et al., 1997)
PDGF CTGTATGAAATGCTGAGCGACCA GCATTGCACATTGCGGTTATTGC (Akai et al., 1994)
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC (Overbergh et al., 1999)
TGF-β TGACGTCACTGGAGTTGTACGG GGTTCATGTCATGGATGGTGC (Overbergh et al., 1999)
Table 2.7.2: Primer sequences used in RT-PCR experiments
36
Chapter 3
3 Results
37
3.1 Macrophage adhesion to collagen and fibronectin
The first step to asses for DDR1 dependent differences in adhesion was to determine
the optimal conditions to assay. Initial static adhesion assays were carried out to
determine optimal cell number per well. Analysis showed a very good correlation
between increasing cell number plated and corresponding change in the optical density
reading (R2 = 0.99), and the optimal cell density for assay was chosen to be 100,000 cells
/ well. Further experiments were conducted to test for optimal matrix concentration to
be used for experiments to measure adhesion. Ranges chosen were between 100 –
1000 nM for type I collagen, between 100 and 600 nM for type IV collagen and between
5 and 25 nM for fibronectin.
Type I collagen: Peritoneal macrophages did not adhere to type I collagen, but adhered
well to tissue culture plastic. Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages showed no
significant differences in adhesion to type I collagen. Ddr1-/-
; Ldlr-/-
macrophages showed
significantly reduced adhesion to tissue culture plastic compared to Ddr1+/+
; Ldlr-/-
macrophages (Figure 3.5.1).
Type IV collagen: Peritoneal macrophages adhered well to type IV collagen and Ddr1-/-
;
Ldlr-/-
macrophages adhered significantly less (on average about 50 % less) to type IV
collagen than Ddr1+/+
; Ldlr-/-
macrophages (Figure 3.5.2).
Fibronectin: Fibronectin is not a known ligand for the DDR1 receptor. As such, it was
included as a positive control – both the Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages
were expected to bind equally well to fibronectin. Macrophages isolated from the
peritoneum adhered to fibronectin, however Ddr1-/-
; Ldlr-/-
macrophages adhered
significantly less (on average 43 % less) to fibronectin than Ddr1+/+
; Ldlr-/-
macrophages
(Figure 3.5.3).
38
3.2 Macrophage adhesion to collagen and fibronectin in the
presence of an integrin β1 blocking antibody
In order to determine what part of the decrease in adhesion seen in the DDR1-deficient
cells was attributable solely to the action of DDR1, rather than to DDR1 acting through
cross talk with integrin receptors, a blocking antibody experiment was designed. β1
integrins were blocked by treating with an anti-CD29 antibody that has previously been
shown to block β1 integrin-mediated adhesion of cells (Hou et al., 2000) by binding to
and blocking the β1 integrin subunit of integrin receptors. Differences in adhesion
observed after this could not be due to differences in expression or affinity of the β1
integrin receptors in the absence of DDR1. We chose to block the β1 integrin because
the major integrin receptors for the 2 matrix proteins being tested (the α5β1 receptor for
fibronectin and the α1β1 receptor for type IV collagen) all contain the β1 integrin subunit.
Type IV collagen: Ddr1-/-
; Ldlr-/-
macrophages adhered significantly less to wells coated
with type IV collagen at concentrations of 100 and 400 nM compared to Ddr1+/+
; Ldlr-/-
macrophages. Blocking the β1 integrin receptor did not eliminate these differences in
adhesion. Ddr1+/+
; Ldlr-/-
macrophages still adhered to type IV collagen when the β1
integrin receptor was blocked. Adding the β1 integrin receptor-blocking antibody to
Ddr1+/+
; Ldlr-/-
macrophages resulted in an average 23% decrease in adhesion of these
cells to type IV collagen ( 100 nM and 400 nM). However adding the blocking antibody
to Ddr1-/-
; Ldlr-/-
macrophages resulted in an average 74 % decrease in the adhesion of
these cells to type IV collagen (Figure 3.5.4).
Treatment with antibodies against MHC II, or IgM did not affect the adhesion of the
macrophages suggesting that the anti CD 29 antibody was specifically affecting the
β1integrin receptor (Figure 3.5.5). MHC II was used as a control to determine the effect
of targeting a non adhesive cell surface receptor on macrophages, and the IgM was
included as an isotype control.
39
Fibronectin: Ddr1-/-
; Ldlr-/-
macrophages adhered significantly less to wells coated with 5,
15 or 25 nM fibronectin compared to Ddr1+/+
; Ldlr-/-
macrophages. Blocking the β1
integrin receptor did not eliminate these differences in adhesion. Ddr1+/+
; Ldlr-/-
macrophages still adhered to fibronectin when the β1 integrin receptor was blocked.
Adding the β1 integrin receptor blocking antibody to Ddr1+/+
; Ldlr-/-
macrophages
resulted in an average 27% decrease in adhesion of these cells to fibronectin (5, 15 and
25 nM). However adding the blocking antibody to Ddr1-/-
; Ldlr-/-
macrophages resulted
in an average 46% decrease in the adhesion of these cells to fibronectin (Figure 3.5.6).
Treatment with antibodies against MHC II, or IgM did not affect the adhesion of the
macrophages suggesting that the anti CD 29 antibody was specifically affecting the
β1integrin receptor (Figure 3.5.7). MHC II was used as a control to determine the effect
of targeting a non adhesive cell surface receptor on macrophages, and the IgM was
included as an isotype control.
3.3 Macrophage adhesion under shear stress
These experiments were carried out to model the in vivo condition, where shear forces
exerted by the flowing blood may affect macrophage adhesion and also in order to
gauge strength of adhesion of these cells to matrix – subjecting cells to step increases in
shear and counting the cells remaining indicates the strength of matrix binding.
A representative data set from one experiment is shown in Figure 3.5.8. There was a
consistent trend towards decreased adhesion of Ddr1-/-
; Ldlr-/-
cells compared to Ddr1+/+
;
Ldlr-/-
cells on both type IV collagen and fibronectin. Also, macrophages did not adhere
well to type I collagen. Examination of the number of adherent cells remaining after
each step increase in shear force suggests that the cells that do adhere are well
adherent, even in the absence of the DDR1 receptor. Not many cells were lost while
increasing shear to 5 and 10 dynes/cm2, and even at the very high shear of 100 dynes
40
/cm2
a significant number of the cells remained adherent, suggesting strong adhesion.
There was extremely high variability between repeats of the experiments due to
technical issues.
