THE SIGNIFICANCE OF SURFACTANT PROTEIN GENE POLYMORPHISMS IN MULTIFACTORIAL INFANTILE PULMONARY DISEASES

Abstract in Finnish

MERIROVA

Faculty of Medicine,Department of Paediatrics,

Biocenter Oulu,University of Oulu

OULU 2005

MERI ROVA

THE SIGNIFICANCE OF SURFACTANT PROTEIN GENE POLYMORPHISMS IN MULTIFACTORIAL INFANTILE PULMONARY DISEASES

Academic Dissertation to be presented with the assent ofthe Faculty of Medicine, University of Oulu, for publicdiscussion in the Auditorium 101 A of the Faculty ofMedicine (Aapistie 5 A), on June 22nd, 2005, at 12 noon.

OULUN YLIOPISTO, OULU 2005

Copyright © 2005University of Oulu, 2005

Supervised byProfessor Mikko HallmanDoctor Ritva Haataja

Reviewed byDocent Jorma IlonenProfessor Ann-Christine Syvänen

ISBN 951-42-7747-3 (nid.)ISBN 951-42-7748-1 (PDF) http://herkules.oulu.fi/isbn9514277481/

ISSN 0355-3221 http://herkules.oulu.fi/issn03553221/

OULU UNIVERSITY PRESSOULU 2005

Rova, Meri, The significance of surfactant protein gene polymorphisms inmultifactorial infantile pulmonary diseases Faculty of Medicine, Department of Paediatrics, Biocenter Oulu, University of Oulu, P.O.Box 5000,FIN-90014 University of Oulu, Finland 2005Oulu, Finland

AbstractPulmonary surfactant is a lipid-protein mixture that lines the inner surface of the lung. The mainfunction of surfactant is to reduce surface tension at the air-liquid interface, thus preventing alveolarcollapse at the end of expiration. Lack of surfactant is the main cause of respiratory distress syndrome(RDS) in preterm infants. Very preterm babies are at risk of developing a lung disease calledbronchopulmonary dysplasia (BPD). The surfactant proteins SP-A, -B, -C and -D have importantfunctions in surfactant structure, homeostasis and innate immunity of the lung. The genes of theseproteins have been studied as candidates for several multifactorial lung diseases both in adults and inchildren.

The aim of the present study was to examine the genetic variation in SP genes and to evaluate therole of SP gene polymorphism in the etiology of severe pulmonary infantile diseases, including RDS,BPD and severe respiratory syncytial virus (RSV) infection among the Finnish population.Conventional allelic association methods in combination with multiparameter analysis and family-based transmission disequilibrium test (TDT) were used.

The SP-D Met11 allele was associated with a risk for severe RSV bronchiolitis in a matched case-control setting of 84 infants with severe RSV infection and 93 control infants. The variants of the SP-C gene had no detectable association with BPD. However, a modest association of SP-C Asn138 andAsn186 alleles with RDS was found. A length variation in the SP-B gene was associated with BPDamong very preterm infants born before 32 weeks of gestation. The SP-B intron 4 deletion variantallele increased the risk for BPD especially in very low birth weight infants. The association wasconfounded by birth order, being evident only among presenting infants, who are more prone toascending infections during a preterm birth process.

The present study provides new evidence about the significance of SP gene polymorphisms in theetiology of complex infantile pulmonary diseases, including RDS, BPD and severe RSVbronchiolitis. The results help us to understand the molecular mechanisms underlying these diseasesand may, in the long run, enable better treatment of these life-threatening diseases.

Keywords: bronchopulmonary dysplasia, genetic polymorphism, preterm birth, pulmonarysurfactant protein, respiratory distress syndrome, respiratory syncytial virus

Rova, Meri, Keuhkosurfaktanttiproteiinien geneettisen muuntelun merkitys pientenlasten ja keskosten vakavissa keuhkosairauksissa Lääketieteellinen tiedekunta, Lastentautien klinikka, Biocenter Oulu, Oulun yliopisto, PL 5000,90014 Oulun yliopisto 2005Oulu

TiivistelmäKeuhkosurfaktantti on keuhkon sisäpintaa peittävä kalvomainen rasva-proteiinikompleksi, jonkatärkein ominaisuus on pintajännityksen vähentäminen keuhkorakkuloissa. Surfaktantin puutosennenaikaisesti syntyneillä lapsilla aiheuttaa hengitysvaikeusoireyhtymän, RDS-taudin (respiratorydistress syndrome). Alle 30 raskausviikon iässä syntyneistä, useimmiten RDS-taudin saaneistakeskosista n. 30 % sairastuu vakavaan krooniseen keuhkotautiin, BPD-tautiin (bronchopulmonarydysplasia). Surfaktanttiproteiineilla SP-A, -B, -C ja -D on osoitettu olevan tärkeä tehtävä surfaktantintoiminnassa ja keuhkon synnynnäisessä immuniteetissa.

Tämän tutkimuksen tavoitteena oli selvittää surfaktanttiproteiineissa esiintyvän geneettisenmuuntelun määrää ja merkitystä keskosten RDS- ja BPD-taudeissa sekä pienten lasten vakavassarespiratory syncytial -viruksen (RSV) aiheuttamassa keuhkotulehduksessa. Tutkimuksen laajin osakeskittyi tutkimaan keskosten BPD-tautia ja surfaktanttiproteiinien geenien osuutta siinä. Geneettisenmuuntelun merkitystä tarkasteltiin populaatiogeneettisin keinoin tapaus-verrokkiasetelmissa japerheaineistojen avulla. Yhteensä analysoitiin noin tuhannen lapsen ja yli kahdensadan vanhemmanDNA-näytteet.

Tutkimuksessa havaittiin SP-D-geenissä olevan metioniini11-geenimuodon liittyvän pientenlasten vakavaan RSV-infektioon. Lisäksi saatiin uutta tietoa SP-C-geenin populaatiotason yleisestämuuntelusta ja todettiin SP-C:n asparagiini138 ja asparagiini186 -geenimuotojen yhteys keskostenRDS-taudin esiintymiseen. Merkittävin löydös oli SP-B-geenissä olevan deleetiovariantinkytkeytyminen alle 32-viikkoisina syntyneiden keskosten BPD-tautiin. Geneettisen altistuksenlisäksi BPD-tautiin sairastumiseen vaikuttivat lukuisat keskosuudelle ominaiset seikat, kutenalhainen syntymäpaino, RDS-tauti ja syntymähetkellä todettu hapenpuute. Geneettisen tekijänvaikutus oli voimakkain erittäin pienipainoisilla keskosilla.

Tutkimuksen tulokset ovat tuoneet arvokasta lisätietoa surfaktanttiproteiinien geenien osuudestakeskosten RDS- ja BPD-taudeissa sekä pienten lasten vakavassa RSV-infektiossa. Ne auttavatymmärtämään näiden molekyylibiologisia syntymekanismeja ja voivat ajan mittaan olla edistämässäuusien hoitomuotojen kehittämistä.

Asiasanat: bronkopulmonaalinen dysplasia, ennenaikainen synnytys, geneettinenmuuntelu, hengitysvaikeusoireyhtymä, keuhkosurfaktanttiproteiini, RS-virus

Acknowledgements

The present work was carried out at the Department of Pediatrics and Biocenter Oulu, University of Oulu, during the years 1999-2005. I am deeply grateful to my supervisor, Professor Mikko Hallman, for the opportunity to work in his research group. I thank him for his encouragement and guidance during all these years.

I owe my warm gratitude to Ritva Haataja, who has successfully fulfilled her role as my supervisor, colleague and friend. I want to thank her for the countless hours of “genetic counseling” and her help in numerous matters related to my work. Without her ideas and suggestions, I would have never succeeded in many of my projects. I also express my gratitude to all my co-authors Riitta Marttila, Johan Löfgren, Mika Rämet, Marjo Renko, Vesa Ollikainen, Tuula Klaavuniemi and Outi Tammela for their input into my projects. I especially thank Riitta for her help in various clinical questions and for providing me with the study material, and Johan for the shared interest towards RSV and collectins. Marja-Leena Pokela, Eija Rautio and Liisa Siermala-Hiironen are acknowledged for their contribution in sample and data collection and for contacting the families. I owe my deepest gratitude to all the children and their parents who participated in these studies.

I am thankful to Professor Ann-Christine Syvänen and Docent Jorma Ilonen for reviewing my thesis manuscript and for their valuable comments. I also thank Sirkka-Liisa Leinonen for the revision of the language of my original articles and of this thesis. Marjatta Paloheimo is acknowledged for her kind help in various official matters.

I wish to express my warm thanks to all members of our research group. I am especially grateful to Maarit Haarala for her valuable input. Her practical assistance in sample analysis helped me enormously during all my research projects. I also thank Mirkka Ovaska, Elsi Jokelainen and Tanja Kanniala for their friendship and help in laboratory matters. I thank Virpi Glumoff for her guidance and support. I wish to thank Reetta Vuolteenaho for her encouraging attitude towards me and my research and also for the numerous non-scientific interests we shared. I warmly thank Marja Ojaniemi for her kind help when ever I needed. I thank Reija Paananen for the various discussions we had about research and life. Her friendship and kindness have been of great importance to me. I wish to express my warmest thanks

to my roommate Samuli Rounioja, who managed to turn my life fun even at the worst moments. His help in numerous computer problems has been invaluable during all these years. I also wish to thank my former roommate Outi Seppänen for her warm personality and friendship. Her effectiveness in everything she did never ceased to surprise me. I thank Kirsi Harju for her long-lasting friendship, which has been very valuable for me at all times, especially during my maternity leave. I also thank her little daughter Sanni for bringing joy to our lives. I thank Mari Liljeroos for the time we spent together as roommates and for numerous laughs during coffee breaks. I thank Saija Taponen for the shared interest in health matters and working ergonomy and Annamari Salminen for the shared interest in SP-D. Johanna Ulvila, Mataleena Parikka and Heidi Enwald are acknowledged for their friendship and fresh scientific ideas. I also wish good luck to our new group members Minna Karjalainen, Juhani Metsola and Sirpa Kangas.

I would like to thank all my friends for their care and support. Kirsi Brandt, Anu Tuohimaa, Anu Sirviö, Maria Meinilä and Vuokko Vanninen are especially thanked for the years at the Biology Department. Their long-lasting friendship and the countless moments of shared joy mean a lot to me.

Finally, I express my loving gratitude to my parents Antti and Helena Lahti. Their support and encouragement have been of great importance for me during all these years. I also thank my brother Ilkka for the shared interest in scientific research and his wife Johanna and daughter Sinituuli for their friendship. I owe my gratitude to my dear sister Riikka for all the common interests we share. I give big hugs to my mother-in-law Aila Rova for the enormous help in taking care of our daughter during the last year of my thesis project. Above all, I thank my beloved husband Risto and my precious little daughter Pauliina for their endless love and support. They have been the source of my inspiration.

This work was financially supported by Biocenter Oulu, The Foundation for Pediatric Research, HES Foundation (Foundation by Pulmonary Association HELI) and the Maud Kuistila Memorial Foundation.

Oulu, May 2005

Meri Rova

Abbreviations

ABCA3 ATP-binding cassette protein A3 AF amniotic fluid ARDS acute respiratory distress syndrome ARF acute respiratory failure BAL(F) bronchoalveolar lavage (fluid) BPD bronchopulmonary dysplasia CAP congenital alveolar proteinosis CL-L1 collectin liver 1 CL-P1 collectin placenta 1 COPD chronic obstructive pulmonary disease cPCR converted PCR CRD carbohydrate recognition domain CSGE conformation-sensitive gel electrophoresis DPPC dipalmitoyl phosphatidylcholine ELBW extremely low birth weight ER endoplasmic reticulum GA gestational age GRE glucocorticoid responsive element HA haemagglutinin HNF-3 hepatocyte nuclear factor 3 IIP idiopathic interstitial pneumonitis ILD interstitial lung disease IL-6 RE-BP interleukin-6 response element –binding protein IPF idiopathic pulmonary fibrosis kb kilobase(s) kDa kilodaltons(s) LPS lipopolysaccharide LTA lipoteichoic acid MBL mannose-binding lectin nt nucleotide PAP pulmonary alveolar proteinosis

PC phosphatidylcholine PCR polymerase chain reaction PE phosphatidylethanolamine PG phosphatidylglycerol PI phosphatidylinositol PMA post menstrual age PS phosphatidylserine RDS respiratory distress syndrome RFLP restriction fragment length polymorphism RSV respiratory syncytial virus SIRPα signal inhibiting regulatory protein alpha SNP single nucleotide polymorphism SP surfactant protein TDT transmission disequilibrium test TF transcription factor TTF-1 thyroid transcription factor 1 UT(R) untranslated (region) VLBW very low birth weight

List of original papers

This thesis is based on the following articles, which are referred to in the text by their Roman numerals:

*I Lahti M, Löfgren J, Marttila R, Renko M, Klaavuniemi T, Haataja R, Rämet M and

Hallman M (2002) Surfactant protein D gene polymorphism associated with severe respiratory syncytial virus infection. Pediatric Research 51: 696-699

*II Lahti M, Marttila R and Hallman M (2004) Surfactant protein C gene variation in

the Finnish population – association with perinatal respiratory disease. European Journal of Human Genetics 12: 312-320

III Rova M, Haataja R, Marttila R, Ollikainen V, Tammela O and Hallman M (2004)

Data mining and multiparameter analysis of lung surfactant protein genes in bronchopulmonary dysplasia. Human Molecular Genetics 13: 1095-1104

IV Rova M, Haataja R, Marttila R and Hallman M (2005) Transmission disequilibrium

test of surfactant protein B intron 4 deletion variants in Finnish preterm infants with bronchopulmonary dysplasia. Manuscript

Additionally, some previously unpublished data are presented. * Meri Rova née Lahti

The original articles (I-III) are reprinted with permissions from International Pediatric Research Foundation, Inc., Nature Publishing Group and Oxford University Press.

Contents

Abstract Abstract in Finnish Acknowledgements Abbreviations List of original papers Contents 1 Introduction ...................................................................................................................15 2 Review of the literature .................................................................................................17

2.1 Human pulmonary surfactant .................................................................................17 2.2 Structure of collagenous surfactant proteins SP-A and SP-D .................................18 2.3 Functions of SP-A ..................................................................................................19 2.4 Functions of SP-D ..................................................................................................20 2.5 Roles of SP-A and SP-D in the innate immunity of the lung..................................20

2.5.1 Interaction of SP-A with lung pathogens .........................................................21 2.5.2 Interaction of SP-D with lung pathogens.........................................................23

2.6 Structure of hydrophobic surfactant proteins SP- B and SP-C ...............................23 2.7 Functions of SP-B...................................................................................................26 2.8 Functions of SP-C...................................................................................................27 2.9 Structure and polymorphisms of surfactant protein genes......................................28

2.9.1 Genes encoding collectins SP-A and SP-D......................................................28 2.9.2 SP-B gene ........................................................................................................30 2.9.3 SP-C gene ........................................................................................................31

2.10 Respiratory syncytial virus (RSV) infection.........................................................32 2.11 Interaction of SP-D with RSV ..............................................................................33 2.12 Lung diseases in newborn.....................................................................................33

2.12.1 Respiratory distress syndrome (RDS)............................................................33 2.12.2 Bronchopulmonary dysplasia (BPD) .............................................................34

2.13 SP gene polymorphisms associated with lung diseases in humans.......................35 2.13.1 Association of SP-A and SP-B alleles with RDS...........................................35 2.13.2 Association of SP alleles with other lung diseases.........................................36

2.14 Genetics of surfactant deficiency..........................................................................36

2.14.1 Hereditary SP-B deficiency ...........................................................................36 2.14.2 SP-C gene mutations associated with surfactant deficiency ..........................37

3 Outlines of the present study .........................................................................................38 4 Subjects and methods ....................................................................................................39

4.1 Ethics ......................................................................................................................39 4.2 Study populations and sample collection................................................................39

4.2.1 Study I .............................................................................................................40 4.2.2 Study II ............................................................................................................41 4.2.3 Study III...........................................................................................................42 4.2.4 Study IV...........................................................................................................42

4.3 DNA extraction and genotyping (I-IV)...................................................................43 4.4 Conformation-sensitive gel electrophoresis (CSGE) and ........................................... nucleotide sequencing (II) ............................................................................................44 4.5 Data processing and statistical analysis (I-IV)........................................................45

5 Results ...........................................................................................................................46 5.1 Polymorphism of the human SP-D gene.................................................................46 5.2 Association of SP-D Met11 with severe RSV infection (I)......................................47 5.3 Polymorphism of the human SP-C gene (II) ..........................................................49 5.4 SP-C alleles and neonatal lung disease (II) ............................................................50 5.5 SP-B intron 4 deletion variant allele as a risk factor for BPD (III, IV) ...............51

5.5.1 Allele frequency comparisons and logistic regression analysis (III) ...............51 5.5.2 SP-B deletion variant allele and the need for supplemental oxygen................52 5.5.3 Data mining (III)..............................................................................................53 5.5.4 Sequence analysis of the SP-B intron 4 (III) ...................................................53 5.5.5 Familial segregation of SP-B deletion variant allele (IV)................................55

6 Discussion .....................................................................................................................56 6.1 Role of SP-D Met11Thr variation in host defense (I).............................................56 6.2 Genetic variation in the SP-C gene – association with RDS and prematurity (II)..58 6.3 SP-B intron 4 deletion variant as risk factor for BPD (III-IV) ...............................59

7 Summary and conclusions .............................................................................................63 8 References .....................................................................................................................64 Original articles ................................................................................................................78

1 Introduction

Pulmonary surfactant is essential for normal respiratory function. It reduces surface tension on the inner surface of the lung and thus prevents alveolar collapse at the end of expiration. The lipid and protein components of surfactant increase during fetal lung development. In preterm infants, deficiency of surfactant leads to respiratory distress syndrome (RDS). Due to improved clinical practices and efficient surfactant treatments, children with RDS usually recover well. However, very preterm babies born before 30 weeks of gestation are at risk for developing a chronic lung disease called bronchopulmonary dysplasia (BPD), which is characterized by a prolonged need for supplementary oxygen.

