The Saccharomyces cerevisiae COQ6 gene encodes a ... · Peter Gin, Adam Y. Hsu, Steven C. Rothman †, Tanya Jonassen, Peter T. Lee, Alexander Tzagoloff §, and Catherine F. Clarke

The Saccharomyces cerevisiae COQ6 gene encodes a mitochondrial flavin

dependent monooxygenase required for coenzyme Q biosynthesis

Peter Gin, Adam Y. Hsu, Steven C. Rothman†, Tanya Jonassen, Peter T. Lee,

Alexander Tzagoloff§, and Catherine F. Clarke*

Department of Chemistry and Biochemistry and the Molecular Biology Institute,

University of California, Los Angeles, 90095

§Department of Biological Sciences, Columbia University, New York, NY 10027

†Present address: Molecular and Cellular Biology Stanley/Donner ASU,

University of California, Berkeley, 229 Stanley Hall #3206, Berkeley, CA 94720-3206

*Corresponding author: Catherine F. Clarke

Department of Chemistry and Biochemistry

University of California, Los Angeles

607 Charles E. Young Drive East

Los Angeles, CA 90095-1569

Tel: (310) 825-0771

Fax: (310) 206-5213

Email: [email protected]

Running Title: Coq6 is a Flavin-Dependent Monooxygenase in Q Biosynthesis

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on April 29, 2003 as Manuscript M303234200 by guest on July 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Coq6 is a Flavin-Dependent Monooxygenase in Q Biosynthesis

2

Summary

Coenzyme Q (Q) is a lipid that functions as an electron carrier in the mitochondrial respiratory

chain in eukaryotes. There are eight complementation groups of Q-deficient Saccharomyces

cerevisiae mutants, designated coq1 - coq8. Here we have isolated the COQ6 gene by functional

complementation and, in contrast to a previous report, find it is not an essential gene. coq6 mutants

are unable to grow on nonfermentable carbon sources and do not synthesize Q, but instead

accumulate the Q biosynthetic intermediate 3-hexaprenyl-4-hydroxybenzoic acid. The Coq6

polypeptide is imported into the mitochondria in a membrane potential-dependent manner. Coq6p

is a peripheral membrane protein that localizes to the matrix side of the inner mitochondrial

membrane. Based on sequence homology to known proteins, we suggest that COQ6 encodes a

flavin-dependent monooxygenase required for one or more steps in Q biosynthesis.

by guest on July 28, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


3

Introduction

Coenzyme Q (ubiquinone or Q) is a prenylated benzoquinone found in cell membranes and

functions in redox chemistry as both an oxidant (Q) and reductant (QH2) (1). Q is most commonly

associated with its role in the respiratory chain where it transports electrons from either Complex I

or Complex II to Complex III (2); however, Q serves multiple functions. Q has been demonstrated

to play a role in stabilizing the bc1 complex (3). Additionally, Q functions in the electron transport

chains of lysosomal and plasma membranes (4, 5), and QH2 acts as a chain breaking antioxidant of

lipid peroxyl radicals (6). In Escherichia coli, a high QH2:Q ratio is sensed by ArcB, a

transmembrane sensor kinase, that phosphorylates ArcA, activating operons involved in

fermentation and repressing those involved in respiration (7). In Caenorhabditis elegans, dietary Q

produces a shortened life span (8). This phenomenon has been attributed to the generation of

superoxide by Q–• (the Q semiquinone radical) generated during respiratory electron transport (9).

In humans, Q supplementation has been shown to be effective in treating patients with specific

respiratory chain defects (10) and to slow the progression of Parkinson’s Disease symptoms (11).

Cells normally acquire Q through de novo synthesis, and the length of the prenyl tail varies

amongst different organisms (12). Saccharomyces cerevisiae produce Q6, which has six isoprene

units, while E. coli synthesize Q8 and humans synthesize Q10 . Eight COQ genes have been

identified to be required for Q synthesis in S. cerevisiae (13, 14). Figure 1 shows the pathway for

Q biosynthesis in both prokaryotes and eukaryotes. In yeast, mutations in any of the eight COQ

genes results in cells which cannot synthesize Q and fail to grow on nonfermentable carbon

sources. Yeast coq3 – coq8 mutants each accumulate the same early intermediate in Q biosynthesis,

3-hexaprenyl-4-hydroxybenzoic acid (HHB or compound 1, Figure 1) (15).

In this work the yeast COQ6 gene has been isolated by functional complementation of a mutant

from the G63 (coq6) complementation group. Transformation of coq6 mutant strains with a

plasmid bearing wild type COQ6 restores Q biosynthesis and growth on non-fermentable carbon

sources. In contrast to a previous report (16), we find COQ6 to be a non-essential gene. Here we


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


4

show the Coq6 polypeptide is imported into mitochondria and is peripherally associated with the

inner membrane on the matrix side. Based on sequence analysis and alignment with other known

hydroxylases, the proposed function of Coq6 polypeptide is that of a flavin-dependent

monooxygenase, required for one or more steps in Q biosynthesis.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


5

Experimental Procedures

Strains and growth media. The strains used in this study are listed in Table I. Growth media for

yeast were prepared as described (17) and included YPD (1% yeast extract, 2% peptone, 2%

dextrose), YPG (1% yeast extract, 2% peptone, 3% glycerol), YPGal (1% yeast extract, 2% peptone,

2% galactose, 0.1% dextrose), SDC (0.18% yeast nitrogen base without amino acids, 2% dextrose,

0.14% NaH2PO4, 0.5% (NH4)2SO4, and complete supplement of amino acids), SD-Leu (SDC

minus leucine), and SD-Ura (SDC minus uracil). The complete supplement was modified as

described (18). Semisynthetic lactate media was prepared as described (19). Media for sporulation

and tetrad analysis were prepared as described (17). Each component of growth media was

purchased from Difco, Fisher or Sigma. 2% agar was added for solid media.

Cloning of the COQ6 gene. The haploid strain SR128-3C containing the coq6-1 allele was

obtained from mating C128 and FY250 (Table 1). SR128-3C yeast were grown to early-log phase

in YPD medium and transformed (20) with the YCp50 centromeric plasmid library of S. cerevisiae

genomic DNA (21) containing the URA3 gene as a selectable marker. Transformants were selected

on SD-Ura plates, and after a three-day incubation at 30ºC were replicaplated onto YPG plates to

test for respiratory growth. Putative Q prototrophic transformants, able to grow on media

containing a nonfermentable carbon source, were further purified and tested for cosegregation of

uracil prototrophy and respiration competency following vegetative growth in rich media. Such

cosegregation was observed in two transformants, indicating these traits were plasmid linked. Yeast

plasmid DNA was recovered from one transformant (494SR) and was amplified in DH5α E. coli

(Life Technologies, Inc.). The plasmid p494SR contained an insert of 4.1-kb and transformation of

SR128-3C with p494SR restored growth on YPG media. A similar cloning procedure was also

performed with a multicopy expression library prepared from yeast genetic DNA in the vector

YEp24 (22) and resulted in the isolation of pG63/T1, which was found to contain a 2.8-kb segment

of DNA that overlapped with the insert present in p494SR (Figure 2). Seven other rescuing yeast


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


6

genomic DNA clones were similarly isolated from a recombinant pUV1-based plasmid library

(generous gift of Junichi Nikawa and Michael Wigler, Cold Spring Harbor Laboratory). Southern

analysis showed that all the clones contained overlapping DNA fragments (data not shown).

Subcloning and disruption of the COQ6 gene. A 3.8-kb HindIII fragment was isolated from

p494SR and was ligated to the HindIII site of pRS316 (23) to generate pSR1-1. The insert of

pSR1-1 was sequenced and found to contain two ORFs located on a segment of chromosome VII.

Only one ORF, YGR255C, was also present on pG63/T1, and was designated COQ6 (deposited in

GenBank with accession number AF003698).