3.4 mRNA levels for cytokines and growth factors involved in
atherosclerosis
The production of cytokines and growth factors by macrophages are essential to the
development of the plaque. The levels of mRNA for 5 different factors were measured in
Ddr1-/-
; Ldlr-/-
and Ddr1+/+
; Ldlr-/-
macrophages. MCP-1, MCSF, tumor necrosis factor α
(TNF-α), transforming growth factor β (TGF- β) and platelet derived growth factor
(PDGF) mRNAs were measured immediately after cell isolation, and after 3 and 7 days in
culture with soluble type I collagen. mRNA levels were also measured after plating cells
for 3 days on 15 nM fibronectin or 100 nM type IV collagen.
mRNA levels measured in macrophages immediately after isolation from the peritoneal
cavity are shown in Figure 3.5.9. We observed significant increases in MCSF, TNF-α, TGF-
β and PDGF mRNA expression in Ddr1-/-
; Ldlr-/-
macrophages compared to Ddr1+/+
; Ldlr-/-
cells. Expression of MCP-1 was not different between the two genotypes. mRNA levels
measured in macrophages after being cultured with soluble type I collagen in vitro for 3
days are shown in Figure 3.5.10. There was a significant increase in the production of
MCP-1, MCSF and PDGF by Ddr1-/-
; Ldlr-/-
macrophages and a slight decrease in TGF- β
mRNA compared to Ddr1+/+
; Ldlr-/-
cells. mRNA levels measured after culture with
soluble type I collagen in vitro for 7 days are shown in Figure 3.5.11.The increases in
MCP-1, MCSF and PDGF persisted at 7 days, however, there was no difference in TGF- β
mRNA at this time. Expression of TNF-α was not different between Ddr1-/-
; Ldlr-/-
and
Ddr1+/+
; Ldlr-/-
macrophages at either time point.
mRNA levels measured in macrophages after being cultured on 100 nM type IV collagen
for 3 days are shown in Figure 3.5.12. There was a significant decrease in the expression
41
of MCP-1, MCSF and PDGF mRNA by Ddr1-/-
; Ldlr-/-
macrophages compared to Ddr1+/+
;
Ldlr-/-
cells. When cultured on 15 nM fibronectin for 3 days (Figure 3.5.13), there were
significant increases in TGF-β and PDGF mRNA in Ddr1-/-
; Ldlr-/-
macrophages compared
to Ddr1+/+
; Ldlr-/-
macrophages, and a trend towards an increase in TNF-α mRNA
expression. There was no change in MCP-1 or MCSF mRNA expression between Ddr1-/-
;
Ldlr-/-
and Ddr1+/+
; Ldlr-/-
macrophages on fibronectin.
Protein levels of MCP-1 and TGF-β secreted into the media by Ddr1+/+
; Ldlr-/-
and Ddr1-/-
;
Ldlr -/-
macrophages after 3 days culture with soluble type I collagen or plated on 15 nM
fibronectin, or 100 nM type IV collagen were measured using ELISAs. Relative changes in
MCP-1 protein levels are presented in Figure 3.5.14. Ddr1-/-
; Ldlr-/-
macrophages
produce significantly reduced levels of MCP -1 compared to Ddr1+/+
; Ldlr-/-
macrophages
when cultured for 3 days with soluble type I collagen (63 % decrease) or plated on 100
nM type IV collagen (48 % decrease) or on 15 nM fibronectin (56% decrease). Relative
changes in TGF-β1 protein levels are presented in Figure 3.5.15. Ddr1-/-
; Ldlr-/-
macrophages produce significantly reduced levels of TGF-β compared to Ddr1+/+
; Ldlr-/-
macrophages when cultured for 3 days with with soluble type I collagen (28% less) and
when plated on 100 nM type IV collagen (43 % less), but had significantly increased
production of TGF-β1 protein when plated on 15 nM fibronectin (23 % increase).
42
3.5 Figures
43
Figure 3.5.1: Peritoneal macrophages did not adhere to type I collagen
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to type I collagen. Plates
were coated with the indicated concentration of type I collagen. Adhesion was
quantified by toluidine blue staining where the absorbance of toluidine blue at an
optical density of 595 nm is proportional to the number of adherent cells. Values are
mean ± SEM (n=3). Comparisons between genotypes were performed by Student’s t-
test. Significant differences (p < 0.05) are indicated by a (*)
44
Figure 3.5.2: Ddr1-/-
macrophages adhered significantly less to type IV collagen
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to type IV collagen. Plates
were coated with the indicated concentration of type IV collagen. Adhesion was
quantified by toluidine blue staining where the absorbance of toluidine blue at an
optical density of 595 nm is proportional to the number of adherent cells. Values are
mean ± SEM (n=3). Comparisons between genotypes were performed by Student’s t-
test. Significant differences (p < 0.05) are indicated by a (*)
45
Figure 3.5.3: Ddr1-/-
macrophages adhered significantly less to fibronectin
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to fibronectin. Plates were
coated with the indicated concentration of fibronectin. Adhesion was quantified by
toluidine blue staining where the absorbance of toluidine blue at an optical density of
595 nm is proportional to the number of adherent cells. Values are mean ± SEM (n=3).
Comparisons between genotypes were performed by Student’s t-test. Significant
differences (p < 0.05) are indicated by a (*)
46
Figure 3.5.4: Ddr1-/-
macrophages adhered significantly less to type IV collagen in the
presence of a β1-integrin blocking antibody
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to type IV collagen, with or
without the presence of an antibody that blocks the β1 integrin receptor. When
indicated, macrophages were incubated with β1-blocking antibody at a concentration of
20 µg/ml. Plates were coated with the indicated concentration of type IV collagen.
Adhesion was quantified by toluidine blue staining where the absorbance of toluidine
blue at an optical density of 595 nm is proportional to the number of adherent cells.
Values are mean ± SEM (n=3). Comparisons were performed by one way ANOVA using
the Holm-Sidak method. Significant differences (p < 0.05) between genotypes are
indicated by an (*), significant differences with or without antibody treatment are
indicated by an (x)
47
Figure 3.5.5: There was no difference in adhesion seen on type IV collagen when using
MHC class II or IgM control antibodies.
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to type IV collagen, with or
without the presence of a MHC class II antibody or an IgM antibody administered at
concentrations of 20 µg/ml. Plates were coated with the indicated concentration of type
IV collagen. Adhesion was quantified by toluidine blue staining where the absorbance of
toluidine blue at an optical density of 595 nm is proportional to the number of adherent
cells. Values are mean ± SEM (n=3). Comparisons were performed by Student’s t-test.
There were no significant differences comparing with or without antibody treatment.
48
Figure 3.5.6: Ddr1-/-
macrophages adhered significantly less to fibronectin in the
presence of a β1-integrin blocking antibody
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to fibronectin with or without
the presence of an antibody that blocks the β1 integrin receptor. When indicated,
macrophages were incubated with β1-blocking antibody at a concentration of 20 µg/ml.
Plates were coated with the indicated concentration of fibronectin. Adhesion was
quantified by toluidine blue staining where the absorbance of toluidine blue at an
optical density of 595 nm is proportional to the number of adherent cells. Values are
mean ± SEM (n=3). Comparisons were performed by one way ANOVA using the Holm-
Sidak method. Significant differences (p < 0.05) between genotypes are indicated by a
(*), with or without antibody treatment are indicated by an (x)
49
Figure 3.5.7: There was no difference in adhesion seen on fibronectin when using MHC
class II or IgM control antibodies
Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages to fibronectin, with or
without the presence of a MHC class II antibody or an IgM antibody administered at
concentrations of 20 µg/ml. Plates were coated with the indicated concentration of
fibronectin. Adhesion was quantified by toluidine blue staining where the absorbance of
toluidine blue at an optical density of 595 nm is proportional to the number of adherent
cells. Values are mean ± SEM (n=3). Comparisons were performed by Student’s t-test.
There were no significant differences comparing with or without antibody treatment.
50
Type of matrix molecule
Type I collagen Type I collagen Type IV collagen Type IV collagen FN FN
Number of cells remaining adherent
0
200
400
600
800
1000
1 dyne / cm2
5 dynes / cm 2
10 dynes / cm2
100 dynes / cm2
Type of matrix molecule
Figure 3.5.8: Adhesion of Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages after shear
stress
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
peritoneal macrophages were tested for strength of
adhesion to type I collagen, type IV collagen and fibronectin by subjecting adherent cells
to 1, 5, 10 and 100 dynes / cm2
of shear force in microfluidic channels. Channels were
coated with 500nM collagen or 15nM fibronectin. The total number of cells still
adherent after each step increase in shear force was counted.
