Embed Size (px)
Citation preview
The Role of Novel Silver(I) Complexes as potential Chemotherapeutics
Jake Gill
BSc Biomolecular Science
School of Biological Sciences
Dublin Institute of Technology
Kevin Street
Dublin 8
This project was submitted in part fulfilment of the BSc Biomolecular Science, Dublin Institu te of Technology
i
Abstract
A previous study by Thornton., (2012) led to the synthesis of novel silver(I) compound MD4 and MD5
and the hypothesis that these compounds are moderately cytotoxic possibly due to their avid DNA
binding and nuclease cleaving properties. This hypothesis explored using the same novel silver(I)
compounds MD4 and MD5 with the same drug controls of cisplatin and MXT in THP-1 monocyte cells.
Initial cytotoxic profiles of the THP-1 cells exposed to all 4 complexes was generated by the MTT assay
to calculate the IC25 concentrations of each complex for the DNA damage stud ies. This was 68.69µM
(24 hour) and 14.94µM (48 hour) for MD4 and MD5 was 29.80µM (24 hour) and 14.94µM (48 hour)
showing MD5 to be the most active complex. Double strand break (DSB) formation abilities of the
compounds was analysed by measuring fluorescent H2AX foci in THP-1 cells exposed to the 4
complexes for 24hr and 48hrs. Results were consolidated by both flow cytometry and confocal
microscopical analysis. Cisplatin showed DSB formation of the same levels at both time points (plateau
after 24hours) whereas MD4 and MD5 only showed significant DSB formation after 24 hours which was
similar to and exceeding cisplatin DSB levels. Furthermore, pro -apoptotic Bim and apoptosome forming
initiator Caspase 9 was also seen to be upregulated in THP-1 cells exposed to cisplatin early at 24
hours (but not 48 hours), and later significantly in MD5 and MD4. Interestingly drug control MXT did not
show DSB forming abilities but did show moderate upregulation of Bim, Caspase 9 and synergistic Bcl2
suggesting a role for apoptosis in its mode of action with the mitochondria a key player. Perhaps ROS
signals apoptosis for MXT rather than DNA damage as seen with cisplatin, MD4 and MD5.
Furthermore, Il-6 was seen to be upregulated in THP-1 cells exposed to MD4 which is suggestive of an
inflammatory response which warrants further investigation.
To conclude, this study demonstrated that there is exciting potential of these novel silver(I) complexes
(MD4 and MD5) as alternative chemotherapeutic drugs to cisplatin since they have the same biological
ii
mode of action by binding to DNA and initiating apoptosis. This study showed demonstrated that they
have greater activity than cisplatin.
iii
Acknowledgements
I would like to thank my supervisor Dr. Orla Howe who constantly guided me throughout this project and
also gave me the opportunity to take on such a challenging project.
A big thank you to Garret Rochford and Dr. Jane Byrant who were neve r far away to help me
throughout this project.
I would also like to thank my friends, my family, my girlfriend, Louise for their love and support.
A mention to everyone in the DT226a WhatsApp group which kept me entertained throughout the three
months.
I would like to thank the guys in Bach16 who were very accommodating with allocating me time off for
project work.
Not to forget Monster Energy.
iv
Abbreviations OH - Hydroxyl Radicals
3-MPA - 3-mercaptopropioinc acid
Bcl-2 – B-cell lymphoma 2
BLM – Bleomycin
COX – Cyclooxygenase
CT-DNA – Calf Thymus DNA
DCFH-DA - 2’,7’-Dichlorofluorescin Diacetate
DMSO – Dimethyl Sulfoxide
DNA – Deoxyribonucleic acid
DSB – Double Stranded Break
dsDNA – Double Stranded DNA
EtBr – Ethidium Bromide
H2O2 - Hydrogen Peroxide
IL – Interleukin
IO2 - Singlet Oxygen
MAPK - Mitogen Activated Protein Kinase
MXT – Mitoxantrone
NFκB – Nuclear Factor κ B
NSAID – Non-steroidal Anti-inflammatory Drugs
O2- - Superoxide Anions
PEB - Platinum, Epoposide and Bleomycin
PGH – Prostaglandin
RNA – Ribonucleic acid
ROS – Reactive Oxygen Species
X-IAP - X-Chromosome Linked Inhibitor of Apoptosis
γH2AX – phosphorylation of Ser 139 on H2AX histone
PBS – Phosphate Buffer Saline
RT-PCR – Real Time Polymerase Chain Reaction
v
PGH2 – Prostaglandin
Dach - 1,2-di-aminocyclohexane
vi
Table of Contents
Abstract ................................................................................................................................... i
Acknowledgements...........................................................................................................iii
Abbreviations ..................................................................................................................... iv
1.0 Introduction .........................................................................................................................1
1.1 Cancer ................................................................................................................................ 1
1.2 Therapy for Cancer .............................................................................................................. 2
1.3 Metal based drugs for Chemotherapy .................................................................................... 2
1.3.1 Cisplatin and its mode of action....................................................................................... 3
1.4 Alternative metal based drugs ............................................................................................... 6
1.4.1 Metallonucleases ........................................................................................................... 7
1.4.2 Novel Copper Based Metallonucleases............................................................................ 7
1.4.3 Novel Silver(I) based chemotherapeutics ......................................................................... 8
1.5 Biological evaluation of alternative metal based drugs ........................................................... 10
1.5.1 Cytotoxicity and tumour selectivity................................................................................. 11
1.5.2 Generation of Reactive Oxygen Species ........................................................................ 11
1.5.3 DNA binding and cleaving properties ............................................................................. 12
1.6 Hypothesised biological effects in Novel silver compounds .................................................... 14
1.6.1 Chemical structures ..................................................................................................... 14
1.6.2. Cytotoxicity analysis.................................................................................................... 16
vii
1.6.3 Potential Generation of ROS by MD4 and MD5 .............................................................. 16
1.6.4 DNA binding activity of MD4 and MD5 ........................................................................... 17
1.6.5 Potential Nuclease Activity ........................................................................................... 19
1.6.6 Potential anti-inflammatory activity ................................................................................ 20
1.7 Hypothesis of project for novel silver compounds .................................................................. 22
1.7.1 Induction of DNA damage by the silver(I) complexes ...................................................... 23
1.7.2 Induction of Apoptosis by silver (I) complexes ................................................................ 25
1.7.3 Anti-inflammatory responses of silver (I) compounds ...................................................... 29
1.8 Project synopsis and future directions .................................................................................. 30
2.0 Materials and Methods.................................................................................................... 31
2.1 Novel Silver(I) drugs........................................................................................................... 31
2.1.1 Solubilisation of Silver(I) drugs and clinically available controls ........................................ 31
2.1.2 Viscosity testing on drug complexes .............................................................................. 32
2.2 Cell culturing methods of THP-1 Cell Line ............................................................................ 33
2.2.1 THP-1 Cells ................................................................................................................ 33
2.2.2 Culturing conditions THP-1 Cell Line ............................................................................. 33
2.2.3 Cell Counting and Plating ............................................................................................. 34
2.3 MTT Cytotoxicity Analysis ................................................................................................... 35
2.3.1 MTT assay on THP-1 cells ........................................................................................... 35
2.3.2 Spectrophotometric analysis ......................................................................................... 36
2.3.3 Statistical analysis ....................................................................................................... 36
viii
2.4 Gamma H2AX foci induction and analysis ............................................................................ 37
2.4.1 Gamma H2AX assay on THP-1 cells ............................................................................. 37
2.4.2 Flow cytometric analysis............................................................................................... 38
2.4.3 Confocal analysis ........................................................................................................ 38
2.5 Gene expression analysis in THP-1 cells ............................................................................. 39
2.5.1 RNA isolation .............................................................................................................. 40
2.5.2 RNA Quantification ...................................................................................................... 41
2.5.3 cDNA synthesis ........................................................................................................... 41
2.5.4 High-throughput Real-time PCR analysis ....................................................................... 42
2.5.5 Analysis of Gene Expression Data ................................................................................ 42
3.0 Results ............................................................................................................................. 43
3.1 Metal based complexes ...................................................................................................... 43
3.1.1 Viscosity results........................................................................................................... 43
3.2 Cytotoxicity of Silver (I) compounds MD4 and MD5 compared to Cisplatin and MTX controls
using the MTT Assay ............................................................................................................... 45
3.3 ƴH2AX .............................................................................................................................. 48
3.3.1 Flow Cytometery Results.............................................................................................. 48
3.3.2 Confocal Microscopy.................................................................................................... 56
3.4 Gene Expression ............................................................................................................... 61
3.4.1 RNA Quantification of cell extracts exposed to average IC25 ........................................... 61
3.4.2 RT-PCR analysis of apoptotic gene expression in THP-1 cells exposed to the complexes at
24 and/or 48 hour exposures ................................................................................................ 63
ix
3.4.3 RT-PCR analysis of inflammatory gene expression in THP-1 cells exposed to the complexes
at 24 and/or 48 hour exposures ............................................................................................. 68
4.0 Discussion........................................................................................................................ 70
5.0 Appendices ...................................................................................................................... 74
Appendix 5.1: Working Protocols .............................................................................................. 74
5.1.1 Solubilisation of Metal based drugs ............................................................................... 74
5.1.2 Aseptic Technique for Cell Culturing .............................................................................. 74
5.1.3 THP-1 Growth Characteristics....................................................................................... 75
5.1.4 Subculturing of THP-1 cells .......................................................................................... 75
5.1.5 THP-1 Cell Counting for experimental procedures .......................................................... 76
5.1.6 MTT Assay protocol ..................................................................................................... 77
5.1.7 γH2AX Focus Assay .................................................................................................... 78
5.1.8 Gene Expression protocols ........................................................................................... 81
Appendix 5.2: Reagents ........................................................................................................... 85
5.2.1 Cell culture reagents .................................................................................................... 85
5.2.2 Control chemotherapeutic drugs ................................................................................... 85
5.2.3 MTT assay reagents .................................................................................................... 85
5.2.4 γH2AX assay reagents ................................................................................................. 86
5.2.5 Gene expression reagents............................................................................................ 87
Appendix 5.3: Raw Data .......................................................................................................... 89
5.3.1 MTT Assay Data.......................................................................................................... 89
x
5.3.2 ƴH2AX.......................................................................................................................105
5.3.3 Gene Expression Raw data .........................................................................................126
6.0 References..................................................................................................................... 130
1
1.0 Introduction
1.1 Cancer
Cancer is caused by a particular cell in the body losing its ability to control its replication and apoptotic
abilities. Cells in the body which have lost this function undergo unregulated cell division and growth
which leads to the formation of tumours. Tumours can be benign or malignant with the latter type
producing tumours that are fast growing and can metastasize around to body to other tissues. There
are many different types of cancer and they are classed by their cellular and tissue origin such as
Adenocarcinoma which is cancer of glandular cells, Carcinoma which is cancer of the epithelial cells,
Lymphoma which is cancer of immune cells and Leukaemia and sarcoma which are known cancers of
erythrocytes and skeletal muscle or bone respectively (National Cancer Institute, 2014). Cancer is
caused by mutations of genes which control the cell cycle and apoptosis, also known as programmed
cell death. Mutations can be genetically inherited or induced by carcinogens such as ionizing radiation,
chemicals or induced by viruses. Mutations can silence key genes responsible for the regulation of the
cell cycle such as p53 or cause the over expression of genes responsible for cell division. In 2012 there
were 8.2 million cancer related deaths, 32.6 million people living with cancer (within 5 years of
diagnosis) and 14.1 million new cases of cancer worldwide (WHO, 2014). Such high prevalence of
cancer worldwide has led to the development of treatment in many forms. Because mutated
deoxyribonucleic acid (DNA) in cells is the root cause of cancer, chemotherapeutic drugs are often
developed to target DNA in order to induce cell death or disrupt the mutation in the cells of a tumour
site.
2
1.2 Therapy for Cancer
Surgery is used in many ways to help cancer patients and it is the oldest form of cancer therapy.
Surgery can result in the total removal of the tumour or it can help the metastatic grade, stage and
diagnosis of the type of cancer. However, often when a tumour has metastasised from its tissue site of
origin it becomes inoperable, particularly if the tumour spreads to the lymphatic system for example.
Radiotherapy in conjunction with surgery is another type of cancer therapy. Ionizing radiations
consisting of either X-rays or γ-rays are used to cause damage to the cancer cells DNA indirectly by
free radicals (OH or H+). Free radicals are caused by the interaction of ionizing radiation with other
molecules; mainly water, since 80% of cells consist of water (Podgorsak & Kainz, 2006).
Immunotherapy is another treatment available for cancer and involves the modification of the immune
system with the overall aim of causing an immune response to the neoplastic cell at the beginning of
cancer development. Treatment of the cancer early will prevent the growth and metastasis of the
tumour and reduce the overall damage to the surrounding tissue. An example of an immunotherapy
drug is Trastuzumab commonly known as Herceptin, and it is used in a form of monoclonal antibody
therapy particularly for breast cancer that interferes with the Her-2/neu receptor which is found to be
over expressed in 10-20% of breast cancers (Köninki et al., 2010) and leads to a disruption in tumour
growth.
1.3 Metal based drugs for Chemotherapy
The use of metals and metal complexes as chemotherapeutic drugs for different cancers is of
increasing importance for current and future treatment plans. Metals are considered inorganic and offer
a more diverse chemistry and therefore enhance their therapeutic application. Metal based drugs have
a central metal ion which is usually the key feature of the drugs mechanism of action. The first type of
metal based drugs synthesised were platinum based, the most successful of these being Cisplatin (cis-
diamminedichloroplatinum(II)).
3
1.3.1 Cisplatin and its mode of action
Cisplatin is the most studied and prescribed chemotherapeutic drug. Cisplatin is a platinum based
metal-ion drug originally used as an antimicrobial agent. It is a relatively small molecule comprised of
11 atoms. Its chemical structure is a central platinum atom surrounded by two chlorine and two
ammonia side chains. Cisplatin is an active chemotherapeutic in its cis conformation, however in its
isomeric trans conformation it is chemotherapeutically inactive; the two isomeric forms of
Diamminedichloroplatinum (II) are illustrated below in Figure 1.1
Figure 1.1: Isomeric forms of Diamminedichloroplatinum (II) (Zlatanova, Yaneva, & Leuba, 1998).
The introduction of Cisplatin to cancer treatment in the 1970s was revolutionarily and has led to the
successful treatment of numerous cancer cases. Combined treatment of Cisplatin and radiotherapy has
been shown to be more successful then radiotherapy alone in non-small cell lung cancer, carcinomas
of the cervix uteri, head and neck cancer and other tumours such as oesophageal carcinomas (Sak et
al., 2009). Cisplatin has been revolutionarily in the treatment of metatastic testicular cancer, as
approximately 70-80% of patients with the disease achieve a complete remission after three to four
cycles of combination cisplatin therapy (Okemeyer et al., 1999). The combination therapy is known as
4
PEB (Platinum, Epoposide and Bleomycin) followed by secondary surgery, however even though the
prognosis is greatly increased for a patient there can be therapy related complications such as acute
and chronic nephrotoxicity caused by cisplatin (Hartmann, Kollmannsberger, Kanz, & Bokemeyer,
1999).
The biological mode of action of Cisplatin in cancer treatment is that it interacts directly with DNA and
mediates the inhibition of DNA synthesis, the suppression of ribonucleic acid (RNA) transcription and
the subsequent induction of apoptosis (Siddik, 2003). Upon interaction with DNA, Cisplatin forms DNA
adducts, which is the drug bound covalently to DNA which creates an altered bulky structure at the site
of binding. Primarily intrastrand 1,2 crosslink adducts are formed primarily with DNA sites containing
purine bases, particularly either two adjacent guanines (65%), an adenine and an adjacent guanine
(25%) or with two guanines separated by one or more bases (10%) (Macciò & Madeddu, 2013); which
lead to the formation of DNA double strand breaks (DSB). DSBs are the most lethal type of DNA
damage, and their inefficient or inaccurate repair can create mutations and chromosomal translocations
that induce genomic instability and ultimately cancer development (Yuan, Adamski, & Chen, 2013). In
addition to being a cause of cancer, DSB induction is paradoxically an effective treatment for cancer.
As cisplatin and other chemotherapeutic agents act by introducing sufficient DSBs into cancer cells to
activate cell death pathways such as apoptosis (Helleday, Petermann, Lundin, Hodgson, & Sharma,
2008).
Although Cisplatin has been a revelation in cancer treatment, there are concerns at the amount of
toxicity that the drug can cause in the human body due to possible accumulation of the metal platnium.
It has been documented that long term treatment with high conce ntrations of Cisplatin has led to
nephrotoxicity in patients treated for testicular cancer (Hanigan & Devarajan, 2003; Macciò & Madeddu,
2013). Nephrotoxicity is the damage caused to the renal system due to the exposure of cisplatin.
Cisplatin induced renal damage is associated with several patterns of histological changes within the
renal system such as acute focal necrosis of the distal convoluted tubules and collecting ducts,
5
dilatation of convoluted tubules and formation of casts and a reduction in the glomerular filtration rate
(Hartmann et al., 1999). Cisplatin is administered via intravenous infusion. Once it has entered the
bloodstream it is met with a high concentration of chloride in the plasma. Plasma itself contains the
protein albumin to which its thiol groups directly bind to the drug leading to the well documented side
effects where a relatively low concentration of the drug reaching and entering the cell causing
nephrotoxicty due to the platinum ion being in a active dichloride state (Trynda-Lemiesz & Luczkowski
2004, Bodur 2010). This binding also leads to a relatively low concentration of the drug reaching the
intracellular environment, as the free cisplatin enters the cell through passive diffusion or through active
transport via copper transport proteins (Ishida, McCormick, Smith-McCune, & Hanahan, 2010).
6
1.4 Alternative metal based drugs
The inorganic nature of metal ion based drugs as well as the success of cisplatin in the treatment of
cancer has led to the development of alternative metal ion based chemotherapeutics. Different drugs
have been synthesised based around a neutral, square -planar platinum(II) containing two cis-amines
and two leaving groups (Hannon, 2007). This structure gives a high probability of activity and therefore
a good strategy for the development of novel metal based drugs. Carboplatin was the first drug to be
synthesised based on the chemistry of cisplatin. It differs by having bidentate dicarboxylate in place of
the two leaving chloride groups (Hannon, 2007) (See Figure 1.2). More recently in 2004, Oxaliplatin
was accepted into clinical use, this being the third platinum based drug to be accepted. Oxaliplatin
benefits cancer treatment as it can be used to treat colorectal cancer, opposed to cisplatin and
carboplatin and other cisplatin resistant cancers. Oxaliplatin has its amines incorporated into a 1,2-di-
aminocyclohexane (dach) framework (Hannon, 2007). Figure 1.2 demonstrates the three clinical drugs
based on platinum chemistry with the platinum group clearly evide nt in the middle of each structure.
Figure 1.2: Contrast between the chemical structures of Cisplatin, Carboplatin and Oxaliplatin.
7
1.4.1 Metallonucleases
Metal-containing reagents that chemically modify supercoiled DNA are often referred to as artificial
metallonucleases (Kellett, McCann, Howe, O’Connor, & Devereux, 2012). Bleomycin (BLM), a clinical
chemotherapeutic derived from Streptomyces verticillus is one such artificial metallonuclease
(Vanderwall et al., 1997). Fe2+BLM or Cu2+BLM, are known to tightly bind to DNA before inducing
chemical scission of the deoxyribose ring of DNA through a biochemical reaction with oxygen to
produce superoxide and hydroxide free radicals which cleave DNA (Kellett et al., 2012).
1.4.2 Novel Copper Based Metallonucleases
The first generation synthetic metallonucleases was [Cu(phen)2]2+, has led to the development of
further generations of drugs based on its chemistry. This is due to its dependency on exogenous
reductant to generate the active species such as L-Ascorbic Acid (Kellett, O’Connor, et al., 2011).