To construct a disruption allele of COQ6, a 2.9-kb HindIII fragment, containing about 350-bp of

the YEp24 sequence and 2.55-kb of yeast genomic DNA, was excised from pG63/T1 and inserted

into the HindIII site of YEp352 to generate the plasmid pG63/ST2. As shown in Figure 2, the coq6

deletion plasmid was constructed by replacing a 414-bp BglII fragment in pG63/ST2 with a 1.7-kb

BamHI fragment containing HIS3 (24). The resulting plasmid, pG63/ST3 was used to obtain a

4.0-kb EcoRI fragment with the disrupted gene. W303-1A, W303-1B and SR128-3C were each

transformed with 1 µg of DNA (25). Most of the histidine prototrophic clones issued from the

transformations were respiration-defective and were complemented by the ° test strains JM6 or

JM8, but not by the coq6-1 mutant strains, implying a genetic linkage between the coq6 ::HIS3

and the coq6-1 alleles. Nuclear DNAs from three independent transformants (one from each of the

three separate parental strains) were digested with EcoRI and EcoRV, separated on 1% agarose, and

transferred to a nitrocellulose membrane. The probe, a 1.1-kb EcoRI/EcoRV fragment within the

COQ6 ORF, recognizes a 1.1-kb fragment in the genomic DNA of the parental strain. The

genomic DNA of the mutant strains, (W303∆COQ6-1, αW303∆COQ6-1, and SR∆COQ6-1) each

contained a larger hybridizing species at approximately 3.15-kb, as expected for the disrupted allele.

To verify the allelism between coq6 and coq6-1 mutations, SR∆COQ6-1 was mated to a wild type

strain W303-1A to form diploid cells, which were then sporulated to produce meiotic progeny.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


7

Spores from 14 tetrads showed 2:2 segregation for respiration competence and histidine

auxotrophy. In all cases, the spores competent to grow on glycerol media were histidine

auxotrophs, while the spores unable to grow on glycerol were histidine prototrophs, confirming the

allelism between the cloned COQ6 gene and the original coq6-1 mutation.

Complete deletion of the COQ6 ORF. A complete deletion of the COQ6 open reading frame was

performed with a PCR-targeting strategy (26). A 1.53-kb fragment containing LEU2 was

generated from the YEp13 vector (GenBank Acc# U03498) using a forward primer pPG6DLF 5’

ATAATTCTTAAAAGTGGAGCTAGTCTATTTCTATTTACATACCTCATTTTGTAATTTCGT

GTCG 3’ and a reverse primer pPG6DLR 5’

TCAAATTGGTCTTTCAGTGAACCTTGTATCGATTGACACAGAGGCAGAGGTCGCCTGA

CGCATA 3’. The 5’ end of the forward primer contained 45 nucleotides corresponding to -45 to -

1 upstream of the COQ6 ORF and at the 3’ end 19 nucleotides corresponding to 5579 to 5597 of

YEp13. The reverse primer similarly was corresponding to 45 nucleotides from +1485 to +1441

of the reverse strand of the COQ6 ORF followed by 19 residues from 7018 to 7000 of the reverse

strand of YEp13. A W303-1AB diploid was created by mating W3031A with W3031B. W3031A,

W3031B, CENPK.2-1C, and W303-1AB cells were transformed with 1 µg of the fragment using

the lithium-acetate method as described (27). Transformed cells were grown on SD-Leu plates at

30ºC for 2 days. Gene disruption was verified by PCR using forward primer Coq6SeqF1 5’

ACCTTTGCATTACAAGTGCAACGCTCTACC 3’ and reverse primer Coq6SeqR1 5’

GGTGACGCGTGTATCCGCCCGCTCTTTTGG 3’ and produced a product of 1.84-kb for both

the wild type and disrupted strains. The PCR product was then digested using the restriction

enzyme EcoRI, which digests the wild type product and produces two products of 0.44 and 1.4-kb,

while the EcoRI digestion fragments of the disrupted product are 1.2 and 0.64-kb. Tetrad analysis

was performed as described above.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


8

In vivo radiolabeling of Q6-intermediates, lipid extraction, and analysis by HPLC. Yeast strains

SR128-3C and W303∆COQ6-1 were grown in 1 liter SDC medium supplemented with 0.65 µCi

of 4-[U-14C]hydroxybenzoic acid (365 Ci/mol), synthesized from L-[U-14C]tyrosine by alkali heat

fusion (28). Cells were harvested after 3 days of incubation at 30ºC with shaking (200 rpm, OD600

nm = 10), and lipids were extracted as described (29). Lipid extracts were concentrated, the volume

adjusted to 1 ml with hexane, and 0.10 ml aliquots (5.0 - 12.0 x 103 cpm) were analyzed by normal

phase HPLC employing a cyanopropyl column (Zorbax, 5 µm, 4.6 mm x 250 mm, MacMod

Analytical, Chadds Ford, PA) as described (30). The column was equilibrated with a mobile phase

composed of 98% solvent A (hexane) and 2% solvent B (isopropanol:hexane:water:methylene

chloride, 52:41:5:2) at a flow rate of 1ml/min. Ten minutes after sample injection, the percentage of

solvent B was increased linearly from 2% to 27% in 25 minutes (35 min from the start) and then

from 27% to 100% in 20 minutes (55 min after the start). In the next 5 minutes, the percentage of

solvent B was decreased linearly from 100% to 2% and remained at 2% for 30 minutes to

equilibrate the column before next sample injection. The radioactivity of one ml fractions was

measured by scintillation counting in 10 ml of BIOsafe nonaqueous scintillation cocktail (Research

Products International) with a Beckman scintillation counter (model LS-3133P). The efficiency of

14C detection was 90%.

Determination of Q6 content in lipid extracts by HPLC and electrochemical detection. Lipid

extraction and analysis were performed as described previously (31). Yeast strains W303-1A,

SR128-3C, W303∆COQ6-1, and W303∆COQ6-1:pSR1-1 (the coq6 null strain harboring a COQ6

containing plasmid), were grown at 30ºC with shaking (200 rpm) in 50 ml of YPGal to an OD600 nm

of about 4 or alternatively were grown to saturation (2 days). 750 ng of Q9 was added as an

internal standard to a yeast cell pellet (100 mg wet weight), and cells were lysed by vortexing with 1

g of glass beads in 0.35 ml water.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


9

Mitochondrial import assay. An in vitro transcription template plasmid was constructed by

inserting the COQ6 ORF into the pRS426 vector downstream of the T7 promoter (32). The COQ6

ORF with SalI and NotI linkers at 5' and 3' ends respectively, was PCR-amplified with the template

pSR1-1, 5' primer JF3 (5’ ACGCACGCGTCGACATGTTCTTTTCAAAAGTTATGC 3’), and 3'

primer JF4-1 (5’ ATAAGAATGCGGCCGCTCTCATTTCTCATTTCCTCC 3’) using Vent DNA

polymerase (New England Biolabs). The PCR product was digested with SalI and NotI and

inserted into the corresponding SalI and NotI sites in pRS426. The resulting product, pT7Q6, was

linearized with XhoI and provided template DNA for in vitro transcription (Promega Ribomax

Large Scale RNA Production System). The resulting mRNA was then translated with Promega

Flexi Rabbit Reticulocyte Lysate System in the presence of [35S] methionine from Amersham Life

Sciences (1000 Ci/mmol, at final concentration of 0.75 µM). Both the mRNA and the [35S]-labeled

polypeptides were stored at –80°C. The isolation of mitochondria (from D273-10B/A1) and

import reaction conditions were performed according to Yaffe (33) as described previously (34).

Cell cultures (1 liter) were grown in semisynthetic lactate media to saturation density. Spheroplasts

were prepared and lysed by Dounce homogenization with a tight fitting pestle as described (19).

Purified mitochondria were isolated from a linear Nycodenz gradient as described (19). Each

import reaction contained 6 µl radiolabeled in vitro translated product and isolated mitochondria

(200 µg protein). Following the 30 min incubation at 30°C, the mitochondria were reisolated and

washed once as described (33). Proteinase K treatment after the import was performed by adding

proteinase K at final concentration of 50 µg/ml to resuspended mitochondria. The proteolytic

digest was allowed to proceed at 0°C for 20 minutes and was terminated by the addition of

phenylmethylsulfonylflouride (PMSF) to a final concentration of 1mM.

Plasmid construction of HA-tagged COQ6. Two yeast expression plasmids, one single copy and

one multicopy, were constructed to express the Coq6 polypeptide containing a carboxyl-terminal

peptide (MYPYDVPDYASLDGPMST) corresponding to the carboxy-terminus of the influenza


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


10

hemagglutinin (HA) viral protein, an epitope for the 12CA5 monoclonal antibody (35). The COQ6

ORF region without the stop codon was PCR-amplified using 5' primer JF3 (5’

ACGCACGCGTCGACATGTTCTTTTCAAAAGTTATGC 3’) and 3' primer JF4 (5’

ATAAGAATGCGGCCGCAGTTTCTCATTTCCTCCTAATGTG 3’). The PCR product was

directionally cloned into the multicopy pADCL vector (SalI and NotI at 5' and 3' respectively) (36),

to generate pHA6. pSHA6, a single copy version of COQ6-HA construct, was generated by

removing the 3.6-kb transcriptional cassette from pHA6 by BamH1 partial digestion and insertion

into BamHI site of the vector pRS316 (23). Yeast cells were transformed with pHA6, pSHA6 or

pSR1-1 (25). Transformants were selected for the presence of either the LEU2 (pHA6) or URA3

(pSHA6) gene on SD-Leu or SD-Ura plate media. Colonies obtained on the respective plate media

were subsequently replicaplated to YPG plate media.