In addition to its important role in fetal lung maturation, surfactant participates in the alveolar inflammatory reactions. While the surfactant proteins SP-A and SP-D bind and agglutinate a range of viruses, bacteria and allergens and mainly function as first-line host defence molecules in the lung, the hydrophobic proteins SP-B and SP-C enhance surfactant film formation, protecting the lung against the deleterious effects of atelectasis.

The genes encoding surfactant proteins (SPs) have been examined in genetic association studies as potential candidates for pediatric and adult pulmonary diseases. While the SP-A and SP-B gene polymorphisms have been studied in many association analyses, the polymorphisms in the SP-C and SP-D genes have previously been of minor interest.

The goal of the present study was to examine the genetic polymorphisms in the SP-C and SP-D genes among a homogenous Finnish population and to evaluate the significance of these and other SP polymorphisms in the etiology of infantile pulmonary diseases, including severe RSV infection, RDS and BPD. Four separate study designs were used. In addition to conventional allelic association studies, a multiparameter analysis and a family-based transmission diequilibrium test (TDT) were performed. The present study took advantage of the relative homogeneity of the Finnish population and the availability of high-quality and extensive medical records in the participating hospitals.

2 Review of the literature

2.1 Human pulmonary surfactant

Lung surfactant is a mixture of lipids and proteins lining the alveolar surface of the lung. Its main function is to decrease the surface tension, thereby preventing alveolar collapse at the end of the expiration. At the interface between the host and the environment, surfactant actively participates in the alveolar response against a wide variety of environmental challenges, including inflammation, infection and oxidant stress (Crouch & Wright 2001, Hawgood & Poulain 2001).

There are approximately 40 different cell types in the lung. Surfactant components are mainly produced by alveolar type II epithelial cells, which comprise 15% of the total number of cells in the adult lung. The main component, i.e. 90%, of surfactant comprises lipids while 10% comprises proteins, including the specific surfactant proteins SP-A, -B, -C and -D. SP-A is the most abundant surfactant protein. In alveolar type II cells, surfactant lipids and the hydrophobic surfactant proteins SP-B and SP-C are stored in organelles called lamellar bodies. The contents of lamellar bodies are secreted into the alveolar lumen, where the surfactant lipids migrate to the air-liquid interface. The hydrophilic surfactant proteins SP-A and SP-D are secreted independently of lamellar bodies (Voorhout et al. 1992, Ikegami et al. 1992) and associate with other surfactant components in the alveolar lumen. Outside the cell, surfactant is organized as a net-like structure called tubular myelin, which helps to make up the surface film at the alveolar air-liquid interface. Majority of surfactant material is recycled by type II cells and alveolar macrophages via endocytosis (Fig. 1).

The surfactant lipids are produced by the alveolar type II epithelial cells. Majority of the lipids are phospholipids (approximately 80%), whereas cholesterol comprises the largest amount of neutral lipids of the surfactant. Dipalmitoylphosphatidylcholine (DPPC) and its unsaturated form phosphatidylcholine (PC), are the predominating phospholipids in surfactant, whereas phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylethanolamine (PE) and phosphatidylserine (PS) comprise the smaller part of the phospholipids (Batenburg & Haagsman 1998).

18

In human lung, SP-A and SP-D are synthesized and secreted by alveolar type II and non-ciliated bronchiolar epithelial cells called Clara cells (Persson et al. 1988, Voorhout et al. 1992). Considerable cell-to-cell variation occurs in the production and accumulation of both SP-A and SP-D by these cells. SP-D mRNA is first detected at low levels in the second trimester and the levels rise during the late fetal period and postnatal lung development (Dulkerian et al. 1996). A distinct increase is seen in the SP-A protein concentration in amniotic fluid at the third trimester, after which the amount of this protein increases exponentially (Hallman et al. 1989). SP-B and SP-C mRNAs can be detected in human lung explants at 13 weeks of gestation (Liley et al. 1989). SP-B is expressed in type II alveolar cells and bronchiolar Clara cells. SP-C is synthesized exclusively by the alveolar type II cells (Weaver 1998).

Fig. 1. Structure of alveolus. Modified from (Hawgood & Clements 1990).

2.2 Structure of collagenous surfactant proteins SP-A and SP-D

SP-A and SP-D are large, hydrophilic, collagenous glycoproteins that belong to the C-type lectin family and are therefore called collectins. The other collectins in this family are mannose-binding lectin (MBL), collectin liver 1 (CL-L1), collectin placenta 1 (CL-P1) and at least three bovine serum lectins, namely conglutinin, CL-43 and CL-46 (van de Wetering et al. 2004). Collectins are composed of four domains: a short amino-terminal domain, a collagen-like domain of varying length, a hydrophobic, coiled-coil neck region and a calcium-dependent carbohydrate recognition domain (CRD). The CRDs of collectins are compactly folded protein modules located at the C-terminus of the protein. The selective binding of collectins to specific complex carbohydrates is mediated

Alveolar macrophage

Tubular myelin

Lamellar body

Alveolar type II cell Alveolar type I cell

Lipid monolayer

Alveolar fluid

19

by these domains (Weis et al. 1991). All collectins form trimers based on the collagen-like triple helix, and the trimers are then organized into higher order multimers of varying arrangements (Crouch et al. 2000). Although dodecamers and octadecamers are the main molecular structures of SP-D and SP-A, respectively, smaller oligomeric forms as well as multimolecular complexes have been detected for both proteins (Fig. 2). Interchain disulfide bonds at the amino-terminal domain stabilize the structure of SP-D and SP-A multimers.

Human SP-A (28-35kDa) has a short 7 amino acid amino-terminal domain and a 73 amino acid collagen region (Holmskov 2000, Palaniyar et al. 2001). The N-linked glycosylation site Asn187 is located in the globular CRD. An additional N-linked glycosylation site in the N-terminus of SP-A is present in many species, including rat, mouse and bovine (McCormack 1998). The Cys6 in the N-terminal region of mature SP-A has been shown to participate in the interchain disulfide bond formation required for the stability of the quaternary structure of SP-A (McCormack et al. 1997, McCormack et al. 1999). The human and most other SP-A cDNAs isolated show N-terminal heterogeneity with additional Cys-1. The collagen region of SP-A is interrupted after the 13th Gly-X-Y repeat, causing a bend in the tertiary structure and spreading the collagenous stalks of the oligomeric molecule away from each other (Fig. 2) (Voss et al. 1991).

The SP-D monomer has a molecular weight of 43 kDa. The main oligomeric structure of SP-D is cross-shaped, consisting of four trimers with rather long collagenous regions of 177 amino acids (Crouch et al. 1994). The short, non-collagenous amino-terminal domain of 25 amino acids of SP-D contains two conserved cysteine residues, Cys15 and Cys20, involved in interchain disulfide bonding (Brown-Augsburger et al. 1996). The collagenous domain consists of 59 uninterrupted Gly-X-Y repeats and is glycosylated at Asn70 (Crouch et al. 1994). A 50 kDa form of monomeric surfactant protein D has been detected in human bronchoalveolar lavage fluid, and it is thought to be produced by post-translational glycosylation (Mason et al. 1998).

2.3 Functions of SP-A

In vitro studies show an important role of SP-A in surfactant structure, function and metabolism. SP-A binds DPPC bilayers through the carbohydrate recognition domain (McCormack 1998). This binding is calcium-dependent and results in a process whereby the contents of secreted lamellar bodies are rapidly reorganized into tubular myelin (Voorhout et al. 1991). SP-A also regulates surfactant metabolism by inhibiting secretion from type II cells and enhancing surfactant uptake into type II cells and alveolar macrophages (Wright 1990).

Despite their minimal tubular myelin structures, mice lacking SP-A survive and breathe normally after term birth, and the surface activity of surfactant remains apparently normal. Moreover, there are no abnormalities in lung histology, weight, volume or compliance (Korfhagen et al. 1998a). There was a modest increase of alveolar DPPC pool size in SP-A-deficient mice, and the lack of SP-A had a minimal effect on the overall metabolism of saturated PC or SP-B (Ikegami et al. 1997, Ikegami et al. 1998).

20

SP-A is an important host defense molecule participating in the innate immunity of the lung (Crouch & Wright 2001). SP-A-deficient mice clear some lung pathogens less efficiently than wild-type mice (Korfhagen et al. 1998a). The binding properties of SP-A and SP-D differ, and these two molecules have partly overlapping, complementary roles in actions against various lung pathogens (Crouch 1998, Crouch & Wright 2001). Outside the lung, SP-A has been detected in porcine eustachian tube (Paananen et al. 2001). Although the lung seems to be the main site for SP-A protein production, SP-A mRNA has been detected in several extrapulmonary human tissues (Akiyama et al. 2002, Madsen et al. 2003).

2.4 Functions of SP-D

SP-D has roles in the surfactant metabolism, homeostasis and host defense mechanisms of the lung (Korfhagen et al. 1998b, Crouch 2000, Ikegami et al. 2000).

Studies on SP-D knockout mice showed accumulation of surfactant lipids, total protein and SP-A and SP-B in the alveolar space. The number of alveolar macrophages was increased, and the cells had a multinuclear and foamy appearance. Type II cells in SP-D-deficient mice were hyperplastic and contained giant lamellar bodies (Botas et al. 1998), suggesting a disturbance in surfactant exocytosis. The size of the lung in SP-D knockout mice was normal at birth, but increased thereafter. Progressive emphysema was also evident and possibly due to the release of proteases and reactive oxygen species (Wert et al. 2000). SP-D-deficient mice had decreased amounts of tubular myelin, but there were no defects in surfactant activity (Korfhagen et al. 1998b). These findings suggest a complex role of SP-D in surfactant metabolism and homeostasis. Studies on mice overexpressing SP-D indicated that distinct expression of SP-D, or even very low local levels of expression could reverse the abnormal phenotype of null mice. However, emphysema was not reversed by SP-D (Zhang et al. 2002b).

SP-D plays an important role in the host defense of lung (Crouch & Wright 2001) and other tissues. Although the lung is the main site of SP-D expression, there are a number of tissues where SP-D protein and/or its transcripts have been detected (Madsen et al. 2000, Bourbon & Chailley-Heu 2001, Paananen et al. 2001). Non-pulmonary expression seems to be restricted to the cells lining the epithelial surfaces, ducts and some glandular epithelial cells in contact with the environment (Crouch 2000). In the light of various studies, it seems that SP-D participates in mucosal immunity throughout the body (Akiyama et al. 2002).

2.5 Roles of SP-A and SP-D in the innate immunity of the lung

The surfactant system is positioned ideally to participate in the clearance and neutralization of inhaled microorganisms and other intruding pathogens. Since serum collectins are presumed to be present only at low concentrations in the extravascular space in uninjured tissues, SP-A and SP-D probably constitute the major collectin defenses of the lung (Crouch 1998). Several studies have demonstrated the binding of SP-

21

A and SP-D to lung pathogens in vitro. In vivo models of SP-A and SP-D knockout mice show increased susceptibility to various micro-organisms. The most recent data provides evidence of a dual role of SP-A and SP-D in lung inflammatory processes: they either enhance or suppress the production of inflammatory mediators, depending on their binding orientation to the target surfaces (Gardai et al. 2003).

2.5.1 Interaction of SP-A with lung pathogens

SP-A can bind and agglutinate a broad range of pathogens, including viruses, bacteria, yeast and fungi (McNeely & Coonrod 1993, Lawson & Reid 2000). Similarly to SP-D, SP-A functions as opsonin, enhancing the attachment of pathogens to phagocytic cells, and promotes the killing and clearance of pathogens. SP-D and SP-A differ in their carbohydrate binding preferences. SP-A preferentially binds to saccharides containing N-acetylmannosamine, L-flucose and maltose. Mutagenesis of the residues Glu195 and Arg197 to Gln and Asp, respectively, alters the carbohydrate binding preferences of SP-A (McCormack et al. 1994).

SP-A-deficient mice show increased susceptibility to infections caused by a variety of gram-negative and gram-positive bacteria and fungal pathogens (LeVine & Whitsett 2001). Bacterial lipopolysaccharides (LPS) are the major outer surface membrane components present in almost all gram-negative bacteria, including Pseudomonas aeruginosa, Haemophilus influenzae and Klebsiella pneumoniae. SP-A preferentially binds to the lipid A component of the rough forms of LPS. The lipid A component anchors the saccharides to the outer bacterial membrane and acts as a primary immunostimulatory centre of LPS (Alexander & Rietschel 2001). Although the encapsulation of bacteria limits their interaction with SP-D, the expression of specific capsular polysaccharides favours SP-A binding (Kabha et al. 1997). In this scheme SP-A and SP-D serve as complementary agents in the interaction with gram-negative bacteria (Crouch 1998).

SP-A was shown to bind the haemagglutinin (HA) of influenza A virus in vitro (Benne et al. 1995). In an in vivo model, decreased clearance of influenza A virus was observed in SP-A knockout mice in association with increased pulmonary inflammation (LeVine et al. 2002). In this study, treatment of SP-A-deficient mice with exogenous SP-A enhanced viral clearance and decreased lung inflammation. Uptake of influenza A virus by alveolar macrophages was similar in SP-A knockout mice and wild-type mice. SP-A-deficient mice show increased susceptibility to viral infections (Harrod et al. 1999, LeVine et al. 1999a). In vitro, SP-A binds and neutralizes the F-protein of respiratory syncytial virus (RSV) (Ghildyal et al. 1999).

22

Fig. 2. Structure and function of lung collectins: (A) collectin trimer, (B) collectin multimers, (C) collectins in host defence.

N-terminal

d i

A. Collectin trimer

Neck region

Collagen triple-helix CRD

SP-D dodecamer SP-A octadecamer SP-D multimer

B. Collectin multimers

C. Collectins in host defense

-Inhibition of microbial growth -Inhibition of viral / bacterial attachment -Opsonization -Agglutination -Modulation of inflammatory responses

23

2.5.2 Interaction of SP-D with lung pathogens

SP-D binds to surface glycoconjugates expressed by a variety of micro-organisms, including gram-negative and gram-positive bacteria, viruses and fungi, and to receptors on host cells (Crouch 2000). SP-D preferentially binds to carbohydrates containing mannose, glucose or inositol (Persson et al. 1990, Lim et al. 1994). The consequences of this interaction include microbial agglutination (Hartshorn et al. 1996), opsonic enhancement of phagocytosis and killing (O'Riordan et al. 1995, Ofek et al. 2001), inhibition of microbial growth (Wu et al. 2003) and modulation of inflammatory responses (Bufler et al. 2003).