Type I collagen Type IV collagen fibronectin
DDR1 +/+ DDR1
-/-
DDR1 +/+
DDR1 -/-
DDR1 +/+ DDR1
-/-
51
Figure 3.5.9: Ddr1-/-
macrophages produced increased levels of mRNA for MCSF, TNF-
α, TGF-β and PDGF immediately following isolation from the peritoneal cavity
Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages immediately following isolation from the
peritoneal cavity, 4 days after thioglycollate injection. Values are mean ± SEM (n=3).
Comparisons between genotypes were performed by Student’s t-test. Significant
differences (p < 0.05) are indicated by a (*)
52
Figure 3.5.10: Ddr1-/-
macrophages produced increased levels of mRNA for MCP1,
MCSF, PDGF and decreased TGF-β after 3 days in culture with type I collagen
Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages 3 days after culture with 50 ug/ml soluble
type I collagen. Values are mean ± SEM (n=3). Comparisons between genotypes were
performed by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)
53
Figure 3.5.11: Ddr1-/-
macrophages produced increased levels of mRNA for
inflammatory cytokines after 7 days in culture with type I collagen
Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages 7 days after culture with 50 ug/ml soluble
type I collagen. Values are mean ± SEM (n=3). Comparisons between genotypes were
performed by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)
54
Figure 3.5.12: Ddr1-/-
macrophages produced decreased amounts of MCP-1, MCSF and
PDGF when cultured for 3 days on type IV collagen
Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages after 3 days in culture on type IV collagen
(100nM). Values are mean ± SEM (n=3). Comparisons between genotypes were
performed by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)
55
Figure 3.5.13: Ddr1-/-
macrophages produced increased amounts of TGF-β and PDGF
when cultured for 3 days on fibronectin
Fold changes in the mRNA levels of MCP-1, MCSF, TNF-α, TGF-β and PDGF between
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
macrophages after 3 days in culture on fibronectin (15
nM). Values are mean ± SEM (n=3). Comparisons between genotypes were performed
by Student’s t-test. Significant differences (p < 0.05) are indicated by a (*)
56
Figure 3.5.14: Ddr1-/-
macrophages produce decreased levels of MCP-1 on type I and
type IV collagen and fibronectin
Fold changes in the secreted protein levels of MCP-1 between Ddr1+/+
; Ldlr-/-
and Ddr1-/-
;
Ldlr-/-
macrophages after 3 days in culture in the presence of type I collagen (50 µg/ml),
or on type IV collagen (100nM) or fibronectin (1 5 nM). Values are mean ± SEM (n=3).
Comparisons between genotypes were performed by Student’s t-test. Significant
differences (p < 0.05) are indicated by a (*)
57
Figure 3.5.15: Ddr1-/-
macrophages produce decreased levels of TGF-β on collagen and
increased TGF-β on fibronectin.
Fold changes in the secreted protein levels of TGF-β between Ddr1+/+
; Ldlr-/-
and Ddr1-/-
;
Ldlr-/-
macrophages after 3 days in culture in the presence of type I collagen (50 µg/ml),
or on type IV collagen (100nM) or fibronectin (15 nM). Values are mean ± SEM (n=3).
Comparisons between genotypes were performed by Student’s t-test. Significant
differences (p < 0.05) are indicated by a (*)
58
Chapter 4
4 Discussion
59
4.1 Discussion
Adhesion studies
We have shown that DDR1-deficient macrophages are deficient in adhesion to
type IV collagen. This is particularly significant because type IV collagen is a major
component of the basement membrane of endothelial cells in the artery wall and is thus
an important matrix protein barrier that macrophages first encounter when they begin
to transmigrate into the intimal space. This makes macrophage adhesion to type IV
collagen a particularly relevant characteristic in atherosclerosis. Deficiency in adhesion
to type IV collagen may contribute to an inability of macrophages to invade into the
plaque because cells need to adhere in order to migrate. It is known that the ability of
macrophages to adhere to matrix plays an important role in macrophage transmigration
(Dangerfield et al., 2002). However, to date, no one has determined whether
endogenous DDR1 mediates the adhesion of macrophages to matrix components found
within the atherosclerotic plaque.
Previous work with systemic deletion of DDR1 showed reduction in macrophage
accumulation or recruitment into the atherosclerotic plaques of Ddr1-/-
; Ldlr-/-
mice
(Franco et al., 2008). In addition, a previous study observing the effect of deletion of the
α1 integrin receptor on atherosclerosis demonstrated that the lack of the α1 receptor in
an ApoE-deficient model of atherosclerosis resulted in smaller plaques with fewer
macrophages, suggesting that the α1β1 receptor, also important for adhesion to type IV
collagen, was an important mediator in macrophage recruitment to the plaque
(Schapira et al., 2005). Hence, the deficit seen in DDR1-/-
macrophages in adhering to
type IV collagen is consistent with a role for DDR1 in mediating macrophage invasion
into the plaque.
In order to determine what portion of the differences in adhesion seen were
mediated by DDR1 vs. integrin-mediated adhesion, a blocking antibody experiment
60
using a β1-integrin blocking antibody was conducted using a C29 antibody that has been
shown to block adhesion (Mendrick et al., 1993). Ddr1-/-
; Ldlr-/-
macrophages adhered
significantly less to type IV collagen compared to Ddr1+/+
; Ldlr-/-
macrophages and
blocking the β1 integrin receptor did not eliminate the difference in adhesion. Ddr1+/+
;
Ldlr-/-
macrophages still adhered to type IV collagen when the β1 integrin receptor was
blocked, suggesting that DDR1 does mediate adhesion to type IV collagen.
In this study we show that DDR1-deficient macrophages adhere significantly less
to fibronectin. In order to determine what portion of the difference in adhesion was
mediated by DDR1 vs. integrin-mediated adhesion, an assay using a β1 blocking
antibody was conducted. Ddr1-/-
; Ldlr-/-
macrophages adhered significantly less to
fibronectin compared to Ddr1+/+
; Ldlr-/-
macrophages and blocking the β1 integrin
receptor did not eliminate the difference in adhesion. Ddr1+/+
; Ldlr-/-
macrophages still
adhered to fibronectin when the β1 integrin receptor was blocked suggesting that DDR1
does mediate adhesion to fibronectin. Therefore we have found new evidence
suggesting an interaction between DDR1 and fibronectin – to date fibronectin has not
been shown to be a direct ligand for DDR1 (Vogel et al., 1997). Recent work has shown
that in the vasculature, endothelial cells under atheroprone shear conditions can
produce a thin layer of fibronectin overlying their basement membrane (Orr et al.,
2005). Therefore we speculate that deficiency in ability of DDR1-deficient macrophages
to adhere to fibronectin could affect macrophage ability to enter the plaque.
We have found that freshly isolated peritoneal macrophage cells do not adhere
to type I collagen. Reports in the literature on the adhesion of macrophages to type I
collagen vary widely, often depending on the source of macrophages used. Adhesion of
monocyte / macrophage to type I collagen was seen in THP-1 cells transfected to over
express DDR1 (Kamohara et al., 2001), in human peripheral blood monocytes (Newman
and Tucci, 1990) and in THP-1 cells (Lin et al., 1995). However, similar to results seen
here, the human macrophage monoblastic cell line U937 was poorly adhesive to type I
collagen (Koyama et al., 2000). In another study, RAW 264 and peritoneal thioglycollate-
61
induced macrophages adhered poorly to fibrillar type I collagen (Gowen et al., 2000). In
studies of atherosclerosis, deletion of the α2 integrin receptor, which is an important
type I collagen integrin receptor had no effect on plaque development. More
importantly, no detectable α2 receptor was found on monocytes or macrophages in the
plaque area (Grenache et al., 2003), suggesting that macrophage adhesion to type I
collagen is not a critical factor in macrophage invasion into the plaque.