Generation of antisera against Coq6p. The 1.44-kb COQ6 ORF was PCR-amplified with a

forward primer pPG6F 5’ GCGGATCCGATGTTCTTTTCAAAAGTTATGCTT 3’ and a reverse

primer pPG6R 5’ GCGGATCCTCATTTCTCATTTCCTCCTAATGTG 3’ and Vent DNA

Polymerase. The product was then digested with BamHI and inserted into PET15b (Novagen) at

the BamHI site to generate a fusion protein containing a 6-His tag at the N-terminus. The fusion

protein was overexpressed in the E. coli BL21(DE3) under induction by 1mM IPTG and was

purified over His-Bind resin (Novagen) and used to generate antiserum in rabbits (Cocalico).

Mitochondrial localization of Coq6p. Yeast cultures (W303-1A) were grown in YPGal to an

OD600 nm between 2 and 4, and mitochondria were isolated and purified as described above.

Mitoplasts were generated by hypotonic treatment of mitochondria (19). Mitochondria (1 mg

protein) were suspended in five volumes of 20mM HEPES-KOH, pH 7.4 and incubated on ice for

20 minutes. The mixture was then sedimented in a microcentrifuge for 10 min at 4°C to separate


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


11

the intermembrane space components (supernatant) and the mitoplasts (pellet). Mitoplasts were

then sonicated and centrifuged at 150,000 × g for 60 min at 4°C to generate matrix (supernatant)

and membrane (pellet) fractions. Alternatively, mitoplasts were alkaline extracted by incubating

with 0.1 M Na2CO3, pH 11.5 for 30 min on ice, followed by centrifugation at 150,000 × g for 60

min at 4°C to separate the integral membrane components (pellet) from the peripheral membrane

and matrix components (supernatant) (37). Proteinase K protection experiments were carried out

as described (38). Samples were analyzed by immunoblot.

Immunoblot analysis. Fractions were assayed for protein concentration by the bicinchoninic acid

assay (Pierce, Rockford, IL). Equal amounts of protein from the mitochondrial fractions of cells

were analyzed by electrophoresis on 12% Tris-Glycine gels and were subsequently transferred to

Hybond ECL Nitrocellulose (Amersham). Immunoblot analysis and treatment of membranes for

re-use with another antisera were performed as described by Amersham. An exception to the stated

protocol was the use of washing buffer: 1X PBS, 0.1% Tween-20. Primary antibodies were used at

the following concentrations: anti-Coq6p, 1:500; anti-Coq3p, 1:1000; anti-Coq4p, 1:1000; anti-

cytochrome b2, 1:1000; anti-Hsp60p, 1:10,000; anti-β subunit of F1-ATPase, 1:10,000; anti-

cytochrome c1, 1:1000; anti-OM45p, 1:1000; anti-Mas2p, 1:1000. Goat anti-rabbit secondary

antibodies conjugated to horseradish peroxidase (Calbiochem) were used at a 1:10,000 dilution.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


12

Results

Isolation and in situ disruption of the COQ6 gene. The original mutant in the coq6

complementation group of yeast mutants (G63) was identified as a Q-deficient nuclear petite strain

(13). The respiratory deficiency was ascribed to a defect in Q because addition of exogenous Q2 or

Q6 to isolated mitochondria rescued NADH-cytochrome c reductase activity (39). SR128-3C, one

of the strains resulting from the cross between C128 (coq6-1) and FY251, had a very low reversion

rate and provided the biological tool for cloning the COQ6 gene by screening yeast genomic DNA

libraries as described under Experimental Procedures. Nine respiration-competent transformants

were obtained, and the representative plasmid p494SR was studied in detail. A 3.8-kb HindIII

fragment was isolated from p494SR and ligated to the HindIII site of pRS316, a centromeric vector,

to form pSR1-1 (Figure 2). Transformation of SR128-3C with pSR1-1 restored growth on media

containing glycerol. DNA sequence analysis revealed the insert to contain two complete ORFs,

identified as YGR256W (the GND2 gene) and YGR255C. The plasmids pG63/T1 and pG63/ST2

containing the complete YGR255C ORF and only a portion of the GND2 gene, each restored the

ability of SR128-3C to grow on YPG (Figure 2). Expression of the YGR255C ORF as a carboxy-

terminal HA-tagged fusion protein from the alcohol dehydrogenase promoter also rescued YPG

growth of SR128-3C.

The one-step gene replacement procedure (24) was used to obtain strains harboring disrupted

alleles of the COQ6 gene (W303∆COQ6-1, αW303∆COQ6-1 and SR∆COQ6-1). Analysis of

these strains (see Experimental Procedures) confirmed the allelism between the coq6 null mutants

and the original coq6-1 mutant. These data identify the YGR255C ORF as COQ6.

COQ6 is not an essential gene. It has been reported that a complete disruption of the COQ6 ORF

results in lethality as heterozygous knockouts failed to produce viable spores containing a coq6

disruption (16). However, all of the coq6 mutant strains used in this study were viable. A complete


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


13

ORF disruption was created to address this apparent discrepancy. Three haploid strains (W303-

1A, W3031B, and CEN.PK2-1C) were transformed with a PCR-generated disruption cassette and

all produced viable disruptants (W303∆COQ6-2, W303∆COQ6-2, and CEN∆COQ6-2) as

confirmed by PCR and restriction digest (data not shown). Similarly, a W303-1AB diploid was

created by mating W303-1A with W303-1B and was transformed using the same cassette. The

heterozygous COQ6/coq6 diploid strain was subjected to sporulation and tetrad dissection. Each

of the ten tetrads analyzed produced four viable spores on YPD plate media. The spores from each

tetrad showed a 2:2 segregation for respiratory competence and leucine auxotrophy. These results

indicate that the COQ6 gene is not essential for viability but is required for growth on

nonfermentable carbon sources.

Yeast coq6 null mutants lack Q6 and accumulate 3-hexaprenyl-4-hydroxybenzoic acid (HHB).

Growth of coq6-1 mutants in the presence of 4-[U-14C]hydroxybenzoic acid, the ring precursor in

Q biosynthesis, showed this mutant lacked Q6 and accumulated HHB (15). HHB is an early

intermediate in the Q biosynthetic pathway, and accumulates in mutant yeast strains harboring

deletions or disruptions in any one of the COQ3, COQ4, COQ5, COQ7 or COQ8/ABC1 genes

(15, 29, 40, 41). To characterize the defect in Q biosynthesis in a coq6 null mutant, both SR128-3C

(coq6-1) and W303∆COQ6-1 (coq6 ) were grown in the presence of 4-[U-14C]hydroxybenzoic

acid, and lipid extracts were analyzed by normal phase HPLC as described in Experimental

Procedures. Both strains lacked Q6 and accumulate a radioactive intermediate that comigrated with

HHB in fraction 26 (Figure 3). Neither the SR128-3C nor W303∆COQ6-1 was observed to

produce Q6 as analyzed by electrochemical detection, a method that can detect as little as 2 pmol Q6

per mg wet weight of yeast. Q6 levels of W303-1A and W303∆COQ6-1:pSR1-1 were 187 and

148 pmol / mg wet weight of yeast, respectively, when grown to log phase, and were 189 and 169

pmol / mg wet weight of yeast, respectively, when grown to stationary phase (data not shown).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


14

Coq6p may act as a flavin dependent monooxygenase to catalyze quinone formation. The

predicted amino acid sequence of the COQ6 ORF revealed 21% and 24% sequence identity with

the respective E. coli UbiH and UbiF polypeptides (Figure 4). E. coli ubiH mutants lack Q8 and

accumulate compound 6, indicating UbiH is required for the monooxygenase step that catalyzes

quinone formation (Figure 1 and Ref. 42). The ubiH gene product was identified as a flavin-

dependent monooxygenase (43). The E. coli ubiF gene product has also been identified as a flavin-

dependent monooxygenase, with 31% amino acid sequence identity to UbiH (44). E. coli ubiF

mutants lack Q8, accumulate compound 8, and both ubiH and ubiF mutants fail to grow on media

containing succinate (Figure 1 and Ref 45). Coq6p, UbiH, UbiF, and other eukaryotic homologs of

Coq6 each contain three regions with amino acid sequence identities that are present in a large

family of flavin-dependent monooxygenases (Figure 5 and Ref 46). Region 1 contains an ADP-

binding fingerprint (47), Region 2 is implicated in the recognition of NAD(P)H and may also be

involved indirectly in binding the pyrophosphate moiety of FAD (48), while Region 3 contains a

consensus sequence for binding to the ribityl moiety of FAD (49). Based on the homology with

UbiH, and UbiF, and the presence of the conserved motifs found in other aromatic flavin-dependent

monooxygenases, it seems likely that Coq6p functions in one or more hydroxylation steps in Q

biosynthesis.