The core sugars of LPS have been identified as major ligands for rat and human SP-D on E. coli and Salmonella Minnesota (Kuan et al. 1992). SP-D also binds the rough forms of LPS from several other gram-negative bacteria causing lung infections (Lim et al. 1994). In recent studies, SP-D bound the smooth and rough forms of Pseudomonas aeruginosa and the smooth forms of LPS expressed by O-serotypes of Klebsiella pneumoniae (Sahly et al. 2002, Bufler et al. 2003), lipoteichoic acid (LTA) of gram-positive bacterium Bacillus subtilis and peptidoglycan of Staphylococcus aureus (van de Wetering et al. 2001). The important lung pathogens Mycobacterium tuberculosis and Mycoplasma pneumoniae are also bound by SP-D (Ferguson et al. 1999, Chiba et al. 2002). SP-D also has a protective effect against an important fungal lung pathogen Aspergillus fumigatus (Kishor et al. 2002).

The first evidence of the anti-viral properties of SP-D was published by Hartshorn and colleagues in 1994 (Hartshorn et al. 1994). They demonstrated that SP-D induces the aggregation and uptake of influenza A virus in vitro. This aggregation correlated directly with the multimerization of SP-D: highly multimerized preparations of SP-D were significantly more potent than dodecamers, and minimal agglutination was induced by trimeric carbohydrate recognition domains. Among the collectins, SP-D is most potent in aggregating influenza A virus particles (Hartshorn et al. 1996). SP-D can also interact with other respiratory viruses, e.g. rotaviruses and RSV, in vitro and in vivo (Hickling et al. 1999, LeVine et al. 2004).

2.6 Structure of hydrophobic surfactant proteins SP- B and SP-C

SP-B and SP-C are small surfactant-associated proteins produced by alveolar epithelial cells. The first description of the presence of hydrophobic proteins in porcine lung surfactant was published in 1979 (Phizackerley et al. 1979). Two proteins with reduced molecular masses of approximately 9 kDa and 4 kDa were soon identified and named SP-B and SP-C, respectively. The cDNA clones of SP-B and SP-C were published in the late 80s (Warr et al. 1987). Both SP-B and SP-C contained unusually large amounts of hydrophobic amino acids.

SP-B is a small (8 kDa), hydrophobic, lipid-associated protein that belongs to a saposin-like family of peptides. SP-B is synthesized as a 381 amino acid precursor that undergoes extensive post-translational processing (Weaver 1998). The SP-B preproprotein is translocated into the endoplasmic reticulum (ER) lumen with the aid of a

24

23 amino acid N-terminal signal sequence. ProSP-B consists of an N-terminal propeptide, mature SP-B and a C-terminal propeptide. The majority of the N-terminal part is removed, followed by the cleavage of the C-terminal part and the last residues of the N-terminus, yielding mature SP-B of 79 amino acids. The N-terminal proprotein is necessary for intracellular trafficking of the mature peptide into lamellar bodies (Lin et al. 1996).

The post-translational processing of SP-B includes N-linked glycosylation in the carboxyl-terminal domain of proSP-B. The amino-terminal domain of human proSP-B contains a second genetically polymorphic glycosylation site at Asn129 that is derived from the SP-B allele encoding threonine at codon 131. SP-B contains 52% hydrophobic amino acids. Dimerization in lamellar bodies is characteristic of mature SP-B. Conserved cystein residues form intramolecular sulfhydryl bridges essential for the three-dimensional structure of SP-B. This binding pattern is shared by the members of the saposin family. In surfactant, SP-B exists as a dimer and is always associated with surfactant phospholipids (Fig. 3) (Weaver & Conkright 2001, Haagsman & Diemel 2001, Nogee 2004).

25

Fig. 3. Structure of SP-B. Modified from (Weaver & Conkright 2001). SP-C is a 35-amino acid peptide composed of 69% hydrophobic amino acids. It is one

of the most hydrophobic proteins in nature. SP-C is synthesized as a 191 or 197 amino acid proprotein (proSP-C), depending on the alternative splicing at the beginning of exon 5 (Warr et al. 1987, Glasser et al. 1988b). The C-terminal and N-terminal propeptides of proSP-C are needed for the intracellular sorting and secretion of mature SP-C (Keller et al. 1992, Conkright et al. 2001). The residues 9-34 of mature SP-C, which are mostly valines and leucines, form a rigid α-helix spanning the membrane bilayer (Weaver & Conkright 2001) (Fig. 4). The minor part of SP-C not spanning the membrane bilayer is hydrophobic as well. In all species described, the cysteines of mature SP-C have been palmitoylated. In human and most other species described, the palmitoylated cysteins are

C

381

279 191 201

1

Helix 1 Helix 2 Helix 3 Helix 4 Helix 5

Mature SP-B monomer (79aa) SP-B dimer

PreproSP-B

ProSP-B

N

26

at the positions 5 and 6. The role of palmitoylation is not clear, but is suggested to be involved in the attachment of the protein to the membrane bilayer (Linder et al. 1993). The SP-C protein is the most conserved of all surfactant proteins among mammalian species (Haagsman & Diemel 2001).

Fig. 4. Structure of SP-C. Modified from (Haagsman & Diemel 2001).

2.7 Functions of SP-B

SP-B has an essential role in surfactant homeostasis, although the molecular mechanisms of its actions have largely remained unknown. In addition to lung homeostasis, recent evidence also supports the protective role of SP-B against oxygen-induced lung injury and a possible role in anti-inflammatory processes of the lung (Weaver & Conkright 2001).

Absence of SP-B expression results in defective intracellular processing of the surfactant and secretion of a complex that is unable to lower alveolar surface tension, contains an excess of proSP-C and lacks mature SP-C (Akinbi et al. 1997, Pryhuber 1998). Incomplete processing of SP-C has been observed in association with inherited

C

ProSP-C

1 191 or 197 58 24

N

Palmitic acid

Mature SP-C (35 aa)

Palmitoylation of residues Cys5 and Cys6

27

SP-B deficiency and may be specific for the disorder (Nogee 2004) (inherited SP-B deficiency is further discussed in chapter 2.14.1).

The formation of lamellar bodies is disrupted in SP-B-deficient alveolar cells: instead of dense storage organelles, these cells contain multiple small vesicles and poorly packed lamellae (deMello et al. 1994). SP-B-deficient mice are unable to inflate their lungs and establish respiration (Clark et al. 1997, Tokieda et al. 1997). Complete absence of SP-B results in rapid neonatal death in mice and fatal respiratory failure of variable duration in human infants. Pathological findings reveal neonatal pulmonary alveolar proteinosis (PAP).

Heterozygous SP-B-deficient mice survive but are more susceptible to oxygen toxicity than wild-type mice (Tokieda et al. 1999b). Hyperoxia (3-day exposure to 95% oxygen) markedly decreased lung compliance and increased the severity of pulmonary edema, hemorrhage and inflammation in SP-B-deficient mice compared with wild-type mice. Although hyperoxia was shown to increase SP-B mRNA expression, the SP-B/total protein ratio was decreased in the alveolar fluid of SP-B-deficient mice, probably due to increased lung permeability and serum protein leakage into the alveolar space. Intratracheal administration of SP-B efficiently restored pulmonary function after oxygen-caused injury (Tokieda et al. 1999a).

Mice overexpressing SP-B were protected from various inflammatory events after endotoxin exposure, compared to heterozygous SP-B-deficient mice (Epaud et al. 2003). Endotoxin exposure had no effect on lung compliance or tissue damping in overexpressing mice. Also, the number of inflammatory cells and the concentrations of proinflammatory cytokines in the lung were reduced in SP-B-overexpressing mice compared with heterozygous SP-B-deficient mice.

Decreased levels of SP-B have previously been detected in association with infections caused by adenovirus (Zsengeller et al. 1997), RSV (Kerr & Paton 1999), Pneumocytis carinii (Beers et al. 1999, Atochina et al. 2000) and bacterial endotoxin treatment (Harrod et al. 2000, Ingenito et al. 2001). The mechanism by which SP-B protects the lung during infection is not fully understood, but it is probably associated with enhanced surfactant function. SP-B is proposed to have an additional function in immune defence, affecting directly detoxification of the LPS structure on microbes (Haagsman & Diemel 2001). Synthetic SP-B was able to inhibit bacterial growth (Kaser & Skouteris 1997). Other proteins in the saposin family are involved in immune defense as well (Pena & Krensky 1997).

2.8 Functions of SP-C

SP-C is closely associated with surfactant lipids. It promotes the formation of a biologically active surface film and enhances the surfactant film function. SP-C has a putative role in disrupting the packing of acyl chains in the bilayer, leading to film destabilization (Horowitz et al. 1992, Johansson et al. 1995, Weaver & Conkright 2001). A synthetic surfactant preparation containing recombinant human SP-C has been extensively studied (Hawgood et al. 1996).

28

The initial studies on SP-C knockout mice reported subtle abnormalities in lung function, specifically in low lung volumes (Glasser et al. 2001). However, recent studies using different mouse strain showed major cellular abnormalities in the lungs of SP-C-deficient mice, leading to severe and progressive lung disease pathologically resembling idiopathic interstitial pneumonitis (IIP) (Glasser et al. 2003). Mice deficient of SP-C developed a severe pulmonary disorder evident as emphysema, monocytic infiltrates, epithelial cell dysplasia and accumulation of intracellular lipids in macrophages and type II cells. The alveolar walls of these mice were thickened, and regions of severe emphysema were associated with septal thinning and degeneration of pulmonary capillaries. The abnormalities in lung structure increased with age. The amounts of proinflammatory cytokines were not altered in SP-C knockout mice, nor was there any change in neutrophil count or evidence of bacterial or viral infection. Abnormal macrophages contained numerous lipid inclusions and produced high levels of matrix metalloproteinases. Also, epithelial cell dysplasia and MUC5A/C –expression, usually induced by inflammation or cytokines, were observed in conducting airways, where SP-C is normally not expressed. Lamellar bodies and tubular myelin were structurally normal in SP-C knockout mice. The molecular pathogenesis underlying SP-C deficiency is unclear and evidently complicated with several unidentified genetic and physiologic mechanisms. (Glasser et al. 2003). Mutations in the SP-C gene are associated with interstitial lung diseases (ILD) both in children and in adults (Nogee 2004) (see chapter 2.14.2.).

2.9 Structure and polymorphisms of surfactant protein genes

2.9.1 Genes encoding collectins SP-A and SP-D

The genes encoding the surfactant proteins SP-A, SP-D and MBL form a collectin locus on the long arm of chromosome 10 (Fig. 5). In most species studied, collectin genes exist in close physical proximity, suggesting an origin of ancestral gene duplication.

The human SP-D gene (originally known as SFTP4) is 11 kb long and located on 10q23.3, about 80-100 kb centromeric from SP-A2. The SP-D gene contains seven protein-coding exons. Exon 1 of the SP-D gene encodes three bases of UTR, a short signal peptide, the amino-terminal domain of the mature protein and the first seven triplets of the collagen domain. Exons 2 to 5 are tandem repeats of 117 nucleotides and encode the collagen domain. Exon 6 encodes the neck region and exon 7 encodes the carbohydrate recognition domain (Crouch et al. 1993).

The human SP-A gene locus consists of two highly homologous (98% nucleotide identity) functional genes, SP-A1 (SFTP1 or SFTPA1) and SP-A2 (SFTP1B or SFTPA2), and a non-functional pseudogene (Floros & Hoover 1998). The SP-A genes are located on 10q22.2-23.1 and are in linkage disequilibrium. Both functional genes consist of four coding exons and untranslated 5’ exons. At least in the alveolar space, SP-A trimers are thought to be formed by two SP-A1 peptides associated with one SP-A2 peptide through

29

their collagen domains (Voss et al. 1991). The MBL gene lies centromeric from the SP-A and SP-D genes and is not linked to either of them (Hoover & Floros 1998).

The SP-A and SP-D genes contain several single nucleotide polymorphisms (SNPs) each (see: http://www.ncbi.nlm.nih.gov/projects/SNP/ for reported variations). Allele frequencies differ between ethnic groups and races (Liu et al. 2003). Two non-synonymous changes in the SP-D gene (Met11Thr and Ala160Thr) have been studied in association analyses of lung diseases in humans (Floros et al. 2000). SNPs in the SP-A gene are in linkage disequilibrium and are inherited as intragenic haplotypes. The combinations of these nucleotide variations are called alleles for historical reasons, the SP-A1 alleles being denoted as 6An and those of the SP-A2 gene as 1An (Floros et al. 1996). The SP-A and SP-D polymorphisms listed in Table 1 have been evaluated in several genetic association studies. In addition to nucleotide variations, both SP-A genes exhibit splicing heterogeneity in their 5’UT region (Karinch & Floros 1995).

Table 1. Polymorphisms in SP-A and SP-D genes

Gene Affected amino-

acid refSNP ID Amino acid /

nucleotide change Location in

gene Location in protein

SP-A1 19 rs1059047 Val (Ala) Exon 1 N-terminal 50 rs17883551 Val (Leu) Exon 1 Collagenous 62 rs1136451 Pro (A/G) Exon 2 Collagenous 133 rs1059057 Thr (A/G) Exon 4 CRD 219 rs4253527 Arg (Trp) Exon 4 CRD SP-A2 9 rs1059046 Asn (Thr) Exon 1 N-terminal 91 rs17886395 Ala (Pro) Exon 2 Collagenous 140 rs17884713 Ser (C/T) Exon 4 CRD 223 rs17881479 Gln (Lys) Exon 4 CRD SP-D 11* rs721917 Met (Thr) Exon 1 N-terminal 160* rs17885900 Ala (Thr) Exon 4 Collagenous * position at the mature protein

30

Fig. 5. Human collectin locus on chromosome 10. Black boxes indicate protein-coding exons, white boxes indicate untranslated exons. The SNPs frequently examined in genetic association studies are identified.

2.9.2 SP-B gene

Human SP-B is encoded by a single 9.5 kb gene (SFTP3) consisting of 11 exons and 10 introns (Pilot-Matias et al. 1989) located on chromosome 2p12-p11.2 (Vamvakopoulos et al. 1995). Mature SP-B is encoded by exons 6 and 7, and exon 11 is untranslated. The gene contains a large 823-nucleotide 3’ UT region. The 5’ flanking region of the SP-B gene contains sequences that are important in conferring cell and tissue specificity of expression (Yang et al. 2003). Several SNPs have been identified in the human SP-B gene. At the end of exon 4, at location +1580, there is a T/C polymorphism leading to an Ile131Thr polymorphism (rs1130866), which affects the N-linked glycosylation of the SP-B proprotein. A length polymorphism in intron 4 includes insertions or/and deletions of varying nucleotide motifs. In addition, SNPs occur at the 5’ and 3’ untranslated regions (Floros et al. 1995). The exon-intron structure of the human SP-B gene is presented in Figure 6.

MBL SP-A2 P SP-A1 SP-D

20kb 16kb

80-100 kb

Ser140 (C/T)

Gln223Lys

Thr133 (A/G)

ARG219Trp

Ala160Thr

p q

Chromosome 10

21.1 21.2 21.4

SP-D gene

Met11Thr

SP-A1 gene SP-A2 gene

Asn9Thr

Ala91Pro

Val19Ala

Val50Leu

Pro62 (A/G)

31

Fig. 6. Exon-intron structure and polymorphism of the human SP-B gene. Black boxes indicate exons and white boxes indicate untranslated exons.

2.9.3 SP-C gene

Human SP-C is encoded by a single 3.5 kb gene (SFTP2) on chromosome 8p21 (Glasser et al. 1988a, Wood et al. 1994). The gene contains six exons, the last exon being entirely untranslated. The gene is transcribed into 0.86 kb mRNA, which directs the synthesis of a 22 kDA proprotein (Nogee 1998). Mature SP-C is encoded by exon 2. Two nonsynonymous polymorphisms are located in the SP-C gene exons 4 (Thr138Asn, rs8192341) and 5 (Ser186Asn, rs1124). Alternative splicing at the beginning of exon 5 leads to two different transcripts, which differ by 18 nucleotides in length. (Warr et al. 1987, Glasser et al. 1988a). The exon-intron structure of the human SP-C gene is presented in Figure 7.