Using the microfluidic channel method to measure the strength of adhesion of
macrophages to matrix, we saw trends similar to the results obtained in the static
adhesion assays – peritoneal macrophages did not adhere well to type I collagen but did
adhere to fibronectin and type IV collagen. Furthermore, there was a trend towards
decreased adhesion of Ddr1-/-
; Ldlr-/-
cells compared to Ddr1+/+
; Ldlr-/-
macrophages.
Cytokine expression studies
For these studies, 5 cytokines were chosen for their potential impact on plaque
development. MCP-1 is a potent monocyte chemoattractant and deletion of this gene in
an LDLR-deficient model of atherosclerosis resulted in significantly reduced lesion size
with fewer macrophages present in the lesions (Gu et al., 1998), similar to results seen
in the systemic DDR1 knockout model (Franco et al., 2008). MCSF is known to aid in the
differentiation of monocytes into macrophages (Becker et al., 1987) once they enter the
plaque area and the deletion of MCSF resulted in smaller plaques with fewer
macrophages (Qiao et al., 1997). PDGF and TGF-β are potent inducers of SMC migration
and together with TNF-α can also induce smooth muscle cell proliferation (Raines and
Ross, 1993).
When plated on type IV collagen, DDR1-deficient macrophages produced
decreased MCP-1, MCSF and PDGF mRNA compared to DDR1-expressing cells.
Furthermore, protein levels of MCP-1 and TGF-β were also decreased in DDR1-deficient
cells plated on type IV collagen. Taken together, this suggests that DDR1 regulates the
62
expression of these cytokines in response to type IV collagen. The consistent results for
MCP-1 down regulation at both the mRNA and protein level suggest that DDR1 may
control MCP-1 expression at the level of transcription – DDR1 can signal through NFkB
(Matsuyama et al., 2004), which is known to be an important transcription factor
controlling the expression of many cytokines including MCP-1 (Blackwell and Christman,
1997). When plated on fibronectin, DDR1-deficient macrophages had increased
expression of TGF-β and PDGF mRNA compared to DDR1-expressing cells, but no change
in MCP-1 mRNA expression. When plated on fibronectin, DDR1-deficient cells produce
increased levels of TGF-β protein consistent with mRNA results. However, DDR1-
deficient macrophages produced decreased levels of MCP-1 protein compared to DDR1-
expressing cells. This suggests that, when plated on fibronectin, DDR1 regulates MCP-1
through post-transcriptional mechanisms, different from regulation when plated on
type IV collagen. TGF-β is increased at both the mRNA and protein level in DDR1-
deficient cells when compared to DDR1-expressing cells, which may suggest a role for
DDR1 in transcriptional repression of TGF-β when macrophages are exposed to
fibronectin.
In freshly isolated DDR1-deficient cells, there was an increase in MCSF, TNF-α,
TGF-β and PDGF compared to DDR1-expressing macrophages. This increase in cytokine
expression at the mRNA level was carried forward after culturing with soluble type I
collagen for 3 days and 7 days (increased MCP-1, MCSF and PDGF). This suggests that
differences seen between DDR1-deficient and expressing cells were elicited in the
mouse due to unknown factors and persisted during culture.
In vivo work done in our lab shows that the systemic deletion of DDR1 leads to
decreased mRNA levels of MCP-1 in the atherosclerotic plaque (Franco et al., 2008), a
finding that agrees well with the data presented here. Other work also suggests that
DDR1 mediates leukocyte recruitment to sites of inflammation. Work with DDR1 in renal
disease suggests that the absence of DDR1 reduced leukocyte recruitment as well as
reduced LPS-induced MCP-1 expression (Flamant et al., 2006), furthermore work with
63
DDR1 knockouts in a model of lung fibrosis suggested that deletion of DDR1 reduced
inflammatory cell recruitment as well as decreased the expression of inflammatory
cytokines like MCP-1 and IL-6 in the bronchoalveolar lavage fluid from DDR1-deficient
mice compared to bronchoalveolar lavage fluid from DDR1-expressing mice (Avivi-Green
et al., 2006).
Overall, when faced with type IV collagen and fibronectin, two important matrix
molecules found in the endothelial basement membrane that macrophages would come
into contact with during transmigration into the plaque area, DDR1-deficient
macrophages produced significantly decreased levels of the potent monocyte
chemoattractant MCP-1. Previous work has shown that a systemic deletion of MCP-1 in
mice attenuates lesion formation and in particular reduces the recruitment of
macrophages to the atherosclerotic plaque (Gosling et al., 1999; Gu et al., 1998). This
deficit in the production of MCP-1 and other inflammatory cytokines may contribute to
reduced recruitment of inflammatory cells from the circulation into the plaque, thus
attenuating plaque development.
Conclusion
In these experiments we have shown that DDR1-deficient macrophages adhered
significantly less to type IV collagen and fibronectin compared to DDR1-expressing cells.
In addition, when plated on these matrix components, DDR1-deficient macrophages
produce decreased levels of MCP-1 protein, a cytokine known to be very important in
plaque development. The inability of DDR1-deficient macrophages to adhere to type IV
collagen and fibronectin, both important components of endothelial basement
membrane in atheroprone areas of the vasculature, as well as their potential inability to
attract further leukocyte recruitment to the plaque area due to a decrease in MCP-1
expression could contribute to decreased macrophage recruitment into the plaque, and
hence the attenuated development of atherosclerosis.
64
4.2 Limitations and Future directions
Static adhesion studies: these experiments occur under static conditions and on one
thin layer of matrix that is adherent to tissue culture plastic, whereas in vivo,
macrophages adhere to endothelium and basement membrane while under flow, and
basement membrane and the plaque extracellular matrix is a complex mix of various
ECM components. Further testing should use matrix more similar to that found in vivo
such as Matrigel, and perhaps use 3D matrix models where cells are imbedded in matrix
to track adhesion and invasion of these cells
Flow adhesion studies: These experiments have been complicated by various technical
issues which cause high variability between repeats – the occurrence of bubbles in the
microchannel devices, while hard to avoid, skews results because of the ability of the
bubbles to rip cells and matrix from the channel walls. In addition, we are currently
collaborating with Dr. Craig Simmons to develop microfluidic devices that can mimic
shear stresses that macrophages are exposed to, and eventually more closely mimic the
in vivo structure of an artery in a microfluidic channel. Future experiments should aim to
optimize this valuable tool by incorporating bubble traps into the design of the channels
to provide more consistency in results.
In these experiments, we show that DDR1-deficient macrophages are deficient in
adhesion to fibronectin. Because fibronectin is not a known DDR1 ligand, further
investigation into this is necessary. In order to conclusively prove that DDR1 is affecting
the change in adhesion seen, and not some other integrin receptor, either more
blocking antibody experiments must be carried out, or DDR1 can be transfected into a
cell type that does not express any other fibronectin receptors, such as the
neuroblastoma cell line LAN-1. The ability or inability of this transfected cell to adhere to
fibronectin may shed more light on the role of DDR1 in fibronectin adhesion. In addition,
the effect of fibronectin binding by DDR1 should be determined by assessing the
phosphorylation status of DDR1 to determine if DDR1 signaling is being activated.