Mitochondrial import of Coq6p. The amino-terminal sequence predicted for Coq6p showed

characteristics of mitochondrial targeting sequences (14). The first 28 amino acid residues are

abundant in positively charged amino acid residues and devoid of acidic residues. Arrangement of

these 28 residues in a helical wheel shows the positively charged residues are located along one side

of the α-helix. The amino terminal region contains the sequence motif common in many

mitochondrial matrix proteins that are proteolytically cleaved twice once imported into matrix, as

characterized by an arginine at -10 , a hydrophobic residue (F, L or I) at -8, and serine, threonine or

glycine at -5 relative to the N-terminal residue of the proteolytically processed protein. To


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


15

determine whether Coq6p is a mitochondrial protein, an in vitro mitochondrial import assay of the

Coq6 polypeptide was performed. Upon incubation with mitochondria prepared from wild type

yeast, the in vitro translated Coq6p was cleaved, and the resulting mature form of the protein was

observed to have a mass of about 51kD, consistent with lysine 21 as the putative cleavage site

(Figure 6). This mature protein was protected and resistant to exogenous proteinase K treatment

(Lane 3, Figure 6). Disruption of mitochondrial membrane with detergent exposed the imported

and processed Coq6p, which became accessible to the proteinase K (Lane 4, Figure 6). The import

of Coq6p also required a mitochondrial membrane potential, as the addition of valinomycin

inhibited import of Coq6p (Lanes 5 and 6, Figure 6).

Mitochondrial localization of Coq6p. Our initial investigation of the subcellular localization of

Coq6p made use of a carboxyl-terminal fusion protein between Coq6p and the HA epitope peptide

(see Experimental Procedures). The Coq6-HA epitope fusion protein retained activity as assayed

by the ability of either the single- or multi-copy plasmid construct to rescue coq6 null mutant yeast

strains for growth on media containing a nonfermentable carbon source (YPG plates, data not

shown). However, subsequent subcellular and submitochondrial fractionation analysis revealed that

the Coq6-HA tagged construct was present in mitochondria as an insoluble aggregate because it

remained in the pellet following treatment with 1% Triton-X100 and 1 M NaCl. For this reason,

antibodies were generated to the Coq6 polypeptide.

A polyclonal antibody was generated in rabbit against a Coq6-His-tagged fusion protein. This

antibody recognized a polypeptide of 51 kD in wild type yeast cell extracts, and also recognized the

Coq6-HA tagged polypeptide that migrates at about 57 kD (Figure 7a). No polypeptide at these

molecular weights was detected in cell extracts of the coq6 deletion strain, indicating that the

antibody is specific for Coq6p. Western blot analysis of subcellular yeast fractions revealed that


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


16

Coq6p co-fractionated with the mitochondria along with Coq4p, Coq3p, and cytochrome b2 (Figure

7b). To determine if Coq6p is a membrane bound or soluble protein, purified mitochondria were

osmotically shocked to disrupt the outer membrane and release components of the intermembrane

space. Mitoplasts were then further disrupted by sonication to separate the remaining soluble and

membrane components. Figure 7c shows that Coq6p localizes to the membrane (pellet) fraction.

To determine if Coq6p resides in the inner or outer membrane, mitochondria were treated with

combinations of proteinase K, Triton X-100, and hypotonic swelling. Figure 7d shows that Coq6p

is degraded only when the detergent is present as is the case for two matrix proteins, Hsp60p and

Mas2p. Finally, to determine if Coq6p is a peripheral or integral protein in the inner mitochondrial

membrane, mitoplasts were treated with 0.1M sodium carbonate buffer, pH 11.5. Figure 7e shows

that following this treatment Coq6p is released into the supernatant, as are the β subunit of F1-

ATPase and Coq4p (two peripheral membrane proteins), whereas cytochrome c1 (an integral

membrane protein) is not.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


17

Discussion

This work characterizes yeast coq6 mutants and the isolation of the COQ6 gene. COQ6 is

necessary for Q biosynthesis. In the original coq6 mutant and in both coq6 partial and complete

deletion mutants, Q6 is undetectable and as a result, these cells are rendered respiratory incompetent.

Based on the data presented here, COQ6 encodes a mitochondrial protein necessary for Q

biosynthesis. Similar to Coq2p, Coq3p, Coq4p, Coq5p, Coq7p, and Coq8p/Abc1p, the Coq6

polypeptide is imported into mitochondria (14). In agreement with submitochondrial localization

studies of Coq1p, Coq3p, Coq4p, Coq5p, and Coq7p, Coq6p is localized to the matrix side of the

inner membrane (18, 40, 50, and unpublished data).

S. cerevisiae is a facultative anaerobe capable of fermentation and aerobic respiration, and none of

the other COQ genes have been identified as being essential. Complete deletions of the COQ6

gene were introduced into both haploid and diploid strains of W303, and also into CEN.PK2-1C, a

haploid strain similar in genetic background to the diploid used by Fiori et al. (16). In contrast to

their results, all yeast strains were viable when COQ6 was deleted, indicating that none of the eight

COQ genes is essential. Q itself is non-essential for growth in this organism.

The function of Coq6p is still unknown, as are the functions of Coq4p and Coq8p. Based on

sequence homology to known flavin dependent monooxygenases, it is likely that Coq6p acts

similarly. Although Coq6p and UbiF share 24% sequence identity, it seems unlikely that Coq6p

functions like UbiF in the hydroxylation of compound 8 in yeast, because previous studies have

shown that yeast Coq7p is required for this hydroxylation step (29). The Coq7 polypeptide has

been identified as a di-iron carboxylate protein, a member of a monooxygenase family distinct from

UbiF (51). Although E. coli lack a homolog of Coq7p, homologs of yeast Coq7p from other

prokaryotic species rescue the E. coli ubiF hydroxylase mutants, indicating that these two distinct


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


18

types of monooxygenases each catalyze the same reaction in Q biosynthesis (51). Currently, two

of the uncharacterized steps in Q biosynthesis are hydroxylations and Coq6p may be responsible

for either or both of these steps. Coq6p has 21% identity to the E. coli UbiH, which converts

compound 6 to 7. Of course other hydroxylation substrates for Coq6p are also possible, including

the hydroxylation of HHB to compound 4 (Figure 1). Indeed, since coq6-1 and coq6 null mutants

both accumulate HHB (Figure 3), it seems attractive to postulate its action at this step. However, the

accumulation of HHB is not diagnostic of the blocked step, since so many other coq mutants also

accumulate HHB (15). Another possibility is that Coq6p catalyzes the oxidative decarboxylation of

compound 5 to 7. It has been demonstrated that 4-hydroxybenzoate 1-hydroxylase oxidatively

decarboxylates 4-hydroxybenzoic acid with the formation of hydroquinone (52). Salicylate

hydroxylase similarly oxidatively decarboxylates salicylate to catechol (53). However, in yeast this

is less likely given that previous work showed a Q-deficient yeast mutant accumulated compound 6

(54). Furthermore, that mutant was never sequenced nor is it available. Identification of the role of

Coq6p in the hydroxylation step(s) of Q biosynthesis will require development of in vitro assays

for these hydroxylation steps.

Blast analysis of Coq6p against other higher eukaryotic genomes revealed that only one homologue

existed for H. sapiens, M. musculus, and C. elegans indicating a conserved evolution for this

protein (Figure 4). For D. melanogaster, two matches were found but only one had a high score

and spanned the entire sequence. The homologs in each case retained the three conserved motifs

depicted in Figure 5.