Collaboration with the Dublin Institute of Technology (DIT) and Dublin City University (DCU) has led to
the development of one such generation of metallonucleases which can function independent of
exogenous reductant. The metallonuclease is [Cu(phen)2(phthalate)] (phthalate = o-, m-, p-phthalate).
See Figure 1.3 for the chemical structure which shows two copper groups in blue with 2 surrounding
phenanthrolines on either side in grey with phthalate ligands. Variations of this structure were
synthesised through the named collaboration above and their cytotoxic and genotoxic properties
measured and compared to cisplatin.
8
Figure 1.3: 3D Chemical structure of is [Cu(phen)2(phthalate)]
Studies conducted have shown that [Cu(phen)2(phthalate)] displays excellent chemotherapeutic
potential against colon, breast and cancer cell lines in vitro (Kellett, O’Connor, et al., 2011). These
drugs also show the induction of reactive oxygen species (ROS), high DNA binding properties, self
cleaving endonuclease activity (without the aid of oxidants or reductants) and the formation of double
strand breaks (DSBs). measuring ƴH2AX foci induction (Kellett, O’Connor, et al., 2011; Kellett et al.,
2012; Prisecaru et al., 2013) however the drug itself has poor solubility in water.
1.4.3 Novel Silver(I) based chemotherapeutics
Recently a series of novel silver based chemotherapeutics were synthesised in a PhD research study
conducted by Laura Thornton in DIT and in collaboration with Institute Technology Tallaght (ITT)A
broad range of silver(I)compounds were synthesised with different lengths of ligands (CH2)n where n =
1-10 Biological analysis of these compounds demonstrated two key compounds named MD4 and MD5
which show promising applications as potential chemotherapeutic drugs due to (a) their physical
properties such as solubility and non-photo sensitivity and (b) biological properties that include medium
cytotoxicity, DNA binding and cleaving activities and potential anti -inflammatory properties. These
9
compounds form the basis of this research project to consolidate this hypothesis and explore the
biological mode of action in further detail.
..
10
1.5 Biological evaluation of alternative metal based drugs
Cisplatin and other metal based drugs such as Copper, Silver and Manganese possess differe nt modes
of action. The difference in function may be key as certain cancers are resistant to the mode of action
of current anti-cancer drugs such as SKOV-3, which are human ovarian cancer cell lines which possess
resistance to cisplatin. The mode of actions of the drugs may be different but they can have the same
overall biological outcome with the aim, to induce DNA damage induce apoptosis and cause the cell to
die. Figure 1.4 below depicts the main modes of action of the potential anti -cancer drugs in cells
Figure 1.4: Cellular targets for potential metal based anti-cancer drugs (Thornton, 2012).
11
1.5.1 Cytotoxicity and tumour selectivity
Cytotoxicity assays are widely used in In vitro toxicology studies. The LDH leakage assay, a protein
assay, the neutral red and the MTT assay are the most common employed for the detection of
cytotoxicity or cell viability following exposure to toxic substances. MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-
diphenyltet-razolium bromide) is a water soluble tetrazolium salt, which is converted to an insoluble
purple formazan by cleavage of the tetrazolium ring by succinate dehydrogenase within the
mitochondria. The formazan product is impermeable to the cell memb ranes and therefore it
accumulates in healthy cells (Fotakis & Timbrell, 2006). This method is far superior to the previously
mentioned methods because it is easy-to-use, safe and has a high reproducibility rate.
Tumour selectivity is a cytotoxicity analysis performed on tumour versus non-tumour cells, to compare
cytoxicity results to determine if the cytotoxic agent is selective to tumour cells or not. Kellet, O’Connor.,
et al (2011) analysed dinuclear copper and manganese bis-phenanthroline dicarboxylate octanedioate
complexes for tumour selectivity across a range of progressive colorectal human derived cancer cells;
HT29, SW480 and SW620 versus a non-cancerous normal human keratinocyte line; HaCaT. The
Manganese complex was found to be 9.25 times less cytotoxic towards the non-cancerous cell line
when compared to HT29 and the Copper complex was 700 times less cytotoxic towards the non-
cancerous cell line when compared to HT29; indicating that the phenanthro line and its metal adducts
can increase the activity of p53, which initiates apoptosis even in cancerous cell line which have a
mutation of the p53 (tumour suppressor gene) such as HT29 (Kellett, O’Connor, et al., 2011).
1.5.2 Generation of Reactive Oxygen Species
The ability of a metal based drug to cause cytotoxicity through generation of Reactive Oxygen Species
(ROS) is one of the mechanisms of action currently being studied as a potential anti-cancer treatment.
Active species such superoxide anions (O2-), hydrogen peroxide (H2O2), hydroxyl radicals (OH) and
12
singlet oxygen (IO2) have the ability when formed intracellularly to induce DNA damage to the cell and
in turn induce apoptosis of the cell. A recent study by Kellet et al., 2011 looked at the potential of
dinuclear copper and a manganese bis-phenanthroline, dicarboxylate, octanedioate, based complexes;
[Cu2(µ2-oda)(phen)4](ClO4)2 and [Mn2(µ2-oda)(phen)4(H2O)2(oda)2]2-[Mn2(µ2- oda)(phen)4(H2O)2]2+. The
study showed that both complexes possessed extensive cytotoxicity and avid DNA binding activity. The
coinciding cellular ROS generation study showed that the manganese based complex (2) was an
exceptional generator of ROS within colon cancer cells (Kellett, O’Connor, et al., 2011).
A study conducted by Prisecaru et al., 2012 also analysed the potential of the metallonuclease di-
copper(II) cation, [Cu2(l-terephthalate)(1,10-phen)4]2+ (S1). Unlike first generation synthetic
metallonuclease [Cu(phen)2]2+, and similar to [Cu(phen)2(phthalate)], S1 can function independent of
exogenous reagents. Cytotoxic analysis was conducted on S1 against cisplatin resistant human ovarian
cancer cell lines (SKOV-3) and non-cancer human ovarian cell line (HS-832). It was found that S1 is a
potent cytotoxin against both cell lines. In comparison with the clinical type II topoisomerase inhibitor,
Mitoxantrone, it was eight times more active against the SKOV-3 cell line. In order to analysis the
potential of cytotoxic oxidative stress, S1 was exposed to human-derived lung cancer cells (A549) and
it was concluded that it was capable of producing intracellular ROS upon a nano -molar exposure
(Prisecaru et al., 2012).
1.5.3 DNA binding and cleaving properties
The ability of a complex to bind DNA is a key mechanistic function. DNA binding can be examined by
way of a competitive ethidium bromide displacement assay. Previous studies have shown that novel
metal based complexes show avid DNA binding ability, particularly if phenanthroline is part of the
complexes structure (Kellet et al., 2012; Kellett, O’Connor, et al., 2011). After demonstration of the
ability of a complex to bind to DNA, a Nuclease Assay can be performed to test for the presence of
endonuclease activity. The complexes are exposed to specifically designed DNA which is in super
13
coiled conformation (Form I) such as Puc18 DNA or Pbr322 (Kellett, O’Connor, et al., 2011; Kellett et
al., 2012; Prisecaru et al., 2012). Endonucleases require co-factors in order to carry out their function
such as the reductants 3-mercaptopropioinc acid (3-MPA) and ascorbic acid and oxidants such as
H2O2. A complex which possesses endonuclease ability is able to cleave DNA in Form I to either Form
II open coiled or Form III linearly coiled. Figure 1.5 demonstrates the three forms of DNA scission which
and a typical gel electrophoresis result.
Figure 1.5: Typical gel electrophoresis of supercoiled DNA (Kennedy., 2012).
Another ability which is tested due a complex possessing the ability to bind to DNA is the ability of the
complex to cause DNA damage directly in the form of double strand breaks (DSB). DSB elicit the
phosphorylation of the histone variant H2AX becomes rapidly phosphorylated at serine-139 to form
γH2AX. A γH2AX Assay can be performed to analyse the presence or not of the γH2AX, this is an
immunoassay using a primary antibody for γH2AX and a secondary fluorescently labelled antibody to
detect the presence of γH2AX. The γH2AX assay is reliable and has been used in previous studies by
Kellet et al., (2012) and Prisecaru et al., (2013) which investigated different metal based complexes to
induce DSB.
14
1.6 Hypothesised biological effects in Novel silver compounds
The study by Thornton., (2012) analysed the biological activity of 20 various novel silver(I) compounds.
The silver(I) complexes were derived from the reaction of various silver(I) dicarboxylate complexes with
the nitrogen donor ligand 1,10- phenanthroline. The silver(I) complexes used for this research project
were MD4 (originally labelled complex 9) and MD5 (originally labelled complex 19). Complexes 1-10
have similar structure to Figure 1.6 (MD4) and complexes 11-20 have similar structure to Figure 1.7
(MD5). Thornton conducted a biological analysis of these compounds as outlined below
1.6.1 Chemical structures
Two specific silver compounds MD4 [Ag2(udda)] and MD5 [Ag2(phen)3(udda)] which both have two Ag
groups divided by a ligand size of n=9 were the most active compounds in the biological test systems
outlined by Thornton, 2012. See Figure 1.6 for the basic chemical structure of the MD4 silver
dicarboxylate the silver (Ag) metal on either end of the compound separated by CH2 (n=9). Figure 1.7
shows basic chemical structure of MD5 with additional phenanthroline groups attached directly to the
two Ag metal groups separated by CH2 ligands (n=9).
The size of the compounds were quite different as MD4 is quite a small compound with a molecular
weight of 430g/mol compared to the more complex MD5 compound with a molecular weight of
1385g/mol. MD5 is a Di-Ag phenanthroline complexes, the phenanthroline acts as a ligand for avid
DNA binding and also possess a strong binding affinity for the silver ion. Both compounds were made
soluble in methanol (MeOH) as this possesses minimal toxicity to cells, however the compounds did not
completely go into suspension.
15
Figure 1.6: Chemical structure of MD4 with two Ag groups separated by n=9 CH2 groups.
where n = 1 - 10
(CH2)nC C
O
O
Ag
O
O
Ag
Figure 1.7: Chemical Structure of MD5 with two Ag groups surrounded by phenanthroline and
seperated by CH2 (n=9)
where n = 1 - 10
C C
O
O
Ag
O
O
AgN
N N
N(CH2)
C C
O
O
Ag
O
O
Ag
N
NN
N(CH2)n
N
N
16
1.6.2. Cytotoxicity analysis
A cytotoxic analysis against two human derived cancer cell lines, breast (MCF-7) and ovarian (SKOV-
3) was performed on the 20 silver(I) complexes and clinically available anti-cancer drugs cisplatin and
mitoxantrone as positive drug controls. The activity was determined by the calculation of IC50 values
(the drug concentration causing a 50% reduction in cellular viability). MD4 and Complexes 1-10 showed
an initial selectivity towards the MCF-7 cell line. Interestingly, MD5 possessed the best cytotoxic activity
against both cancer cell lines; this may be due to the large amount of phenanthroline ligands which may
contribute to the activity. It is known that phenanthroline alone can bind directly to DNA and attached to
a specific metal group can enhance its activity (Kellett, Connor, et al., 2011; McCann et al., 2012;
Prisecaru et al., 2013).
In an attempt to determine whether this class of silver(I) complex displayed any selectivity for cancer
cells over non-cancerous cells, a representative complex was tested against the normal Human
Keratinocyte cell line (HaCaT). Since MD5 showed the most potent activity against the cancer cell lines
this was selected. MD4 was also tested as this is its silver(I) dicarboxylate starting material as well as
the cisplatin and mitoxantrone (MXT) controls. Results showed that MD5 was fast acting against the
non-cancerous cell line with an increasing activity compared to that of the two cancer cell lines.
1.6.3 Potential Generation of ROS by MD4 and MD5
In order to conclude whether the results from the cytotoxicity analysis were derived by the silver(I)
complexes ability to cause cell death through production of ROS, SKOV-3 cisplatin resistant ovarian
and MCF-7 breast cancer cells along with HaCaT normal human keratinocyte cells which had been pre -
treated with the intracellular ROS indicator 2’,7’-dichlorofluorescin diacetate (DCFH-DA) were exposed
to both MD4 and MD5.The results obtained clearly demonstrated that neither of the silver(I) complexes
were capable of generating reactive oxygen species within the cancer or normal cells and that ROS
generation does not appear to be a feature of their biological mode of action in cells. This was an
17
interesting result since cisplatin and copper based drugs have been shown to induce ROS in their
mechanistic response. This would therefore indicate a possible alternative mode of action of silver (I)
compounds.
1.6.4 DNA binding activity of MD4 and MD5
Another way anti-cancer drugs cause cell death through apoptosis is through direct DNA binding form
DNA adducts (as described previously). Thornton., (2012) tested the ability of these silver (I)
compounds to bind to DNA by using a competitive ethidium bromide (EtBr) displacement experiment
using calf thymus DNA (CT-DNA). EtBr bound DNA is highly flouregenic, the assay uses the principle in
which the drugs must compete with the EtBr for binding to the DNA leading in a reduction of
fluorescence. This assay compared the binding of these compounds to DNA compared to the known
DNA intercalator actinomycin D and the DNA minor groove binder pentamidine and therefore the
binding properties could be calculated.
As expected complexes 11-20 including MD5 had a very high DNA binding activity due to its phen
ligand and MD5 showed higher DNA binding properties than EtBr. Complexes 1-10 including MD4 also
possessed good DNA binding activity. Figure 6 displays the EtBr displacement of MD4 (9) and MD5
(19) versus the DNA intercalators and known DNA binding structures; MD4 displayed good apparent
DNA binding constants but compared to the intercalators the binding ability is significantly less. MD5
displayed a DNA binding constant of 18 times greater than that of the intercalators.
18
Figure 1.8: Competitive EtBr displacement for complexes 9 (MD4) and 19 (MD5), uddaH2, phen,
pentamidine and actinomycin D (Thornton., 2012).
Based on the binding interactions of the compounds Thornton., (2012) further analysed the possible
DNA intercalation ability (insertion into DNA) of the drugs through a DNA viscosity titration. Helical
lengthening of DNA results in an increase of viscosity indicating intercalation has occurred . Viscosity
profiles were carried out on MD4 (9), MD5 (19), metal free phen, the known DNA intercalator EtBr and
pentamidine (minor groove binder) as controls. Figure 1.9 displays the viscosity profiles of all
complexes; the viscosity profile of MD4 (9) is one of a complex which does not intercalate with DNA but
its silver do bind to DNA but do not intercalate with it based on results above. The viscosity profile of
MD5 is exceptional compared to the DNA intercalator EtBr, this result is significant as it suggests that
MD5 possesses avid DNA binding and intercalation ability.
Concentration (µM)
0 50 100 150 200 250
Flu
ore
sence (
a.u.)
10
20
30
40
509
19
UddaH2
Phen
Pentamidine
Actinomycin D
19
Figure 1.9: Relative viscosity increments of CT-DNA upon exposure to complexes 9 (MD4) and 19
(MD5, metal free phen, ethidium bromide and pentamidine (Thornton., 2012).
1.6.5 Potential Nuclease Activity
Since these compounds demonstrated avid DNA binding properties, Thornton., (2012) then tested their
endonuclease activity by measuring the DNA cleavage of supercoiled (SC) pBR322 DNA in the
presence of cofactors such as the reductants 3-mercaptopropioinc acid (3-MPA) and ascorbic acid and
oxidants such as H2O2. If the DNA was cleaved from exposure to the silver(I) complexes then this could
be clearly seen by separation of the DNA by gel electrophoresis to yield three different forms. Form I is
the supercoiled form which is wrapped really tight and therefore able to mediate further through the
matrix of the gel. Form II is the open coiled form where one strand has been cut. Form III is the linear
coiled form where double stranded scission has occurred and two strands of the DNA have been cut
(Kellett, O’Connor, et al., 2011). Figure 1.5 displays an animation of the three forms of the coiled DNA.
Compound/ DNA (µM)
0.00 0.05 0.10 0.15 0.20
0.9
1.0
1.1
1.2
1.3
1.4
1.5
1.6
9
19
Phen
Ethidium Bromide
Pentamidine
20
Figure 1.10 Relaxation of pBR322 DNA by (a) lane 1: DNA control, lanes 2 – 4 complex 9 (MD4) at 50,
5 and 0.5 µM (b) lane 1: DNA control, lanes 2 – 6 complex 19 (MD5) at 50, 20, 10, 5 and 1 µM
(Thornton., 2012).
(a)
1 2 3 4
(b)
1 2 3 4 5 6
The agarose gel electrophoresis results indicate that MD4 possesses no nuclease activity. In contrast
MD5 based on results has depleted the DNA from form to form III.
1.6.6 Potential anti-inflammatory activity
Thornton., (2012) also analysed the silver(I) complexes for Cyclooxygenase (COX) Inhibition ability as
due to the role of inflammation in the development of cancer there is a potential development of non-
steroidal anti-inflammatory drugs (NSAIDS) combined with a metal based ion. NSAIDS inhibit the action
of prostaglandins by inhibiting cyclo-oxygenase (COX) activity of the enzyme prostaglandin G/ H-
synthase. The level of prostaglandin found in tumour cells is much higher than normal cells.
COX-1 and COX-2 are bifunctional enzymes which have a COX component that converts arachidonic
acid to prostaglandin (PGH2). Prostaglandins play a key role in inflammatory response and contribute to
the characteristics of acute inflammation (FitzGerald & Ricciotti, 2011).
21
The COX inhibitory effects of MD4 and MD5 were analysed and results showed that they were
marginally active towards COX-1 (9.6 and 25.2 % Inhibition, respectively) and are inactive against
COX-2. Similarly, salicylic acid (aspirin) which is known to have weak anti -COX-1 and anti-COX-2
inhibition is inactive as a COX-2 inhibitor however, moderate COX-1 inhibition (26.7 %) is observed.
22
1.7 Hypothesis of project for novel silver compounds
From the biological evaluation results obtained by Thornton (2012) it is clear that both MD4 and MD5
possess cytotoxicity in both cancerous and non-cancerous cell lines but were not tumour selective and,
MD4 being initially cytotoxic to MCF-7 cell line, however over longer time period the cytotoxic effects of
MD4 was the same for both MCF-7 and SKOV-3 cell lines. MD5 exhibited the best cytotoxic activity
over the time points against MCF-7 and SKOV-3 cell lines with an IC50 value comparable to that of
cisplatin. Further biological mechanistic analysis showed that ne ither of the silver(I) complexes
possessed any potential ROS generation but did show strong DNA binding and endonuclease
activities. This highlights the hypothesis that ROS is not a key player in the DNA damage response in
cells and although the binding properties increased with the phenanthroline groups (MD5) that silver (I)
does appear to be directly bound to DNA causing the cytotoxic and genotoxic effects. .
The aim of this current research study was to further analyse both MD4 and MD5 for their mechanistic
mode of action in cells using the information that was gathered by Thornton (2012). THP-1 cells were
used and basic cytotoxic analysis was conducted to calculate the IC50 concentration of both MD4 and
MD5 as the concentrations to use for the subsequent biological testing. The DNA damage effect was
further investigated using an alternative approach to measure the induction of double strand breaks
(DSB) (ƴH2AX assay) compared to the Nuclease assay. Once DNA is damaged in cells then apoptosis
is usually signalled by key genes to initiate cell death. Key genes in the Intrinsic Apoptosis response
were analysed. Due to the clearly different mode of action of these silver (I) compounds compared to
copper and cisplatin, preliminary studies were also conducted to investigate the anti-inflammatory
properties of these compounds.