5’UT

-18 A/C

Intron 2 +1013 A/C

Exon 4 +1580 T/C (Ile131Thr)

Intron 4 +1650 del/ins 3’UT +9306 A/G

Human SP-B gene 9.5 kb

Mature SP-B

32

Fig. 7. Exon-intron structure and polymorphism of the human SP-C gene. Black boxes indicate exons and white boxes indicate untranslated exons.

2.10 Respiratory syncytial virus (RSV) infection

RSV is the major respiratory tract pathogen in early childhood. RSV commonly causes bronchiolitis, bronchitis and pneumonia, and severe cases may require mechanical ventilatory support. RSV occurs worldwide in yearly epidemics. In Finland, these epidemics occur every second year during the winter months. RSV is responsible for 45-75% of cases of bronchiolitis, 15-25% of childhood pneumonias and 6-8% of cases of croup. Almost all children have had RSV by their 2nd birthday. Most children experience coryza and pharyngitis, usually with fever and sometimes with otitis. The lower respiratory track is involved in 10-40% of patients. Approximately 1% of the infants with RSV infection are hospitalized because of severe symptoms, and of those, 10% require treatment in a pediatric intensive care unit. The mortality of hospitalized patients in industrial countries is 0.5-1% (Malhotra & Krilov 2000).

Factors increasing the risk of severe RSV infection include prematurity at birth, congenital heart disease, male sex, postnatal age of 2-7 months at the time of the epidemic and smoking in the family. Genetic factors are also likely to influence the susceptibility to severe RSV infections (Hull et al. 2000, Hull et al. 2001, Stark et al. 2002, Tal et al. 2004). Abnormalities in surfactant function activity and reduced concentrations of the surfactant proteins A, B and D in bronchoalveolar lavage (BAL) fluid have been measured in infants with RSV infection (Dargaville et al. 1996, Kerr & Paton 1999). Lung collectins are thought to play a major role in the first-line defence against RSV (Griese 2002).

Exon 4 +2294 C/A (Thr138Asn)

Exon 5 +2772 G/A (Ser186Asn)

Human SP-C gene 3.5 kb

Mature SP-C

33

2.11 Interaction of SP-D with RSV

All pneumoviruses, including RSV, encode two major surface glycoproteins (G and F), which are incorporated in the virus envelope. The G protein is responsible for the attachment of the virus to the host cell surface (Levine et al. 1987), whereas the F protein mediates the fusion of the cell and viral membranes (Walsh et al. 1985). SP-D binds to the RSV G protein through calcium-dependent protein-carbohydrate interaction. Recombinant SP-D, consisting of a carbohydrate recognition domain and a neck region, inhibited RSV infectivity in Hep-2C cell culture in a dose-dependent manner. This binding prevented RSV entry into epithelial cells. Recombinant SP-D also inhibited viral replication in vivo, as demonstrated in RSV-infected BALB/c mice (Hickling et al. 1999). This was the first in vivo report of a collectin as an inhibitor of viral infectivity. These results also suggest that multimerization of SP-D is not required for its protective role against RSV. Later studies with SP-D knockout mice showed decreased clearance of RSV and increased inflammation and inflammatory cell recruitment in their lungs. In vitro, SP-D bound RSV-infected cells and recognized the G and F proteins of RSV. SP-D also enhanced the phagocytosis of RSV by alveolar macrophages and neutrophils. (LeVine et al. 2004).

2.12 Lung diseases in newborn

2.12.1 Respiratory distress syndrome (RDS)

RDS affects preterm infants born mainly before 34 weeks of gestation. The incidence of RDS decreases towards longer gestation, being virtually zero among term infants born at 37-40 weeks of gestation. Among very preterm infants born before 26 weeks of gestation, the incidence of RDS is nearly 100%. In Finland, the incidence of RDS is about 8 per thousand live births (Koivisto et al. 2004). There is striking variability in the rate of surfactant secretion and the differentiation of surfactant among preterm infants (Hallman et al. 1989, Hallman et al. 1992).

The main cause of RDS is the deficiency of pulmonary surfactant in the premature lung. The amounts of phosphatidylcholine and particularly its disaturated form are reduced, whereas phosphatidylglycerol is undetectable. The stage of maturity of the fetal lungs and the risk of developing RDS can be predicted during pregnancy based on amnioncentesis and analysis of the lecithin / sphingomyelin ratio (< 2 in RDS) and other surfactant components from the amniotic fluid sample (Kulovich et al. 1979, Hallman et al. 1989).

Lack of surfactant in the alveoli prevents normal surface tension reduction and therefore leads to alveolar collapse and atelectasis. The symptoms of RDS include progressive breathing difficulties within a few hours after preterm birth, tachypnea, grunting, cyanosis and retractions. Ventilatory support is often needed for two to three days, and exogenous surfactant administration soon after birth is a routine procedure. In

34

most cases of RDS, the surfactant level normalizes after one week of postnatal age (Hallman et al. 1994).

Glucocorticoids enhance phospholipid and protein synthesis in alveolar type II cells and thus accelerate lung maturation. Prophylactic maternal glucocrticoid treatment decreases the risk of RDS in preterm infants (Crowley et al. 1990). However, according to recent evidence, multiple doses of glucocorticoid treatment may damage the premature lung of the unborn fetus, as structural changes in lung morphology after exposure to glucocorticoids have been reported (Willet et al. 2000).

Despite the efficient pre- and post-natal treatments, the most premature infants are still at great risk of developing severe RDS, often leading to extrapulmonary complications and even death. The pathological findings in children who have died of RDS include hemorrhage, pulmonary vascular congestion, edema and hyaline membrane formation in the alveoli.

2.12.2 Bronchopulmonary dysplasia (BPD)

BPD is the most common severe, chronic lung disease affecting mostly infants born before 30 weeks of gestation. BPD is currently diagnosed based on either a need for supplemental oxygen at 36 weeks of postmenstrual age (PMA) or a need for supplemental oxygen for at least 28 days after birth. Initially, BPD was described as a lung injury of ventilated preterm infants (Northway, Jr. et al. 1967, O'Brodovich & Mellins 1985). Later studies with animal models showed that very premature lung can be acutely injured by either oxygen or mechanical ventilation, resulting in abnormal alveolarization and vascular development (Coalson et al. 1995, Coalson et al. 1999). Today, BPD is uncommon among infants with birth weight of more than 1500 g or born at gestations exceeding 32 weeks. However, because of the improved clinical practices and more gentle ventilation techniques, the survival of extremely low birth weight (ELBW, <1000g) infants has increased. Among these infants, the incidence of BPD is about 30% (Stevenson et al. 1998).

Before the era of surfactant treatment, the pathology of BPD included airway injury, inflammation and parenchymal fibrosis. The disease was re-characterized by Husain on the basis of pathological findings in infants who had died from BPD (Husain et al. 1998). Today, the lungs of BPD infants show less fibrosis and more uniform inflation. Interference of microvascular development and septation results in fewer and larger alveoli and increased microvascular permeability leading to edema (Zimmerman 1995, Jobe & Bancalari 2001, Bancalari et al. 2003). Chronic consequences of BPD include a variable degree of pulmonary dysfunction consisting of airway obstruction, hyperinflation and hyperreactivity (Northway, Jr. et al. 1990, Pelkonen et al. 1998).

About half of the preterm deliveries before 30 weeks of gestation are associated with chronic chorioamnionitis. Many of the fetuses in these pregnancies may have been exposed to low-grade inflammation for long periods. Antenatal infection and inflammation may have both beneficial and injurious effect on the preterm lung, resulting in earlier lung maturation and therefore decreased incidence of RDS but, on the other hand, an increased risk of lung injury and BPD (Watterberg et al. 1996). According to

35

current evidence, inflammatory mediators may interfere with alveolarization, strongly suggesting the role of a complex inflammatory reaction in BPD pathogenesis (Jobe 1999, Jobe & Ikegami 2001). Elevated levels of pro-inflammatory cytokines and products of inflammation have been measured in the amniotic fluid (AF) (Yoon et al. 1997), bronchoalveolar fluid (BALF) (Kotecha et al. 1996) and cord plasma (Gomez et al. 1998, Yoon et al. 1999) of infants who develop BPD. However, not all data support the role of infection or inflammation in the etiology of BPD (Kent & Dahlstrom 2004, Panickar et al. 2004).

2.13 SP gene polymorphisms associated with lung diseases in humans

2.13.1 Association of SP-A and SP-B alleles with RDS

The roles of SP-A alleles in the etiology of RDS have been studied in several candidate gene association analyses. The study designs vary, as do the heterogeneity and size of the study populations. The most convincing studies have been performed using racially and ethnically homogenous populations and study designs that minimize the effect of confounding environmental factors. The SP-A alleles 1A0 and 6A2 were associated with an increased risk of RDS, while the 6A3 and 1A1 alleles were associated with protection against RDS (Kala et al. 1998, Rämet et al. 2000, Floros & Fan 2001, Haataja et al. 2001). The association between the SP-A alleles and RDS was restricted to infants born before 32 weeks of gestation, and was dependent on the SP-B Ile131Thr (nt 1580 T/C) genotype (Haataja et al. 2000). Since the genes encoding SP-A and SP-B are unlinked and not even located in the same chromosome, the results suggest that SP-A and SP-B may have a co-operative role in the disease pathogenesis at the transcriptional or protein level. In some studies, SP-B intron 4 variant alleles have been associated with an increased risk of RDS in certain racial subgroups (Floros et al. 1995, Floros et al. 2001, Makri et al. 2002) but the described association was absent in the Finnish population (Haataja et al. 2000, Rämet et al. 2000).

The mechanisms by which the SP-A and SP-B alleles influence the risk or outcome of RDS are not known, although some evidence has been published concerning possible effects at the molecular level: the RDS-related 6A2-1A0 haplotype has been associated with decreased levels of SP-A mRNA (Karinch et al. 1997), which could be critical under compromised conditions in prenatal lung development. The SP-B Ile131Thr polymorphism has been shown to affect glycosylation of the SP-B propeptide (Wang et al. 2003a, Marttila et al. 2003a), which in turn may affect protein folding, processing, sorting and secretion (Haataja et al. 2000).

36

2.13.2 Association of SP alleles with other lung diseases

Besides RDS, the alleles of the surfactant protein genes have been associated with several other multifactorial lung diseases. Increased frequency of the SP-B Thr131 allele has been associated with acute RDS (ARDS), septic shock and need for mechanical ventilation in adults with community-acquired pneumonia (Lin et al. 2000, Quasney et al. 2004), chronic obstructive pulmonary disease (COPD) (Guo et al. 2001, Hu et al. 2004) and idiopathic pulmonary fibrosis (IPF) (Selman et al. 2003). The SP-B intron 4 variant alleles were recently found to be associated with ARDS and direct pulmonary injury in women, but not in men (Gong et al. 2004). Increased intron 4 variant allele frequency was observed in a subgroup of acute respiratory failure (ARF) patients among a series of COPD patients (Seifart et al. 2002a). Also, an increased risk for squamous cell carcinoma of the lung was detected among patients carrying intron 4 variant alleles (Seifart et al. 2002b).

The SP-A1 6A4 and SP-A2 1A3 allele frequencies were increased among patients with tuberculosis (Floros et al. 2000). The frequency of 1A3 was increased and the frequency of 1A decreased among infants with severe RSV infection (Löfgren et al. 2002).

2.14 Genetics of surfactant deficiency

2.14.1 Hereditary SP-B deficiency

Absence of SP-B leads to severe, lethal respiratory disease. The most common mutation causing SP-B deficiency is a substitution of three bases for one in exon 4 of the SP-B gene, leading to a 121ins2 frameshift mutation (Nogee et al. 1994). The first detected case of complete SP-B deficiency was a patient with a fatal disorder called congenital pulmonary alveolar proteinosis (CAP) homozygous for this mutation. Although numerous other mutations have been identified, including mostly frameshift and nonsense mutations, the 121ins2 mutation accounts for approximately two thirds of the SP-B mutant alleles identified so far (Nogee 2004). SP-B deficiency is an extremely rare disorder. It is inherited as an autosomal recessive trait. The frequency of the 121ins2 mutation in the US population has been estimated to be approximately 1 in 1000 individuals (Cole et al. 2000, Hamvas et al. 2001). The carrier frequency of any SP-B mutation has been estimated to be 1 in 600, and the predicted disease incidence of SP-B deficiency would be 1 in 1.5 million (Nogee 2004). To date, no mutations leading to hereditary deficiency of SP-B have been detected in the Finnish population.

The symptoms of total SP-B deficiency in full-term infants resemble those of RDS in preterm, but the disease is progressive and responds inconsistently to therapeutic interventions such as exogenous surfactant treatment and corticosteroids. The only effective treatment so far has been lung transplantation (Hamvas et al. 1997). Partial deficiency of SP-B occurs in cases with only one mutated allele and in the cases of milder mutations allowing some SP-B production (Ballard et al. 1995, Dunbar, III et al.

37

2000). Haploinsufficiency of SP-B refers to a critical level of SP-B protein expression needed for proper lung function, which has been estimated to be approximately 25% of normal in mouse experiments (Tokieda et al. 1999a).

Site-directed mutagenesis of SP-B has been used to evaluate functionally and regulationally important sites in the mature protein or the proprotein (Beck et al. 2000). So far, hederitary SP-B deficiency has resulted from mutations in the protein-coding exons of the SP-B gene or mutations affecting mRNA splicing. Mutations in the untranslated regions affecting transcription, mRNA stability or splicing have not yet been detected (Nogee 2004).

2.14.2 SP-C gene mutations associated with surfactant deficiency

SP-C gene mutations have been associated with lung disease in several unrelated kindreds. The first reported mutation in the SP-C gene resulted in frameshift and truncated SP-C mRNA in an infant with familial ILD (Nogee et al. 2001). The mutation segregated with the disease and had a dominant effect on the phenotype: although the other allele was found to be normal, no detectable amounts of mature SP-C were found in lung tissue (Wang et al. 2003b).

Thomas et al (Thomas et al. 2002) reported a missense mutation Leu188Gln in a large kindred with familial pulmonary fibrosis. The pattern of penetrance in this family was incomplete, and the onset of the disease varied considerably among the carriers. The histopathologic findings varied between nonspecific interstitial pneumonitis, typical interstitial pneumonitis and pulmonary fibrosis. Environmental factors are likely to modify the course of the disease, since many probands developed symptoms after a viral infection. Several other SP-C gene mutations associated with ILD have been reported (Nogee et al. 2002).

The most recent reports describe three new SP-C gene mutations. Ile73Thr and Arg167Gln resulted in abnormal proSP-C processing and infantile PAP (Tredano et al. 2004, Cameron et al. 2005), and a 9-bp deletion spanning the codons 91-93 resulted in misfolding of proSP-C in an infant with progressive ILD (Hamvas et al. 2004).

The pathophysiology of lung disease associated with SP-C deficiency is incompletely understood. It has been proposed that the accumulation of misfolded proSP-C caused by known SP-C mutations, causes chronic cellular stress and injury and results in symptoms resembling those of interstitial pneumonitis (Nogee 2004). The variability in the histopathologic pattern of ILD related to SP-C mutations may be further influenced by the nature and biology of the present SP-C mutation, the amounts of active SP-C produced, other genetic modifiers and environmental factors (Whitsett 2002). The involvement of yet unknown genetic and environmental factors in the epidemiology of SP-C deficiency is likely, considering the marked heterogeneity and variability in the outcome of SP-C-deficient patients.

3 Outlines of the present study

Surfactant proteins have an important role in lung maturation during fetal development. They are also involved in the immunological processes of the lung and may serve as anti-inflammatory factors. Surfactant protein genes have been studied as candidates for multifactorial pulmonary diseases both in infants and in adults in several ethnic populations. Using the candidate gene approach, the goals of the present study were defined as follows:

1. To examine the occurrence of and to create genotyping methods for the common polymorphisms in the exonic regions of the SP-C and SP-D genes among the Finnish population

2. To evaluate the role of SP-D gene polymorphisms in the etiology of severe RSV-

caused viral bronchiolitis

3. To evaluate the role of surfactant protein gene polymorphisms in the etiology of neonatal lung diseases among preterm Finnish infants

4 Subjects and methods

4.1 Ethics

The present studies (I-IV) were approved by the ethical committees of the participating centres. Participation in all studies was voluntary and the parents of the infants gave a written permission to analyze their and their child’s DNA samples. The clinical data concerning the mothers and the infants were obtained from hospitals’ medical records, and additional data was elicited from the parents by means of a questionnaire.