65
RT-PCR and ELISA studies: Once again, these experiments were carried out on a thin
layer of matrix that is adherent to tissue culture plastic, whereas in vivo, macrophages
would be exposed to a complex mix of various ECM components. Further testing should
use matrix more similar to that found in vivo such as matrigel, and perhaps use 3D
matrix models where cells are imbedded in matrix to better simulate the in vivo
condition. In addition, verification of these results with other cell sources, and in
particular bone marrow-derived macrophages, which is a cell type more analogous to
circulating monocytes found in the vasculature, will further add credence to these
findings.
66
5 References
Abdulhussein, R., Koo, D. H. H., and Vogel, W. F. (2008). Identification of disulfide-linked
dimers of the receptor tyrosine kinase DDR1. Journal of Biological Chemistry 283, 12026
-12033.
Akai, Y., Iwano, M., Kitamura, Y., Shiki, H., Dohi, Y., Dohi, K., Moriyama, T., and
Ynoemasu, K. (1994). Intraglomerular expressions of IL-1α and platelet-derived growth
factor (PDGF-B) mRNA in experimental immune complex-mediated glomerulonephritis.
Clinical & Experimental Immunology 95, 29-34.
Alves, F., Saupe, S., Ledwon, M., Schaub, F., Hiddemann, W., and Vogel, W. (2001).
Identification of two novel, kinase-deficient variants of discoidin domain receptor 1:
differential expression in human colon cancer cell lines. FASEB J., 00-0626fje.
Augé, N., Pieraggi, M. T., Thiers, J. C., Nègre-Salvayre, A., and Salvayre, R. (1995).
Proliferative and cytotoxic effects of mildly oxidized low-density lipoproteins on vascular
smooth-muscle cells. Biochem. J. 309, 1015-1020.
Autio, I., Jaakkola, O., Solakivi, T., and Nikkari, T. (1990). Oxidized low-density
lipoprotein is chemotactic for arterial smooth muscle cells in culture. FEBS Letters 277,
247-249.
Avivi-Green, C., Singal, M., and Vogel, W. F. (2006). Discoidin domain receptor 1-
deficient mice rre resistant to bleomycin-induced lung fibrosis. Am. J. Respir. Crit. Care
Med. 174, 420-427.
Becker, S., Warren, M., and Haskill, S. (1987). Colony-stimulating factor-induced
monocyte survival and differentiation into macrophages in serum-free cultures. J
Immunol 139, 3703-3709.
Bendeck, M. P., Hou, G., Chen, J., Nejat, S., and Adiguzel, E. (2004). Matrix, matrix
metalloproteinases and smooth muscle cell function in atherosclerosis. International
Congress Series 1262, 486-489.
Berliner, J. A., Territo, M. C., Sevanian, A., Ramin, S., Kim, J. A., Bamshad, B., Esterson,
M., and Fogelman, A. M. (1990). Minimally modified low density lipoprotein stimulates
monocyte endothelial interactions. J Clin Invest 85, 1260-1266.
Brown, M., and Goldstein, J. (1986). A receptor-mediated pathway for cholesterol
homeostasis. Science 232, 34-47.
Collins, T., Palmer, H. J., Whitley, M. Z., Neish, A. S., and Williams, A. J. (1993). A
67
common theme in endothelial activation: Insights from the structural analysis of the
genes for E-selectin and VCAM-1. Trends in Cardiovascular Medicine 3, 92-97.
Costell, M. (1999). Perlecan maintains the integrity of cartilage and some basement
membranes. The Journal of Cell Biology 147, 1109-1122.
Curat, C. A., Eck, M., Dervillez, X., and Vogel, W. F. (2001). Mapping of epitopes in
discoidin domain receptor 1 critical for collagen binding. J. Biol. Chem 276, 45952-
45958.
Curat, C. A., and Vogel, W. F. (2002). Discoidin Domain Receptor 1 Controls Growth and
Adhesion of Mesangial Cells. J Am Soc Nephrol 13, 2648-2656.
Danen, E. H., and Sonnenberg, A. (2003). Integrins in regulation of tissue development
and function. J. Pathol. 200, 471-480.
Dangerfield, J., Larbi, K. Y., Huang, M., Dewar, A., and Nourshargh, S. (2002). PECAM-1
(CD31) homophilic interaction up-regulates α6β1 on transmigrated neutrophils in vivo
and plays a functional role in the ability of α6 integrins to mediate leukocyte migration
through the perivascular basement membrane. The Journal of Experimental Medicine
196, 1201 -1212.
Dejmek, J., Dib, K., Jonsson, M., and Andersson, T. (2003). Wnt-5a and G-protein
signaling are required for collagen-induced DDR1 receptor activation and normal
mammary cell adhesion. International Journal of Cancer 103, 344-351.
Evanko, S. P., Raines, E. W., Ross, R., Gold, L. I., and Wight, T. N. (1998). Proteoglycan
distribution in lesions of atherosclerosis depends on lesion severity, structural
characteristics, and the proximity of platelet-derived growth factor and transforming
growth factor-beta. Am J Pathol 152, 533-546.
Ezure, T., Ishiwata, T., Asano, G., Tanaka, S., and Yokomuro, K. (1997). Production of
macrophage colony-stimulating factor by murine liver in vivo. Cytokine 9, 53-58.
Ferri, N., Carragher, N. O., and Raines, E. W. (2004). Role of Discoidin Domain Receptors
1 and 2 in Human Smooth Muscle Cell-Mediated Collagen Remodeling: Potential
Implications in Atherosclerosis and Lymphangioleiomyomatosis. Am J Pathol 164, 1575-
1585.
Flamant, M., Placier, S., Rodenas, A., Curat, C. A., Vogel, W. F., Chatziantoniou, C., and
Dussaule, J. (2006). Discoidin domain receptor 1 null mice are protected against
hypertension-induced renal disease. J Am Soc Nephrol 17, 3374-3381.
Franco, C. (2009). A functional role for discoidin domain receptor 1 (Ddr1) in the
68
regulation of inflammation and fibrosis during atherosclerotic plaque development.
Franco, C., Britto, K., Wong, E., Hou, G., Zhu, S., Chen, M., Cybulsky, M. I., and Bendeck,
M. P. (2009). Discoidin Domain Receptor 1 on Bone Marrow-Derived Cells Promotes
Macrophage Accumulation During Atherogenesis. Circ Res 105, 1141-1148.
Franco, C., Hou, G., Ahmad, P. J., Fu, E. Y., Koh, L., Vogel, W. F., and Bendeck, M. P.
(2008). Discoidin domain receptor 1 (Ddr1) deletion decreases atherosclerosis by
accelerating matrix accumulation and reducing inflammation in low-density lipoprotein
receptor-deficient mice. Circ Res 102, 1202-1211.
Galis, Z. S., Sukhova, G. K., Lark, M. W., and Libby, P. (1994). Increased expression of
matrix metalloproteinases and matrix degrading activity in vulnerable regions of human
atherosclerotic plaques. J Clin Invest 94, 2493-2503.
Gelse, K., Po ¨schl, E., and Aigner, T. (2003). Collagens—structure, function, and
biosynthesis. Advanced Drug Delivery Reviews 55, 1531-1546.
Gerrity, R. G. (1981). The role of the monocyte in atherogenesis: I. Transition of blood-
borne monocytes into foam cells in fatty lesions. Am J Pathol 103, 181-190.