23
1.7.1 Induction of DNA damage by the silver(I) complexes
It was determined that MD5 possessed DNA binding and cleavage ability and that MD4 possessed
apparent DNA binding ability. Double strand breaks (DSB) are a form of DNA damage believed to be
caused by the Silver(I) compounds. In response to DSBs caused by the potential chemotherapeutic
drugs, the conserved C-terminal tail of the histone variant H2AX becomes rapidly phosphorylated at
serine-139 to form γH2AX by PI3-K like kinases, including ATM, ATR and DNA-PKc (Yuan et al., 2013).
H2AX is a member of histone H2A family, which is one of the five types of histones that package and
organize eukaryotic DNA into chromatin. The basic composition of chromatin is the nucleosome. Each
nucleosome consists of eight histone molecules, two from each of the four core histones (H2A, H2B,
H3, and H4) to form an octamer, which is wrapped by approximately 146 b ase pairs of DNA (Yuan et
al., 2013). The γH2AX assay represents a fast and sensitive approach for detection of DNA DSBs
induced by cancer therapeutics. There is a linear relationship between the number of γH2AX foci and
DNA DSB in a cell, as DSB increase so does the number of γH2AX foci and as DSB are repaired the
number of γH2AX foci decreases. This can be quantified to the number of foci per nucleus and can be
determined if the drug is efficient or not (Bonner, Martin, & Lobachevsky, 2011). The assay uses the
phosphorylated serine-139 residue on γH2AX as a biomarker to quantify the amount of foci per
nucleus.
The gold standard methods in performing γH2AX assays are to use flow cytometry and confocal
microscopy to detect and quantitatively measure the induction of fluorescent foci. Both methods involve
the use of a rabbit polyclonal antibody with specificity for γH2AX, with a fluorescent probe to allow
quantification. Flow cytometry is a technique for quantification and examination of a cell population. The
cells are incubated with the fluorescently labelled antibody and aspirated one by one in droplets in a
hydrodynamic stream of fluid. This passes through a series of lasers and detectors, and there are a
number of detectors which measure different properties such as side scatter, forward scatter and
fluorescence at a particular wavelength. This is used to quantify the bound fluorescently labelled
24
antibody to γH2AX per cell nucleus (Jahan-Tigh, Ryan, Obermoser, & Schwarzenberger, 2012).
Confocal microscopy is a microscopic technique which uses a small pinhole aperture allowing only the
light emitting from the desired focal spot to pass through and therefore eliminate any out of focus light.
By using the pinhole aperture the resolution is greatly increased leading to the ability to focus on a
particular area for examination. The areas focused on are that of fluorescence caused by the antibody
binding to γH2AX in the nucleus of the cells (Nwaneshiudu et al., 2012). Images can be taken of the
area and manual quantification can be performed to quantify the amount of cells with labelled
antibodies.
Figure 1.11: Sample of ƴH2AX foci (Green) at DSB sites (Indicated with arrows). Confocal image from
THP-1 cell line exposure to IC25 value of Cisplatin for 24 Hours.
Mitosis
25
1.7.2 Induction of Apoptosis by silver (I) complexes
Apoptosis is a conserved process designed to removed damaged or extraneous cells from an organism
without inducing inflammation (Maag, Hicks, & Machamer, 2003). Apoptosis can occur in two pathways;
the Extrinsic (Death Receptor Pathway) or the Intrinsic (Mitochondrial Apoptotic Pathway). The Intrinsic
pathway is activated when the mitochondria of the cell is damaged due to a variety of toxic agents
which would include these test silver(I) compounds MD4 and MD5.
The Bcl-2 protein family play a vital role in the deciding if a cell will live or d ie, they are divided into pro-
apoptotic and anti-apoptotic (Gross, Mcdonnell, & Korsmeyer, 1999). Following a death signal, cytosolic
and monomeric pro-apoptotic BAX translocates to the mitochondria where it becomes an integral
membrane protein and cross-links as a homodimer (Gross et al., 1999). The integration of BAX and
another pro-apoptotic protein BAK leads to the release of cytochrome c to the cytosolic which begins
the downstream biochemical reactions which lead to apoptosis by binding to and activating the
apoptosome.
Caspases are the general death causing proteins used in apoptosis; they orchestrate the cellular and
biochemical reactions in order to cause the cell to die. There are two main types of Caspases; Initiator
and Effector. Initiator caspases exist in cells as inactive monomers, which are activated by the
formation of dimers (induced proximity) and subsequent stabilisation with cleavage at their aspartate
residues. Caspase 9 is the initiator caspase in the intrinsic pathway. Caspase 9 is activated by the
formation of the dimers in a protein called the apoptosome which in turn is activated by the release of
cytochrome c from the mitochondria into the cytosol. There are three executioner caspases; 3, 6 and 7.
Caspase 3 being the main effector, and they exist as inactive dimeric zymogens (pro -caspases) until
activation. They are activated by the cleavage at specific aspartate residues between a small and a
large subunit to yield a mature executioner caspase (active). Cleavage (activation) of the executioner
caspases are mediated by upstream initiator caspases. Once activated, the executioner caspase can
26
cleave different proteins which in turn bring about the morphological changes which occur during
apoptosis such as DNA fragmentation, membrane blebbing and the formation of apoptotic bodies.
Figure 1.12: Animation of the Intrinsic Pathway of Apoptosis; A – Bcl-2, B – Bim, C – Caspase 9 and D
– Caspase 3 (Testa, 2004).
This apoptotic study involved the analysis of the intrinsic apoptotic genes expressed in THP-1 cells
exposed to MD4 and MD5 novel silver (I) compounds. The method involves q uantifying the gene
expression in real time by Real Time Polymerase Chain Reaction (RT-PCR) of the target gene
transcripts against a reference gene transcript (housekeeper genes) using SYBR green technology.
RT-PCR has three major steps; Denaturation, Annealing and Elongation (Extension) (Edwards,
Saunders and Logan, 2004).
27
The cDNA is denatured at a high temperature to single stranded DNA. During the annealing step of real
time PCR, the forward and reverse primers hybridise to the target mRNA, this forms small regions of
double stranded DNA (dsDNA) where the SYBR green can intercalate, therefore producing a
fluorescent signal. In the elongation step, more dsDNA is formed and therefore the SYBR green can
intercalate and increasing the fluorescence more so. At the end of this step when the maximum SYBR
green has intercalated, the complete fluorescence is measured. Melting curve analysis (Tm) is
performed to determine that only the specific target product has been detected and prevents error in
final data analysis. One melting peak represents one amplicon (Edwards, Saunders and Logan, 2004).
During denaturation the SYBR green is released and fluorescence is greatly reduced. Primers (forward
and reverse) then anneal to the two separate single strands and a PCR product is generated using
dNTPs (Deoxynucleotide triphosphates) which act as “building blocks” for the PCR product and TAQ -
Polymerase which is derived from the thermo tolerant bacterium Thermus aquaticus. When the
polymerization is completed the SYBR green dye binds to the double stranded PCR products which
results in a net increase in fluorescence. The RT-PCR cycles continue until the cycle threshold (set by
the housekeeper genes – Actin and Tubulin) are complete (Edwards, Saunders and Logan, 2004).
28
Figure1.13: Animation of RT-PCR using SYBR Green technology
A number of apoptotic genes were analysed to determine if the silver(I) in MD4 and MD 5 had any
effects on the level of gene expression. Bcl-2 was analysed as it has a pivotal role in deciding if a cell
should undergo apoptosis or not, BIM a member of the Bcl-2 family with a BH3 domain which interact
with Bcl-2 to suppress its anti-apoptotic activity (Gross et al., 1999). Caspase 9 is an initiator caspase
which forms a complex with APAF-1 to form the apoptosome and Caspase 3 is an executioner caspase
which is activated to ensure that cell death is executed. These caspases were analysed as increased
expression of these genes can indicate the activation of the intrinsic p athway of apoptosis and that they
are fundamentally linked to each other. NF-κB (nuclear factor kappa-light-chain-enhancer of activated B
cells) expression was also analysed. NF-κB is a transcription factor which when activated can localise
into the nucleus and bind to DNA as specific enhancer regions to up-regulate anti-apoptotic genes
(Lamkanfi, Declercq, Vanden Berghe, & Vandenabeele, 2006). As regards the anti-apoptotic activity of
29
NF-κB it has been shown to increase the expression of X-IAP (X-Chromosome Linked Inhibitor of
Apoptosis), X-IAP prevents activation of pro-caspase 9 and also blocks the catalytic cleft of caspase 3
thus inhibiting its activity (Karin & Lin, 2002). Interleukin 6 (IL-6) is a cytokine which plays a major role
as a signal transducer in inflammation (Scheller, Chalaris, Schmidt-Arras, & Rose-John, 2011). Once
activated IL-6 can lead to the increased expression of other inflammatory genes through a Mitogen
Activated Protein Kinase (MAPK) pathway.
1.7.3 Anti-inflammatory responses of silver (I) compounds
NF-κB and IL-6 gene expression were measured to test the hypothesis that MD4 and MD5 has role to
play in the inflammatory response in cells and could potentially be anti -inflammatory compounds. The
inflammatory response is less toxic to cells and considering that the silver (I) compounds show medium
toxicity to cells, then the inflammatory response may be an alternative or additional biological mode of
action.
NF-κB as described above as a role to play in apoptosis but it also plays a key role in inflammation by
regulating the expression of many target genes that mediate distinct events in the inflammatory
response (Staal, Bekaert, & Beyaert, 2011). IL-6 is a key cytokine that is immediately stimulated in an
innate immune response in monocyte/macrophage cells (such as the THP-1 cells used) when they are
invaded by a potential pathogen.
This study involved using the methodology described in section 1.7.2 above to measure key genes
expressed in an innate inflammatory response; IL-6 and NF-κB. This was a preliminary study to
compare DNA damage and an apoptotic response to a less toxic inflammatory response.
30
1.8 Project synopsis and future directions
In this study, an analysis of two promising silver(I) complexes named MD4 and MD5 was carried out to
investigate their biological mode of action and potential use as chemotherapeutic drugs as alternatives
to Cisplatin and its derivatives currently on the market.
THP-1 cells were used to first consolidate the hypothesis that MD4 and MD5 cause DNA damage and
initiate apoptosis in cells as a consequence. THP-1 cells were then used to measure an alternative less
toxic mode of action as MD4 and MD5 were suggested to have anti -inflammatory properties. THP-1
cells were chosen on the basis to develop the latter hypothesis further as part of a new PhD research
project for the future. The silver(I) complexes themselves are in a very early stage of biological analysis
and many different cellular mechanisms need to be explored to elucidate their potential as drugs for
chemotherapy.
31
2.0 Materials and Methods
2.1 Novel Silver(I) drugs
Both MD4 and MD5 complexes were derived from the PhD thesis study of Laura Thornton (2012). Both
complexes were synthesised in this study and were kindly donated by her supervisor Prof. Michael
Devereux, Director and Dean of the College of Sciences and Health at DIT. MD4 was present in a
colourless powder and was insoluble with common solvents. MD5 was present as a yellow powder.
As well as the two silver(I) complexes, two other clinically available were selected for analysis and to
function as controls. Cisplatin Cl2H6N2Pt+2 (Sigma-Aldrich) and Mitoxantrone C22H28N4O6 (MXT)
(Sigma-Aldrich) were selected because they had been used in all of the original biological evaluation
studies by Thornton (2012).
2.1.1 Solubilisation of Silver(I) drugs and clinically available controls
Prior to any of the biological experiments to be conducted all of the drugs were put into solution
(solubilised). MXT, MD4 and MD5 were solubilised in Methanol (MeOH) and Cisplatin was solubilised in
H20 with 2.5% NaCl.
A stock concentration of the solution was determined through calculations based on the molecular
weight of the compound and the final stock concentration. The adequate amount of drug was weighed
out and was made soluble in 5ml of the coinciding solution named above. See Table 2.1 for details on
the molecular weight, stock concentration, stock volume and solution the compounds were made
soluble in.
32
Table 2.1: Metal based drugs stock solution components.
2.1.2 Viscosity testing on drug complexes
The samples of drugs demonstrated a small degree of insolubility and therefore viscosity was
measured. 10 mls of each sample was placed into a small plastic cup, this cup was then placed
appropriately into a SV-10 Viscometer, which measure the viscosity of liquids. The sensory plates and
temperature probe were lowed to the indentation of the probes and the measurement commenced.
Results were presented in millipascal (mPa).
Metal Based Drug Mw Desired [Stock] Stock Volume Amount of drug Solution
Cisplatin 300.05g/mol 2mM 5ml 3.0005mg H₂0 2.5% NaCl
MXT 454.44g/mol 2.5mM 5ml 5.68mg MeOH
MD4 430g/mol 2.5mM 5ml 5.37mg MeOH
MD5 1385g/mol 2.5mM 5ml 17.31mg MeOH
33
2.2 Cell culturing methods of THP-1 Cell Line
2.2.1 THP-1 Cells
THP-1 is a human monocytic cell line derived from the peripheral blood of a one year old male with
acute monocytic leukaemia. The THP-1 cells were obtained from the American Tissue Culture
Collection (ATCC). Monocytes are polymorphogranular leukocytes, meaning that they have granule s in
their cytoplasm as well as a multi-lobed nucleus. However the THP-1 cell line is cancerous and
histological analysis shows that in contrast to the non-cancerous monocyte they possess a much larger
circular nucleus and a smaller cytoplasmic area due to the immature cells being produced due to the
cancer.
2.2.2 Culturing conditions THP-1 Cell Line
The cell line THP-1 was resuscitated from liquid nitrogen and grown up in Roswell Park Memorial
Institute media (RPMI 1640, Sigma). The media was also further supplemented with 60ml of Foetal Calf
Serum (Gibco) and 5ml of L-Glutamine (Gibco) to further aid growth of the cell line. The cell line stock
was cultured in T75 cell culture flasks (Corning) and incubated at 37°C with 5% CO² and 95% O2. THP-
1 cells are grown in suspension and were recorded to have a doubling time of 24-48hours. It was vital
to ensure a sterile environment when handling the mammalian cell line to avoid contamination with
microorganisms. Therefore aspectic technique was practiced at all times during culturing and
experimentation. See 5.1.2 for details of aseptic technique and 5.1.3 for the growth characteristics of
THP-1 cells.
The THP-1 cell line was easily sub-cultured as the cells were already grown in suspension. To
subculture the cells, the media from the T75 flask was transferred to a sterile tube and centrifuged to
condense the cells. The supernatant was poured off into a discard jar and the pellet was re-suspended
in 50ml of fresh supplemented RPMI 1640 media. Cell cultures were transferred in 5 and 10ml volumes
to T75 flasks and topped up to a total volume of 50ml to increase the number of cells in culture and
34
accommodate the large number of experiments. This was necessary to ensure the cell line remained
viable throughout the study. See 5.1.2 for a more detailed protocol.
2.2.3 Cell Counting and Plating
In order to determine the amount of THP-1 cells in suspension and to ensure that correct amount of
cells are used for each experiment the THP-1 cells were counted using a Coulter Counter (Beckman
Coulter). 1ml of the cell suspension was placed into 20ml of Isoton electrolyte solution (Beckman
Coulter) in a dilivial. The instrument itself was pre-set to count cells per 0.5ml. Prior to a cell count, a
background count was performed on just Isoton solution to ensure that the instrument was clear and
ready to measure the cell suspension.
The final count from the coulter counter was obtained and the background count subtracted. The value
obtained was then multiplied by 42 (probe reads 0.5ml; the total volume in the dilivial is 21mls x 2,
yielding 42) to get the number of cells per ml of suspension. See 5.1.5 for a more detailed protocol on
using the Coulter Counter.
35
2.3 MTT Cytotoxicity Analysis
The cytotoxic properties of MD4 and MD5 along with the clinically available anti- cancer drugs cisplatin
and mitoxantrone were investigated using a standard MTT assay against the human derived cell line
THP-1. The cytotoxicty of these 4 compounds were analysed at a 24 hour and a 48 hour exposure.
This cytotoxicity data allows for the calculation of IC25 values (inhibitory concentration) for each
complex.
2.3.1 MTT assay on THP-1 cells
This is a colorimetric assay that measures the reduction o f yellow 3-(4,5-dimethythiazol-2-yl)-2,5-
diphenyl tetrazolium bromide (MTT) by mitochondrial succinate dehydrogenase. The MTT enters the
cells and passes into the mitochondria where it is reduced to an insoluble, coloured (dark purple)
formazan product. The cells were then solubilised with an organic solvent; Dimethyl Sulfoxide (Sigma-
Aldrich) and the released, the solubilised formazan reagent was measured spectrophotometrically.
Since the reduction of MTT can only occur in metabolically active cells the level of activity is a measure
of the viability of the cells. Cells that are non-viable or dead will not show any metabolic activity and
therefore will not reduce the MTT.
In order to determine the effectiveness and the concentration of the metal based drugs to induce cell
death over a 24 hour and a 48 hour exposure, the MTT Assay was set up using 12.5mM, 25mM,
50mM, 100mM and 200mM of the drugs and negative controls for the assay on 96 well round bo ttom
cell culture plates (Fisher Scientific) (See Table 5.2 for image for the set up of each plate). In order to
coincide with statistical validity the plates were set up in triplicate and the assay was repeated three
times. For the 24 hour time point, the plate wells were seeded to a total volume of 100µl (cells and
media) in the plates with 1x104 cells and 1x105 cells for the 48 hour time point. The plates were pre-
incubated at 37°C for 24 hours to ensure cells were able to recover and re -enter the log phase due to
stress induced by the experimental setup. After the pre -incubation, the plates were centrifuged and the
36
supernatant was removed using a multi-channel pipette. The cell pellets were re-suspended in the drug
stock solution diluted with cell culture media to the required concentration described above and for
either 24hour or 48 hour exposure time points.
After the 24 hour or 48 hour drug exposure time point the plates were centrifuged and washed in
Phosphate Buffer Saline (PBS) three times. After washing the pellet was re -suspended in 100µl MTT
reagent and incubated at 37°C for 3 hours to allow the reaction to occur. After reaction, the plates were
centrifuged and washed three times in PBS ensuring that the formazan salts were firmly attached to the
bottom of the wells. The formazan salts were re-suspended in 100µl Dimethyl Sulfoxide (DMSO)
(Sigma-Aldrich) and placed on a bench top plate shaker for 15 minutes.
2.3.2 Spectrophotometric analysis
The absorbance of the MTT reduced cells on the plates was read by spectrophotometer (1420
Multilabel Counter Victor3V) at 595nm wavelength. The data obtained from the absorbance were
analysed and their cytotoxic concentrations calculated.
2.3.3 Statistical analysis
Each plate had five replicate concentrations and the assay was repeated three times and in each
separate repeat there were three replicates per drug exposure. This was done for statistical validity and
led to the collection of large amounts of raw data of absorbance values. Absorbance values were
exported from the 1420 Multilabel Counter Victor3V to Microsoft Office Excel. Basic statistical
calculations were performed using Excel, the mean absorbance per individual triplicate this led to the
normalisation of the means (The average of the negative control being 100%). Standard deviation was
also calculated in order to assess any significant errors across the assays. An Excel software addition
known as ‘XLFIT’ (ID Business Solutions) was used to calculate the IC25 values of the individual
replicates across the three separate assays. The average IC25 value for each drug and exposure time
was then calculated.
37
2.4 Gamma H2AX foci induction and analysis
2.4.1 Gamma H2AX assay on THP-1 cells
Five T25 flasks of THP-1 cells in 5mls of supplemented RPMI1640 media (as described previously)
were set up for each time exposure; Negative control, Cisplatin, MXT, MD4 and MD5. The appropriate
drug:media amount to equate the IC25 values were added to a total volume of 5mls for 24 hrs and 48
hrs. After each time exposure, the cell suspension in each T25 flash was transferred to sterile tubes
and centrifuged at 400g for 5 minutes at room temperate. The supernatant was removed and the pellet
was re-suspended in 5mls of PBS and centrifuged as before. The cell pellet was fixed in 200µl of 2%
paraformaldehyde (See 5.2.4) and allowed to stand for 10 minutes. The tubes were centrifuged as
before and the supernatant was removed and tubes were allowed to blot dry for 5 minutes. The pellets
were re-suspended and transferred to eppendorf tubes in 1ml of 70% ice cold ethanol (See 5.2.4).