4.2 Study populations and sample collection

The study populations consisted of infants with severe RSV bronchiolitis hospitalized in Oulu University Hospital or Seinäjoki Central Hospital (I), preterm infants born in Oulu University Hospital, Seinäjoki Central Hospital, Tampere University Hospital (II-IV), Helsinki University Hospital and Turku University Hospital (IV), healthy full-term infants born in Oulu University Hospital (II) and the parents of the preterm infants (II and IV) (Fig. 8). Umbilical cord blood samples were collected prospectively during the years 1997-2002 (II-IV). Buccal smear samples from the parents and their children born during the years 1987-2003 (I-IV) were collected retrospectively. In addition, some of the blood specimens collected prospectively during 1995-1997 were available only as dried blood spots on filter paper (IV). The summary of the study populations is shown in Tables 2-5. The characteristics of the study populations in each study will be given below. More detailed descriptions of the subjects and the methods are presented in original articles (I-IV).

40

Fig. 8. Study populations of preterm and full-term infants in studies II-IV. Additional 69 and 163 parental DNA samples were included in studies II and IV, respectively.

4.2.1 Study I

The infants with severe RSV infection were admitted into Oulu University Hospital or Seinäjoki Central Hospital during two RSV epidemics between the years 1998 and 2000. All infants had a diagnosis of bronchiolitis, and RSV infection was confirmed by an antigen detection test. All infants were less than one year of age and had no concomittant disease. Control infants were selected from the records of newborn infants. A total of 172 RSV infants and 207 control infants were available for further analysis. The control infants were then matched with the cases on the basis of sex, hospital district, date of birth and gestational age. The controls had no respiratory infections requiring hospitalization, and a maximum of one ear infection was allowed during infancy. Additional data on neonatal diseases, previous lung diseases, ear infections, allergies, daycare, parental smoking and the number of children in the family was obtained from all infants by means of a questionnaire sent to the parents.

All high-risk preterm infants receiving prophylactic Palivizumab monoclonal RSV antibodies and infants with congenital heart disease were excluded. A few samples were excluded because high-quality DNA was not obtained. Altogether 84 infants with RSV bronchiolitis and 93 control infants were included in the final analyses (Table 2).

An additional comparison of SP-D allele frequencies among unmatched study populations of RSV infants and their controls was performed. A total of 172 infants with RSV and 204 control infants were included in the analysis. This population consisted of those individuals included in study I and additional 88 cases and 111 controls that could not be matched according the previously defined criteria.

Preterm N=245 GA<34wk

Preterm N=365 GA<32wk

Preterm N=87 GA<32wk

Full term N=158 GA 37-42wk

Study III

Study II

Study IV

41

Table 2. Characteristics of the study population of RSV infants and their matched controls in study I (N=177)

Characteristic Infants with RSV Control Infants N 84 93 Male / Female 54 / 30 60 / 33 Mean GA (weeks) 39.7 39.7 Birth Weight (g), Mean + SD 3572 + 562 3598 + 506

4.2.2 Study II

The study population consisted of 245 preterm infants born before 34 weeks of gestation, 158 healthy full-term infants and 69 parents of preterm infants (Table 3). The samples of the preterm infants consisted of prospectively collected umbilical cord blood samples (N=116) and retrospectively collected buccal smear samples (N=129). Term infants were born in Oulu University Hospital during two months in 1998, and umbilical cord blood specimens from them were available. Retrospectively collected buccal smear samples were available from the parents of the preterm infants.

The diagnosis of RDS was made on the basis of the published criteria (Rämet et al. 2000). The diagnostic criterion of BPD used in the study was the need for supplemental oxygen at the postmenstrual age of 36 weeks (Jobe & Bancalari 2001). Maternal and neonatal medical histories were evaluated for clinical data concerning gestational age, glucocorticoid treatment, gender, birth order, etiology of preterm birth, mode of delivery and the severity of respiratory disorders in the infant.

42

Table 3. Characteristics of the study population of preterm and full-term infants in study II (N=427)

Characteristic Infants with

RDS Infants with

BPD* Preterm Control

Infants Full term Control

Infants Parents

N 183 75 55 158 69 Male / Female 106 / 77 45 / 30 27 / 28 75 / 83 33 / 36 Mean GA (weeks) 28.2 27.9 30.0 39.4 Birth Weight, Mean + SD

1102 + 333 978 + 270 1369 + 349 3480 + 470

* Seven of the preterm infants with BPD did not have RDS at birth

4.2.3 Study III

Altogether 365 preterm infants born between 24 and 32 weeks of gestation were analyzed in study III (Table 4). The samples of the preterm infants consisted of prospectively collected umbilical cord blood samples (N=156) and retrospectively collected buccal smear samples (N=209). The study populations of preterm infants in the studies II and III partly overlapped, approximately 60 % of the infants being the same. The maternal and neonatal medical histories were evaluated for clinical data concerning various pre- and postnatal factors. The diagnoses of RDS and BPD were made using similar criteria in the studies II and III. The definition of “mild BPD” was based on the need for supplemental oxygen for at least 28 days after birth, but no longer at 36 weeks of postmenstrual age. Table 4. Characteristics of the study populations of preterm infants in study III (N=365)

Characteristic Infants with

BPD Control Infants with

RDS Control Infants without

RDS N 86 188 91 Male / Female 50 / 36 99 / 89 40 / 51 Mean GA (weeks) 27.4 28.7 29.5 Birth Weight (g) + SD 977 + 273 1285 + 356 1379 + 336

4.2.4 Study IV

Eighty-seven families with one affected child in each were included (Table 5). Only presenting infants (singletons and A-twins) were included, and all of them were born before 32 weeks of gestation. The samples of the preterm infants consisted of prospectively collected umbilical cord blood samples (N=38) and retrospectively collected buccal smear samples (N=47). In addition, two samples were available only as dried blood spots on filter paper. The study population of preterm infants overlapped with the populations included in studies II and III (Fig. 8) by approximately 70%. Eight paternal and 3 maternal DNA samples were either missing (N=8) or of low quality (N=3),

43

and the SP-B intron 4 genotypes were predicted from the parental allele frequencies. The antenatal and neonatal medical histories were evaluated for clinical data concerning certain pre- and postnatal factors. Fifty-seven of the preterm infants had moderate to severe BPD (required supplemental oxygen at 36 weeks of postmenstrual age), and 30 had mild BPD (required supplemental oxygen for at least 28 days after birth, but no longer at the postmenstrual age of 36 weeks). Seventy-eight of the infants had RDS, while 9 had no RDS despite of developing BPD. Table 5. Characteristics of the study populations of preterm infants and their parents in study IV (N=250)

Characteristic Infants with BPD Parents N 87 163 Mild BPD 30 Moderate to severe BPD 57 Male / Female 47 / 40 79 / 84 Mean GA (weeks) 27.0 Birth Weight (g) + SD 936 + 287

4.3 DNA extraction and genotyping (I-IV)

DNA was extracted from frozen, anticoagulated whole blood samples (II-IV) using the Puregene Isolation Kit (Gentra Systems). Crude DNA was diluted to 50 ng/μl and stored at +8°C for further analysis. DNA was extracted from buccal smear samples (I-IV) using 10% Chelex 100 medium (Bio-Rad) and diluted to a final volume of 150-200 μl. DNA contamination controls were included in each series of buccal smear samples extracted. From dried blood spots on paper (IV), a 3mm disk was first punched and purified with DNA Purification Solution (Gentra Systems). The purified paper disk was then used as a template for PCR reaction. A blank paper disk treated in a similar manner was included in each sample series as a contamination control.

Genotyping was based on the restriction fragment length polymorphism (RFLP) of amplified DNA fragments containing the polymorphic site. Genotyping was performed using polymerase chain reaction (PCR) or converted PCR (cPCR) followed by restriction enzyme digestion and fragment separation by agarose or polyacrylamide gel electrophoresis. The detailed genotyping procedures are presented in the original articles (I-II) and in previously published studies (DiAngelo et al. 1999, Haataja et al. 2000, Rämet et al. 2000). For genotyping a previously undescribed Ala286Ala polymorphism in the SP-D gene exon 7, primers for Ser270Thr genotyping were used, and the resulting fragment was then digested with enzyme DdeI. The resulting fragments were 62bp, 33bp and 20bp for GCT and 62bp and 53bp for GCC. The SP-B intron 4 length polymorphism was determined using single PCR amplification and agarose gel electrophoresis (Haataja et al. 2000).

44

4.4 Conformation-sensitive gel electrophoresis (CSGE) and nucleotide sequencing (II)

The exons of the SP-C and SP-D genes were screened for common polymorphisms or other variations in their nucleotide sequence using CSGE. CSGE identifies heteroduplex bands which arise when complementary strands originating from different alleles are annealed under specific conditions. The resulting single-base mismatches in the double-stranded DNA produce conformational changes leading to the differential migration of heteroduplex and homoduplex on a polyacrylamide gel. After visualization of the heteroduplexes the samples have to be sequenced to locate and identify the nature of the polymorphism.

Altogether 90 DNA samples from healthy full-term infants were analyzed with CSGE to search for previously unknown variations in both genes. The primers used for the analysis of the SP-D gene exons 1 to 7 are listed in Table 6. The sequencies of the primers used for the SP-C gene are presented in study II, and the location of the primers is shown in Figure 10. The PCR for each CSGE reaction was performed in a 20 µl reaction volume containing approximately 100 ng of genomic DNA. The amplifying conditions are described in study II. The analysis of SP-C gene fragments by CSGE was performed using 15% polyacrylamide gel (99:1 ratio of acrylamide to 1,4-bis(acryloyl)piperazine, 10% ethylene glycol, 15% formamide, 0.1% ammonium persulfate and 0.07% N,N,N’,N’-tetramethylethylenediamine in 0.5 × TTE buffer, pH 9.0). The CSGE gel electrophoresis was performed using 1-mm-thick 38 × 52.5 cm gel with 32-well comb. 0.5 × TTE buffer was used as electrode buffer. The samples were separated at room temperature with 40 W run for approximately 8.5 h. The gel was stained with ethidium bromide, and the fragments were visualized under UV light. Similar conditions were used for the CSGE analysis of the SP-D gene. After detection of heteroduplexes, the DNA fragments of interest were sequenced (ABI PRISMTM 377 Sequencer) using DYEnamic ET chemistry (DYEnamic ET Terminator Cycle Sequencing Kit, Amersham Pharmacia Biotech). The same primers were used for CSGE and for nucleotide sequencing.

45

Table 6. Primers used for SP-D gene analysis with CSGE and nucleotide sequencing

Exon Forward primer sequence (5’-3’)

Reverse primer sequence (5’-3’)

Annealing temperature

Product length

1 TGAGCCAAGTCCCTAAACCA CCAGAGTTGCTGGGCTAGTT 58 346bp 2 TCTAGGGCCAGGTCTTTGTC ACCACCTGGAAACACCTGAA 58 200bp 3 TCCTGCCAAGAGGATTCATT TATTGCAGTTGTGGGGATTG 56 320bp 4 AACAAAACCACACCTGCTGA CGATACCACCTCTGCCTTTG 60 289bp 5 ACTGGGGACCCATCTGTCTA AGGAGGGCTTCCTCTCTGCC 60 311bp 6 CAGAGACACCCTTCCTTTGG ACACAGGTCCCAGCTCATTC 58 327bp 7 CAACCCCAACCTGACTTTC TTAGATATTGGCAGCATGAGG 58 495bp

4.5 Data processing and statistical analysis (I-IV)

SPSS for Windows (SPSS Inc., Chicago, IL, USA) was used to process the clinical and genotype data in all studies. Calculations of the allele and genotype frequencies were made by the SPSS versions 9, 11 or 12. Arcus Quickstat Biomedical (Longman Software Publishing, Cambridge, UK) was used to perform the comparisons of the allele and genotype frequencies by two-sided χ2 test using 2×2 or 2×3 contingency tables, respectively. Conditional logistic regression analysis performed by Egret statistical software (Cytel Software, Cambridge, MA, U.S.A.) was used to evaluate whether the genetic and environmental variables explained the risk for severe RSV infection (I). Linkage disequilibrium between the alleles coding for SP-C amino acid 138 and 186 was estimated by haplotype analysis. Seventy parental haplotypes were determined, and the strength of linkage disequilibrium was evaluated by calculating Lewontin’s D’ (II). SPSS was used for logistic regression analyses (II-III). Data mining analyses made in collaboration with the Finnish IT Centre for Science (CSC) were used to study the complex interactions between genetic and environmental factors (III). To carry out data mining, Christian Borgelt’s freeway implementation of Agrawal’s Apriori algorithm was used. To study the familial transmission of the SP-B intron 4 deletion variant allele, TDT analysis (IV) was performed by the Genehunter2 software (Kruglyak et al. 1996).

5 Results

5.1 Polymorphism of the human SP-D gene

To determine the exonic polymorphism of the SP-D gene, 90 DNA samples from full-term Finnish infants were analyzed with CSGE and nucleotide sequencing. In addition to the published biallelic polymorphisms in the exons 1 (Met11Thr) and 4 (Ala160Thr) encoding for the mature SP-D, two biallelic polymorphisms were detected in exon 7 that codes for the carbohydrate recognition domain of SP-D (Fig 9). These polymorphisms are separated by only 45 nucleotides, and are in tight linkage disequilibrium. The Ser270Thr polymorphism results from T/A variation and the Ala286Ala polymorphism from T/C variation. The allele coding for Ser270 is tightly in linkage disequilibrium with the allele coding for Ala(T)286, as Thr270 is with Ala(C)286. The frequencies of the SP-D alleles determined among a population of 111 full-term infants are presented in Table 7 (previously unpublished data).

Fig. 9. Exonic polymorphisms in the SP-D gene. The nucleotide numbers refer to the sequence L05483-L05485 (Crouch et al. 1993) (GeneBankTM/EMBL Data Bank).

Exon 4 +478 G/A (Ala160Thr)

Exon 7 + 808 T/A (Ser270Thr) + 858 T/C (Ala286Ala)

SP-D gene

Exon 1 +32 T/C (Met11Thr)

47

Table 7. SP-D allele frequencies (%) among Finnish full-term infants (N=111). SP-D polymorphism Major allele Minor allele Met11Thr (ATG/ACG) 68.9 31.1 Ala160Thr (GCA/ ACA) 55.0 45.0 Ser270Thr (TCT/ ACT) 96.4 3.6 Ala286Ala (GCT/ GCC) 96.8 3.2

5.2 Association of SP-D Met11 with severe RSV infection (I)

The role of SP-D gene polymorphism in the etiology of severe RSV infections was evaluated among a matched case-control population (I). The allele coding for SP-D Met11 was increased among the infants with severe RSV infection (n=84) compared to the matched control infants (n=93) (Fig. 10). There were no significant differences in the frequencies of the alleles coding for the amino acids 160 or 270. The frequency of the homozygous genotype Met/Met was increased among RSV cases (0.55 vs. 0.37, p=0.015), whereas the frequency of the heterozygous genotype Met/Thr was decreased (0.35 vs. 0.49, p=0.045) (Fig. 11). Conditional logistic regression analysis confirmed the association between the homozygous genotype 11 Met/Met and severe RSV bronchiolitis when confounding factors (smoking in the family, number of children in the family) were included in the analysis (p=0.028, OR=2.29, 95%CI=1.09-4.81).

An additional comparison of SP-D allele frequencies was made between the unmatched populations of RSV infants and their controls. This population included those subjects that were matched and evaluated in study I and additional 88 cases and 111 controls that could not be matched according to the criteria defined previously. In the unmatched study population (172 cases, 204 controls), the frequency of Met11 was 0.71 in the RSV group and 0.61 in the control group (p=0.0037) (previously unpublished data). None of the populations significantly differed from Hardy-Weinberg equilibrium.

48

Fig. 10. SP-D allele frequencies (%) among 84 infants with severe RSV infection and their 93 matched controls. Statistically significant differences (p<0.05) are indicated by an asterisk (*).The frequency of the allele coding for Met11 was 0.72 in the RSV group and 0.61 in the control group (p=0.033).