Giddens, D. P., Zarins, C. K., and Glagov, S. (1993). The role of fluid mechanics in the
localization and detection of atherosclerosis. J. Biomech. Eng. 115, 588-594.
Gosling, J., Slaymaker, S., Gu, L., Tseng, S., Zlot, C. H., Young, S. G., Rollins, B. J., and
Charo, I. F. (1999). MCP-1 deficiency reduces susceptibility to atherosclerosis in mice
that overexpress human apolipoprotein B. J Clin Invest 103, 773-778.
Gowen, B. B., Borg, T. K., Ghaffar, A., and Mayer, E. P. (2000). Selective adhesion of
macrophages to denatured forms of type I collagen is mediated by scavenger receptors.
Matrix Biology 19, 61-71.
Grenache, D. G., Coleman, T., Semenkovich, C. F., Santoro, S. A., and Zutter, M. M.
(2003). {alpha}2{beta}1 integrin and development of atherosclerosis in a mouse model:
assessment of risk. Arterioscler Thromb Vasc Biol 23, 2104-2109.
Gu, L., Okada, Y., Clinton, S. K., Gerard, C., Sukhova, G. K., Libby, P., and Rollins, B.
(1998). Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low
density lipoprotein receptor deficient mice. Molecular Cell 2, 275-281.
Hahn, C., and Schwartz, M. A. (2008). The role of cellular adaptation to mechanical
forces in atherosclerosis. Arterioscler Thromb Vasc Biol 28, 2101-2107.
Hansen, C., Greengard, P., Nairn, A. C., Andersson, T., and Vogel, W. F. (2006).
69
Phosphorylation of DARPP-32 regulates breast cancer cell migration downstream of the
receptor tyrosine kinase DDR1. Experimental Cell Research 312, 4011-4018.
Hardingham, T., and Fosang, A. (1992). Proteoglycans: many forms and many functions.
FASEB J. 6, 861-870.
Hedin, U., Bottger, B. A., Luthman, J., Johansson, S., and Thyberg, J. (1989). A substrate
of the cell-attachment sequence of fibronectin (Arg-Gly-Asp-Ser) is sufficient to promote
transition of arterial smooth muscle cells from a contractile to a synthetic phenotype.
Developmental Biology 133, 489-501.
Hilton, H. N., Stanford, P. M., Harris, J., Oakes, S. R., Kaplan, W., Daly, R. J., and
Ormandy, C. J. (2008). KIBRA interacts with discoidin domain receptor 1 to modulate
collagen-induced signalling. Biochimica et Biophysica Acta (BBA) - Molecular Cell
Research 1783, 383-393.
Hocking, D. C., Sottile, J., and McKeown-Longo, P. J. (1994). Fibronectin's III-1 module
contains a conformation-dependent binding site for the amino-terminal region of
fibronectin. Journal of Biological Chemistry 269, 19183 -19187.
Hou, G., Mulholland, D., Gronska, M. A., and Bendeck, M. P. (2000). Type VIII collagen
stimulates smooth muscle cell migration and matrix metalloproteinase synthesis after
arterial injury. Am J Pathol 156, 467-476.
Hou, G., Vogel, W., and Bendeck, M. P. (2001). The discoidin domain receptor tyrosine
kinase DDR1 in arterial wound repair. J. Clin. Invest. 107, 727-735.
Huang, Y., Arora, P., McCulloch, C. A., and Vogel, W. F. (2009). The collagen receptor
DDR1 regulates cell spreading and motility by associating with myosin IIA. J Cell Sci 122,
1637-1646.
Hurt, E., Bondjers, G., and Camejo, G. (1990). Interaction of LDL with human arterial
proteoglycans stimulates its uptake by human monocyte-derived macrophages. J. Lipid
Res. 31, 443-454.
Hynes, R. O. (1992). Integrins: Versatility, modulation, and signaling in cell adhesion. Cell
69, 11-25.
Ichikawa, O., Osawa, M., Nishida, N., Goshima, N., Nomura, N., and Shimada, I. (2007).
Structural basis of the collagen-binding mode of discoidin domain receptor 2. EMBO J
26, 4168-4176.
Iiyama, K., Hajra, L., Iiyama, M., Li, H., DiChiara, M., Medoff, B. D., and Cybulsky, M. I.
(1999). Patterns of vascular cell adhesion molecule-1 and intercellular adhesion
70
molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites
predisposed to lesion formation. Circ Res 85, 199-207.
Ishibashi, S., Brown, M. S., Goldstein, J. L., Gerard, R. D., Hammer, R. E., and Herz, J.
(1993). Hypercholesterolemia in low density lipoprotein receptor knockout mice and its
reversal by adenovirus-mediated gene delivery. J Clin Invest 92, 883-893.
Jonsson, M., and Andersson, T. (2001). Repression of Wnt-5a impairs DDR1
phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci 114,
2043-2053.
Kamohara, H., Yamashiro, S., Galligan, C., and Yoshimura, T. (2001). Discoidin domain
receptor 1 isoform-a (DDR1a) promotes migration of leukocytes in three-dimensional
collagen lattices. FASEB J.
Kim, S., Lee, S., Suk, K., Bark, H., Jun, C., Kim, D., Choi, C., and Yoshimura, T. (2007).
Discoidin domain receptor 1 mediates collagen-induced nitric oxide production in
J774A.1 murine macrophages. Free Radical Biology and Medicine 42, 343-352.
Konitsiotis, A. D., Raynal, N., Bihan, D., Hohenester, E., Farndale, R. W., and Leitinger, B.
(2008). Characterization of high affinity binding motifs for the discoidin domain receptor
DDR2 in collagen. J. Biol. Chem 283, 6861-6868.
Koyama, Y., Norose-Toyoda, K., Hirano, S., Kobayashi, M., Ebihara, T., Someki, I., Fujisaki,
H., and Irie, S. (2000). Type I collagen is a non-adhesive extracellular matrix for
macrophages. Arch. Histol. Cytol 63, 71-79.
Leitinger, B. (2003). Molecular Analysis of Collagen Binding by the Human Discoidin
Domain Receptors, DDR1 and DDR2. Journal of Biological Chemistry 278, 16761 -16769.
Leitinger, B., and Kwan, A. P. (2006). The discoidin domain receptor DDR2 is a receptor
for type X collagen. Matrix Biology 25, 355-364.
Ley, K., Laudanna, C., Cybulsky, M. I., and Nourshargh, S. (2007). Getting to the site of
inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol 7, 678-689.
L'hote, C. G. M., Thomas, P. H., and Ganesan, T. S. (2001). Functional analysis of
discoidin domain receptor 1: effect of adhesion on DDR1 phosphorylation. FASEB J.
Lin, T. H., Rosales, C., Mondal, K., Bolen, J. B., Haskill, S., and Juliano, R. L. (1995).
Integrin-mediated Tyrosine Phosphorylation and Cytokine Message Induction in
Monocytic Cells. Journal of Biological Chemistry 270, 16189 -16197.
Loree, H., Kamm, R., Stringfellow, R., and Lee, R. (1992). Effects of fibrous cap thickness
71
on peak circumferential stress in model atherosclerotic vessels. Circ Res 71, 850-858.
Lu, K. K., Trcka, D., and Bendeck, M. P. Collagen stimulates discoidin domain receptor 1-
mediated migration of smooth muscle cells through Src. Cardiovascular Pathology In
Press, Corrected Proof. Available at:
http://www.sciencedirect.com/science/article/B6T13-4Y7NDN1-
3/2/047b46cf1213a88da33c87005055c795.