Samples were stored in the freezer overnight.
The samples were centrifuged at 1200rpm for 5 minutes at room temperature to acclimatise the
samples from the freezer. Once the supernatant was removed the pellet was re -suspended in200µl
0.25% Triton X-100 (Sigma-Aldrich) (Appendix 2: 5.2.4) and allowed to stand at room temperature for 5
minutes. The samples were then centrifuged as before and once the supernatant was removed the
pellet was re-suspended in 200µl of 2% Bovine Serum Albumin (Sigma-Aldrich) (See 5.2.4) and
allowed to stand for 30 minutes. The samples were centrifuged and the supernatants were removed.
The pellets were re-suspended in 100µl of the primary antibody (Millipore) (1:500) (See 5.2.4) and
incubated at room temperature for 1 hour. After incubation the samples were centrifuged as before and
washed in 300µl of PBS three times. 100µl of the secondary antibody (Millipore) (1:200) (See 5.2.4)
was added to re-suspend the pellet and incubated at room temperature for 1 hour in the dark. After the
incubation the cells were centrifuged as before and washed in 300µl of PBS three times. The counter
38
stain; popidium iodide (PI) (Sigma) (1:100) was added to the samples at a volume of 350µl with PBS.
The samples were then ready for subsequent flow cytometry and confocal analysis.
2.4.2 Flow cytometric analysis
250µl of each of the samples were placed into sterile glass tubes as well as an unstained negative
sample. The flow cytometry analysis was performed using a C6 Flow Cytometer (Accuri®). The flow
cytometer analyses the cells as they pass through the machine in a sheath fluid through a series of
forward scatter, side scatter and photo-detectors. This quantifies the cells based on their size,
granularity and the presence of the fluorescently antibody labelled dye. The scattering of light and
intensity of the fluorescence can be quantified and presented on scatter plot histograms. Mean
Fluorescent Intensity (MFI) and the percentage of H2AX positive cells was calculated from each
sample.
2.4.3 Confocal analysis
100µl of each cell sample was placed on a glass slide using a cyto spin at 1200rpm for five minutes. #0
thickness coverslips (0.080-0.120 microns) (Zeiss) were applied using mounting media and sealed
using clear nail varnish on each of the sample slides to avoid oxidation of the fluorescently labelled
antibodies.
The slides were read using the Zeiss LSM© 510 Meta Confocal Microscope using LSM© software
(Germany) and the images were processed with imageJ software.
39
2.5 Gene expression analysis in THP-1 cells
Many different genes and proteins contribute to the initiation o f apoptosis or an inflammatory response.
These specific regulatory proteins have their expression increased or decreased according to their
gene activity. Genes that are expressed transcribe mRNAs that are subsequently translated into their
protein counterpart causing a cellular response in cells according to the molecular machinery Therefore
measuring gene expression is often the first level of measuring a molecular response. Gene
expression of specific apoptosis and inflammatory targets were analysed through RT-PCR. Each target
gene has specific Forward and Reverse primers (as a set) which amplify out the target gene sequence.
The primer sequences used for this project were designed in house and synthesised by Sigma-Aldrich.
Table 2.2 and 2.3 show the primer set sequences for Apoptotic and inflammatory gene targets
respectively. Table 2.4 shows the primer set sequences for the house -keeper reference genes.
Apoptotic Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
Bcl-2 AAGTCTGGGAATCGATCTGG AATGCATAAGGCAACGATCC
BIM TTCGACGAGCATGTTATTGG CTGATGCTGACAGTGCATCC
Caspase 9 AATGCTGTTTCGGTGAAAGG CAAGATAAGGCAGGGTGAGC
Caspase 3 GAGGCCGACTTCTTGTATGC TGTCGGCATACTGTTTCAGC
NF-κB TCTGTGTTTGTCCAGCTTCG GCTTCTGACGTTTCCTCTGC
Table 2.2: Primer sets for apoptotic genes.
Inflammatory Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
IL-6 GATGCAATAACCACCCCTGACCC CAATCTGAGGTGCCCATGCTAC
Table 2.3: Primer set for inflammatory genes.
Housekeeper Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
Actin ACTCTTCCAGCCTTCCTTCC GTTGGCGTACAGGTCTTTGC
Tubulin GCTTCTTGGTTTTCCACAGC CTCCAGCTTGGACTTCTTGC
Table 2.4: Primer sets for housekeeper genes.
40
2.5.1 RNA isolation
The T25 Flasks of THP-1 cells were set up and exposed as per 2.4.1 above. After exposure the
samples were centrifuged and washed as above three times. From that point on extra care was taking
when handling the samples to avoid contamination by RNases. RNase is a ubiquitous enzyme which
can essentially chop up single stranded RNA into small fragments. Therefore throughout the RNA
extraction the following measures were taken. Gloves were worn at all times, Pipette tips; eppendorf
tubes and glassware were all treated with RNase AWAY (Molecular BioProducts) and autoclaved. All
work surfaces were pre-treated with RNase AWAY. All extractions were carried out on ice. All
eppendorf tubes were labelled accordingly and placed on ice.
After the cell washing steps cell pellets were re-suspended in 2mls of Tri-reagent (Sigma-Aldrich) and
1ml of each sample was placed into 1.5ml eppendorf tubes and stored in the freezer at -80°C.
Samples were thawed out on ice, vortexed briefly and allowed to stand at room temperature for five
minutes. 0.2ml of Chloroform (Romil) was added to each sample in the fume hood. Samples were
mixed and allowed to stand for two minutes at room temperature. Samples were placed in a centrifuge
at 12000g for 15 minutes at 4°C. This separated the sample into three phases, a lower phase of red
colour containing protein, an interphase of DNA and a colourless upper aqueous phase containing
RNA.
150µl of the upper aqueous phase was carefully pipetted out of each sample into RNase free
eppendorf tubes. 0.5ml of isopropanol (2-propanol; Sigma) was added to each sample in the fume
hood. Samples were vortexed briefly and allowed to stand at room temperature for five minutes.
Samples were placed in a centrifuge at 12000g for 10 minutes at 4°C, and this allowed a RNA pellet to
form with each sample. Supernatant was removed by careful pipetting and the pellets were washed in
1ml 70% ethanol (Merck). Samples were placed in a centrifuge at 12000g for five minutes at 4°C. The
41
supernatant was poured off into a discard jar and samples were allowed to air dry for 10 minutes. The
RNA pellets were re-suspended in 30µl of DEPC H2O.
2.5.2 RNA Quantification
Each extracted RNA sample was quantified using a Nanodrop spectrophotometer (Maestro Gen). The
Nanodrop was blanked with 2µL DEPC (Diethyl Pyrocarbonate) treated water (See 5.2.5). The
concentration of the RNA was determined by carefully placing 2µL of each RNA sample onto the
Nanodrop probe. A ratio of absorbance at different wavelengths (Absorbance 260:280) was calculated
and samples were selected based on whether the fell in between or around the permitted ratio range of
1.8 – 2.1 which indicates high quality RNA samples.
𝐴260𝑛𝑚
𝐴280𝑛𝑚
Equation 1: Ratio of absorbance between proteins and nucleic acids.
Concentration values (ng/µl) were also computed by the Nanodrop and then recorded for subsequent
cDNA synthesis.
2.5.3 cDNA synthesis
In order to synthesis complimentary deoxyribonucleic acid (cDNA) a standardised concentration of RNA
(ng/µl) was used of each RNA sample to reverse transcribe into cDNA using a qScript cDNA synthesis
kit (Quanta Biosciences). Samples were thawed out on ice and 0.2ml eppendorf tubes were labelled
appropriately and also placed on ice. The components of the qScript cDNA kit were also placed on ice.
4μl of qScript Reaction Mix (5x concentrated solution of optimised buffer, magnesium, olig(dT) and
random primers and dNTPs (dinucleotide phosphates)), 1μl qScript Reverse Transcriptase, the volume
of RNA at the concentration of the lowest sample in a 5µl standard (made up in DEPC water) were
added to the tubes to keep the amount of RNA in each sample the same (See 5.3.3). Tubes were
42
mixed gently and placed in a Thermo Cycler (Techne) which initiated the correct temperature and time
for the reverse transcription of the RNA into cDNA.
2.5.4 High-throughput Real-time PCR analysis
The synthesised cDNA served as the template for the RT-PCR reaction. Specific Primer set Master
Mixes were setup for each of the genes to be expressed (see Tables 2. 2, 2.3 and 2.4c for all the
primer sets). Each Master Mix comprised of 84µl of PCR grade H2O (DEPC treated H2O), 140µl SYBR
Green (Roche), 14µl forward primer (5’-3’) and 14µl reverse primer (3’-5’). 18µl of each corresponding
primer set master mix was added to a 96 well RT-PCR plate (Roche) (See Figures 5.5 and 5.6 for each
RT-PCR set up for 24 hour and 48 hour exposure). 2µl of the corresponding cDNA was added to the
plates. The plates were sealed with specific sealing foil and centrifuged at 1500rpm for two minutes at
4°C. Plates were plated in the Light Cycler 480 (Roche) RT-PCR machine for gene analysis.
2.5.5 Analysis of Gene Expression Data
The expression levels each of the target genes was measured using RT-PCR in the LC480 machine
along with the reference genes. The quantitative endpoint for real-time PCR is the threshold cycle (Ct or
Cp). The Ct is defined as the PCR cycle at which the fluorescent signal of the reporter dye crosses an
arbitrarily placed threshold. The numerical value of the Ct is inversely related to the amount of amplicon
in the reaction (i.e., the lower the Ct, the greater the amount of amplicon) (Livak & Schmittgen, 2001).
The LC480 determines the Ct values for each of the target genes and reference genes. From the Ct
values of the target genes and the reference genes, the 2⁻∆∆Ct value was calculated for each of the
target genes. 2⁻∆∆Ct value was used to compare the levels of two different gene expressions, one being
the untreated sample (Negative) and the other the treated sample to MD4 and MD5 (Pfaffl, 2001). This
gives the mean fold change of gene expression over a period of time (24 hour or 48 hour).
43
3.0 Results
3.1 Metal based complexes
3.1.1 Viscosity results
The viscosity level of the drug samples were tested due to solubility issues. When selecting the
chemical solution to dissolve the drugs, the effects of this chemical on the cells themselves must be
taken into account. The chemical must be non-toxic to the cells to avoid firstly killing the cell population
or inducing false positives through cytotoxicity analysis. Methanol (MeOH) was selected as the
chemical to dissolve the drug complexes in. However Cisplatin historically is extremely insoluble in
MeOH. Therefore Cisplatin was made soluble in a water and low salt concentration solution. The
complexes could have been made soluble in an inorganic solvent such as DMSO but again this would
be extremely toxic to the cell population and care needs to be taken that the concentration of DMSO
used for dissolving drugs is below 2%. Due to the large Molecular Weight of MD5 it was hard to get into
solution and had to be mixed quite vigorously throughout the experimental protocols to ensure the drug
stayed in solution, the same for MD4. As regards the viscosity results, the higher the result in mPAS
units, the more viscous the drug solution is (insoluble). Cisplatin, MXT and MD5 had a low level of
viscosity and therefore possessed a good solubility profile (See Table 3.1). MD4 yielded a viscosity
profile of double compared to the other three compounds (See Table 3.1), which showed that it was
partially insoluble in MeOH.
44
Drug mPAS
Cisplatin (H2O and 2.5% NaCl) 0.33
MXT (MeOH) 0.34
MD4 (MeOH) 0.71
MD5 (MeOH) 0.35
Table 3.1: Viscosity results of all complexes
45
3.2 Cytotoxicity of Silver (I) compounds MD4 and MD5 compared to
Cisplatin and MTX controls using the MTT Assay
The IC25 (the compound concentration that inhibits the proliferation rate cancer cells by 25% as
compared to the control untreated cells) was calculated by averaging the IC25 values from each of the
three independent MTT Assays. The IC25 values were calculated over a 24 Hour and 48 Hour
exposure to the complexes. Table 3.2 below contains the results for the mean IC25 values for the
complexes over both exposure time points.
Cisplatin was less sensitive than the other three complexes, but its IC25 is reduced between the 24
hour and 48 hour time points which indicated that a prolonged exposure to cisplatin is more effective.
Similarly both the control compound MXT and the test compound MD4 have similar IC25 values, but
they do not change drastically over a prolonged exposure as seen with cisplatin, which indicated that
both MXT and MD4 were not as effective over a prolonged exposure. In contrast MD5 was the most
sensitive of the four compounds as it had the lowest IC25 values over both time points. Its IC25 vale
was reduced radically to half at the 48 hour time point which showed a similar pattern to cisplatin that it
is more effective over a prolonged period of time.
24 Hour Exposure 48 Hour Exposure
Cisplatin MXT MD4 MD5 Cisplatin MXT MD4 MD5
AVERAGE IC25
(µM) 64.72 57.74 68.69 29.8 32.05 45.28 57.9 14.94
Table 3.2: Average IC25 Values of all complexes from the 3 independent MTT assays.
46
Figures 3.1 and 3.2 represent the percentage reduction in viable cells versus the increasing
concentration of drug used in the MTT assay over the 24 hour and 48 hour time points. The 100%
value is the number of viable cells in the negative (untreated) control sample.
Cisplatin over a 24 hour time point at a low concentration showed a proportional reduction in the
number of viable cells as the concentration of the drug increased. And in the 48 hour time point a low
concentration proved to significantly reduce the number of viable cells, which suggested again that
cisplatin is more effective over a longer period of time.
47
Figure 3.1: Percentage reduction in viable cells with increasing concentration of each drug over a 24
hour exposure.
Figure 3.2: Percentage reduction in viable cells with increasing concentration of each drug over a 48
hour exposure.
48
3.3 ƴH2AX
3.3.1 Flow Cytometery Results
Results from the flow cytometer are presented below in Figures 3.3 (24 hour exposure) and 3.4 (48
hour exposure) below; results are presented in bar chart form. Histograms (scatter plots) were
generated from the flow cytometer. Each of the histograms represents THP-1 cell lines exposed to the
IC25 of the corresponding drug complex in their expression (or not) of fluorescently labelled ƴH2AX foci
representing the level of DSBs. The X axis contains the concentration of FL-1 which is the ƴH2AX foci
and the Y axis contains the concentration of FL-3 which is Popidium Iodide (PI) (Counterstain).
Figure 3.3 and 3.4 represents the Mean Fluorescence Intensity (MFI) for all samples exposed to the
IC25 value for a 24 hour period and for a 48 hour period respectively. Therefore, a high MFI value
represents an increase in the level of ƴH2AX expression in the cell population and therefore a higher
amount of DNA damage through DSBs.
Cisplatin showed a large MFI value exceeding the negative control at the 24 hour exposure and this is
consistent at the 48 hour exposure meaning that cisplatin induces DSB DNA damage initially and this
does not increase over time (plateaus). The flow cytometry histogram in Figure 3.6 compared the
expression of ƴH2AX foci presence in the Cisplatin control samples for the 24 Hour and 48 Hour
Exposure. For the 24 hour exposure the upper right quadrant was virtually full of scatter dots indicating
the presence of the fluorescently labelled antibody and therefore ƴH2AX foci. In the 48 hour exposure
the upper right quadrant had the presence of scatter dots however was not as severe as the 24 hour
exposure.
MXT showed relatively low values of MFI below the negative control values for both the 24 and 48 hour
exposure. These low values compared to the histogram in Figure 3.7 verified that there were little
fluorescently labelled antibodies indicating ƴH2AX foci in the THP-1 cells exposed to MXT as both the
49
upper right quadrants in the 24 hour and 48 hour exposure contain little or none scatter dots. In
comparison the upper left quadrant was heavily dotted in both exposures due to the high levels of
popidium iodide, (PI is the counter stain used in the ƴH2AX immunostaining procedure, a high
concentration of this can indicate that there is no presence o f secondary antibodies) and therefore no
presence of ƴH2AX foci in THP-1 cells exposed to MXT. These results show that MXT does not
damage DNA by inducing DSB and possibly has a different biological mode of action compared to
Cisplatin.
MD4 had very little MFI in the 24 hour exposure however in the 48 hour exposure it dramatically
increased exceeding the negative control and exceeding the additional effect observed in Cisplatin at
this time point. This would suggest that MD4 is equally as effective at forming DSBs as cisplatin but it
takes longer to bind to DNA than cisplatin with the effect only evident at 48hrs and not 24hrs. The MFI
values were proportional to the histogram results in Figure 3.8, the 24 hour exposure shows a high
concentration of scatter dots in the upper left quadrant indicating presence of PI and therefore no
secondary antibody interaction and the 48 hour exposure shows a relative concentration of scatter dots
in the upper right quadrant indicating presence of ƴH2AX foci.
MD5 showed some ƴH2AX foci with a moderate MFI value for the 24 hour exposure but was below the
negative control, however the MFI value for the 48 hour exposure drastically increased to >1,100,000
indicating that there is a high concentration of ƴH2AX foci present. In contrast to all other control and
test complexes this MFI value was by far the largest and was consistent with the DNA binding and
intercalating studies by Thornton., 2012 which showed that MD5 had avid DNA binding and
intercalating ability due to its additional phenanthroline groups attached to the silver molecules. The
histogram in Figure 3.9 shows a proportionate relationship between the presence of ƴH2AX foci (upper
right quadrant) and PI (upper left quadrant) this contributes to the moderate MFI value fo r the 24 hour
exposure. The 48 hour exposure histogram showed a population of high concentration scatter dots in
50
the upper right quadrant with a low concentration of scatter dots in the upper left quadrant, thus
indicating a high concentration of ƴH2AX foci and therefore DNA damage in the THP-1 cell population.
Figure 3.3: Mean MFI Values for ƴH2AX Foci presence after 24 Hour exposure.
0
200000
400000
600000
800000
1000000
1200000
Negative Cisplatin MXT MD4 MD5
Delta Mean Flouresence Intensity (MFI) for FL-A (ƴH2AX) (Total MF1 minus background unstained MF1) 24 Hour Exposure
MF1 Values
52
Figure 3.4: Mean MFI Values for ƴH2AX Foci presence after 48 Hour exposure.
0
200000
400000
600000
800000
1000000
1200000
Negative Cisplatin MXT MD4 MD5
Delta Mean Flouresence Intensity (MFI) for FL-A (ƴH2AX) (Total MF1 minus background unstained MF1) 48 Hour Exposure
MF1 Values
Figure 3.5: Comparison of ƴH2AX foci presence in the Negative control samples for the 24 Hour and
48 Hour Exposure.
Figure 3.6: Comparison of ƴH2AX foci presence in the Cisplatin control samples for the 24 Hour and
48 Hour Exposure.
54
Figure 3.7: Comparison of ƴH2AX foci presence in the MXT control samples for the 24 Hour and 48
Hour Exposure.
Figure 3.8: Comparison of ƴH2AX foci presence in the MD4 test samples for the 24 Hour and 48 Hour
Exposure.
55
Figure 3.9: Comparison of ƴH2AX foci presence in the MD5 test samples for the 24 Hour and 48 Hour
Exposure.
56
3.3.2 Confocal Microscopy
Figures 3.10 and 3.11 below show Confocal microscopy images of the THP-1 cell line respectively
exposed to the novel silver(I) complexes and control complexes; Cisplatin and MXT at the IC25 values
determined from the cytotoxicity study. The images on the left of each figure represent the propidium
iodide cell counterstain which is a fluorescent intercalating molecule that binds in a non specific fashion
every 4-5 nucleotide bases. The images in the middle represent the γH2AX fluorescent green foci and
the images on the right hand side show the merged image from the left and middle. Confocal
microscopy images are a visual representation of the production of γH2AX fluorescent green foci due to
the exposure to the complexes.