11 Met 11 Thr 160 Ala 160 Thr 270 Ser 270 Thr0

20

40

60

80

100

SP-D allele

RSV Controls

*

*

Freq (%)

49

Fig. 11. SP-D Met11Thr genotype frequencies (%) among matched study populations of 84 RSV infants and their 93 controls. The frequency of the homozygous genotype Met/Met was increased among RSV cases (0.55 vs. 0.37, p=0.015), whereas the frequency of the heterozygous genotype Met/Thr was decreased (0.35 vs. 0.49, p=0.045).

5.3 Polymorphism of the human SP-C gene (II)

To evaluate the exonic polymorphism of the SP-C gene, the six exons were analyzed with CSGE and nucleotide sequencing in a population of 90 full-term Finnish infants. In addition to the published biallelic polymorphisms in the exons 4 (Thr138Asn) and 5 (Ser186Asn), a CCG/CCA variation (Pro14Pro) was detected in the last codon of exon 1. In addition, three biallelic polymorphisms were detected in the untranslated exon 6, and altogether three intronic polymorphisms in the introns 1 and 4 (Fig. 12). Genotyping methods for the Pro14Pro, Thr138Asn and Ser186Asn polymorphisms were developed, and the allele and genotype frequencies were determined in a population of 158 full-term Finnish infants (Table 8).

Met / Met Met / Thr Thr / Thr0

10

20

30

40

50

SP-D Met11Thr genotype

RSV ControlsFreq (%)

*

*

50

Fig. 12. Polymorphisms in the SP-C gene. The location of the primers used for CSGE and the fragment sizes are shown. The nucleotide numbers refer to sequence J03890 (Glasser et al. 1988a). Table 8. SP-C allele frequencies (%) among Finnish full-term infants (n=158)

SP-C polymorphism Major allele Minor allele Pro14Pro (CCG/CCA) 99.4 0.6 Thr138Asn (ACT/AAT) 74.1 25.9 Ser186Asn (AGC/AAC) 69.3 30.7

The allele coding for Asn138 was in linkage disequilibrium with the allele coding for Asn186, and the allele coding for Thr138 with the allele coding for Ser186. The strength of linkage disequilibrium was estimated by haplotype analysis. Lewontin’s D’ was calculated to be 0.973, and it suggested strong linkage disequilibrium between these loci.

5.4 SP-C alleles and neonatal lung disease (II)

The frequencies of the SP-C polymorphisms Pro14Pro, Thr138Asn and Ser186Asn were evaluated in a high-risk population of 245 preterm infants born before 34 weeks of gestation. Of these infants, 183 had RDS at birth, and 75 developed BPD. Seven infants who did not have RDS at birth developed BPD. Fifty-five infants had neither RDS nor BPD. The frequency of the allele coding for Asn186 was increased among the preterm infants with RDS compared to their preterm controls (p=0.04). According to logistic regression analysis, Asn186 and Asn138 were independent risk factors for RDS, as was also the haplotype Asn138 – Asn186 (p=0.02, OR 2.05, 95% CI 1.12-3.74). The association of SP-C alleles with BPD was tested. No association with BPD was found, even when the study groups were categorized according to their gestational age or birth weight. There was a moderate increase in the frequency of the SP-C allele Asn138 among infants born

Exon 4 +2294 C/A (Thr138Asn)

Exon 5 +2772 G/A (Ser186Asn) Exon 1 +657 G/A (Pro14Pro)

Exon 6 (UT)

+ 3130 A/G

+ 3180 T/C

+ 3181 A/G

I

295bp

II

334bp

III

732bp

IV

334bp

V

441bp VI

430bp

C/T -TG G/C

51

before 28 weeks of gestation compared to full-term infants born between 37 and 42 weeks of gestation.

5.5 SP-B intron 4 deletion variant allele as a risk factor for BPD (III, IV)

To evaluate the role of SP gene polymorphisms in the etiology of BPD, a multiparameter analysis of SP gene polymorphisms (SP-A1, -A2, -B, -C and –D genes) and selected environmental variables was performed (III). The whole data set included 86 infants with severe to moderate BPD, defined as a need for supplemental oxygen at a postmenstrual age of 36 weeks, and 279 control infants. Children with mild BPD were also identified (mild BPD was defined as a need for supplemental oxygen for at least 28 days after birth) and when pooled with the BPD cases, the phenotype was defined as broad BPD phenotype. To further evaluate the role of the SP-B intron 4 deletion variant allele in the etiology of BPD, a family-based TDT analysis was used to investigate the familial segregation of the SP-B intron 4 deletion variant alleles from parents to affected offspring. Altogether 87 families with one affected child in each were included in the analysis (IV).

5.5.1 Allele frequency comparisons and logistic regression analysis (III)

When the whole population was first analyzed for SP alleles, a difference was observed in the SP-B intron 4 allele frequencies between the BPD cases and the controls. The invariant allele was overrepresented and the deletion variant allele was underrepresented among the control infants compared to the infants with BPD.

Birth order is a significant confounding factor in the etiology of RDS and possibly also in BPD. Therefore, a separate analysis including only presenting infants was made. In this subpopulation, the difference in SP-B intron 4 deletion variant allele frequencies was stronger than in the whole population. The frequency of the deletion variant allele was increased among BPD-cases, and the invariant allele frequency was decreased (Table 9). The difference in allele frequencies between the cases and the controls was even more marked if the broad definition of BPD was used (requirement of supplemental oxygen for at least 28 days after birth, N=107, p=0.0036 for the difference in deletion variant allele frequencies between the cases and the controls).

52

Table 9. SP-B intron 4 allele and genotype frequencies (%) among singletons and presenting multiples

SP-B intron 4 allele or genotype

BPD infants (N=67)

Control infants (N=178)

p-value OR 95% CI

SP-B intron 4 allele invariant 76.1 87.4 0.003 0.5 0.3-0.8 deletion 20.9 11.5 0.008 2.0 1.2-3.4 insertion 3.0 1.1 NS

SP-B intron 4 genotype invariant / invariant 58.2 75.8 0.007 0.4 0.2-0.8 invariant / deletion 29.9 21.3 NS invariant / insertion 6.0 1.7 NS deletion / deletion 6.0 0.6 0.021 11.2 1.1-556.5 deletion / insertion 0 0.6 NS

Logistic regression analysis was used to investigate whether the SP-B intron 4 deletion variant allele or genotype explained the risk of BPD regardless of the known confounding environmental factors. Birth order, RDS, birth asphyxia and gestational age (<28 weeks or 28-32 weeks) were included in the analysis as dichotomous variables. According to logistic regression analysis, the presence of the SP-B intron 4 deletion variant allele (p=0.036) and the homozygous deletion variant genotype (p=0.008) were risk factors for BPD.

5.5.2 SP-B deletion variant allele and the need for supplemental oxygen

BPD is defined as a need for supplemental oxygen at the postmenstrual age of 36 weeks or at least 28 days after birth. We analyzed the possible association between the SP-B deletion variant allele and the duration (days) of the need for supplemental oxygen regardless of the BPD phenotype. The children who carried the SP-B deletion variant allele (being either heterozygous or homozygous for the allele) required longer periods of supplemental oxygen compared to the children who didn’t carry the deletion variant allele (Table 10). Although there was a clear difference between the carriers and non-carriers, the results were not statistically significant, as tested with Mann-Whitney Test (p=0.097) (previously unpublished data).

53

Table 10. Impact of the deletion variant allele on the need for supplemental oxygen regardless of the BPD phenotype

Study population N Range (days)

(min/max) Mean + SD Median (interquartiles)

All infants

365* 0 / 500 31 + 51 14 (2, 45)

Heterozygous for the SP-B intron 4 deletion variant allele 81 0 / 500 37 + 63 29 (2, 52)

Homozygous for the SP-B intron 4 deletion variant allele 8 0 / 365 76 + 120 48 (2, 74)

Non-carriers of the SP-B intron 4 deletion variant allele** 251 0 / 365 28 + 42 12 (2, 40)

* 6 SP-B intron 4 genotypes failed and from 19 infants the information of the days of supplemental O2 was not available ** Carriers vs. non-carriers of the SP-B deletion variant allele: Mann-Whitney Test p=0.097

5.5.3 Data mining (III)

Data mining was performed in order to study the complex interactions between the genetic and environmental factors in the etiology of BPD. In the analysis of the whole study population, low gestational age (below 197 days), low birth weight (below 1050 g) and RDS in different combinations were associated with the broadly defined BPD phenotype. None of the genetic variables had an unambiguous effect on the phenotype per se.

A separate analysis including only presenting infants revealed a subgroup in which a joint association of low birth weight (below 1050g) and the presence of SP-B intron 4 deletion variant allele very strongly predicted the broadly defined BPD phenotype (22 out of 24 cases, significance threshold p<0.001). Other risk factors that, together with SP-B intron 4 deletion variant allele, predicted BPD included RDS and birth asphyxia. In other words, even though these environmental variables are known risk factors for BPD, their impact seems to be especially drastic in the individuals who additionally carry the SP-B intron 4 deletion variant allele.

5.5.4 Sequence analysis of the SP-B intron 4 (III)

The SP-B intron 4 nucleotide sequence was analyzed in order to detect putative transcription factor binding sites. The number and composition of these sites were compared between the sequence coding for the wild-type invariant allele and the most common deletion variant allele lacking sequence motifs M5-M9. The alleles differed in the amount and composition of several putative TF-binding sites (Table 11, Fig. 13).

54

Table 11. Number of putative transcription factor binding sites in the variable region of SP-B intron 4

Transcription factor(s) Invariant allele Deletion variant allele CAC-binding protein 3 3 TFIID 4 2 Sp1 9 6 HNF-1A, B, C 6 3 RAP-1 6 3 NF-1 6 3 GR 9 5 HNF-3 2 2 HiNF-A 2 1 AhR 1 1 AP-4 4 1 E47, HEB, INSAF, MyoD, myogenin, Tal-1 4 1 NF-InsE2, NF-InsE3 3 1 C/EBPbeta 1 0 IL-6 RE-BP 1 0 Zeste 1 0 AML1, AML1a, AML1c 1 0 TFIID, TATA-binding protein; Sp1, Sp1 transcription factor; HNF, hepatocyte nuclear factor; RAP-1, telomeric repeat binding factor 2 interacting protein 1; NF-1, neurofibromin 1; GR, glucocorticoid receptor; HiNF-A, histone nuclear factor A; AhR, aryl hydrocarbon receptor; AP-4, activating enhancer-binding protein 4; E47, helix-loop-helix protein E47; HEB, transcription factor 12; INSAF, insulin activator factor; MyoD, myogenic transcription factor D; Tal-1, T-cell acute lymphocytic leukemia 1; NF-InsE, nuclear factor insulin enhancer; C/EBPβ, CCAAT/enhancer-binding protein beta; IL-6 RE-BP, interleukin-6 response element -binding protein; Zeste, Drosophila bithorax complex regulatory gene; AML, acute myeloid leukemia gene

55

Fig. 13. Locations of the putative TTF-1, HNF-3, C/EBPβ, IL-6RE-BP, Zeste and AML1 binding sites in SP-B intron 4. M1-M11 are the unique sequence motifs characteristic of the variable region, with CAn microsatellite repeats located between them. The most common deletion variant allele lacks the motifs 5-9 (indicated in grey). TTF, thyroid transcription factor; HNF, hepatocyte nuclear factor; C/EBPβ, CCAAT/enhancer-binding protein beta; IL-6 RE-BP, interleukin-6 response element -binding protein; Zeste, Drosophila bithorax complex regulatory gene; AML, acute myeloid leukemia gene.

5.5.5 Familial segregation of SP-B deletion variant allele (IV)

TDT analysis was used to investigate the familial segregation of the SP-B intron 4 deletion variant allele from parents to affected offspring with BPD. Two BPD phenotypes were defined: mild BPD was defined as a need for supplemental oxygen for at least 28 days after birth (N=87) and moderate to severe BPD was defined as a need for supplemental oxygen at 36 weeks of postmenstrual age (N=57). The SP-B intron 4 deletion variant allele frequency was higher in the affected probands compared to the family-based control allele frequencies derived from the parental nontransmitted alleles (0.17 vs 0.10, p=0.058). The informativeness of the marker was 25% (44 informative meioses / 174 parental genotypes). Increased transmission of the SP-B deletion variant allele from parents to affected offspring was observed only among the families where the infant had moderate to severe BPD (transmissions/non-transmissions 21/9, χ2=4.8, corrected p=0.016). There was no significant parental preference in the transmissions.

M1 -(CA)14- M2 -(CA)3- M3 -(CA)11- M4 -(CA)7-

M5 -(CA)3- M6 -(CA)5- M7 -(CA)7-

M8 -(CA)3- M9 -(CA)9- M10 -(CA)5- M11 -(CA)10-

TTF-1 HNF-3

HNF-3

C/EBPβ, IL-6 RE-BP

Zeste

AML1

6 Discussion

The common polymorphisms in the SP-C and SP-D genes was examined, and the role of these and other SP gene polymorphisms in the etiology of infantile respiratory diseases was evaluated based on allelic association studies using the candidate gene approach. The present study described an allelic association between SP-D Met11 and severe RSV bronchiolitis. The role of SP-C gene variation in the etiology of neonatal lung diseases was evaluated among a high-risk population of very preterm infants. SP-C was not associated with BPD, but a modest association with RDS was evident. The roles of the SP-A1, -A2, -B, -C and -D gene polymorphisms in the etiology of BPD were extensively evaluated. The results strongly suggested the SP-B deletion variant allele as a risk factor for BPD. Below, the significance of the present findings of surfactant protein allele associations is further discussed.

6.1 Role of SP-D Met11Thr variation in host defense (I)

An allelic association of SP-D Met11 with severe RSV infection was found in a population of 86 Finnish infants hospitalized with severe RSV bronchiolitis (I). So far, there have been no other studies suggesting that the same SP-D allele would be associated with a disease. Interestingly, the alternative allele, Thr11, was associated with the susceptibility to infection caused by Mycobacterium tuberculosis, an intracellular pathogen that enters human macrophages (Floros et al. 2000).

There is some variation in the frequencies of SP-D alleles among different ethnic groups. In the Finnish population of healthy full-term infants (n=111), the frequency of Met11 was 0.69, and among the population of healthy control infants in study I, the frequency was 0.61. Reported Met11 allele frequencies in the Mexican, German, Dutch, White American and Danish populations were 0.60, 0.55, 0.71, 0.60 (Liu et al. 2003) and 0.59 (Leth-Larsen et al. 2005), respectively. In addition to differences in the allele frequencies between different populations, genetic heterogeneity as well as environmental factors may have a significant confounding effect on the genetic associations in a complex disease. Therefore, caution must be observed when comparing the results of genetic association studies of different ethnic groups.

57

During the past decade, the significance of SP-D in pulmonary host defense has become evident. In addition to numerous functional studies describing the direct binding of SP-D to a variety of micro-organisms, studies on the immunological mechanisms related to lung homeostasis and the interaction of SP-D with host cells have been published (Gardai et al. 2003, Clark & Reid 2003, Wright 2005). The potential biological significance of the Met11Thr variation was recently evaluated (Leth-Larsen et al. 2005). The Met11Thr variation significantly influenced the serum SP-D concentration and the oligomerization state of the SP-D molecule. Gel filtration chromatography of culture media of human embryonic kidney cells transfected with human cDNAs encoding either Met11 or Thr11 showed the SP-DMet variant to be composed mainly of highly multimerized protein forms, whereas the SP-DThr variant was composed of trimeric forms of SP-D. Notably, SP-DMet/Thr was composed of high levels of both highly multimerized and trimeric forms of SP-D. These results strongly suggest that the Met11Thr variation has a directly codominant effect on SP-D oligomerization.