Lund, A., Stegemann, J., and Plopper, G. (2009). Mesenchymal stem cells sense three
dimensional type I collagen through discoidin domain receptor 1. Open Stem Cell J 1, 40-
53.
Matsuyama, W., Faure, M., and Yoshimura, T. (2003). Activation of discoidin domain
receptor 1 facilitates the maturation of human monocyte-derived dendritic cells through
the TNF receptor associated factor 6/TGF-beta-activated protein kinase 1 binding
protein 1 beta/p38 alpha mitogen-activated protein kinase signaling cascade. J.
Immunol 171, 3520-3532.
Matsuyama, W., Wang, L., Farrar, W. L., Faure, M., and Yoshimura, T. (2004). Activation
of discoidin domain receptor 1 isoform b with collagen up-regulates chemokine
production in human macrophages: role of p38 mitogen-activated protein kinase and
NF-kappa B. J. Immunol 172, 2332-2340.
Newman, S. L., and Tucci, M. A. (1990). Regulation of human monocyte/macrophage
function by extracellular matrix. Adherence of monocytes to collagen matrices enhances
phagocytosis of opsonized bacteria by activation of complement receptors and
enhancement of Fc receptor function. J. Clin. Invest 86, 703-714.
Noordeen, N. A., Carafoli, F., Hohenester, E., Horton, M. A., and Leitinger, B. (2006). A
transmembrane leucine zipper Is required for activation of the dimeric receptor tyrosine
kinase DDR1. Journal of Biological Chemistry 281, 22744 -22751.
Ongusaha, P. P., Kim, J., Fang, L., Wong, T. W., Yancopoulos, G. D., Aaronson, S. A., and
Lee, S. W. (2003). p53 induction and activation of DDR1 kinase counteract p53-mediated
apoptosis and influence p53 regulation through a positive feedback loop. EMBO J 22,
1289-1301.
Orr, A. W., Sanders, J. M., Bevard, M., Coleman, E., Sarembock, I. J., and Schwartz, M. A.
(2005). The subendothelial extracellular matrix modulates NF-κB activation by flow. The
Journal of Cell Biology 169, 191 -202.
Overbergh, L., Valckx, D., Waer, M., and Mathieu, C. (1999). Quantification if murine
cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11,
305-312.
72
Paulson, K. E., Zhu, S., Chen, M., Nurmohamed, S., Jongstra-Bilen, J., and Cybulsky, M. I.
(2010). Resident intimal dendritic cells accumulate lipid and contribute to the initiation
of atherosclerosis. Circ Res 106, 383-390.
Perez, J. L., Shen, X., Finkernagel, S., Sciorra, L., Jenkins, N. A., Gilbert, D. J., Copeland, N.
G., and Wong, T. W. (1994). Identification and chromosomal mapping of a receptor
tyrosine kinase with a putative phospholipid binding sequence in its ectodomain.
Oncogene 9, 211-219.
Potts, J. R. (1994). Fibronectin structure and assembly. Current Opinion in Cell Biology 6,
648-655.
Qiao, J., Tripathi, J., Mishra, N., Cai, Y., Tripathi, S., Wang, X., Imes, S., Fishbein, M.,
Clinton, S., Libby, P., et al. (1997). Role of macrophage colony-stimulating factor in
atherosclerosis: studies of osteopetrotic mice. Am J Pathol 150, 1687-1699.
Qureshi, R., and Jakschik, B. (1988). The role of mast cells in thioglycollate-induced
inflammation. J Immunol 141, 2090-2096.
Raines, E. W., and Ross, R. (1993). Smooth muscle cells and the pathogenesis of the
lesions of atherosclerosis. Br Heart J 69, S30-S37.
Ross, R. (1999). Atherosclerosis — An inflammatory disease. New England Journal of
Medicine 340, 115-126.
Ross, R. (1993). The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature
362, 801-809.
Seimon, T., and Tabas, I. (2009). Mechanisms and consequences of macrophage
apoptosis in atherosclerosis. J. Lipid Res. 50, S382-387.
Shekhonin, B., Domogatsky, S., Idelson, G., Koteliansky, V., and Rukosuev, V. (1987).
Relative distribution of fibronectin and type I, III, IV, V collagens in normal and
atherosclerotic intima of human arteries. Atherosclerosis 67, 9-16.
Shintani, Y., Fukumoto, Y., Chaika, N., Svoboda, R., Wheelock, M. J., and Johnson, K. R.
(2008). Collagen I–mediated up-regulation of N-cadherin requires cooperative signals
from integrins and discoidin domain receptor 1. The Journal of Cell Biology 180, 1277 -
1289.
Slack, B. E., Siniaia, M. S., and Blusztajn, J. K. (2006). Collagen type I selectively activates
ectodomain shedding of the discoidin domain receptor 1: Involvement of Src tyrosine
kinase. Journal of Cellular Biochemistry 98, 672-684.
73
Smith, E. B. (1965). The influence of age and atherosclerosis on the chemistry of aortic
intima: Part 2. Collagen and mucopolysaccharides. Journal of Atherosclerosis Research
5, 241-248.
Tzima, E., Irani-Tehrani, M., Kiosses, W. B., Dejana, E., Schultz, D. A., Engelhardt, B., Cao,
G., DeLisser, H., and Schwartz, M. A. (2005). A mechanosensory complex that mediates
the endothelial cell response to fluid shear stress. Nature 437, 426-431.
Valent, A., Meddeb, M., Danglot, G., Duverger, A., Nguyen, V. C., and Bernheim, A.
(1996). Assignment of the NTRK4 (trkE) gene to chromosome 6p21. Human Genetics 98,
12-15.
Vogel, W., Gish, G. D., Alves, F., and Pawson, T. (1997). The Discoidin Domain Receptor
Tyrosine Kinases Are Activated by Collagen. Mol. Cell. Biol. 13-23.
Vogel, W. F. (2002). Ligand-induced shedding of discoidin domain receptor 1. FEBS
Letters 514, 175-180.
Vogel, W. F., Aszodi, A., Alves, F., and Pawson, T. (2001). Discoidin domain receptor 1
tyrosine kinase has an essential role in mammary gland development. Mol. Cell. Biol. 21,
2906-2917.
Voisin, M., Woodfin, A., and Nourshargh, S. (2009). Monocytes and neutrophils exhibit
both distinct and common mechanisms in penetrating the vascular basement
membrane in vivo. Arterioscler Thromb Vasc Biol 29, 1193-1199.
Wang, C., Hsu, Y., and Tang, M. (2005). Function of discoidin domain receptor I in HGF-
induced branching tubulogenesis of MDCK cells in collagen gel. Journal of Cellular
Physiology 203, 295-304.
Wang, C., Su, H., Hsu, Y., Shen, M., and Tang, M. (2006). A Discoidin Domain Receptor
1/SHP-2 Signaling Complex Inhibits {alpha}2beta1-Integrin-mediated Signal Transducers
and Activators of Transcription 1/3 Activation and Cell Migration. Mol. Biol. Cell 17,
2839-2852.
Wesley, R. B., Meng, X., Godin, D., and Galis, Z. S. (1998). Extracellular matrix modulates
macrophage functions characteristic to atheroma : collagen type I enhances acquisition
of resident macrophage traits by human peripheral blood monocytes in vitro.
Arterioscler Thromb Vasc Biol 18, 432-440.
Yeh, Y., Wang, C., and Tang, M. (2009). Discoidin domain receptor 1 activation
suppresses alpha2beta1 integrin-dependent cell spreading through inhibition of Cdc42
activity. Journal of Cellular Physiology 218, 146-156.