Figure 3.10 below shows the confocal microscopy images for the THP-1 cell line after exposure to the
IC25 of each complex after a 24 hour period. The Negative exposure shows some positively labelled
γH2AX fluorescent green foci which are consistent with the background fluorescence measured as MIF
in the flow cytometry experiments described previous ly. Figure 3.11 below shows the confocal
microscopy images for the THP-1 cell line after exposure to the IC25 of each complex after a 48 hour
period. Similar to the 24 hour exposure the Negative exposure shows presence of γH2AX fluorescent
green foci. Again this could be due to the experimental procedure inducing DNA damage, cellular
debris or gamma rays in the environment.
The cisplatin control shows a large amount of γH2AX fluorescent green foci amongst the THP-1 cell
population. This coincides with flow cytometery results (see Figure 3.3 above) that cisplatin is inducing
DNA damages through DSBs in the cell population. This result is a benchmark for a positive control to
compare the novel silver(I) complexes to. The confocal microscopy image for cisplatin showed
presence of γH2AX fluorescent green foci in cisplatin exposed cells , however a large number of cells
were lost through the experimental procedure. The image present is of a single THP-1 cell which is
57
γH2AX positive. Results are indicative of the previous flow cytometery analysis that cisplatin expressed
a high level of γH2AX (see Figure 3.4).
The MXT control shows no presence of γH2AX fluorescent green foci. This result was expected as the
flow cytometer results as per Figure 3.3 also showed little γH2AX fluorescent green foci presence. This
results is therefore a potential benchmark for a negative control to compare the novel silver(I)
complexes to. And suggested that MXT is resistant to the production of γH2AX and therefore is
undergoing another mechanism of cytotoxic ability. Similar to the confocal microscopy images for the
24 hour exposure (See Figure 3.10) and the flow cytometery results (See Figure 3.4) the MXT has
shown no production of any γH2AX. This again coincides with the 24 hour exposure and interlinks with
the flow cytometery that MXT has another mode of cytotoxic action and not the ability to produce
γH2AX.
Similarly to results derived from the flow cytometer in Figure 3.3 MD4 shows no γH2AX fluorescent
green foci. Similar to the cisplatin exposure the MD4 exposure had a low number of cells presence for
confocal microscopy analysis, due to loss in the experimental procedure. However results based on a
single THP-1 cell indicate γH2AX which in turn is indicative of the flow Cytometery results previous in
that over a 48 hour period the presence of γH2AX foci is greatly increased compared to the 24 hour
exposure.
MD5 showed a significant amount of γH2AX fluorescent green foci, which indicate DNA damage
through DSBs. This coincides with results from the flow cytometer (see Figures 3.3 and 3.9) as they
both show a high concentration of γH2AX fluorescent green foci . The confocal microscopy images for
MD5 after the 48 hour exposure show a relatively high amount of γH2AX foci. This coincides with the
flow cytometery results (See Figure 3.4) where the γH2AX foci amount was the largest seen in all
58
complexes. Both results suggested that MD5 is extremely genotoxic, even more than the clinically
available control cisplatin.
59
Figure: 3.10: Confocal Microscopy Images for all complexes after 24 Hour Exposure.
Figure3.11: Confocal Microscopy Images for all complexes after 48 Hour Exposure.
Propidium Iodide ƴH2AX Merging
MD5
MD4
MXT
Cisplatin
Negative
60
61
3.4 Gene Expression
3.4.1 RNA Quantification of cell extracts exposed to average IC25
Table 3.3 below contains the relative quantitative results for the extracted RNA from cells exposed to
the complexes. The absorbance of light at 260nm was used to identify the concentration of RNA in a
sample and the absorbance at 280nm was used to identify protein concentration in a sample. Ideally for
RNA quantification the ratio of these two values (A260/A280) should be 1.8-2.1 to indicate high purity
RNA samples.
The ratio obtained after isolation of RNA from the THP-1 cells was between 0.856 and 1.662, this does
not fall between the ideal ratio of 1.8-2.1 however the results were deemed acceptable for subsequent
studies (due to time constraints). The ability to obtain pure RNA samples appeared to be greatly
reduced due to the cellular debris present from the comp lexes (due to partial insolubility properties).
Table 3.3: RNA Quantification results.
From Table 3.3 the lowest concentration of RNA 90.52ng/µl was set as the benchmark concentration
for cDNA synthesis. A concentration of 90.52ng/µl was thus needed in a 5µl volume for the cDNA
synthesis. See Table 3.4 below for calculations of the volume of RNA needed to achieve the
benchmark concentration of RNA.
Sample A260 A280 A260/A280 ng/µl Sample A260 A280 A260/A280 ng/µl
Negative 3.115 3.293 0.946 124.6 Negative 14.247 15.599 0.913 569.87
Cisplatin 6.202 6.294 0.985 248.09 Cisplatin 4.642 4.939 0.94 185.67
MXT 4.204 3.149 1.335 168.18 MXT 5.737 3.512 1.634 229.48
MD4 4.509 2.713 1.662 180.36 MD4 2.458 2.871 0.856 98.3
MD5 6.479 8.03 0.807 259.17 MD5 2.263 1.561 1.45 90.52
48 Hour24 Hour
62
24 Hour 48 Hour Volume of RNA (µl)
Volume of DepC H₂O (µl)
Volume of RNA (µl)
Volume of DepC H₂O (µl)
3.63 1.37 0.79 4.21
0.55 4.45 2.44 2.56
2.69 2.31 1.97 3.03
2.51 2.49 4.60 0.40
1.75 3.25 5.00 0.00 Table 3.4: Volume required of each RNA sample to make a 90.52ng/µl concentration in a 5µl solution.
63
3.4.2 RT-PCR analysis of apoptotic gene expression in THP-1 cells exposed to the
complexes at 24 and/or 48 hour exposures
Bcl-2 plays a vital role in determining whether or not a cell should undergo apoptosis or not. The
expression of Bcl-2 is increased both the control and test samples. Perhaps indicating either the pro- or
anti-apoptotic function of Bcl-2 (See Table 5.3.3f for gene analysis raw data). This Result was
significant as Bcl-2 is an essential protein needed for apoptosis and an increased expression of this
along with pro-apoptotic genes such as Bim indicate the initiation of apoptosis.
Figure 3.12: Bcl-2 gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.
64
Bim
As previously discussed Bim is a pro-apoptotic protein which acts on Bcl-2 to inhibit its anti-apoptotic
functions. An increase in gene expression to compared to that of the negative control is seen in
Cisplatin, MXT and MD5. More so in Cisplatin which is expected due to previous cytotoxic analysis.
Interestingly there is no increase of the gene in MD4 exposure. MXT also upregulates the expression of
Bim indicating that it is involved in initiating apoptosis, in contrast to ƴH2AX analysis it was not shown
to induce any DNA damage, therefore MXT is initiating apoptosis through another mechanism of
cytoxicity. See Table 5.11 for gene analysis raw data. Bim gene expression is increased in both the
MD4 and MD5 samples over the 48 hour period. The increased expression after a 48 hour period is in
contrast to no expression after a 24 hour period (See Table 5.17 for gene analysis raw data). These
findings were significant as Bim is a pro-apoptotic marker and indicated that the cells are signalling for
apoptosis over a longer period of time when exposed to both MD4 and MD5. And signalling apo ptosis
in a shorter period of time in MD5.
65
Figure 3.13: Bim gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.
Figure 3.14: Bim gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.
66
Caspase 9
As previously stated Caspase 9 plays a key role in the initiation of the intrinsic pathway of apoptosis
(Initiator Caspase), once activated it forms the apoptosome which in turn activates effector caspase 3.
An increase in caspase 9 gene expression would be suggestive of the initiation of Apoptosis. As
expected cisplatin has increased gene expression of caspase 9 due to the elicit DNA damage it was
causing to the THP-1 cells. In contrast MD5 shows minimal gene expression of caspase 9, which
indicated that there is a pro-apoptotic response over a short exposure to MD5 and MD4 did not express
the gene. See Table 5.12 for gene analysis raw data.
Figure 3.15: Caspase 9 gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.
67
Caspase 3
Caspase 3 is the main executioner caspase; it induces the cellular damage associated with apoptosis
once activated. Problematically the caspase 3 gene was not expressed in any of the sample complexes
including the negative control. This could be down to the primer set not amplifying out the target gene.
See Table 5.13 for gene analysis raw data.
68
3.4.3 RT-PCR analysis of inflammatory gene expression in THP-1 cells exposed to
the complexes at 24 and/or 48 hour exposures
NF-κB
NF-κB has the ability to induce an inflammatory response once activated and also increase the
expression of anti-apoptotic genes. It is expressed greatly in the cisplatin control perhaps initiating an
inflammatory response to the damage caused by the drug itself. The gene was not expressed in both
the MD4 and MD5 samples. See Table 5.14 for gene analysis raw data. This indicated that over a short
exposure MD4 and MD5 do not initiate an inflammatory response over a short period of exposure.
Figure 3.16: NF-κB gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.
69
IL-6
IL-6 plays a vital role as a signal transducer in an innate inflammatory response. The expression of IL-6
is marginally increased in the cells exposed to MD4; perhaps indicating that MD4 WAS inducing an
inflammatory response over a short period of time. See Table 5.15 for gene analysis raw data.
Figure 3.17: IL-6 gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.
70
4.0 Discussion
The two novel silver(I) complexes and the control complexes have their structures based around a
central metal ion. Cisplatin has a platinum group in its centre whilst MXT can be classified as
anthraquinones. These are organic compounds containing anthrace ne-9,10-quinone, an anthracene
derivative with two ketone groups attached to the central benzene ring. The novel complexes used in
this study were focused on the use of silver as the active metal groups in two compounds named MD4
and MD5. MD4 is a Di-Ag (2 silver groups) complex with a relatively low molecular weight. MD5, the
derivative of MD4 is structurally a very large molecule which is reflective in its molecular weight due to
the presence of phenanthroline in its molecular structure. Both MD4 and MD4 were synthesised as part
of a PhD study conducted by Thornton., (2012).
This study by Thornton., (2012) showed that out of 20 novel silver(I) complexes MD4 and MD5 (and
compared to clinically available drug controls cisplatin and MXT) were the most biologically active
particularly MD5. This was thought to be partly due to the large amount of phenanthroline ligands in its
molecular structure which contribute to the activity . Thornton., (2012) showed avid DNA binding and
nuclease cleaving properties of MD4 and MD5 (particularly MD5 with data exceeding EtBr).
The hypothesis of DNA damage being induced by MD4 and MD5 and the further downstream signalling
of apoptosis were explored by this study. First a cytotoxicity analysis was performed on the chosen
THP-1 cell line as these cell lines hadn’t been used previously and the IC25 value needed to be
computed for each of the complexes so that this concentration could be used for the remaining studies .
It was found that MD5 induced a cytotoxic effect in THP-1 cells greater than cisplatin (control) at half
the concentration. To further investigate the hypothesis the DNA damage by DSB formation was
measured using a reliable and alternative DNA damaging assay measuring fluorescent ƴH2AX foci as
an indicator of DSB damage. Results were analysed by both Flow Cytometery and Confocal
Microscopy image processing to consolidate results. It was expected that Cisplatin with a known DNA
71
binding and cleaving mechanism of action, would show DSB formation at both 24 hrs and consistently
but not increased at 48 hours. This consolidates the hypothesis that cisplatin directly targets DNA
forming DSBs early. In contrast the MXT drug control showed no DSB formation at either time points
and for both methods which demonstrate that MTX has a different biological mode of action. However
at 48 hours (not 24 hrs) both MD4 and MD5 showed increased DSB formation exceeding the negative
control and similar to cisplatin levels with MD5 the most active. This was interesting as it suggested
that MD4 and MD5 took longer to bind to DNA and form DSB compared to cisplatin, but when it did it
was equally or more effective (MD5) than cisplatin.
A number of intrinsic apoptotic genes were analysed by real-time PCR to investigate if apoptosis was
signalled in conjunction with the DNA damaging effects of the complexes. Bim a pro-apoptotic gene
(inhibits the anti-apoptotic ability of Bcl-2) was measured in THP-1 cells exposed to all of the 4 drugs for
24 hours and 48hours. As suspected, Bim was expressed in cells exposed to cisplatin for the 24 hour
timpanist but not the 48 hour time point which was consistent with its DNA binding and DSB forming
abilities occurring early and plateauing at 24hours. It would appear that DNA DSBs are formed and
apoptosis is signalled immediately. MXT showed a small level of Bim expression at 24 hours but this
was completely eradicated by 48hours. Interestingly MD4 showed no expression of Bim at 24 hours but
did later at 48 hours which again was consistent with its DNA DSB forming abilities only observed at the
later time point of 48 hours. MD5 showed high Bim expression at both 24 hour and 48 hour exposures
with a consistent increase in expression at the later time point. This again would be consistent with the
DSB forming abilities of MD5 where a small induction of DSBs (but not exceeding the negative control
and not at the same level as cisplatin) was seen at 24 hours and this increased dramatically up to 48
hours.
Caspase 9 which initiates the formation of the apoptosome downstream from the Bcl2 family member
Bim was upregulated in cells exposed to Cisplatin, MXT and MD5 (but not MD4) at 24 hours. Due to
time constraints the 48hour time point could not be carried out, but these results are consistent with the
72
previous results showing Cisplatin to clearly initiate apoptosis early (24hours) due to its double strand
formation and MD5 which appears to work similarly to cisplatin but at a delayed rate with DSB
formation, Bim and caspase 9 expression initiated at 24 hours but increased substantially up to 48
hours within the 24-48 hour window. Similarly for MD4 a delayed response in DSB formation, Bim and
possibly caspase 9 recruitment occur within the 24-48 hour window but is not as targeted as MD5 which
is possibly due to the phenanthroline groups attached to the complex aiding in its DNA binding
properties. Unfortunately the downstream effector caspase 3 could not be measured in samples and
this needs to be repeated in the future. An interesting finding was also with the MXT drug control which
did not show DSB forming capabilities but did show early apoptosis formation (at 24 hours) through pro -
apoptotic Bim expression and initiator caspase 9 expression. Anti-apoptosis Bcl2 expression that works
synergistically to Bim at the mitochondria was also observed. This would suggest that the biological
mechanism of action of MXT is not in targeting DNA and forming DSB to subsequently switch on
apoptosis but that an alternative mechanism operates with the involvement of the mitochondria as a
key player. However this is in contrast with previous literature as MXT can intercalate into DNA through
hydrogen bonding (Bhalla et al., 1993) and carry out its function to inhibit the enzyme topoisomerase II,
an enzyme responsible for uncoiling and repairing damaged DNA (Huang et al., 2006). The inhibition of
the enzyme leads to the formation of DSBs which are indicated by the presence of ƴH2AX. Previous
literature also describes MXT as a inducer of ROS as well as a inhibitor of topoisomerase II (Gor et al.,
2007). The cytotoxic ability of MXT to generate free radicals can lead to the induction of apoptosis in
cells.
The second hypothesis for the mechanistic role of these novel silver(I) complexes was that they could
possibly have as anti-inflammatory effect in a normal inflammatory response to cells. This was
suggested in a preliminary anti-inflammatory study by Thornton., (2012). The silver(I) complexes were
analysed for Cyclooxygenase (COX) Inhibition ability. The results showed that both compounds were
marginally active towards COX-1 and inactive against COX-2. Similarly, salicylic acid (aspirin) which is
73
known to have weak anti-COX-1 and anti-COX-2 inhibition is inactive as a COX-2 inhibitor however,
moderate COX-1 inhibition (26.7 %) is observed. NF-κB and IL-6 were included in the gene expression
study described previously to conduct a preliminary study on the potential of these novel drugs in a less
cyto- and geno-toxic biological mode of action such as the inflammatory response.. NF-κB was found to
be expressed in both of the drug controls for cisplatin and MTX but not for MD4 or MD5 which suggests
that it is not a regulator of transcriptional control of either apoptotic OR inflammatory response genes.
However, Il-6 was found to be highly upregulated in MD4 but not for MD5 at 48 hours.
Therefore it can be concluded for MD4 and MD5 that they both bind to DNA and form DSBs to a similar
effect of cisplatin but at a later stage than cisplatin (after 24hours) and both initiate apoptosis once
DSBs have been formed after 24 hours. MD5 is more potent that MD4 in producing this biological
response which is thought to be due to the additional phenanthroline groups on the compound which
have strong DNA binding properties and leading the silver metal to DNA to induce the DSBs.
Interestingly MD4 is also active in inducing a similar response without the phenanthroline groups and is
more active than cisplatin in this response. Interestingly MD4 was the only drug to show IL-6
expression. This is a cytokine that is signalled in an innate immune response. It would suggest that
perhaps the capabilities of MD4 and MD5 go beyond the scope of cyto - and geno-toxic properties and
this needs to be investigated further.
74
5.0 Appendices
Appendix 5.1: Working Protocols
5.1.1 Solubilisation of Metal based drugs
1. Calculations were done to determine the amount of drug needed for the desired stock
concentration, see Table 2.1.
2. The coinciding amount of drug was weighed out and placed into 5ml of the correspo nding
solution and mixed vigorously.
3. Stock solutions were stored at 4°C and covered in tinfoil for light sensitivity issues.
5.1.2 Aseptic Technique for Cell Culturing
Aseptic technique is the execution of tissue culture procedures without introducing contaminating
microorganisms from the environment. Contaminations in cell culture arise from airborne
microorganisms and 70% of problems in cell culture occur due to lack of good aseptic technique.
Bacterial, Fungal and mycoplasma are all associated with cell culture contamination. Bacterial is
the most common type. Bacterial contamination can be identified by a number of ways; The RPMI
1640 contains a methyl red pH indicator which changes from red to yellow to the bacteria lowering
the pH. Bacterial growth can make the media turbid and bacteria can also be observed under the
phase contrast microscope when investigating the cell lines.
In accordance to strict aseptic technique it is also essential to maintain a sterile work environment.
All equipment and materials are sterilised specifically with an autoclave (121°C) that removes
contaminants. Cell culture is performed in a fully sterilised class II laminar flow cabinet, protecting
75
both the biological material and the researcher. The sterile environment is maintained by regular
cleaning with Ethanol and Virkon.
5.1.3 THP-1 Growth Characteristics
The behaviour of cells and their growth characteristics are important in cell culture. They undergo
the same growth curve phases as bacteria. This theory of growth can be applied to the cells in
culture. Initially when cells are seeded it takes 4-5 hours for them to adapt to the new environment,
this is known as the lag phase. After this phase cells can start to grow and divide via the cell cycle
(DNA replication and mitosis). The doubling time for THP-1 cells is 24-48 hours; this is known as
the log phase where exponential growth can occur due to presence of nutrients and space to grow.
Once the space in the flask begins to fill up (95-100% confluency), nutrients become depleted and
cells cannot continue to grow at the same rate; this is known as the stationary phase and cells
should be sub-cultured at this point. A colour change can be observed at this point, as nutrients are
used up by the cells the medium will change from a dark red to a much lighter red colour. Failure to
subculture will lead to cell death in the decline phase .
5.1.4 Subculturing of THP-1 cells
The following is the protocol used for the subculturing of the THP-1 cells.
1. All cell culture work must be performed in a grade II laminar flow cabinet, cleaned with virkon
and ethanol prior to use.