The highly multimerized forms of recombinant SP-D and recombinant SP-D/MBL or SP-D/conglutinin fusion proteins have increased antiviral properties in binding influenza A virus (Brown-Augsburger et al. 1996, Eda et al. 1997, Hartshorn et al. 2000, Zhang et al. 2001, White et al. 2001). Multimerization also affects the properties of SP-D in enhancing surfactant homeostasis (Zhang et al. 2002a). In general, the monomeric form of the SP-D trimer seems to have a restricted range of biological activities compared to the highly multimerized forms. The mechanism by which the Met11Thr variation affects the multimerization of SP-D is probably related to the close proximity of the SP-D amino acid position 11 to the conserved amino acids Cys15 and Cys20. These sites are known to participate in the inter-chain disulfide bonding of the trimeric SP-D subunits (Brown-Augsburger et al. 1996). It has been proposed that O-linked glycosylation at Thr11 may influence the oligomerization of the SP-D subunits (Mason et al. 1998), inhibiting the formation of highly multimerized forms of SP-D protein. In addition, the alternative amino acids Met and Thr have significantly different hydrophobic properties, possibly also affecting the molecular structure of the peptide.

The highly multimerized forms of SP-D have different binding properties from the low molecular weight forms (Leth-Larsen et al. 2005). The highly multimerized forms bound significantly better to mannan, whereas the low form bound significantly better to rough and smooth LPS. There was marked variation in the binding of SP-D multimers to bacterial strains, but the binding of SP-D multimers in the selected strains was exclusively more active than the binding of lower molecular forms. Also, the highly multimerized form showed more active binding to influenza A virus than the lower form.

According to our results, the children with homozygous Met/Met genotype were more susceptible to severe RSV infection than the children carrying other SP-D genotypes. It can be speculated that the multimerization of SP-D may be either advantageous or deleterious, depending on the presenting pathogen. The effect of multimerization on the binding of SP-D to RSV was not evaluated in the study by Leth-Larsen and coworkers (Leth-Larsen et al. 2005). In the light of the fact that differentially multimerized forms of SP-D showed distinct binding preferences, and that the SP-DMet/Thr variant showed significant levels of both high and low forms of SP-D, the heterozygous genotype may be regarded as the generally most advantageous genotype in defense against a large variety of different pathogens. In our study, the heterozygous genotype Met/Thr was less

58

common among the RSV cases and more common among the controls infants (p=0.045), supporting the beneficial effect of the heterozygous Met/Thr genotype in defense against RSV.

In the two studies that have so far been published about the interaction between SP-D and RSV, active multimerization of SP-D was not required for the binding of SP-D to RSV when investigated with recombinant trimeric SP-D lectin domains or recombinant rat SP-D dodecamers (Hickling et al. 1999, LeVine et al. 2004).

A recent study proposed that, depending on its binding orientation to the target surface, SP-D may have a dual role in either enhancing or suppressing the production of inflammatory mediators (Gardai et al. 2003). It was demonstrated that via interaction of the collagenous tail with calreticulin/CD91, pulmonary collectins stimulate phagocytosis and proinflammatory responses, whereas interaction of globular carbohydrate recognition domains with the signal-inhibiting regulatory protein α (SIRPα) suppresses the inflammatory reaction by inhibiting the production of proinflammatory mediators. The collagenous tails of SP-D are aggregated and mostly covered in the highly multimerized protein forms, but free in the smaller trimeric protein form (Fig. 2). It may be speculated that the trimeric forms of SP-D are required for the activation of the proinflammatory cascade by binding to surface receptors on phagocytotic cells by their long collagenous tails, whereas the highly multimerized forms are required for binding and aggregating the surface structures of certain pathogens. As a conclusion, it is evident that the structure and composition of the collagenous tail and amino-terminus of SP-D affects its inflammatory properties by modifying its multimerization and binding properties. The inflammatory reactions are complex cascades including the interaction between proinflammatory mediators, host cells and intruding pathogens. Specified in vivo models should be used to evaluate the effects of the different allelic forms of SP-D in host defense reactions against RSV and other common lung pathogens.

6.2 Genetic variation in the SP-C gene – association with RDS and prematurity (II)

The protein-coding exons 1-5 and the untranslated exon 6 of the SP-C gene were analyzed with CSGE in order to detect common polymorphisms that could be useful tools in genetic association studies. The nucleotide sequence of SP-C was first published by Glasser and coworkers in 1988 (Glasser et al. 1988a). The existence of two separate SP-C genes was initially suggested, but the later studies confirmed the presence of only one SP-C gene (Wood et al. 1994, Nogee et al. 2001). Before the present study, the common polymorphism in the SP-C gene had not been examined in detail, and the gene was actually thought to be highly conserved.

CSGE was chosen as a method for sequence variability analysis on the basis of its rather simple use, low cost and efficiency in detecting nucleotide variations even at nucleotide sequences with high GC content (Körkkö et al. 1998). The sensitivity of CSGE turned out to be high. About 95% of the heterozygous samples could be visually identified in CSGE gels as heteroduplexes. CSGE seems to be an efficient tool in detecting variations in rather conserved nucleotide sequencies, but its use in the analysis

59

of highly variable sequences, such as introns, may not be straightforward. If the sequence is highly variable, the amount of differentially migrating heteroduplexes is expected to be high, and an increasing amount of nucleotide sequencing must be undertaken in order to identify the molecular structure of each variation causing a specific heteroduplex. Therefore, CSGE could be recommended to be used mainly in mutation screening of known genes or nucleotide sequences or in analyzing the exonic regions of the protein-coding genes of relatively normal or low variability.

A previously undescribed type of variation, i.e. a heterozygous substitution of A for G, was detected at the last nucleotide in exon 1. The exon-intron boundaries are usually highly conserved, and the present variation could therefore have biological significance at, for example, the transcriptional level. The frequency of the variant CCA was very low, and it may not be informative enough to be used in genetic association studies. However, it could be a target for further functional characterization. Two polymorphisms, Thr138Asn and Ser186Asn, were frequent in the present Finnish study population. The present study evaluates these polymorphisms for the first time in a genetic association study. Both of these polymorphisms are located in the proSP-C C-terminus, which has an important role in the processing and targeting of proSP-C (Keller et al. 1992, Beers et al. 1998). Mutations associated with interstitial lung diseases have been reported very close to these positions, highlighting the importance of this region in the proper function of SP-C (Thomas et al. 2002, Nogee et al. 2002).

The SP-C polymorphisms were studied in a high-risk population of preterm infants of less than 34 gestational weeks. None of the SP-C variants associated with BPD, but a modest association with RDS was detected. The association was confirmed by logistic regression analysis, and both Asn-coding alleles at the sites 138 and 186 of proSP-C were found to be risk factors for RDS. The association was confounded by the gender, being stronger among males than in females. RDS occurs more frequently among males than in females and is also confounded by ethnicity and birth order, being frequent especially among white male subjects (Farrell & Wood 1976) and second-born twins (Lankenau 1976, Ziadeh & Badria 2000). Interestingly, the levels of SP-C expression in fetal lung are influenced by fetal gender (Dammann et al. 2000).

An allele coding for Asn138 was associated with very preterm birth, manifesting as a difference between full-term infants and very preterm infants of less than 28 weeks of gestation. The mechanism of this association is not known and should be confirmed by further genetic and functional studies. However, it is of special interest that the expressions of the hydrophobic surfactant proteins SP-B and SP-C regulate the production of prostaglandins required for the onset of labour process (Lopez et al. 1989, Challis & Smith 2001), possibly suggesting some shared regulatory pathways.

6.3 SP-B intron 4 deletion variant as risk factor for BPD (III-IV)

An allelic association of the SP-B deletion variant allele with BPD was described among presenting infants. Only those born before 32 weeks of gestation were included in the analysis, as BPD was very infrequent among infants born later in gestation. The association was evident in two separate studies. First, the effect of SP genes together with

60

numerous environmental factors related to preterm birth was evaluated using conventional allelic association study methods in combination with a data mining procedure, which takes into account the simultaneous effects of multiple genetic and environmental factors (III). Second, a family-based TDT analysis was made to investigate the familial segregation of the SP-B intron 4 alleles from parents to affected offspring (IV). The first study revealed a joint association of low birth weight and the SP-B intron 4 deletion variant allele with the broad BPD phenotype. In the second study, increased transmission of the SP-B deletion variant allele from parents to affected offspring was observed in the families where the infant had moderate to severe BPD diagnosed at 36 weeks of postmenstrual age.

Numerous environmental factors are presumed to play a role in the pathogenesis of BPD. Factors related to preterm birth, e.g. low birth weight, birth asphyxia and RDS, are regarded as major predictors for BPD. Other factors presumed to play an important role include inflammation, infection, pulmonary edema, nutritional deficiencies, predisposition to airway reactivity and early adrenal insufficiency (Bancalari et al. 2003).

There is variability in individual susceptibility to BPD, suggesting the existence of as yet unidentified risk factors. Genes are thought to play a role in the pathogenesis of BPD, and several studies are published describing either an allelic association (Makri et al. 2002, Manar et al. 2004, Wagenaar et al. 2004, Kazzi et al. 2004), or a non-association with the risk for BPD (Lin et al. 2004, Yanamandra et al. 2004). However, the genetic effect in complex diseases like BPD is likely to be modest. Moreover, because the common susceptibility alleles of many interacting genes have reduced penetrance and affect the disease risk in varying combinations with each other and with non-genetic factors, the impact of a single allele is not expected to be very strong. Therefore, it is highly unlikely that the odds ratios or frequency differences for any single genetic factor would reach statistically highly significant levels. Also, the lack of uniformity in the the diagnostic criteria of many complex diseases, including BPD (Bancalari et al. 2003), may influence the stratification of study populations, thus affecting the reproducibility of genetic findings in different study populations.

The interaction of multiple environmental and genetic factors influencing the pathogenesis of BPD was evaluated for the first time in the present study (III). By using a data-mining method for multiparameter analysis, the combined effect of genes and several pre- and postnatal clinical factors could be examined, and the significance of the genetic component alone or in combination with environmental factors could be statistically estimated. Low birth weight, RDS and low gestational age were the major predictors for BPD among the present study population. However, even though none of the genetic variables had any clear effect on the phenotype per se, the finding that the SP-B intron 4 deletion variant allele in combination with very low birth weight strongly predicted the broad disease phenotype is interesting. Other factors that, together with the SP-B intron 4 deletion variant allele, predicted BPD included RDS and birth asphyxia. It may thus be speculated that the combined effect of RDS, birth asphyxia and very low birth weight is especially drastic in the individuals who additionally carry the SP-B deletion variant allele. These individuals may be at an especially high risk for developing BPD. The association of the SP-B deletion variant with the overall requirement for postnatal oxygen therapy was evaluated (Table 10). The individuals who carried the deletion variant needed prolonged periods of supplemental oxygen, implying a negative

61

effect of the SP-B deletion variant allele. Although the difference was not statistically significant in Mann-Whitney test (p=0.097), the trend towards increased oxygen need was obvious.

The present finding of the SP-B intron 4 deletion variant and the risk of BPD was confounded by birth order, being only evident among presenting infants. Singletons and presenting twins are exposed to the conditions of the intrauterine cervix and are more prone to ascending infections than the non-presenting twins or multiples during pregnancy. A similar confounding effect of birth order has been reported in allele association studies on the SP-A and SP-B genes and RDS (Marttila et al. 2003a, Marttila et al. 2003b). The present study (III) described for the first time a similar confounding effect of birth order in BPD.

The lungs of very preterm infants are structurally immature. The infants at maximum risk for BPD are born before 30 weeks of gestation, i.e. at the saccular stage of lung development. The postnatal alveolarization process is disrupted in BPD, leading to structurally abnormal alveoli. This interference with microvascular development and septation results in fewer and larger alveoli and increased microvascular permeability leading to edema (Zimmerman 1995, Jobe & Bancalari 2001, Bancalari et al. 2003). Postnatal glucocorticoids are used as treatment of BPD. Glucocorticoids regulate the inflammatory response by interaction with transcription factors, such as nuclear factor κB (NFκB). However, high doses and repeated courses of corticosteroids may have negative long-term effects on the immature lung, disrupting vascular growth and alveolarization (Grier & Halliday 2004). Elevated levels of pro-inflammatory cytokines and products of inflammation have been measured in amniotic fluid, bronchoalveolar lavage and cord plasma of infants destined to develop BPD (Kotecha et al. 1996, Yoon et al. 1997, Gomez et al. 1998, Yoon et al. 1999). As inflammatory mediators interfere with alveolarization, their role in BPD pathogenesis is likely to be significant (Jobe 1999, Jobe & Ikegami 2001).

The intron regions of the genome have an important regulatory role in gene expression. For example, insertion/deletion polymorphisms have been associated with altered mRNA and protein levels (Suehiro et al. 2004, Kealey et al. 2005). Several putative transcription factor binding sites were lost or reorganized in the deletion variant allele compared to the wild-type SP-B intron 4 allele, as examined with computer-assisted sequence analysis in study III (Table 11). Many of the detected sites are related to inflammatory reactions and may well be targets for transcription factors activated by specific proinflammatory cytokines. For example, thyroid transcription factor 1 (TTF-1) is a critical regulator of transcription for the surfactant proteins SP-A, -B and –C and essential for normal lung morphogenesis and alveolarization (Margana & Boggaram 1997, Wert et al. 2002, DeFelice et al. 2003). In human BPD lung, TTF-1 was absent in areas of alveolar collapse or infection and present in regenerating open airways. The expression of TTF-1 followed the pattern of distribution of SP-B in developing lungs, consistent with its role in the regulation of pulmonary epithelial cell gene expression (Stahlman et al. 1996, Margana & Boggaram 1997). The role of interleukin-6 response element -binding protein (IL-6 RE-BP) in SP-B regulation has not been studied, but it has potential importance since IL-6 is a proinflammatory cytokine involved in the development of BPD (Yoon et al. 1997). Also, hepatocyte nuclear factor 3 (HNF-3) is a regulator of SP-B promoter activity and inflammation (Hromas & Costa 1995). TTF-1

62

and HNF-3 have been shown to act synergistically in the regulation of SP-B promoter activity. Interestingly, in the deletion variant allele these sites were brought in close proximity in a similar manner as in the promoter region of SP-B. This combination of closely spaced putative binding sites for TTF-1 and HNF-3 was not present in the other SP-B intron 4 alleles.

Decreased levels of SP-B are associated with acute lung injury and other physiological abnormalities (Clark et al. 1997, Tokieda et al. 1999b, Ingenito et al. 2001). Haploinsufficient mice expressing inadequate amounts of SP-B protein had increased susceptibility to pulmonary oxygen toxicity characterized by high permeability lung edema (O'Brodovich & Mellins 1985, Tokieda et al. 1999a). SP-B expression levels are potentially critical at times of oxidative stress and imminent oxygen toxicity. Therefore, any allelic variation affecting transcriptional regulation of the SP-B gene may indeed have an important role in the pathogenesis of BPD.

SP-B intron 4 variant alleles have previously been associated with acute respiratory distress syndrome and direct pulmonary injury (Gong et al. 2004), acute respiratory failure (Seifart et al. 2002a) and squamous cell carcinoma (Seifart et al. 2002b). In line with our results, the increased SP-B deletion variant allele frequency was associated with chronic lung disease (CLD) (defined as a need for supplemental oxygen at the postmenstrual age of 36 weeks) among a German population of 140 preterms and 58 term neonates (Makri et al. 2002).

The association of the SP-B deletion variant allele with BPD was supported by family-based TDT (IV). In this analysis, the segregation of deletion variants from parents to affected offspring was examined. The population consisted of presenting infants of less than 32 weeks of gestation. No other confounding environmental factors were included in the analysis. The TDT results confirmed the association of the SP-B deletion variant allele with the moderate to severe BPD phenotype diagnosed at 36 weeks of postmenstrual age. Increased transmission of the deletion variant allele was not evident among the families where the infant had mild BPD phenotype. Even though the small sample size of the father-mother-offspring trios with this mild phenotype (N=30) is possibly inadequate to reveal the the true differences between these two phenotypes, the results point out the importance of the preciseness of the diagnostic criteria used.

Similarly to other complex diseases, BPD is most probably influenced by several genes. The present study provides evidence of the SP-B deletion variant allele as a predisposing factor in the development of BPD. However, the current understanding related to the complex biological mechanisms leading to BPD raises the question of several other potential candidate genes that should be evaluated in genetic studies. Potential candidate genes in BPD include those affecting lung morphogenesis (Whitsett et al. 2004), maturation (Chen et al. 2004), alveolarization (Gauldie et al. 2003) and immunological responses (Kazzi et al. 2004). In addition to them, other as yet unidentified genes are likely to be involved in the disease etiology.