74
Young, E. W. K., Wheeler, A. R., and Simmons, C. A. (2007). Matrix-dependent adhesion
of vascular and valvular endothelial cells in microfluidic channels. Lab Chip 7, 1759-1766.
Zhang, S., Reddick, R., Piedrahita, J., and Maeda, N. (1992). Spontaneous
hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258,
468-471.
75
6 Appendices
76
6.1 Flow cytometry to determine if differences exist in
macrophage recruitment to the peritoneal cavity:
77
6.1.1 Rationale
Previous work has shown that in various models of inflammation, a systemic
deletion of DDR1 leads to a decrease in the number of recruited macrophage cells – this
has been shown in models of lung inflammation (Avivi-Green et al., 2006), renal
inflammation (Flamant et al., 2006) and by our lab in atherosclerotic plaque
development (Franco et al., 2008). In order to determine if the absence of DDR1 on
macrophages would affect macrophage recruitment in a simpler model of inflammation,
we chose to examine macrophage recruitment to the peritoneal cavity in response to a
thioglycollate injection. Thioglycollate is known to cause an acute inflammatory reaction
upon injection into the peritoneal cavity, with monocyte / macrophage accumulation
beginning about 16 hours following injection, and peaking 4 days after (Qureshi and
Jakschik, 1988). By analyzing cellular composition of the peritoneal lavage at an early
timepoint after injection (24 hours) we sought to determine if there were differences in
recruitment of monocyte/macrophages in response to the injection of the irritant
stimulus.
6.1.2 Materials and Methods
1 ml of 4% thioglycollate was injected into the peritoneal cavity of Ddr1+/+
; Ldlr-/-
and
Ddr1-/-
; Ldlr-/-
mice and 24 hours later were subjected to a peritoneal lavage with 10ml
PBS supplemented with 1mM EDTA. From the total lavage, aliquots of 1,000,000 cells in
1% BSA in RPMI were then incubated with unlabeled mAb or directly conjugated
primary mAb for 30 min on ice. Staining was carried out using the following markers:
CD115-phycoerythrin (1:100, eBioscience), Ly6C-biotin (1:200, BMA Biomedical). After
washing in 0.5% FBS / 1 mM EDTA/PBS, samples that had been stained with biotinylated
primary antibodies were incubated with Streptavidin-allophycocyanin (SA-APC, 1:800,
Becton-Dickinson). Samples were analyzed on a Beckman Coulter FC500 flow cytometer
at the following wavelengths: PE: 560 nm – 590 nm, APC: 660 nm – 690 nm. Cells that
78
were CD115+ and Ly6C+ were labelled as monocyte / macrophages. The experiment was
conducted with n = 4 for each genotype.
6.1.3 Results
The results of these experiments are summarized in Figure 6.1.5.1 below. While
there is a trend to a decreased number of macrophages in the Ddr1-/-
; Ldlr-/-
mice, with
a 20% reduction in the number of CD115+/Ly6C+ labelled monocyte /macrophages in
the peritoneal lavage of Ddr1-/-
; Ldlr-/-
mice, the difference is not significant.
6.1.4 Discussion
We chose this model of inflammation in order to determine if, as with other
more complicated models of chronic inflammation, DDR1-deficient macrophages would
have reduced accumulation to the site of inflammation. However, we were unable to
see a significant difference between the DDR1-deficient and the DDR1 expessing mice,
though we do see a trend towards a decrease in accumulation of macrophages in the
DDR1-deficient mice
One possible reason for this is that , recently it has been shown that monocytes
preferentially pass through postcapillary venules at sites called matrix protein low
expression regions (LERs) which have reduced basement membrane protein, and that
monocyte transmigration at these sites may not require proteases (Voisin et al., 2009).
It is possible that the requirement of proteases for monocyte transmigration at matrix
rich arterial locations accounts for differences seen when comparing this simpler model
of recruitment to infiltration in atherosclerotic plaques – previous work has shown that
DDR1-deficient macrophages produce decreased levels of the MMP family of proteases
(Franco et al., 2008).
79
6.1.5 Figure:
Figure 6.1.5.1: There is no difference in macrophage recruitment to the peritoneal
cavity 1 day after thioglycollate injection
Percent positive CD115+/Ly6C+ labeled cells (macrophages) in peritoneal lavage of
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
mice 1 day after thioglycollate injection into the
peritoneal cavity. Values are mean ± SEM (n=4 for each genotype)
80
6.2 Attempts to immunoblot for DDR1
81
6.2.1 Rationale:
These experiments were carried out using a polyclonal goat antibody which
recognizes an epitope mapping to the C- terminus of human DDR1, in order to
characterize the expression of DDR1 on peritoneal macrophages at different time points
and under different stimulations. We have previously used this antibody to detect a 120
kDa corresponding to DDR1 in mouse vascular smooth muscle cells.
6.2.2 Materials and Methods:
Ddr1+/+
; Ldlr-/-
and Ddr1-/-
; Ldlr-/-
mice were injected with 1 ml of 4% thioglycollate
medium in the peritoneal cavity, and 4 days later a peritoneal lavage was carried out as
previously described ( Section 2.2) Macrophages were plated at a density of 6 million
cells / 10 cm dish and 3 days later, total cellular protein was extracted using a lysis
buffer made up of a 50 mm Tris – buffer solution (pH 7.6), with 1% SDS, 10 μg/mL
leupeptin and 0.01 nM phenylmethanesulfonylfluoride. Lysate was collected from the
plate with a cell scraper and homogenized by passing though a 20 gauge needle 3-4
times. Protein quantification of cell lystates was carried out using a BioRad Detergent
Compatible Microplate Assay. Equal amounts (30 ug) of protein were mixed with a 2X
solution of sample buffer (20% 0.5M Tris (pH 6.8), 20 % glycerol, 5% SDS, 0.005%
bromophenol blue), electrophoresed through a 10% SDS-polyacrylamide gel and
transferred overnight at 30 volts to a nitrocellulose membrane (BioRad). The membrane
was blocked in 0.5% T-TBS solution containing 5% non-fat milk for 1 hour and then
incubated overnight with antibodies directed against DDR1 (Santa-Cruz C-20) diluted
1:500 in TTBS containing 5% non-fat milk. The following day, the membrane was
incubated in horseradish peroxidase-conjugated antibodies directed against rabbit IgG
diluted 1:2000 for 1 hour and protein expression was detected using enhanced
chemiluminescence (Perkin-Elmer)
82
6.2.3 Results and Discussion
The results from one repeat of these experiments is shown in Figure 6.2.4.1
below. There were multiple bands present in the DDR1 immunoblots, with none of the
bands showing a good correlation with the expected 120 kDa weight of the DDR1
protein. In addition there were multiple bands present in the DDR1 knockout cell
lystates (DDR1 knockout status was confirmed by RT-PCR).
Multiple different lots of the C-20 antibody were tested, all with similar results.
We conclude that this antibody does not identify DDR1 expressed in mouse
macrophages.
83
6.2.4 Figure:
Figure 6.2.4.1 The C-20 Santa Cruz DDR1 antibody is not specific for DDR1
Lane A) Ddr1+/+
; Ldlr-/-
cell lysate showing multiple bands present in lane, with no 120 kb
band. Lane B) Ddr1-/-
; Ldlr-/-
cell lysate showing multiple bands present, demonstrating
that the antibody is not DDR1 specific.
A B
230 kb
130 kb
95 kb
72 kb
56 kb
36 kb
28 kb