2. All materials and reagents must be cleaned with ethanol before placed in the cabinet.
3. Transfer the media and suspension cells into a 50mL sterile tube (Sarstedt).
76
4. Centrifuge the sterile tube at 400g for 5 minutes at 22°C.
5. Pour off supernatant into a discard jar and re-suspend pellet in 50mL of fresh supplemented
RPMI 1640, this is known as the cell suspension
6. Aliquots from this cell suspension can be placed into different flasks (T75 or T25) in order to
seed them with cells.
7. Once seeded, flasks are placed in an incubator set at 37°C with 5% CO² and 95% O2.
5.1.5 THP-1 Cell Counting for experimental procedures
1. Prior to usage of the Coulter Counter (Beckman Coulter), it must be flushed with Isoton solution
to remove any residual cells.
2. Perform a cell count to ensure levels are <10. And record this value as it is the background
count.
3. Aspirate 1ml of cell suspension into 20ml isoton solution and place in the machine and perform
a cell count. Record the value obtained.
4. Remove the sample and place another 20ml of isoton solution into the machine and begin
flushing once again.
5. Perform a cell count to analysis the amount of residual cells still in the machine. <10 is the
standard.
Remove the isoton solution and store the probe by submerging it in Coulter Clenz solution (Beckman
Coulter).
77
5.1.6 MTT Assay protocol
1. A 96well plate is seeded with 105 cells for the 24 hour exposure and with 104 cells for the 48
hour exposure to a total of 100µl. The plate is placed in an incubator set at 37°C with 5% CO²
and 95% O2 to undergo a pre-incubation period for 24hours.
2. Following pre-incubation the plate is centrifuged at 800g for 10 minutes at 22°C, the
supernatant media is removed and the corresponding media:drug concentration is added to the
wells to a volume of 100µl from a stock concentration of 4ml. The plate is placed in an
incubator set at 37°C with 5% CO² and 95% O2 for its corresponding exposure time.
Table 5.1: Corresponding media and drug stock volumes for concentration range.
3. Following the corresponding incubation period the plates are removed from the incubator and
centrifuged at 800g for 10 minutes at 22°C.
4. Supernatant is removed and the pellet is re-suspended in 100µl of sterile Phosphate Buffer
Saline (PBS) as a wash step. Repeat three times.
5. Ensuring the removal of all PBS the pellet is re-suspended in 100µl of MTT Reagent (10mg per
1ml of PBS, Diluted 1/10 with serum free RPMI 1640) and placed in an incubator set at 37°C
with 5% CO² and 95% O2 for 3hours.
6. Following the 3hour incubation the plates are centrifuged at 3000g for 10 minutes at 22°C to
ensure the MTT salts form a pellet.
7. The supernatant is removed and the pellet was re-suspended in 100µl PBS as a wash step.
Repeat 3 times.
Drug Stock Media (µl) Drug (µl) Media (µl) Drug (µl) Media (µl) Drug (µl) Media (µl) Drug (µl) Media (µl) Drug (µl)
2mM Cisplatin 3975 25 3950 50 3900 100 3800 200 3600 400
2.5mM MXT 3980 20 3960 40 3920 80 3840 160 3680 320
2.5mM MD4 3980 20 3960 40 3920 80 3840 160 3680 320
2.5 mM MD5 3980 20 3960 40 3920 80 3840 160 3680 320
12.5µM 25µM 50µM 100µM 200µM
78
8. Ensuring the removal of PBS the pellets are re-suspended in 100µl DMSO (Sigma) and placed
on a bench plate shaker for 15minutes.
9. Plates are then read spectrophotometrically, and results are calculated and the ic25 and ic50
values are determined.
Table 5.2: MTT Cytotoxicity Assay 96well set up.
5.1.7 γH2AX Focus Assay
Preparation and Fixation:
1. Cells were seeded at 106 in T25 Flasks in a volume of 5mls in triplicate for both time points with
a negative control in each, yielding 30 T25 flasks total.
2. Once seeded the cells were placed in an incubator set at 37°C with 5% CO² and 95% O2 to
undergo a pre-incubation period for 24hours.
3. Following the pre-incubation the triplicate flasks were pooled into sterile tubes, placed in a
centrifuge at 400g for 10 minutes at 22°C.
4. The supernatant was removed and the corresponding triplicates were re -suspended in a drug
(IC25):Media solution to a volume of 5mls in each T25 flask (30 T25 flasks total).
1 2 3 4 5 6 7 8 9 10 11 12
A
B Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
C Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
D Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
E Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
F Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
G
H
79
Table 5.3: Appropriate Drug:Media ratio for each IC25 in a 12ml stock
5. After the corresponding time points (24 and 48 hours) the samples were transferred from the
T25 flasks into sterile tubes, and centrifuged at 400g for 5 minutes at 22°C.
6. Discard supernatant and re-suspend pellet in 5mls of PBS and centrifuge at 400g for 5 minutes
at 22°C.
7. Fix cells by re-suspending pellet in 200µl of Fixative (0.5ml Formaldehyde and 9.5mls PBS)
and store at room temperature for 10 minutes.
8. Centrifuge at 400g for 5 minutes at 22°C, pour off supernatant and allow tubes to air dry by
inverting them on tissue paper.
9. Re-suspend in 1ml of 70% ice cold ethanol (300µl PBS and 700µl 100% EtOH), transfer
samples to 1.5ml eppendorf tubes and store samples in a freezer.
Permeabilization and Blocking
1. Following the suspension in ice-cold ethanol the cells are centrifuged at 1200rpm for 5
minutes and the supernatant discarded.
2. The pellet was re-suspended in 200µl of 0.25% Triton X-100 for 5 minutes at room
temperature.
3. The cell permeabilization solution is removed by centrifugation as before for 5 minutes and the
pellet was re-suspended in 200µl of blocking solution for 30 minutes at room temperature.
Drug Stock Media (µl) Drug (µl) Media (µl) Drug (µl)
2mM Cisplatin 11661.7 338.3 11807.7 192.3
2.5mM MXT 11722.8 277.2 11782.7 217.3
2.5mM MD4 11670.3 329.7 11722.1 277.9
2.5 mM MD5 11857 277.9 11923.3 71.7
24 Hour Exposure IC25 48 Hour Exposure IC25
80
Immunostaining:
1. Blocking solution was removed from the previous step by centrifugation as before and the
pellet was re-suspended in 100µl of primary antibody (1:500) followed by incubation at room
temperature for 1 hour.
2. Cells were centrifuged as before and the primary antibody was removed.
3. Cells were washed by addition of 500μl of PBS and centrifuged as before. This operation is
repeated twice.
4. After the final wash step the PBS was removed and the secondary antibody (1:200) was added
and the samples were incubated for 1 hour at room temperature in the dark.
5. Following the 1 hour incubation the cells are pelleted in the centrifuge as before and 3 washes
with PBS are performed.
6. Following the final wash step the pellet was re-suspended in 1ml of PBS for analysis on the
flow cytometer.
Propidium Iodide counterstain:
Following the immunostaining procedure an aliquot of the stained cell suspension is removed into a
separate eppendorf. These cells were then pelleted by centrifugation and were re -suspended in 100µl
PBS containing 1µg/ml propidium iodide for 10 minutes at room temperature. After the incubation, the
cells were washed by re-suspending them in 500µl of PBS and centrifuged as before for 5 minutes, 3
times. After the washing step the cells were re-suspended in 1ml PBS.
81
5.1.8 Gene Expression protocols
Note: All work benches, gloves, pipette tips, eppendorf tubes and all experimental apparatus was
treated with RNase Away (Molecular Bioproducts)
RNA Extraction from exposed THP-1 cells (Exposure protocol same as above)
1. Pour cell suspension from each T25 flask into sterile tubes and centrifuge at 400g for 5 minutes
at 22°C.
2. Pour off supernatant into discard jar and re-suspend (wash) pellet in 5ml PBS. Repeat wash
step three times.
3. Remove supernatant and invert tubes on paper tissue to decant remaining supernatant.
4. Re-suspend pellet in 2ml of Tri-Reagent (Sigma) and aliquot 1ml to two sterile eppendorf tubes.
5. Store eppendorf tubes at -80°C freezer.
RNA Isolation
1. Remove samples from the -80°C freezer and allow thaw on ice.
2. Vortex samples briefly and allow to stand at room temperature for 5 minutes.
3. In the fume hood add 200µl of Tri-reagent Chloroform (Sigma Aldrich). Shake and vortex
samples and allow to stand at room temperature for 2 minutes.
4. Centrifuge samples at 12000g for 15 minutes at 4°C.
5. This separates the mixture into three phases; Red organic phase (containing proteins),
Interphase (very small thin layer containing DNA) and colourless upper aqueous layer
(containing RNA).
6. Very carefully pipette out 200µl of the aqueous phase (ensuring that none of the other two
phases are pipetted out) into a 1.5ml eppendorf tube.
82
7. In the fume hood add 500µl of isopropanol C3H80 (2-propanol) (Sigma Aldrich) to the sample.
Vortex briefly and allow to stand for 5 minutes at room temperature. Centrifuge at 12000g for
10 minutes at 4°C (RNA pellet will form on side of tube).
8. Remove supernatant ensuring that there is some liquid at the base of the eppendorf.
9. Was RNA pellet in 1ml of 75% Ethanol C2H5OH (Merck). Vortex and centrifuge at 12000g for 5
minutes at 4°C.
10. Pour off supernatant and invert the eppendorfs gently onto tissue paper and allow to air dry for
5 minutes (do not allow to fully dry).
11. Re-suspend pellet in 30µl 0.1% DepC H2O ensuring to aspirate sample mixture gently.
RNA Quantification
1. Turn on Nanodrop spectrophotometer (Maestro Gen) and set to RNA analysis.
2. Remove protective cap, and clean probe and reader with ethanol.
3. Blank the spectrophotometer with 2μL of DEPC treated water.
4. Clean probe and reader in between each reading with ethanol.
5. Read RNA samples by placing 2μL of RNA sample onto the probe and carefully
lowering the reader.
6. Save and print results.
cDNA Synthesis using qScript Kit (Quanta Biosciences, 95047-100)
1. Determine the volume ‘x’ (μl) of RNA sample to get a concentration of 1μg/μl.
2. Subtract the ‘x’ volume from 15μl to determine the volume ‘y’ of DEPC treated water.
83
3. In 0.2ml Eppendorf tubes (on ice) add 4μl of qScript reaction mix (5X).
4. Add 1μl of qScript Reverse Transcriptase (50X) to the tubes .
5. Add the corresponding RNA (x) volume and DEPC treated water volume (y) to total
solution at 20μl.
6. Centrifuge gently to mix samples.
7. Place in Thermocycler (Techne) and set at the following qScript standard:
Table 5.4: Thermocycler standard run for cDNA synthesis using qScript kit.
8. cDNA samples are stored in freezer at -20°C.
qRT-PCR using SYBR Green Technology
1. Thaw cDNA samples, SYBR Green (Roche) and PCR-grade H2O on ice.
2. Prepare a Primer set Master Mix by placing into an eppendorf tube 84µl H2O, 140µl SYBR
Green, 14µl forward primer and 14µl reverse primer (Set up separate eppendorf tubes for each
primer set). Store eppendorf tubes on ice.
3. Pipette 18µl of each primer set master mix to a RT-PCR Plate (Roche). See Figures 5.1.8a and
5.1.8b for RT-PCR plate layout.
4. Pipette 2µl of the corresponding cDNA to the RT-PCR plate and cover in plastic foil sticker.
5. Centrifuge at 1500rpm for two minutes at 4°C.
Number of cycles Temperature (ºC) Duration (minutes)
1 22 5
1 42 30
1 85 5
84
6. Place RT-PCR Plate into the Light Cycler 480 (Roche) and initiate the RT-PCR programme
run.
7. Gene Expression analysis is recorded with the LC480 system.
Figure 5.5: RT-PCR Plate setup for 24 Hour Exposures.
Figure 5.6: RT-PCR Plate setup for 48 Hour Exposures.
1 2 3 4 5 6 7 8 9 10 11 12
A Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg
B Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin
C MXT MXT MXT MXT MXT MXT MXT MXT MXT MXT
D MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4
E MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5
F H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O
G
H
Key: Actin
Caspase 9
Caspase 3
Bim
NFkB
1 2 3 4 5 6 7 8 9 10 11 12
A Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg
B Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin Cisplatin
C MXT MXT MXT MXT MXT MXT MXT MXT MXT MXT
D MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4 MD4
E MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5 MD5
F H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O H₂O
G
H
Key: Actin
Tubulin
Bcl-2
Bim
IL-6
85
Appendix 5.2: Reagents
5.2.1 Cell culture reagents
Roswell Park Memorial Institute (RPMI 1640) 500ml
Supplemented with:
1. 60mls Foetal Calf Serum
2. 5mls L-Glutamine
5.2.2 Control chemotherapeutic drugs
Cisplatin (Sigma-Aldrich) (cis-Diamineplatinum(II) dichloride, CAS 15663-27-1)
Mitoxantrone dihydrochloride (Sigma; Lot No: 050M1241V)
5.2.3 MTT assay reagents
Thiazolyl Blue Tetrazolium Bromide (Sigma; Lot # MKBD8254V)
1. 10mg per 1ml of PBS
2. 1:10 Dilution with serum free (non-supplemented) RPMI 1640
Dimethyl Sulfoxide (Sigma Aldrich; Lot # SZBD252SV)
86
5.2.4 γH2AX assay reagents
2% v/v paraformaldehyde
1. 0.5ml Formaldehyde () to 9.5mls PBS
70% Ethanol
1. 700mls EtOH to 300mls PBS
87
Triton X-100 solution (0.25%)
1. 2.5µl of Triton X-100.
2. 9997.5µl of PBS.
2% Bovine Serum Albumin (w/v) in PBS
Primary antibody (Milipore; Anti-phospho-Histone H2A.X (Ser 139), clone JBW301) (Cat. # 05-
636) (Lot # 2276332)
1. 1:500 dilution in blocking solution
Secondary antibody (Molecular Probes; Alexa Flour® 488 Goat Anti-Mouse IgG; Lot # 1397999)
1. 1:200 dilution in blocking solution
Propidium Iodide (Sigma-Aldrich; Lot # 019K1149) (1:100)
1. 1µl of Propidium iodide.
2. 100µl of PBS.