Genetic data have suggested that a putative complex of these Coq polypetides is responsible for Q

biosynthesis because a deletion in any one of the eight COQ genes results in a profound decrease

in steady state protein levels for Coq3p, Coq4p, and Coq7p (34 and unpublished observations).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


19

Furthermore, null mutations in coq3, coq4, coq5, coq7 or coq8/abc1 result in the accumulation of

HHB (15). Similarly, analyses of lipid extracts of coq6 mutants in the studies presented here show

these mutants also accumulate HHB. It has been observed that an E226K coq4 point mutant did

allow for the steady state expression of Coq3p and Coq7p (40). In addition, a G104D coq7 point

mutant allowed for the accumulation of 2-hexaprenyl-3-methyl-6-methoxy-1,4-benzoquinone

(demethoxy-Q, or compound 8, Figure 1) (29). It would appear that both the coq4 and coq7 amino

acid substitution mutants allow for the expression of correctly folded but inactive Coq4p and

Coq7p, respectively, and each may be interacting and stabilizing the steady state expression of the

other Coq polypeptides in a complex. The accumulation of HHB in both the coq6 mutants further

suggests that Coq6p similarly is required for stabilization of a complex. Additionally, the coq6-1

mutant has been found to be a nonsense mutation of the tyrosine at position 218 (Hsieh, E., and

Clarke, C., unpublished). This mutant would be unable to produce a stable polypeptide at full

length and would explain why we see an accumulation of HHB.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


20

References

1. Brandt, U., and Trumpower, B. (1994) Crit. Rev. Biochem. Mol. Biol. 29, 165-197

2. Dutton, P. L., Ohnishi, T., Darrouzet, E., Leonard, M. A., Sharp, R. E., Gibney, B. R.,

Daldal, F., and Moser, C. C. (2000) in Coenzyme Q: Molecular Mechanisms in Health and

Disease (Kagan, V. E. and Quinn, P. J., eds) pp 65-82, CRC Press, Boca Raton, FL

3. Santos-Ocaña, C., Do, T. Q., Padilla, S., Navas, P., and Clarke, C. F. (2002) J. Biol. Chem.

277, 10973-10981

4. Gille, L., and Nohl, H. (2000) Arch. Biochem. Biophys. 375, 347-354

5. Santos-Ocana, C., Do, T. Q., Padilla, S., Navas, P., and Clarke, C. F. (2002) J. Biol. Chem.

277, 10973-10981

6. Kagan, V. E., Nohl, H., and Quinn, P. J. (1996) in Handbook of Antioxidants (Cadenas, E.,

and Packer, L., eds.), pp 157-201, Dekker, New York

7. Georgellis, D., Kwon, O., Lin, E.C. (2001) Science 292, 2314-2316

8. Larsen, P. L., and Clarke, C. F. (2002) Science 295, 120-123

9. Jonassen, T., Marbois, B.N., Faull, K.F., Clarke, C.F., Larsen, P.L. (2002) J Biol Chem 277,

45020-45027

10. Geromel, V., Darin, N., Chretien, D., Benit, P., DeLonlay, P., Rotig, A., Munnich, A., Rustin,

P. (2002) Mol Genet Metab 77, 21-30

11. Shults, C. W., Oakes, D., Kieburtz, K., Beal, M. F., Haas, R., Plumb, S., Juncos, J. L., Nutt,

J., Shoulson, I., Carter, J., Kompoliti, K., Perlmutter, J. S., Reich, S., Stern, M., Watts, R. L.,

Kurlan, R., Molho, E., Harrison, M., and Lew, M. (2002) Arch. Neurol. 59, 1541-1550

12. Meganathan R. (2001) FEMS Microbiol Lett 203, 131-139


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


21

13. Tzagoloff, A., and Dieckmann, C. L. (1990) Microbiol. Rev. 54, 211-225

14. Jonassen, T. and Clarke, C. F. “Genetic Analysis of Coenzyme Q Biosynthesis”

Coenzyme Q: Molecular Mechanisms in Health and Disease. (Kagan, V. E. and Quinn, P.

J., eds.) (2000), 185-208, CRC Press, Boca Raton, FL

15. Poon, W. W., Do, T. Q., Marbois, B. N., and Clarke, C. F. (1997) Mol. Aspects Med. 18,

s121-s127

16. Fiori, A., Bianchi, M. M., Fabiani, L., Falcone, C., Francisci, S., Palleschi, C., Solimando, N.,

Uccelletti, D., and Frontali, L. (2000) Yeast 16, 377-386

17. Adams, A., Gottschling, D. E., Kaiser, C. A., and Stearns, T. (1997) Methods in Yeast

Genetics pp. 145-154, Cold Spring Harbor Laboratory Press, Plainview, NY

18. Poon, W. W., Barkovich, R. J., Hsu, A. Y., Frankel, A., Lee, P. T., Shepherd, J. N., Myles,

D. C., and Clarke, C. F. (1999) J. Biol. Chem. 274, 21665-21672

19. Glick, B. S., and Pon, L. A. (1995) Methods Enzymol. 260, 213-223

20. Marbois, B. N., Hsu, A., Pillai, R., Colicelli, J., and Clarke, C. F. (1994) Gene 138, 213-217

21. Rose, M. D., Novick, P., Thomas, J. H., Botstein, D., and Fink, G. R. (1987) Gene 60, 237-

243

22. Carlson, M., and Botstein, D. (1982) Cell 28, 145-154

23. Sikorski, R. S., and Hieter, P. (1989) Genetics 122, 19-27

24. Rothstein, R. J. (1983) Methods Enzymol. 101, 202-211

25. Elble, R. (1992) Biotechniques 13, 18-20

26. Baudin, A, Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993) Nucl.

Acids Res. 21, 3329-3330


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


22

27. Gietz, R., Schiestl, R., Willems, A., and Woods, R. (1995) Yeast 11, 355-360

28. Clarke, C. F., Williams, W. and Teruya, J. H. (1991) J. Biol. Chem. 266, 16636-16644

29. Marbois, B .N., and Clarke, C. F. (1996) J. Biol. Chem. 271, 2995-3004

30. Poon, W. W., Marbois, B. N., Faull, K. F. and Clarke, C. F. (1995) Arch. Biochem.

Biophys. 320, 305-314

31. Jonassen, T., and Clarke, C. F. (2000) J. Biol. Chem. 276, 18161-18168

32. Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P. (1992) Gene

110, 119-122

33. Yaffe, M. P. (1991) Methods Enzymol. 194, 627-643

34. Hsu, A. Y., Poon, W. W., Shepherd, J. A., Myles, D. A., and Clarke, C. F. (1996)

Biochemistry 35, 9797-9806

35. Niman, H. L., Houghten, R. A., Walker, L. E., Reisfeld, R. A., Wilson, I. A., Hogle, J. M.,

and Lerner, R. A. (1983) Proc. Natl. Acad. Sci. USA 80, 4949-4953

36. Spain, B. H., Koo, D., Ramakrishnan, M., Dzudzor, B., and Colicelli, J. (1995) J. Biol.

Chem. 270, 25435-25444

37. Jarosch, E., Tuller, G., Daum, G., Waldherr, M., Voskova, A., and Schweyen, R. J. (1996) J.

Biol. Chem. 271, 17219-17225

38. Glick, B. S., Brandt, A., Cunningham, K., Muller, S., Hallberg, R. L., and Schatz, G. (1992)

Cell 69, 809–822

39. Tzagoloff, A., Akai, A., and Needleman, R. B. (1975) J. Biol. Chem. 250, 8228-8235

40. Belogrudov, G. I., Lee, P. T., Jonassen, T., Hsu, A. Y., Gin, P., and Clarke, C. F. (2001)

Arch. Biochem. Biophys. 392, 48-58


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


23

41. Do, T. Q., Hsu, A. Y., Jonassen, T., Lee, P. T., and Clarke, C. F. (2001) J. Biol. Chem. 276,

18161-18168

42. Young, I. G., Stroobant, P., MacDonald, C. G., and Gibson, F. (1973) J. Bacteriol. 114, 42-

52

43. Nakahigashi, K., Miyamoto, K., Nishimura, K., and Inokuchi, H. (1992) J. Bacteriol. 174,

7352-7359

44. Kwon, O., Kotsakis, A., and Meganathan, R. (2000) FEMS Microbiol. Lett. 186, 157-161

45. Young, I. G., McCann, L. M., Stroobant, P., and Gibson, F. (1971) J. Bacteriol. 105, 769-

778

46. Palfey, B. A., Ballou, D. P., and Massey, V. (1995) Oxygen activation by flavins and

pterins, In Active Oxygen in Biochemistry, (Valentine, J. S., Foote, C. S., Greenberg, A., and

Liebman, J. F., eds.) pp. 37-83, Blackie Academic & Professional Press, Glasgow, UK