5.2.5 Gene expression reagents
Tri-Reagent (Sigma; Lot # BCBK9896V
Chloroform (Romil; Batch # E552417)
100% Ethanol (Millipore; Lot # K45159383349)
2-propanol (Sigma; Lot # SHBC8810V)
88
0.1% Dep-C treated water
1. 100mls ddH2O to 100µl Diethyl pyrocarbonate
89
Appendix 5.3: Raw Data
5.3.1 MTT Assay Data
MTT Assay (n=1)
24 Hour Cisplatin:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.081 0.088 0.075 0.055 0.044 0.041 0.086 0.085
0.055 0.086 0.082 0.056 0.045 0.044 0.085 0.11
0.099 0.105 0.086 0.056 0.05 0.044 0.098 0.076
0.076 0.096 0.075 0.053 0.062 0.043 0.06 0.067
0.106 0.1 0.077 0.056 0.046 0.046 0.055 0.071
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.193 0.184 0.165 0.155 0.142 0.117 0.146 0.113 0.219 0.195 0.182 0.198 0.168 0.15 0.198 0.141
0.219 0.207 0.195 0.201 0.171 0.152 0.184 0.132
0.229 0.21 0.217 0.21 0.194 0.169 0.226 0.199
0.232 0.236 0.228 0.222 0.194 0.161 0.221 0.164
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.093 0.067 0.072 0.042 0.045 0.045 0.054 0.088
0.098 0.075 0.069 0.057 0.045 0.045 0.057 0.079
0.109 0.094 0.061 0.064 0.048 0.045 0.089 0.138
0.113 0.07 0.07 0.064 0.045 0.042 0.072 0.06
0.084 0.075 0.068 0.05 0.042 0.044 0.053 0.062
90
24 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.082 0.04 0.042 0.047 0.046 0.047 0.065 0.08
0.092 0.039 0.041 0.046 0.048 0.048 0.072 0.088
0.076 0.039 0.043 0.043 0.047 0.045 0.044 0.072
0.072 0.042 0.043 0.051 0.049 0.047 0.05 0.065
0.038 0.04 0.042 0.043 0.043 0.046 0.045 0.068
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.165 0.109 0.113 0.106 0.107 0.094 0.103 0.108
0.171 0.119 0.13 0.114 0.119 0.112 0.165 0.12
0.152 0.126 0.128 0.107 0.113 0.095 0.103 0.089
0.146 0.133 0.139 0.117 0.131 0.126 0.144 0.138
0.158 0.131 0.132 0.119 0.13 0.116 0.144 0.112
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.167 0.145 0.149 0.141 0.144 0.12 0.141 0.115
0.17 0.145 0.158 0.151 0.16 0.141 0.165 0.132
0.201 0.17 0.167 0.159 0.158 0.181 0.17 0.102
0.202 0.177 0.175 0.169 0.184 0.162 0.208 0.165
0.202 0.195 0.187 0.173 0.181 0.173 0.188 0.12
24 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.105 0.098 0.054 0.043 0.042 0.041 0.112 0.11
0.092 0.077 0.04 0.042 0.042 0.042 0.125 0.117 0.075 0.078 0.039 0.041 0.04 0.039 0.051 0.058
0.109 0.091 0.044 0.039 0.041 0.04 0.066 0.057
0.052 0.072 0.041 0.042 0.041 0.04 0.121 0.095
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.072 0.079 0.041 0.042 0.038 0.038 0.063 0.052
0.113 0.095 0.045 0.042 0.04 0.038 0.084 0.086
0.106 0.099 0.069 0.041 0.038 0.039 0.088 0.095
0.059 0.073 0.075 0.042 0.038 0.039 0.119 0.096
0.099 0.088 0.054 0.044 0.039 0.039 0.066 0.056
91
24 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.11 0.037 0.039 0.038 0.048 0.038 0.13 0.122
0.088 0.039 0.04 0.041 0.038 0.04 0.038 0.064
0.083 0.039 0.038 0.036 0.033 0.037 0.04 0.039
0.117 0.038 0.038 0.038 0.037 0.04 0.04 0.039
0.049 0.039 0.038 0.041 0.038 0.04 0.039 0.098
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.091 0.041 0.041 0.04 0.043 0.039 0.086 0.079
0.13 0.047 0.05 0.051 0.042 0.043 0.099 0.097
0.087 0.047 0.039 0.043 0.038 0.037 0.079 0.09
0.11 0.041 0.042 0.04 0.038 0.04 0.043 0.065
0.077 0.041 0.038 0.044 0.038 0.038 0.04 0.056
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.209 0.098 0.078 0.058 0.049 0.049 0.122 0.11
0.187 0.07 0.059 0.05 0.048 0.041 0.117 0.1
0.199 0.062 0.052 0.045 0.042 0.04 0.08 0.079
0.154 0.073 0.058 0.045 0.045 0.042 0.093 0.069
0.106 0.058 0.049 0.044 0.042 0.041 0.111 0.076
48 Hour Cisplatin:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.098 0.042 0.044 0.041 0.042 0.041 0.103 0.063
0.154 0.045 0.046 0.042 0.041 0.042 0.15 0.144
0.111 0.05 0.047 0.042 0.043 0.042 0.139 0.166 0.099 0.052 0.047 0.043 0.044 0.042 0.096 0.091
0.059 0.048 0.046 0.044 0.04 0.049 0.109 0.118
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.073 0.039 0.042 0.041 0.047 0.042 0.072 0.074
0.119 0.051 0.048 0.042 0.041 0.041 0.115 0.102
0.041 0.047 0.044 0.041 0.041 0.041 0.121 0.113
0.114 0.046 0.044 0.042 0.041 0.04 0.118 0.13
0.084 0.047 0.044 0.041 0.041 0.044 0.145 0.106
92
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.09 0.04 0.041 0.042 0.044 0.046 0.048 0.054 0.128 0.043 0.046 0.043 0.045 0.046 0.053 0.098
0.09 0.041 0.042 0.041 0.041 0.044 0.052 0.096
0.119 0.042 0.042 0.042 0.045 0.045 0.055 0.064
0.13 0.049 0.045 0.041 0.045 0.051 0.121 0.105
48 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.089 0.046 0.049 0.045 0.057 0.046 0.076 0.106 0.081 0.042 0.044 0.045 0.046 0.049 0.064 0.052
0.1 0.042 0.044 0.045 0.048 0.054 0.111 0.044
0.128 0.051 0.045 0.048 0.05 0.052 0.113 0.106
0.089 0.044 0.042 0.045 0.045 0.053 0.083 0.061
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.073 0.041 0.043 0.047 0.051 0.048 0.049 0.066
0.062 0.044 0.044 0.049 0.052 0.054 0.046 0.095
0.072 0.042 0.046 0.049 0.048 0.055 0.05 0.097
0.052 0.042 0.044 0.047 0.045 0.049 0.049 0.059
0.055 0.043 0.042 0.045 0.05 0.049 0.047 0.061
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.111 0.041 0.041 0.045 0.046 0.051 0.087 0.043
0.134 0.041 0.042 0.044 0.056 0.049 0.091 0.05 0.15 0.04 0.045 0.048 0.047 0.047 0.076 0.043
0.106 0.04 0.044 0.046 0.048 0.048 0.069 0.053
0.076 0.042 0.041 0.048 0.048 0.048 0.064 0.046
93
48 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.136 0.12 0.119 0.039 0.043 0.041 0.091 0.099
0.103 0.132 0.045 0.041 0.043 0.043 0.118 0.087
0.144 0.098 0.042 0.041 0.043 0.047 0.084 0.137
0.176 0.062 0.043 0.041 0.046 0.045 0.043 0.156
0.186 0.069 0.042 0.043 0.045 0.045 0.134 0.109
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.139 0.088 0.042 0.042 0.042 0.042 0.123 0.114
0.047 0.044 0.043 0.044 0.043 0.043 0.186 0.162
0.051 0.095 0.043 0.042 0.041 0.041 0.152 0.139
0.157 0.049 0.042 0.04 0.041 0.043 0.061 0.113
0.124 0.069 0.041 0.044 0.047 0.045 0.09 0.118
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.136 0.109 0.04 0.04 0.041 0.041 0.105 0.113
0.124 0.093 0.04 0.04 0.04 0.041 0.197 0.049
0.141 0.1 0.04 0.04 0.043 0.04 0.119 0.107
0.164 0.146 0.041 0.041 0.043 0.042 0.188 0.123
0.129 0.083 0.041 0.043 0.042 0.043 0.094 0.099
48 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.05 0.039 0.038 0.038 0.037 0.038 0.081 0.08
0.132 0.04 0.038 0.039 0.037 0.039 0.137 0.094
0.123 0.053 0.038 0.038 0.037 0.038 0.179 0.104 0.091 0.039 0.037 0.038 0.037 0.039 0.163 0.13
0.106 0.041 0.038 0.039 0.038 0.04 0.145 0.084
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.168 0.038 0.04 0.04 0.039 0.04 0.177 0.14
0.208 0.038 0.041 0.038 0.04 0.041 0.204 0.184
0.221 0.04 0.041 0.041 0.04 0.04 0.187 0.17
0.157 0.039 0.038 0.041 0.04 0.04 0.181 0.136
0.083 0.04 0.038 0.042 0.04 0.042 0.077 0.073
94
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.106 0.04 0.038 0.041 0.039 0.043 0.127 0.09 0.135 0.038 0.038 0.039 0.04 0.042 0.189 0.066
0.152 0.041 0.039 0.038 0.039 0.047 0.205 0.099
0.122 0.038 0.039 0.037 0.038 0.04 0.193 0.141
0.165 0.037 0.041 0.04 0.039 0.039 0.15 0.114
95
MTT Assay (n=2)
24 Hour Cisplatin:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.227 0.126 0.089 0.075 0.048 0.041 0.103 0.116
0.29 0.185 0.123 0.078 0.05 0.044 0.138 0.158 0.279 0.182 0.143 0.085 0.048 0.044 0.176 0.218
0.278 0.185 0.111 0.075 0.048 0.042 0.227 0.067
0.173 0.176 0.134 0.08 0.043 0.045 0.179 0.126
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.27 0.187 0.141 0.105 0.049 0.042 0.225 0.192 0.268 0.181 0.129 0.08 0.047 0.046 0.215 0.186
0.253 0.199 0.122 0.081 0.049 0.045 0.207 0.263
0.254 0.162 0.123 0.086 0.053 0.042 0.201 0.126
0.247 0.192 0.13 0.095 0.048 0.042 0.119 0.149
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.18 0.161 0.106 0.077 0.053 0.043 0.25 0.197
0.233 0.143 0.106 0.065 0.049 0.042 0.183 0.197
0.206 0.155 0.113 0.076 0.05 0.044 0.209 0.194
0.245 0.154 0.113 0.071 0.049 0.043 0.135 0.177
0.159 0.15 0.118 0.072 0.054 0.049 0.217 0.193
24 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.203 0.043 0.045 0.049 0.05 0.047 0.118 0.171
0.115 0.046 0.044 0.053 0.044 0.043 0.072 0.088 0.124 0.045 0.044 0.045 0.049 0.048 0.1 0.057
0.169 0.04 0.045 0.045 0.051 0.049 0.105 0.087
0.125 0.045 0.044 0.045 0.049 0.05 0.13 0.121
96
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.235 0.15 0.15 0.144 0.162 0.142 0.211 0.199 0.252 0.16 0.154 0.159 0.171 0.154 0.211 0.198
0.268 0.225 0.21 0.184 0.233 0.217 0.259 0.259
0.234 0.186 0.198 0.157 0.201 0.178 0.221 0.215
0.225 0.196 0.184 0.173 0.199 0.173 0.227 0.246
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.191 0.051 0.053 0.054 0.054 0.059 0.108 0.076
0.082 0.048 0.05 0.053 0.054 0.054 0.097 0.082
0.162 0.05 0.05 0.05 0.059 0.053 0.098 0.127
0.15 0.052 0.049 0.052 0.051 0.051 0.066 0.086 0.116 0.048 0.05 0.051 0.053 0.051 0.074 0.142
24 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.207 0.202 0.185 0.179 0.05 0.047 0.231 0.241
0.215 0.188 0.154 0.163 0.05 0.05 0.207 0.212
0.21 0.2 0.159 0.113 0.052 0.047 0.188 0.131
0.221 0.123 0.147 0.101 0.054 0.046 0.151 0.131
0.189 0.161 0.161 0.139 0.054 0.052 0.142 0.219
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.223 0.216 0.126 0.055 0.05 0.05 0.177 0.158
0.17 0.079 0.093 0.05 0.048 0.051 0.149 0.143
0.19 0.185 0.106 0.05 0.049 0.054 0.119 0.1
0.174 0.15 0.118 0.05 0.049 0.052 0.136 0.17
0.277 0.073 0.091 0.053 0.049 0.051 0.13 0.118
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.346 0.319 0.285 0.196 0.171 0.165 0.345 0.296
0.384 0.386 0.329 0.263 0.178 0.172 0.277 0.252
0.307 0.324 0.289 0.209 0.197 0.205 0.3 0.225
0.339 0.357 0.3 0.257 0.204 0.196 0.334 0.272
0.274 0.259 0.284 0.183 0.188 0.161 0.307 0.213
97
24 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.195 0.048 0.047 0.05 0.05 0.05 0.176 0.186
0.228 0.048 0.049 0.048 0.046 0.045 0.152 0.142
0.223 0.047 0.048 0.047 0.047 0.047 0.132 0.188
0.137 0.049 0.048 0.046 0.048 0.049 0.093 0.145
0.221 0.048 0.046 0.046 0.047 0.051 0.133 0.145
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.272 0.045 0.045 0.047 0.046 0.053 0.167 0.188
0.201 0.046 0.046 0.047 0.05 0.054 0.167 0.175
0.214 0.048 0.046 0.045 0.047 0.047 0.115 0.104
0.139 0.047 0.046 0.045 0.05 0.047 0.089 0.076
0.123 0.047 0.047 0.047 0.052 0.05 0.076 0.09
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.12 0.047 0.049 0.057 0.05 0.049 0.177 0.185
0.145 0.048 0.05 0.051 0.049 0.048 0.162 0.209
0.186 0.048 0.05 0.047 0.049 0.048 0.121 0.156
0.133 0.049 0.052 0.052 0.052 0.048 0.206 0.236
0.122 0.051 0.048 0.048 0.05 0.052 0.164 0.142
48 Hour Cisplatin:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.429 0.221 0.141 0.157 0.178 0.148 0.465 0.402
0.402 0.196 0.174 0.166 0.193 0.161 0.425 0.366 0.439 0.201 0.192 0.157 0.153 0.147 0.347 0.252
0.402 0.228 0.231 0.281 0.179 0.157 0.371 0.292
0.442 0.252 0.233 0.189 0.2 0.2 0.38 0.256
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.227 0.093 0.066 0.05 0.047 0.046 0.254 0.223
0.367 0.087 0.074 0.053 0.05 0.046 0.441 0.199
0.389 0.087 0.062 0.052 0.05 0.047 0.377 0.271
0.314 0.107 0.076 0.056 0.048 0.047 0.461 0.223
0.274 0.096 0.075 0.057 0.049 0.045 0.352 0.283
98
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.416 0.19 0.158 0.132 0.13 0.116 0.368 0.37 0.46 0.203 0.176 0.15 0.16 0.15 0.447 0.206
0.373 0.178 0.147 0.129 0.136 0.127 0.509 0.273
0.277 0.183 0.158 0.131 0.141 0.115 0.483 0.44
0.476 0.188 0.165 0.147 0.151 0.132 0.391 0.418
48 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.429 0.221 0.141 0.157 0.178 0.148 0.465 0.402
0.402 0.196 0.174 0.166 0.193 0.161 0.425 0.366
0.439 0.201 0.192 0.157 0.153 0.147 0.347 0.252
0.402 0.228 0.231 0.281 0.179 0.157 0.371 0.292
0.442 0.252 0.233 0.189 0.2 0.2 0.38 0.256
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.227 0.093 0.066 0.05 0.047 0.046 0.254 0.223
0.367 0.087 0.074 0.053 0.05 0.046 0.441 0.199
0.389 0.087 0.062 0.052 0.05 0.047 0.377 0.271
0.314 0.107 0.076 0.056 0.048 0.047 0.461 0.223
0.274 0.096 0.075 0.057 0.049 0.045 0.352 0.283
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.416 0.19 0.158 0.132 0.13 0.116 0.368 0.37
0.46 0.203 0.176 0.15 0.16 0.15 0.447 0.206
0.373 0.178 0.147 0.129 0.136 0.127 0.509 0.273
0.277 0.183 0.158 0.131 0.141 0.115 0.483 0.44
0.476 0.188 0.165 0.147 0.151 0.132 0.391 0.418
48 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.317 0.34 0.242 0.078 0.087 0.088 0.258 0.252
0.531 0.328 0.184 0.104 0.113 0.095 0.397 0.391
0.399 0.294 0.276 0.085 0.094 0.089 0.264 0.384
0.363 0.342 0.348 0.088 0.096 0.081 0.315 0.308
0.225 0.315 0.31 0.087 0.089 0.087 0.136 0.208
99
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.205 0.283 0.083 0.039 0.04 0.045 0.276 0.254 0.306 0.282 0.191 0.043 0.041 0.042 0.189 0.151
0.304 0.199 0.051 0.043 0.042 0.045 0.119 0.162
0.248 0.331 0.144 0.044 0.044 0.045 0.25 0.311
0.221 0.31 0.223 0.047 0.043 0.045 0.216 0.137
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.393 0.298 0.195 0.042 0.046 0.043 0.367 0.25
0.521 0.296 0.239 0.085 0.043 0.052 0.492 0.302
0.345 0.311 0.064 0.065 0.045 0.044 0.333 0.281
0.33 0.38 0.242 0.049 0.043 0.044 0.313 0.316 0.397 0.309 0.168 0.053 0.043 0.045 0.289 0.235
48 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.379 0.047 0.044 0.043 0.048 0.045 0.193 0.323
0.29 0.043 0.046 0.045 0.049 0.046 0.258 0.232
0.345 0.044 0.045 0.046 0.049 0.046 0.118 0.3
0.369 0.045 0.046 0.048 0.046 0.048 0.126 0.222
0.333 0.046 0.045 0.046 0.047 0.047 0.127 0.132
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.203 0.044 0.045 0.057 0.048 0.048 0.14 0.223
0.226 0.043 0.044 0.046 0.047 0.048 0.238 0.181
0.213 0.054 0.044 0.045 0.046 0.053 0.151 0.229
0.305 0.087 0.046 0.045 0.046 0.048 0.181 0.286
0.281 0.071 0.046 0.046 0.047 0.051 0.235 0.241
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.339 0.049 0.046 0.047 0.049 0.047 0.347 0.382
0.355 0.047 0.045 0.046 0.048 0.045 0.344 0.279
0.356 0.049 0.049 0.049 0.05 0.048 0.297 0.28
0.34 0.047 0.045 0.047 0.047 0.046 0.373 0.257
0.081 0.045 0.046 0.045 0.047 0.049 0.347 0.181
100
MTT Assay (n=3)
24 Hour Cisplatin:
24 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.178 0.094 0.094 0.100 0.098 0.092 0.210 0.152
0.189 0.094 0.095 0.108 0.099 0.095 0.255 0.160
0.193 0.101 0.106 0.103 0.106 0.104 0.231 0.146
0.178 0.100 0.105 0.100 0.106 0.096 0.168 0.152
0.188 0.104 0.096 0.107 0.105 0.100 0.179 0.132
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.152 0.045 0.045 0.050 0.047 0.048 0.203 0.166
0.154 0.045 0.045 0.076 0.047 0.050 0.233 0.214
0.143 0.046 0.047 0.076 0.047 0.049 0.213 0.083
0.138 0.045 0.045 0.048 0.048 0.047 0.180 0.089 0.141 0.048 0.046 0.075 0.049 0.053 0.122 0.133
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.252 0.142 0.132 0.127 0.133 0.131 0.184 0.187
0.307 0.142 0.139 0.169 0.144 0.140 0.171 0.188
0.304 0.150 0.140 0.173 0.150 0.142 0.202 0.167 0.271 0.148 0.142 0.144 0.156 0.132 0.220 0.241
0.305 0.145 0.144 0.126 0.150 0.139 0.216 0.187
24 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.279 0.336 0.182 0.193 0.151 0.134 0.327 0.216
0.37 0.26 0.232 0.152 0.162 0.141 0.254 0.202
0.345 0.328 0.255 0.158 0.162 0.15 0.288 0.185 0.309 0.29 0.225 0.162 0.173 0.145 0.29 0.275
0.336 0.376 0.212 0.19 0.166 0.141 0.32 0.266
101
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.226 0.249 0.178 0.176 0.043 0.043 0.232 0.235 0.274 0.283 0.271 0.15 0.046 0.042 0.249 0.23
0.191 0.209 0.174 0.157 0.043 0.041 0.105 0.165
0.186 0.199 0.154 0.107 0.044 0.041 0.134 0.104
0.206 0.264 0.154 0.197 0.045 0.043 0.219 0.171
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.118 0.096 0.084 0.06 0.05 0.045 0.096 0.086
0.119 0.098 0.054 0.07 0.045 0.047 0.101 0.077
0.132 0.108 0.091 0.052 0.045 0.047 0.119 0.096
0.107 0.107 0.157 0.061 0.046 0.05 0.087 0.085 0.096 0.062 0.067 0.064 0.048 0.044 0.088 0.087
24 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.166 0.053 0.048 0.048 0.046 0.046 0.168 0.183
0.098 0.046 0.048 0.045 0.047 0.048 0.1 0.113
0.159 0.05 0.046 0.044 0.046 0.05 0.155 0.188
0.224 0.05 0.047 0.048 0.047 0.045 0.118 0.223
0.222 0.047 0.046 0.048 0.051 0.049 0.229 0.21
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.246 0.049 0.046 0.045 0.05 0.048 0.185 0.189
0.244 0.048 0.046 0.047 0.049 0.052 0.167 0.22
0.172 0.047 0.047 0.046 0.049 0.046 0.136 0.142
0.231 0.049 0.047 0.05 0.049 0.046 0.129 0.15
0.154 0.048 0.048 0.047 0.053 0.051 0.117 0.149
48 Hour Cisplatin:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.39 0.088 0.069 0.055 0.053 0.052 0.411 0.116
0.294 0.091 0.067 0.055 0.051 0.051 0.4 0.143
0.35 0.082 0.057 0.056 0.052 0.053 0.338 0.216
0.352 0.085 0.075 0.054 0.055 0.056 0.367 0.439
0.374 0.098 0.071 0.06 0.053 0.058 0.364 0.454
102
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.314 0.083 0.078 0.058 0.049 0.045 0.35 0.311 0.347 0.084 0.061 0.058 0.056 0.059 0.326 0.214
0.274 0.107 0.067 0.061 0.058 0.058 0.297 0.289
0.173 0.07 0.058 0.061 0.065 0.054 0.382 0.309
0.347 0.073 0.059 0.061 0.059 0.07 0.148 0.189
48 Hour MXT:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.234 0.046 0.049 0.044 0.05 0.056 0.073 0.333
0.288 0.043 0.045 0.046 0.048 0.048 0.057 0.058
0.266 0.043 0.045 0.048 0.047 0.054 0.084 0.148
0.321 0.043 0.046 0.047 0.05 0.052 0.105 0.222
0.188 0.044 0.044 0.046 0.047 0.051 0.061 0.236
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.402 0.174 0.149 0.168 0.169 0.156 0.211 0.406
0.368 0.155 0.138 0.141 0.159 0.144 0.171 0.225
0.38 0.164 0.156 0.145 0.172 0.157 0.22 0.442
0.397 0.17 0.162 0.157 0.184 0.147 0.181 0.34
0.436 0.181 0.169 0.137 0.169 0.164 0.18 0.371
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.202 0.142 0.141 0.156 0.147 0.139 0.382 0.325
0.223 0.143 0.153 0.175 0.162 0.148 0.266 0.359
0.193 0.143 0.147 0.186 0.166 0.147 0.302 0.303
0.191 0.154 0.159 0.167 0.174 0.143 0.222 0.3
0.191 0.146 0.155 0.172 0.158 0.152 0.365 0.21
103
48 Hour MD4:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.455 0.305 0.171 0.043 0.043 0.042 0.358 0.384
0.378 0.284 0.262 0.042 0.044 0.042 0.419 0.358
0.332 0.26 0.236 0.059 0.046 0.043 0.239 0.284
0.221 0.295 0.225 0.043 0.05 0.066 0.168 0.247
0.338 0.286 0.221 0.045 0.044 0.043 0.264 0.289
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.421 0.384 0.331 0.198 0.041 0.04 0.137 0.326
0.202 0.319 0.336 0.195 0.041 0.041 0.131 0.167
0.351 0.351 0.266 0.225 0.042 0.046 0.378 0.503
0.201 0.282 0.26 0.257 0.04 0.043 0.28 0.141
0.098 0.284 0.268 0.051 0.041 0.042 0.085 0.087
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative 0.387 0.398 0.386 0.057 0.046 0.044 0.382 0.46
0.401 0.377 0.159 0.046 0.045 0.043 0.322 0.314
0.341 0.364 0.323 0.047 0.045 0.048 0.359 0.342
0.424 0.321 0.292 0.159 0.047 0.044 0.392 0.273
0.436 0.261 0.266 0.178 0.049 0.044 0.484 0.455
48 Hour MD5:
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.268 0.039 0.043 0.044 0.046 0.045 0.356 0.326
0.222 0.058 0.047 0.051 0.046 0.046 0.481 0.441 0.255 0.046 0.047 0.053 0.045 0.045 0.224 0.4
0.345 0.045 0.05 0.053 0.05 0.048 0.436 0.382
0.208 0.047 0.049 0.046 0.049 0.049 0.359 0.294
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.329 0.117 0.106 0.1 0.115 0.107 0.402 0.347
0.348 0.116 0.108 0.099 0.121 0.107 0.42 0.425
0.21 0.115 0.106 0.1 0.123 0.109 0.319 0.199
0.286 0.115 0.11 0.108 0.122 0.11 0.267 0.146
0.336 0.114 0.12 0.107 0.129 0.115 0.218 0.132
104
Negative 12.5µM 25µM 50µM 100µM 200µM Negative Negative
0.33 0.046 0.047 0.064 0.05 0.048 0.554 0.341 0.271 0.046 0.044 0.046 0.047 0.046 0.358 0.361
0.276 0.044 0.045 0.05 0.046 0.045 0.357 0.228
0.27 0.046 0.046 0.042 0.046 0.046 0.312 0.243
0.202 0.044 0.044 0.043 0.044 0.047 0.335 0.321
IC25 Values for all MTT Assay Runs
24 Hour Exposure 48 Hour Exposure
Cisplatin MXT MD4 MD5 Cisplatin MXT MD4 MD5
RUN 1 IC25
(µM) 80.29 78.89 57.48 39.17 40.38 52.83 43.99 N/A
RUN 2 IC25
(µM) 49.15 47.88 69.87 29.39 35.82 35.9 61.3 11.69
RUN 3 IC25
(µM) n/a 46.44 78.73 20.86 19.95 47.11 68.41 18.18
AVERAGE IC25
(µM) 64.72 57.74 68.69 29.8 32.05 45.28 57.9 14.94
Table 5.7: IC25 values for all complexes and time points over three independent MTT assays.