47. Wierenga, R. K., Terpstra, P., and Hol, W. G. J. (1986) J. Mol. Biol. 187, 101-107

48. Eppink, M. H. M., Schreuder, H. A., and Van Berkel, W. J. H. (1997) Protein Sci. 6, 2454-

2458

49. Eggink, G., Engel, H., Vriend, G., Terpstra, P., and Witholt, B. (1990) J. Mol. Biol. 212,

135-142

50. Jonassen T., Proft M., Randez-Gil F., Schultz J. R., Marbois B. N., Entian K. D., and

Clarke C. F. (1998) J. Biol. Chem. 273, 3351-3357

51. Stenmark, P., Grunler, J., Mattsson, J., Sindelar, P. J., Nordlund, P., and Berthold, D. A.

(2001) J. Biol. Chem. 276, 33297-300


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


24

52. Eppink, M. H. M., Boeren, S. A., Vervoort, J., and Van Berkel, W. J. H. (1997) J. Bacteriol.

179, 6680-6687

53. Katagiri, M., Takemori, S., Suzuki, K., and Yasuda, H. (1966) J. Biol. Chem. 241, 5675-

5677

54. Goewert, R. R., Sippel, C. J., Grimm, M. F., and Olson, R. E. (1978) FEBS Lett. 87, 219-

221

55. Tzagoloff, A., Akai, A., and Foury, F. (1976) FEBS Lett. 65, 391-395

56. Proft, M., Kotter, P., Hedges, D., Bojunga, N., and Entian, K. D. (1995) EMBO J. 14, 6116-

6126

57. McEwen, J. E., Ko, C., Kloeckner-Gruissem, B., and Poyton, R .O. (1986) J. Biol. Chem.

261, 11872-11879

58. Wong, C. M., Dilworth, M. J., and Glen, A. R. (1994) Microbiology 140, 2775-2786

59. Kalin, M., Neujahr, H. Y., Weissmahr, R. N., Sejlitz, T., Johl, R., Fiechter, A., and Reiser,

J. (1992) J. Bacteriol. 174, 7112-7120

60. Suzuki, K., Mizuguchi, M., Ohnishi, K., and Itagaki, E. (1996) Biochim. Biophys. Acta

1275, 154-156

61. Orser, C. S., Lange, C. C., Xun, L., Zahrt, T. C., and Schneider, B. J. (1993) J. Bacteriol.

175, 411-416

62. Weijer, W. J., Hofsteenge, J., Beintema, J. J., Wierenga, R. K., and Drenth, J. (1983) Eur.

J. Biochem. 133, 109-118

63. DiMarco, A. A., Averhoff, B. A., Kim, E. E., and Ornston, L. N. (1993) Gene 125, 25-33


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


25

64. Filippini, S., Solinas, M. M., Breme, U., Schluter, M. B., Gabellini, D., Biamonti, G.,

Colombo, A. L., and Garofano, L. (1995) Micriobiology 141, 1007-1016

65. Nurk, A., Kasak, L., and Kivisaar, M. (1991) Gene 102, 13-18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


26

Acknowledgements

This work was supported in part by National Institutes of Health Grant GM45952 (to C. Clarke)

and National Institutes of Health Grant HL2274 (to A. Tzagoloff).

1The abbreviations used are: Q, ubiquinone or coenzyme Q; Coq6p, the polypeptide encoded by

the COQ6 gene.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


27

Figure Legends

Figure 1. The Q biosynthetic pathway in eukaryotes and prokaryotes. Coq1p (S.

cerevisiae) or IspB (E. coli) assemble the polyprenyldiphosphate tail with n=6 and n=8 isoprene

units, respectively. After formation of 3-polyprenyl-4-hydroxybenzoic acid (compound 1), by the

4-hydroxybenzoic acid:polyprenyltransferase (Coq2p or UbiA), the proposed biosynthetic

pathways for Q in eukaryotes and in prokaryotes is thought to diverge as shown. In yeast, n=6 and

compound 1 is 3-hexaprenyl-4-hydroxybenzoic acid (HHB). E. coli gene products are identified

as Ubi (and also include IspB); S. cerevisiae gene products are identified as Coq.

Figure 2. Restriction map of isolated yeast genomic DNA containing the COQ6 gene and

strategy of COQ6 deletion. The gray bars indicate the positions of the GND2 and COQ6 genes

present on p494SR. Each of the plasmids depicted was able to restore growth of coq6 yeast mutant

strains on YPG plate media as identified by the (+) sign. A deletion construct was prepared by

replacing a 414-bp BglII fragment (black bar) with the HIS3 gene on a BamHI fragment, as

described in Experimental Procedures. Restriction sites are symbolized by either one or two letters

and correspond to the following DNA restriction enzymes: B, BglII; H, HindIII; RI, EcoRI; RV,

EcoRV.

Figure 3. Yeast coq6 mutants lack Q and accumulate a polar intermediate that

corresponds to HHB. (a) Lipid extracts were prepared from SR128-3C (coq6-1 allele) or (b)

from W303∆COQ6-1 (coq6 deletion mutant) and separated by normal phase HPLC as described

in Experimental Procedures. Fractions were collected (1 ml) and 14C radioactivity was determined

by scintillation counting. A Q6 standard eluted in fraction 6.

Figure 4. Alignment of predicted yeast COQ6 amino acid sequence with two E. coli

homologs. The sequence of the yeast Coq6 polypeptide is shown in alignment with homologs in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


28

C. elegans (GenBank Acc# NP_505415), H. sapiens (GenBank Acc# NP_057024), M. musculus

(GenBank Acc# XP_126972), D. melanogaster (GenBank Acc# NP_608934), E. coli UbiH

(GenBank Acc# P25534), and E. coli UbiF (GenBank Acc# P75728). Alignments were created on

DNASTAR™'s Megalign with the Clustal method and the PAM 250 residue weight table.

Identical amino acid residues are shaded and noted above the alignment. Yeast Coq6 amino acid

sequence shared identities of 29.0% (C. elegans), 28.6% (H. sapiens), 29.2% (M. musculus),

25.8% (D. melanogaster), 21.2% (E. coli UbiH), 24.3% (E. coli UbiF).

Figure 5. Comparison of regions of the predicted COQ6 amino acid sequence with

conserved sequences found in FAD binding aromatic hydroxylases. Alignments were

created on DNASTAR™'s Megalign with the Clustal method and the PAM 250 residue weight

table. The (∆) symbol represents amino acid residues A, I, L, V, M, or C that occur as part of the

ADP binding fingerprint of Region 1 (47). Region 2 is implicated in the recognition of NADH or

NADPH and is also involved indirectly in binding the pyrophosphate moiety of FAD (48). Region

3 contains a consensus for binding to the ribityl moiety of FAD (49). The aromatic hydroxylases

are designated as UbiH, 2-octaprenyl-6-methoxyphenol hydroxylase from Escherichia coli

(GenBank Acc# P25534) (43); PobARh, 4-hydroxybenzoate hydroxylase (PobA) from Rhizobium

leguminosarum (GenBank Acc# AAA73519) (58); PhyATc, phenol hydroxylase from

Trichosporon cutaneum (GenBank Acc# AAA34202) (59); ShPs, salicylate hydroxylase from

Pseudomonas putida (GenBank Acc# d1011754) (60); PcpB, pentachlorophenol 4-

monooxygenase(pcpB) from Flavobacterium sp. (GenBank Acc# AAF15368) (61); PobAPS, p-

hydroxybenzoate hydroxylase from Pseudomonas fluorescens (GenBank Acc# WHPSBF) (62);

PobAAc, p-hydroxybenzoate hydroxylase (pobA) from Acinetobacter calcoaceticus (GenBank

Acc# AAC37163) (63); DnrF, 11-aklavinone hydroxylase from Streptomyces peucetius (GenBank

Acc# AAC43342) (64); PheA, phenol monooxygenase from Pseudomonas sp (GenBank Acc#

AAC64901) (65).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


29

Figure 6. In vitro mitochondrial import and proteolytic processing of Coq6. Lane 1: 10%

of the radiolabeled in vitro translation product used in each import reaction. Lane 2: in vitro

translation product incubated with isolated mitochondria. Lane 3: Same as Lane 2 but including a

post-import proteinase K treatment. Lane 4: Same as Lane 3 except Triton X-100 was added to

disrupt the mitochondria before proteinase K treatment. Lane 5 and Lane 6: in vitro translation

product was incubated with mitochondria in the presence of the uncoupler valinomycin (10µg/ml

final concentration). After the incubation, the reisolated mitochondria were either treated with

proteinase K as in Lane 5 or were directly analyzed as in Lane 6. The samples were mixed with

sample buffer and heated at 100°C for 5 minutes prior to analysis by SDS polyacrylamide

electrophoresis (12% polyacrylamide) and autoradiography. P and M indicate the positions of the

precursor form and the mature form of Coq6p respectively.

Figure7. Coq6p is peripherally associated with the inner membrane of mitochondria. (a)

The antiserum generated against Coq6p and its specificity was tested against the wild type strain

W303-1A (WT), the coq6 deletion strain W303-1A∆COQ6-1 (∆), and the multicopy HA-tagged

rescued strain W303-1A∆COQ6-1:pHA6-1 (MC). (b) Whole cell yeast was homogenized and

separated by differential centrifugation into nuclear (P1), crude mitochondrial (CM), Nycodenz

gradient purified mitochondrial (NM), and post mitochondrial supernatant fractions (PS). (c)

Nycodenz purified mitochondria (NM) were subjected to hypotonic swelling, centrifuged to

separate intermembrane space proteins in the supernatant (IMS). The pellet was then sonicated and

centrifuged to release a soluble matrix protein fraction in the supernatant (S) and membrane protein

fraction pellet (P). (d) Intact mitochondria or mitoplasts generated by hypotonic swelling were

treated with proteinase K (100 µg/ml) for 30 min with or without 1% Triton X-100. (e) Mitoplasts

were incubated with 0.1 M Na2CO3, pH 11.5 on ice 30 min. Centrifugation produced soluble (S)

and insoluble (P) fractions, which were compared against Nycodenz purified mitochondria (NM).

All samples were separated by SDS-PAGE and analyzed by immunoblotting as described in

experimental procedures. Antiserum was used against Coq6p and compared to results of antisera


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


30

against outer membrane protein OM45p, intermembrane space protein cytochrome b2 (Cyt b2),

integral inner membrane protein cytochrome c1 (Cyt c1), peripheral inner membrane proteins

Coq3p, Coq4p, and the β subunit of F1-ATPase (F1β), and matrix proteins Hsp60 and Mas2.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


31

TABLE I

Genotypes and sources of S. cerevisiae strains

Strain Genotype Source or Ref.

D273-10B/A1 α, met6 55

W303-1Α a, ade2-2, his3-11,15, leu2-3-115, trp1-1, ura3-1 R. Rothsteina

W303-1Β α, ade2-2, his3-11,15, leu2-3-115, trp1-1, ura3-1 R. Rothsteina

W303-1AB a/α, ade2-2/ade2-2, his3-11,15/his3-11,15, leu2-3-

115/leu2-3-115, trp1-/ trp1-1, ura3-1/ura3-1

This study

CEN.PK2-1C a, ura3, his3, leu2, trp1 56

FY251 a, ura3-52, his3 200, leu2 1, trp1 63 F. Winstonb

JM6 a, his4, ρ° 57

JM8 α, ade1, ρ° 57

C128 α, coq6-1, met 13

SR128-1A a, coq6-1, leu2 1 C128 x FY251

SR128-3C α, coq6-1, his3 200, trp1 63, ura3-52 C128 x FY251

W303∆COQ6-1 W303-1A, coq6::HIS3 This study

αW303∆COQ6-1 W303-1B, coq6::HIS3 This study

SR∆COQ6-1 SR128-3C, coq6::HIS3 This study

W303∆COQ6-2 W303-1A, coq6::LEU2 This study

αW303∆COQ6-2 W303-1B, coq6::LEU2 This study

W303-1AB∆COQ6-2 W303, coq6::LEU2 This study

CEN∆COQ6-2 CEN.PK2-1C, coq6::LEU2 This study

W303∆COQ6-1:pSR1-1 W303-1A, coq6::HIS3:pSR1-1 This studya Dr. Rodney Rothstein, Department of Human Genetics, Columbia Universityb Dr. Fred Winston, C. Dollard and S. Ricapero-Hovasse, Department of Genetics, Harvard

University


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

- - - - - - - - - - - - - - - - - - - - - M F F S K V M L T R R I L V R G L A T A K S S A P K L T D V L I V G G G P1 S. cerevisiae- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - M K L P G G T I I C A R N A S S Y Y D T V I V G G G M1 C. elegans- - - - - - - - - - - - - M A A R L V S R C G A V R A A P H S G P L A V L A Q V V R R S T D T V Y D V V V S G G G L1 H. sapiens- - - - - M A A R I G S M A G L L C V R W W S S A Q L A A R G G P L V A S Q R W A G S S A D T V Y D V V V S G G G L1 M. musculusM L G V L R I Q G A L A S A G Q A R L L S V R L L A S K S T T D M T T N R G E S T Q S T S T E H F D I I I G G G G L1 D. melanogaster- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - M S V I I V G G G M1 E. coli UbiH- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - M T N Q P T E I A I V G G G M1 E. coli UbiF

A G L T L A A S I K N S P Q L K D L K T T L V D M V D L K D K L S D F Y N S P P D Y F T N R I V S V T P R S I H F L38 S. cerevisiaeV G N A M A C S L G A N K S F Q S K S V L L L D A G R S P S L A S F - - - K P G A P F N N R V V A T S P T S I D T F28 C. elegansV G A A M A C A L G Y D I H F H D K K I L L L E A G - - P K K V L E - - - K L S E T Y S N R V S S I S P G S A T L L46 H. sapiensV G S A M A C A L G H D I H F H D K K I L L L E A G - - P K K A L E - - - K L S E T Y S N R V S S I S P G S T T L L54 M. musculusV G T T L A A A L A K N S T L A D K K V L L L E G A - - P E F R G F - - - N P T G P Y Q N R V S A I N H N S I E L F59 D. melanogasterA G A T L A L A I S R L S H - G A L P V H L I E A T A P E S H - A H - - - - - - P G F D G R A I A L A A G T C Q Q L11 E. coli UbiHV G G A L A L G - - - L A Q - H G F T V T V I E H A E P A P F V A D - - - - - - S Q P D V R I S A I S A A S V S L L16 E. coli UbiF

E N N A G - A T L M H D R I Q - S Y D G L Y V T D G C S K A T L D L A R D S M L - C M I E - I I N I Q A S L Y N R I96 S. cerevisiaeK K L G V W D Q I N S H R T K - K V N R L F V F D S C S T S E I E F E R G Q - Q - E E V A F I I E N D L I V G S L Y83 C. elegansS S F G A W D H I C N M R Y R - A F R R M Q V W D A C S E A L I M F D K D N L D - - D M G Y I V E N D V I M H A L T99 H. sapiensS S F G A W D H I C N M R C K - A F R R M Q V W D S C S E A L I M F D R D N L D - - D M G Y I V E N D V I M Y A L T107 M. musculusK S I D A W K H I E S A R Y K - P V K Q M Q V W E S N T D A L I Q F Q H D N F A - S D V A C I I E N D L I L D A V Y112 D. melanogasterA R I G V W Q S L A D - - C A T A I T T V H V S D R G H A G F V T L A A E D Y Q L A A L G Q V V E L H N V G Q R L F61 E. coli UbiHK G L G V W D A V Q A M R C H - P Y R R L E T W E W - E T A H V V F D A A E L K L P L L G Y M V E N T V L Q Q A L W64 E. coli UbiF

S Q Y D S K K D S I D I I D N T K V V N I K H S D P - - - N D P L S W P L V T L S N G E V Y K T R L L V G A D G F N150 S. cerevisiaeE K L A E Y K N - V D V K T G A K V E D C S I P N A L E N M A T - - - - - I K L E N G D V I E T S L L I G A D G V N138 C. elegansK Q L E A V S D R V T V L Y R S K A I R Y T W P C P F P M A D S S P W V H I T L G D G S T F Q T K L L I G A D G H N154 H. sapiensK Q L E A V A D R V K V L Y E S K A V G Y S W P G A F S M A D S S P W V H I T L G D G S T L Q T K L L I G A D G H K162 M. musculus- A L A K E S P N V E I L N K A R - I Q C V R - - - L P R D S N S N H S E L Q L E D G R N F S C D L L I G A D G A N168 D. melanogasterA L L R K - A P G V T L H C P D R V A N V A R T Q S H - - - - - - - - V E V T L E S G E T L T G R V L V A A D G T H117 E. coli UbiHQ A L E A - H P K V T L R V P T S L I A L H R D N D L - - - - - - - - Q E L E L K G G E V I R A K L V I G A D G A N120 E. coli UbiF