105
5.3.2 ƴH2AX
Flow Cytometery Histogram Results
Figure 5.1: Scatter plots derived for all samples after 24 hour exposure.
Figure 5.2: Scatter plots derived for all samples after 48 hour exposure.
Unstained Negative
Negative
Cisplatin
MXT
MD4
MD5
106
Unstained
Negative
Negative
Cisplatin
MXT
MD4
MD5
107
Delta Mean Fluorescence Intensity Values (MF1) FOR FL-A (ƴH2AX)
Table 5.8: MF1 values for FL-A minus the background unstained MF1.
24 Hour Exposure 48 Hour Exposure
Negative 577411 325689
Cisplatin 955993 779012
MXT 107151 162945
MD4 51682 982923
MD5 379380 1106532
108
Confocal Microscopy Results (n=2)
Negative 24 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
109
4
5
6
7
110
Cisplatin 24 Hour Time point:
Propidium Iodide ƴH2AX Merged
1
2
3
4
111
5
6
7
112
MXT 24 Hour Time point:
Propidium Iodide ƴH2AX Merged
1
2
3
4
113
5
6
114
MD4 24 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
115
MD5 24 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
4
116
5
6
7
8
117
9
118
Negative 48 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
4
119
5
6
120
Cisplatin 48 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
4
121
MXT 48 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
4
122
5
6
7
123
MD4 48 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
124
MD5 48 Hour Exposure:
Propidium Iodide ƴH2AX Merged
1
2
3
4
125
5
6
7
126
5.3.3 Gene Expression Raw data
Master Mix volumes for qScript Kit
qScript cDNA Synthesis Master Mix
Mixture Component Volume (µl) No. of samples Total Volume (µl)
qScript Reverse Transcriptase 1 12 12
qScript Reaction Mix 4 12 48
Nuclease Free H₂O 10 12 120
Master Mix Total Volume (µl) 180
Table 5.9: Required volumes of qScript cDNA Synthesis kit components for master mix.
RNA Quantification Results from first gene expression analysis
First Aliquot:
24 Hour
Sample A260 A280 A260/A280 ng/µl Volume of RNA (µl)
Volume of DepC H₂O (µl)
Negative 3.115 3.293 0.946 124.6 3.63 1.37
Cisplatin 6.202 6.294 0.985 248.09 0.55 4.45
MXT 4.204 3.149 1.335 168.18 2.69 2.31
MD4 4.509 2.713 1.662 180.36 2.51 2.49
MD5 6.479 8.03 0.807 259.17 1.75 3.25
48 Hour
Sample A260 A280 A260/A280 ng/µl Volume of RNA (µl)
Volume of DepC H₂O (µl)
Negative 14.247 15.599 0.913 569.87 0.79 4.21
Cisplatin 4.642 4.939 0.94 185.67 2.44 2.56
MXT 5.737 3.512 1.634 229.48 1.97 3.03
MD4 2.458 2.871 0.856 98.3 4.60 0.40
MD5 2.263 1.561 1.45 90.52 5.00 0.00
Table 5.10: RNA Quantification values and corresponding volumes needed for cDNA Synthesis.
127
Raw Data from RT-PCR Gene Expression Studies
RT-PCR calculations:
Ct or Cp can be defined as the PCR cycle at which the fluorescent signal of the reporter dye crosses an
arbitrary placed threshold.
dct is the Ct of the target gene minus the Ct of the reference gene (Actin or Tubulin).
ddct is the Ct of the control (Negative Exposure) minus the Ct of the corresponding Complex drug.
2-ddct (2⁻∆∆Ct) is the mean fold change of gene expression over a period of time.
Table 5.11: Gene expression data for Bim after 24 hour exposure.
Table 5.12: Gene expression data for Caspase 9 after 24 hour exposure.
Bim (Target) cp Tubulin cp (Reference) dct ddct 2-ddct LOG
Negative 34.79 21.15 13.64 1.00 0.00
Cisplatin 34.50 21.07 13.43 0.29 1.22 0.09
MXT 35.86 23.75 12.11 -1.07 0.48 -0.32
MD4 0.00 34.48 0.00 0.00 0.00 0.00
MD5 35.76 30.37 5.40 -0.97 0.51 -0.29
Caspase 9 (Target) cp Tubulin cp (Reference) dct ddct 2-ddct LOG
Negative 27.82 21.15 6.67 1.00 0.00
Cisplatin 28.81 21.07 7.74 -0.99 0.50 -0.30
MXT 31.36 23.75 7.61 -3.54 0.09 -1.07
MD4 0.00 34.48 0.00 0.00 0.00 0.00
MD5 33.21 30.37 2.85 -5.39 0.02 -1.62
128
Table 5.13: Gene expression data for Caspase 3 after 24 hour exposure.
Table 5.14: Gene expression data for NF-κB after 24 hour exposure.
Table 5.15: Gene expression data for IL-6 after 48 hour exposure.
Table 5.16: Gene expression data for Bcl-2 after 48 hour exposure.
Caspase 3 (Target) cp Tubulin cp (Reference) dct ddct 2-ddct LOG
Negative 0.00 21.15 0.00 1.00 0.00
Cisplatin 0.00 21.07 0.00 0.00 0.00 0.00
MXT 0.00 23.75 0.00 0.00 0.00 0.00
MD4 0.00 34.48 0.00 0.00 0.00 0.00
MD5 0.00 30.37 0.00 0.00 0.00 0.00
NFkB (Target) cp Tubulin cp (Reference) dct ddct 2-ddct LOG
Negative 30.67 21.15 9.52 1.00 0.00
Cisplatin 28.75 21.07 7.68 1.92 3.78 0.58
MXT 31.74 23.75 7.99 -1.07 0.48 -0.32
MD4 0.00 34.48 0.00 0.00 0.00 0.00
MD5 0.00 30.37 0.00 0.00 0.00 0.00
IL-6 (Target) cp Tubulin cp (Reference) Actin cp (Reference) Mean Reference cp dct ddct 2-ddct LOG
Negative 37.68 21.89 18.64 20.26 17.42 0.00
Cisplatin 0.00 29.40 24.06 26.73 0.00 0.00 0.00
MXT 0.00 28.55 25.20 26.87 0.00 0.00 0.00
MD4 39.57 33.30 32.17 32.74 6.84 -1.89 0.27 -0.57
MD5 0.00 34.91 33.83 34.37 0.00 0.00 0.00
Bcl-2 (Target) cp Tubulin cp (Reference) Actin cp (Reference) Mean Reference cp dct ddct 2-ddct LOG
Negative 24.44 21.89 18.64 20.26 4.18 0.00
Cisplatin 30.68 29.40 24.06 26.73 3.95 -6.25 0.01 -1.88
MXT 31.66 28.55 25.20 26.87 4.79 -7.23 0.01 -2.17
MD4 33.10 33.30 32.17 32.74 0.37 -8.67 0.00 -2.61
MD5 34.92 34.91 33.83 34.37 0.55 -10.48 0.00 -3.15
129
Table 5.17: Gene expression data for Bim after 48 hour exposure.
Bim (Target) cp Tubulin cp (Reference) Actin cp (Reference) Mean Reference cp dct ddct 2-ddct LOG
Negative 38.30 21.89 18.64 20.26 19.67
Cisplatin 0.00 29.40 24.06 26.73 0.00 0.00 0.00 0.00
MXT 0.00 28.55 25.20 26.87 0.00 0.00 0.00 0.00
MD4 41.79 33.30 32.17 32.74 9.62 -3.49 0.09 -1.05
MD5 40.74 34.91 33.83 34.37 6.91 -2.44 0.18 -0.73
130
6.0 References
Bhalla, K., Ibrado, A. M., Tourkina, E., Tang, C., Grant, S., Bullock, G., Mahoney, M. E. (1993). High-
dose mitoxantrone induces programmed cell death or apoptosis in human myeloid leukemia cells. Blood, 82(10), 3133–40.
Bodur, E. (2010). Human serum butyrylcholinesterase interactions with cisplatin and cyclophosphamide. Biochimie, 92, 979–84.
Bonner, M., Martin, R. F., & Lobachevsky, P. N. (2011). γH2AX foci as a measure of DNA damage: a computational approach to automatic analysis. Mutation Research, 711(1-2), 49–60.
FitzGerald, G., & Ricciotti, E. (2011). Prostaglandins and Inflammation. Arteriosclerosis, Thrombosis, and Vascular Biology, 31(5), 986–1000.
Fotakis, G., & Timbrell, J. A. (2006). In vitro cytotoxicity assays: comparison of LDH, neutral red, MTT and protein assay in hepatoma cell lines following exposure to cadmium chloride. Toxicology Letters, 160(2), 171–7.
Gor, J., Dubois, P., Bougnoux, P., Vibet, S., Mah, K., & Chourpa, I. (2007). Differential Subcellular
Distribution of Mitoxantrone in Relation to Chemosensitization in Two Human Breast Cancer Cell Lines ABSTRACT : Drug Metabolism and Disposition, 35(5), 822–828.
Gross, A., Mcdonnell, J. M., & Korsmeyer, S. J. (1999). BCL-2 family members and the mitochondria in apoptosis BCL-2 family members and the mitochondria in apoptosis. Genes & Development, 13, 1899–1911.
Hanigan, M., & Devarajan, P. (2003). Cisplatin Nephrotoxicity: Molecular Mechanisms. Cancer Therapy, (1), 47–61.
Hannon, M. J. (2007). Metal-based Anticancer drugs: From a past anchored in Platinum Chemistry to a Post-Genomic future of diverse Chemistry and Biology. Pure and Applied Chemistry, 79(12), 2243–
2261.
Hartmann, J. T., Kollmannsberger, C., Kanz, L., & Bokemeyer, C. (1999). Platinum Organ Toxicity and possible prevention in patients with Testicular Cancer. International Journal of Cancer, 83(6), 866–9.
Helleday, T., Petermann, E., Lundin, C., Hodgson, B., & Sharma, R. A. (2008). DNA Repair Pathways as targets for Cancer Therapy. Nature Reviews. Cancer, 8(3), 193–204.
Huang, X., Kurose, A., Tanaka, T., Traganos, F., Dai, W., & Darzynkiewicz, Z. (2006). Activation of ATM and Histone H2AX Phosphorylation Induced by Mitoxantrone but not by Topotecan is Prevented by the Antioxidant N-acetyl-L-Cysteine. Cancer Biology & Therapy, 5(8), 959–964.
Ishida, S., McCormick, F., Smith-McCune, K., & Hanahan, D. (2010). Enhancing Tumor-Specific uptake of the Anticancer drug Cisplatin with a Copper Chelator. Cancer Cell, 17(6), 574–83.
Jahan-Tigh, R. R., Ryan, C., Obermoser, G., & Schwarzenberger, K. (2012). Flow Cytometry. The Journal of Inestigative Dermatology, 132(10), 1–5.
Karin, M., & Lin, A. (2002). NFkB at the Crossroads of Life and Death. Nature Immunology, 3(3), 221–227.
131
Kellet, A., Howe, O., O’Connor, M., McCann, M. , Creaven, B. S., McClean, S., Devereux, M. (2012). Radical-induced DNA Damage by Cytotoxic Square-Planar Copper(II) complexes Incorporating o-
phthalate and 1,10-phenanthroline or 2,20-dipyridyl. Radical Biology and Medicine, 53, 564–576.
Kellett, A., Connor, M. O., Mccann, M., Howe, O., Casey, A., Mccarron, P., Devereux, M. (2011).
Water-soluble Cu II and Mn II bis-phenanthroline octanedioate complexes with unprecedented nano and picomolar in vitro cytotoxicity as promising leads for chemotherapeutic drug development. MedChemComm, 2(7), 579.
Kellett, A., McCann, M., Howe, O., O’Connor, M., & Devereux, M. (2012). DNA Cleavage Reactions o f
the Dinuclear Chemotherapeutic Agent Copper(II) bis-1,10-phenanthroline terephthalate. International Journal of Clinical Pharmacology and Therapeutics , 50(01), 79–81.
Kennedy, S., (2012). Measurement of double stranded DNA damage in cancer cells induced by novel copper II drug complexes
Köninki, K., Barok, M., Tanner, M., Staff, S., Pitkänen, J., Hemmilä, P., Isola, J. (2010). Multiple Molecular Mechanisms underlying Trastuzumab and Lapatinib Resistance in JIMT-1 Breast Cancer Cells. Cancer Letterstters, 294(2), 211–9.
Lamkanfi, M., Declercq, W., Vanden Berghe, T., & Vandenabeele, P. (2006). Caspases leave the beaten track: Caspase-Mediated Activation of NF-kappaB. The Journal of Cell Biology, 173(2), 165–71.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, California), 25(4), 402–8.
Maag, R. S., Hicks, S. W., & Machamer, C. E. (2003). Death from within: Apoptosis and the Secretory
Pathway. Current Opinion in Cell Biology, 15(4), 456–461.
Macciò, A., & Madeddu, C. (2013). Cisplatin: An old Drug with a newfound Efficacy - From Mechanisms
of Action to Cytotoxicity. Expert Opinion on Pharmacotherapy, 14(13), 1839–57.
McCann, M., Santos, A. L. S., da Silva, B. a., Romanos, M. T. V., Pyrrho, A. S., Devereux, M., Kellett,
A. (2012). In vitro and In vivo studies into the Biological Activities of 1,10-Phenanthroline, 1,10-Phenanthroline-5,6-dione and its Copper(ii) and Silver(i) complexes. Toxicology Research, 1(1), 47.
National Cancer Institute, 2014. A to Z List of Cancers [ONLINE]. Available at: http://www.cancer.gov/cancertopics/types/alphalist [Accessed 18 March 2014].
Nwaneshiudu, A., Kuschal, C., Sakamoto, F. H., Anderson, R. R., Schwarzenberger, K., & Young, R. C. (2012). Introduction to Confocal Microscopy. The Journal of Inestigative Dermatology, 132(12), 1–5.
Okemeyer, C. B., Ollmannsberger, C. K., Arstrick, A. H., Eyer, B., Erl, A. G., Asper, J. C., Anz, L. K. (1999). Treatment of patients with Cisplatin-Refractory Testicular Germ-Cell Cancer. International
Journal of Cancer, 83(6), 848–851.
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time (RT-PCR).
Nucleic Acids Research, 29(9), 45.
Podgorsak, E. B., & Kainz, K. (2006). Radiation Oncology Physics: A Handbook for Teachers and
Students. Medical Physics, 33(6), 1920.
132
Prisecaru, A., Devereux, M., Barron, N., McCann, M., Colleran, J., Casey, A., Kellett, A. (2012). Potent Oxidative DNA Cleavage by the di-copper cytotoxin: [Cu2(μ-terephthalate)(1,10-phen)4]2+. Chemical
Communications (Cambridge, England), 48(55), 6906–6908.
Prisecaru, A., McKee, V., Howe, O., Rochford, G., McCann, M., Colleran, J., Kellet, A. (2013).
Regulating Bioactivity of Cu2+ Bis-1, 10-phenanthroline Artificial Metallonucleases with Sterically Functionalized Pendant Carboxylates. Journal of Medicinal Chemistry, 56(21), 8599–8615.
Sak, A., Grehl, S., Engelhard, M., Wierlemann, A., Kaelberlah, H.-P., Erichsen, P., Stuschke, M. (2009). Long-Term In vivo Effects of Cisplatin on γH2AX Foci Signaling in Peripheral Lymphocytes of Tumor
Patients After Irradiation. Clinical Cancer Research, 15(8), 2927–34.
Scheller, J., Chalaris, A., Schmidt-Arras, D., & Rose-John, S. (2011). The Pro- and Anti-Inflammatory
properties of the Cytokine Interleukin-6. Molecular Cell Research, 1813(5), 878–88.
Siddik, Z. H. (2003). Cisplatin: Mode of Cytotoxic Action and Molecular basis of Resis tance. Oncogene,
22(47), 7265–79.
Staal, J., Bekaert, T., & Beyaert, R. (2011). Regulation of NF-κB signaling by caspases and MALT1
paracaspase. Cell Research, 21(1), 40–54.
Testa, U. (2004). Apoptotic Mechanisms in the Control of Erythropoiesis. Leukemia, 18(7), 1176–99.
Thornton, L., (2012). Synthesis, Characterisation and Biological Activity of Novel Silver(I) and Copper(I) Dicarboxylate Complexes.
Trynda-Lemiesz, L., & Luczkowski, M. (2004). Human serum albumin: spectroscopic studies of the paclitaxel binding and proximity relationships with cisplatin and adriamycin. Journal of Inorganic
Biochemistry, 98, 1851–6.
Vanderwall, D. E., Lui, S. M., Wu, W., Turner, C. J., Kozarich, J. W., & Stubbe, J. (1997). A model of the structure of HOO-Co.bleomycin bound to d(CCAGTACTGG): recognition at the d(GpT) site and implications for double-stranded DNA cleavage. Chemistry & Biology, 4, 373–87.
World Health Organisation, 2014 Cancer [ONLINE]. Available at: http://www.who.int/mediacentre/factsheets/fs297/en [Accessed 18 March 2014].
Yuan, J., Adamski, R., & Chen, J. (2013). Focus on Histone variant H2AX: to be or not to be. FEBS Letters, 584(17), 3717–3724.
Zlatanova, J., Yaneva, J., & Leuba, S. H. (1998). Proteins that specifically recognize Cisplatin-Damaged DNA: a clue to Anticancer Activity of Xisplatin. The FASEB Journal, 12(10), 791–9.
![Preparation, spectral characterization and antibacterial ...downloads.hindawi.com/journals/jspec/2008/170213.pdf · Silver(I) complexes of 2-mercaptopyridine (Mpy), [Ag(Mpy)]NO3 and](https://img.pdfslide.net/doc/110x75/60624f0612c8e33fb2601f91/preparation-spectral-characterization-and-antibacterial-silveri-complexes.jpg)