S P T R R F S Q I P S R G W M - - - Y N A Y G V V A S M K L E Y P P F K L R - G W Q R F L P T G P I A H L P M P E N205 S. cerevisiaeS K V R H A S N L D Y T T F N - - - Y N Q H G L V A I V N I E T A N G K N E T A W Q R F T T L G P V A L L P L S D T190 C. elegansS G V R Q A V G I Q N V S W N - - - Y D Q S A V V A T L H L S E A T - E N N V A W Q R F L P S G P I A L L P L S D T212 H. sapiensS G V R Q A A G I Q N V S W K - - - Y D Q S A V V A T L H L S E A T - E N N V A W Q R F L P S G P I A L L P L S D T220 M. musculusS V V R K E M N V D V F S L N - - - Y D R M G L V A T L E L G E D A C D N S V A W Q R F L P N G P V A L L P L T D R221 D. melanogasterS A L A T A C G V D - - - W Q Q E P Y E Q L A V I A N V A T S V A H - - E G R A F E R F T Q H G P L A M L P M S D G166 E. coli UbiHS Q V R Q M A G I G V H A W Q - - - Y A Q S C M L I S V Q C E N D P - - G D S T W Q Q F T P D G P R A F L P L F D N169 E. coli UbiF

N A T L V W S S S E R L S R L L L S L P P E S F T A L I N A A F V L E D A D M N Y Y Y R T L E D G S M D T D K L I E259 S. cerevisiaeV S G L T W S T S P E E A Q R L K Q L P S D Q F V D E L N S A L F S Q N N Q I P L - - - - - - - - - - - V N Q T I F245 C. elegansL S S L V W S T S H E H A A E L V S M D E E K F V D A V N S A F W S D A D H T D F - - - - - - - - - - - I D T A G A266 H. sapiensL S S L V W S T S H E H A A E L V S M D E E E F V D A I N S A F W S D V H H T D F - - - - - - - - - - - V D S A S A274 M. musculusL S S L V W S T T N E Q A K M L Q A L P P T E F V D A L N E A F C R Q Y P R V E L - - - - - - - - - - - A D K A V Q276 D. melanogasterR C S L V W C H P L E R R E E V L S W S D E K F C R E L Q S A F G W R L G K I T - - - - - - - - - - - - - - - - - -219 E. coli UbiHW A S L V W Y D S P A R I R Q L Q N M N M A Q L Q V E I A K H F P S R L G Y V T - - - - - - - - - - - - - - - - - -222 E. coli UbiF

D I K F R T E E I Y A T L K D E S D I D E I Y P P R V V S I I D K T R A R F P L K L T H A D R Y C T D R V A L V G D317 S. cerevisiaeA L N - R - M N P F R T E T F G R K A E G T T P P H V I T V Q D K S R A S F P L G F G N A H S Y I T T R C A L I G D292 C. elegansM L Q - Y P V S L L K P T K V S A R - Q - - L P P S V P W V D A K S R V L F P L G L G H A A E Y V R P R V A L I G D313 H. sapiensM V R - H A V A L L K P T K V S A R - Q - - L P P S I A K V D A K S R A L F P L G L G H A A E Y V R P R V A L I G D321 M. musculusA L N - - - - S L F G H N G S Q H Q V Q - - Y P P R V C G V L D K S R A T F P L G F L H A S S Y V C N G A A L V G D323 D. melanogaster- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - H A G K R S A Y P L A L T H A A R S I T H R T V L V G N259 E. coli UbiH- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - P L A A - G A F P L T R R H A L Q Y V Q P G L A L V G D262 E. coli UbiF

A A H T T H P L A G Q G L N M G Q T D V H G L V Y A L E K A M E R G L D I G S S L S L E P F W A E R Y P S N N V L L375 S. cerevisiaeA A H R M H P L A G Q G V N L G W S D V Q I L D K V L G D A V R E G A D I G S I T Y L R E Y D S A A Q K H N L P V M348 C. elegansA A H R V H P L A G Q G V N M G F G D I S S L A H H L S T A A F N G K D L G S V S H L T G Y E T E R Q R H N T A L L367 H. sapiensA A H R I H P L A G Q G V N M G F G D I S S L V H H L S T A A F N G K D L G S M S H L T G Y E T D R Q R H N T A L L375 M. musculusA A H R V H P L A G Q G V N L G F S D V R Y L V E S L A A G A Y A G F K L G D K Q H L I K Y E R K C L A K N V P I M375 D. melanogasterA A Q T L H P I A G Q G F N L G M R D V M S L A E T L T Q A Q E R G E D M G D Y G V L C R Y Q Q R R Q S D R E A T I287 E. coli UbiHA A H T I H P L A G Q G V N L G Y R D V D A L I D V L V N A R S Y G E A W A S Y P V L K R Y Q M R R M A D N F I M Q289 E. coli UbiF

G M A D K L F K L Y H T N F P P V V A L R T F G L N L T N K I G P V K N M I I D - T L G G N E K 433 S. cerevisiaeV S V D L L N R L Y R T D A P A I V A A R A F G L N A F N S L G P V K N F L M N - Y L S A H - - R 406 C. elegansA A T D L L K R L Y S T S A S P L V L L R T W G L Q A T N A V S P L K E Q I M - - A F A S - - - K 425 H. sapiensA A T D L L K R L Y S T S A T P L V L L R T W G L Q A T N A V S P L K E Q I M - - A F A S - - - K 433 M. musculusL G V H G L H T L Y A T Q F S P V V L L R S L G L Q L T Q N L P P V K N L F M R - G A M G - - - Q 433 D. melanogasterG V T D S L V H L F A N R W A P L V V G R N I G L M T M E L F T P A R D V L A Q R T L G W - V A R 345 E. coli UbiHS G M D L F Y A G F S N N L P P L R F V R N L G L M A A E - - - - R A G V L K R Q A L K Y A L G L 347 E. coli UbiF


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Coq6UbiHPobAPhyATcShPsPcpBPobAPsPobAAcDnrFPheA

Rh

R L L V G A D G F N S P T R195R V L V A A D G T H S A L A156D F I A G C D G F H G A S R153K Y V I G C D G G H S W V R219D V A I A A D G I K S S M R154R W V I G A D G V R S R V R167D Y I A G C D G F H G I S R153D F I A G C D G Y H G V C R155R Y L V A A D G P R S A I R173K Y L I G A D G A R S K V A201

V L I V G G G P A G L T L A A S I K N S P30V I I V G G G M A G A T L A L A I S R L S3V A I I G S G P S G L L L G Q L L T E A G5V L I V G A G P A G L M A A R V L S E Y V10V A V I G G G I A G T A L A L G L S K S S8V L I V G G G P T G L I A A N E L L R R G17V A I I G A G P S G L L L G Q L L H K A G5V A I I G S G P A G L L L G Q L L Y K A G8V L V V G G G L G G L S T A L F L A R R G10V L I V G S G P A G S S A A M F L S T Q G38


Rh

D R V A L V G D A A H T T H P L A G Q G L N M G Q T D V H G L V Y A L367H R T V L V G N A A Q T L H P I A G Q G F N L G M R D V M S L A E T L279G R L F L V G D A A H I V P P T G A K G L N L A A S D V H Y L F S G L279E R V F I A G D A C H T H S P K A G Q G M N T S M M D T Y N L G W K L350G R V A L I G D A A H A M L P H Q G A G A G Q G L E D A Y F M A E L L305G N V F L A G D A A H C H S P S G G S G M N V G M Q D A F N L G W K I291G R L F L A G D A A H I V P P T G A K G L N L A A S D V S T L Y R L L279G K L F L A G D A A H I V P P T G A K G L N L A A S D I A Y L S S A L281G P V L L V G D A A K V T P P T G G M G G N T A I G H G F D V A W K L301G R V C C A G D A I H K H P P S H G L G S N T S I Q D S Y N L C W K L322


Rh

Region 1: ADP Binding Fingerprint

Region 2: NAD(P)H / FAD Recognition

Region 3: Ribityl Binding Motif

∆ ∆ ∆ ∆


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Tzagoloff and Catherine F. ClarkePeter Gin, Adam Y. Hsu, Steven C. Rothman, Tanya Jonassen, Peter T. Lee, Alexander

monooxygenase required for coenzyme Q biosynthesisThe saccharomyces cerevisiae COQ6 gene encodes a mitochondrial flavin dependent

published online April 29, 2003J. Biol. Chem.

10.1074/jbc.M303234200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M303234200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M303234200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/04/29/jbc.M303234200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/04/29/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/04/29/jbc.M303234200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

The Saccharomyces cerevisiae COQ6 gene encodes a ... · Peter Gin, Adam Y. Hsu, Steven C. Rothman †, Tanya Jonassen, Peter T. Lee, Alexander Tzagoloff §, and Catherine F. Clarke