7 Summary and conclusions

In the present study, the genetic variation in SP-C and SP-D genes was characterized at the population level, and the role of SP gene polymorphisms was evaluated in the etiology of infantile lung diseases, including RDS, BPD and severe RSV infections. Conventional allelic association study methods were used in combination with multiparameter analysis and family-based TDT. The present study took advantage of the homogeneity of the present population and the availability of high-quality medical records concerning the maternal and neonatal medical histories.

Environmental factors have a major predisposing role in the etiology of multifactorial complex diseases. The present findings suggest that allelic variation in SP genes plays a significant, but limited role in the etiology of the diseases examined, explaining only partly individual disease suspectibility. An SP-D gene polymorphism was associated with an increased risk for severe RSV infection. According to a recent study, this polymorphism has potential biological significance. SP-C gene polymorphisms were evaluated in a population-based genetic association study for the first time. None of the SP-C alleles associated with BPD, but a modest association with RDS and preterm birth was detected. Using a data mining method for multiparameter analysis, the complex interactions of genetic and environmental factors in the etiology of BPD could be estimated. An association of the SP-B intron variant with the BPD phenotype was evident based on two studies using different genetic approaches. The allelic association was confounded by birth order, being evident only among presenting fetuses. A similar confounding effect has been previously reported in RDS.

The present findings yielded new information about the significance of several SP gene polymorphisms in infantile pulmonary diseases, including RDS, BPD and severe RSV infections. The present results promote our understanding of the mechanisms underlying these phenotypes. The diseases examined here are highly complex and possibly affected by numerous, as yet unidentified genes and environmental factors. Improved genetic tools and computer-based data processing should be utilized in the future to develop methods to examine the complex interactions between the factors leading to these diseases.

8 References

Akinbi HT, Breslin JS, Ikegami M, Iwamoto HS, Clark JC, Whitsett JA, Jobe AH & Weaver TE (1997) Rescue of SP-B knockout mice with a truncated SP-B proprotein. Function of the C-terminal propeptide. J Biol Chem 272: 9640-9647.

Akiyama J, Hoffman A, Brown C, Allen L, Edmondson J, Poulain F & Hawgood S (2002) Tissue distribution of surfactant proteins A and D in the mouse. J Histochem Cytochem 50: 993-996.

Alexander C & Rietschel ET (2001) Bacterial lipopolysaccharides and innate immunity. J Endotoxin Res 7: 167-202.

Atochina EN, Beers MF, Scanlon ST, Preston AM & Beck JM (2000) P. carinii induces selective alterations in component expression and biophysical activity of lung surfactant. Am J Physiol Lung Cell Mol Physiol 278: L599-L609.

Ballard PL, Nogee LM, Beers MF, Ballard RA, Planer BC, Polk L, deMello DE, Moxley MA & Longmore WJ (1995) Partial deficiency of surfactant protein B in an infant with chronic lung disease. Pediatrics 96: 1046-1052.

Bancalari E, Claure N & Sosenko IR (2003) Bronchopulmonary dysplasia: changes in pathogenesis, epidemiology and definition. Semin Neonatol 8: 63-71.

Batenburg JJ & Haagsman HP (1998) The lipids of pulmonary surfactant: dynamics and interactions with proteins. Prog Lipid Res 37: 235-276.

Beck DC, Na CL, Whitsett JA & Weaver TE (2000) Ablation of a critical surfactant protein B intramolecular disulfide bond in transgenic mice. J Biol Chem 275: 3371-3376.

Beers MF, Atochina EN, Preston AM & Beck JM (1999) Inhibition of lung surfactant protein B expression during Pneumocystis carinii pneumonia in mice. J Lab Clin Med 133: 423-433.

Beers MF, Lomax CA & Russo SJ (1998) Synthetic processing of surfactant protein C by alevolar epithelial cells. The COOH terminus of proSP-C is required for post-translational targeting and proteolysis. J Biol Chem 273: 15287-15293.

Benne CA, Kraaijeveld CA, van Strijp JA, Brouwer E, Harmsen M, Verhoef J, van Golde LM & van Iwaarden JF (1995) Interactions of surfactant protein A with influenza A viruses: binding and neutralization. J Infect Dis 171: 335-341.

Botas C, Poulain F, Akiyama J, Brown C, Allen L, Goerke J, Clements J, Carlson E, Gillespie AM, Epstein C & Hawgood S (1998) Altered surfactant homeostasis and alveolar type II cell morphology in mice lacking surfactant protein D. Proc Natl Acad Sci U S A 95: 11869-11874.

65

Bourbon JR & Chailley-Heu B (2001) Surfactant proteins in the digestive tract, mesentery, and other organs: evolutionary significance. Comp Biochem Physiol A Mol Integr Physiol 129: 151-161.

Brown-Augsburger P, Hartshorn K, Chang D, Rust K, Fliszar C, Welgus HG & Crouch EC (1996) Site-directed mutagenesis of Cys-15 and Cys-20 of pulmonary surfactant protein D. Expression of a trimeric protein with altered anti-viral properties. J Biol Chem 271: 13724-13730.

Bufler P, Schmidt B, Schikor D, Bauernfeind A, Crouch EC & Griese M (2003) Surfactant protein A and D differently regulate the immune response to nonmucoid Pseudomonas aeruginosa and its lipopolysaccharide. Am J Respir Cell Mol Biol 28: 249-256.

Cameron HS, Somaschini M, Carrera P, Hamvas A, Whitsett JA, Wert SE, Deutsch G & Nogee LM (2005) A common mutation in the surfactant protein C gene associated with lung disease. J Pediatr 146: 370-375.

Challis JR & Smith SK (2001) Fetal endocrine signals and preterm labor. Biol Neonate 79: 163-167.

Chen H, Sun J, Buckley S, Chen C, Warburton D, Wang XF & Shi W (2004) Abnormal Mouse Lung Alveolarization Caused by Smad3 Deficiency Is A Developmental Antecedent of Centrilobular Emphysema. Am J Physiol Lung Cell Mol Physiol.

Chiba H, Pattanajitvilai S, Evans AJ, Harbeck RJ & Voelker DR (2002) Human surfactant protein D (SP-D) binds Mycoplasma pneumoniae by high affinity interactions with lipids. J Biol Chem 277: 20379-20385.

Clark H & Reid K (2003) The potential of recombinant surfactant protein D therapy to reduce inflammation in neonatal chronic lung disease, cystic fibrosis, and emphysema. Arch Dis Child 88: 981-984.

Clark JC, Weaver TE, Iwamoto HS, Ikegami M, Jobe AH, Hull WM & Whitsett JA (1997) Decreased lung compliance and air trapping in heterozygous SP-B-deficient mice. Am J Respir Cell Mol Biol 16: 46-52.

Coalson JJ, Winter V & deLemos RA (1995) Decreased alveolarization in baboon survivors with bronchopulmonary dysplasia. Am J Respir Crit Care Med 152: 640-646.

Coalson JJ, Winter VT, Siler-Khodr T & Yoder BA (1999) Neonatal chronic lung disease in extremely immature baboons. Am J Respir Crit Care Med 160: 1333-1346.

Cole FS, Hamvas A, Rubinstein P, King E, Trusgnich M, Nogee LM, deMello DE & Colten HR (2000) Population-based estimates of surfactant protein B deficiency. Pediatrics 105: 538-541.

Conkright JJ, Bridges JP, Na CL, Voorhout WF, Trapnell B, Glasser SW & Weaver TE (2001) Secretion of surfactant protein C, an integral membrane protein, requires the N-terminal propeptide. J Biol Chem 276: 14658-14664.

Crouch E, Hartshorn K & Ofek I (2000) Collectins and pulmonary innate immunity. Immunol Rev 173: 52-65.

Crouch E, Persson A, Chang D & Heuser J (1994) Molecular structure of pulmonary surfactant protein D (SP-D). J Biol Chem 269: 17311-17319.

Crouch E, Rust K, Veile R, Donis-Keller H & Grosso L (1993) Genomic organization of human surfactant protein D (SP-D). SP-D is encoded on chromosome 10q22.2-23.1. J Biol Chem 268: 2976-2983.

Crouch E & Wright JR (2001) Surfactant proteins a and d and pulmonary host defense. Annu Rev Physiol 63: 521-554.

Crouch EC (1998) Collectins and pulmonary host defense. Am J Respir Cell Mol Biol 19: 177-201. Crouch EC (2000) Surfactant protein-D and pulmonary host defense. Respir Res 1: 93-108.

66

Crowley P, Chalmers I & Keirse MJ (1990) The effects of corticosteroid administration before preterm delivery: an overview of the evidence from controlled trials. Br J Obstet Gynaecol 97: 11-25.

Dammann CE, Ramadurai SM, McCants DD, Pham LD & Nielsen HC (2000) Androgen regulation of signaling pathways in late fetal mouse lung development. Endocrinology 141: 2923-2929.

Dargaville PA, South M & McDougall PN (1996) Surfactant abnormalities in infants with severe viral bronchiolitis. Arch Dis Child 75: 133-136.

DeFelice M, Silberschmidt D, DiLauro R, Xu Y, Wert SE, Weaver TE, Bachurski CJ, Clark JC & Whitsett JA (2003) TTF-1 phosphorylation is required for peripheral lung morphogenesis, perinatal survival, and tissue-specific gene expression. J Biol Chem 278: 35574-35583.

deMello DE, Heyman S, Phelps DS, Hamvas A, Nogee L, Cole S & Colten HR (1994) Ultrastructure of lung in surfactant protein B deficiency. Am J Respir Cell Mol Biol 11: 230-239.

DiAngelo S, Lin Z, Wang G, Phillips S, Rämet M, Luo J & Floros J (1999) Novel, non-radioactive, simple and multiplex PCR-cRFLP methods for genotyping human SP-A and SP-D marker alleles. Dis Markers 15: 269-281.

Dulkerian SJ, Gonzales LW, Ning Y & Ballard PL (1996) Regulation of surfactant protein D in human fetal lung. Am J Respir Cell Mol Biol 15: 781-786.

Dunbar AE, III, Wert SE, Ikegami M, Whitsett JA, Hamvas A, White FV, Piedboeuf B, Jobin C, Guttentag S & Nogee LM (2000) Prolonged survival in hereditary surfactant protein B (SP-B) deficiency associated with a novel splicing mutation. Pediatr Res 48: 275-282.

Eda S, Suzuki Y, Kawai T, Ohtani K, Kase T, Fujinaga Y, Sakamoto T, Kurimura T & Wakamiya N (1997) Structure of a truncated human surfactant protein D is less effective in agglutinating bacteria than the native structure and fails to inhibit haemagglutination by influenza A virus. Biochem J 323 ( Pt 2): 393-399.

Epaud R, Ikegami M, Whitsett JA, Jobe AH, Weaver TE & Akinbi HT (2003) Surfactant protein B inhibits endotoxin-induced lung inflammation. Am J Respir Cell Mol Biol 28: 373-378.

Farrell PM & Wood RE (1976) Epidemiology of hyaline membrane disease in the United States: analysis of national mortality statistics. Pediatrics 58: 167-176.

Ferguson JS, Voelker DR, McCormack FX & Schlesinger LS (1999) Surfactant protein D binds to Mycobacterium tuberculosis bacilli and lipoarabinomannan via carbohydrate-lectin interactions resulting in reduced phagocytosis of the bacteria by macrophages. J Immunol 163: 312-321.

Floros J, DiAngelo S, Koptides M, Karinch AM, Rogan PK, Nielsen H, Spragg RG, Watterberg K & Deiter G (1996) Human SP-A locus: allele frequencies and linkage disequilibrium between the two surfactant protein A genes. Am J Respir Cell Mol Biol 15: 489-498.

Floros J & Fan R (2001) Surfactant protein A and B genetic variants and respiratory distress syndrome: allele interactions. Biol Neonate 80 Suppl 1: 22-25.

Floros J, Fan R, DiAngelo S, Guo X, Wert J & Luo J (2001) Surfactant protein (SP) B associations and interactions with SP-A in white and black subjects with respiratory distress syndrome. Pediatr Int 43: 567-576.

Floros J & Hoover RR (1998) Genetics of the hydrophilic surfactant proteins A and D. Biochim Biophys Acta 1408: 312-322.

Floros J, Lin HM, Garcia A, Salazar MA, Guo X, DiAngelo S, Montano M, Luo J, Pardo A & Selman M (2000) Surfactant protein genetic marker alleles identify a subgroup of tuberculosis in a Mexican population. J Infect Dis 182: 1473-1478.

67

Floros J, Veletza SV, Kotikalapudi P, Krizkova L, Karinch AM, Friedman C, Buchter S & Marks K (1995) Dinucleotide repeats in the human surfactant protein-B gene and respiratory-distress syndrome. Biochem J 305 ( Pt 2): 583-590.

Gardai SJ, Xiao YQ, Dickinson M, Nick JA, Voelker DR, Greene KE & Henson PM (2003) By binding SIRPalpha or calreticulin/CD91, lung collectins act as dual function surveillance molecules to suppress or enhance inflammation. Cell 115: 13-23.

Gauldie J, Galt T, Bonniaud P, Robbins C, Kelly M & Warburton D (2003) Transfer of the active form of transforming growth factor-beta 1 gene to newborn rat lung induces changes consistent with bronchopulmonary dysplasia. Am J Pathol 163: 2575-2584.

Ghildyal R, Hartley C, Varrasso A, Meanger J, Voelker DR, Anders EM & Mills J (1999) Surfactant protein A binds to the fusion glycoprotein of respiratory syncytial virus and neutralizes virion infectivity. J Infect Dis 180: 2009-2013.

Glasser SW, Burhans MS, Korfhagen TR, Na CL, Sly PD, Ross GF, Ikegami M & Whitsett JA (2001) Altered stability of pulmonary surfactant in SP-C-deficient mice. Proc Natl Acad Sci U S A 98: 6366-6371.

Glasser SW, Detmer EA, Ikegami M, Na CL, Stahlman MT & Whitsett JA (2003) Pneumonitis and emphysema in sp-C gene targeted mice. J Biol Chem 278: 14291-14298.

Glasser SW, Korfhagen TR, Perme CM, Pilot-Matias TJ, Kister SE & Whitsett JA (1988a) Two SP-C genes encoding human pulmonary surfactant proteolipid. J Biol Chem 263: 10326-10331.

Glasser SW, Korfhagen TR, Weaver TE, Clark JC, Pilot-Matias T, Meuth J, Fox JL & Whitsett JA (1988b) cDNA, deduced polypeptide structure and chromosomal assignment of human pulmonary surfactant proteolipid, SPL(pVal). J Biol Chem 263: 9-12.

Gomez R, Romero R, Ghezzi F, Yoon BH, Mazor M & Berry SM (1998) The fetal inflammatory response syndrome. Am J Obstet Gynecol 179: 194-202.

Gong MN, Wei Z, Xu LL, Miller DP, Thompson BT & Christiani DC (2004) Polymorphism in the surfactant protein-B gene, gender, and the risk of direct pulmonary injury and ARDS. Chest 125: 203-211.

Grier DG & Halliday HL (2004) Effects of glucocorticoids on fetal and neonatal lung development. Treat Respir Med 3: 295-306.

Griese M (2002) Respiratory syncytial virus and pulmonary surfactant. Viral Immunol 15: 357-363. Guo X, Lin HM, Lin Z, Montano M, Sansores R, Wang G, DiAngelo S, Pardo A, Selman M &

Floros J (2001) Surfactant protein gene A, B, and D marker alleles in chronic obstructive pulmonary disease of a Mexican population. Eur Respir J 18: 482-490.

Haagsman HP & Diemel RV (2001) Surfactant-associated proteins: functions and structural variation. Comp Biochem Physiol A Mol Integr Physiol 129: 91-108.

Haataja R, Marttila R, Uimari P, Löfgren J, Rämet M & Hallman M (2001) Respiratory distress syndrome: evaluation of genetic susceptibility and protection by transmission disequilibrium test. Hum Genet 109: 351-355.

Haataja R, Rämet M, Marttila R & Hallman M (2000) Surfactant proteins A and B as interactive genetic determinants of neonatal respiratory distress syndrome. Hum Mol Genet 9: 2751-2760.

Hallman M, Arjomaa P, Hoppu K, Teramo K & Akino T (1989) Surfactant proteins in the diagnosis of fetal lung maturity. II. The 35 kd protein and phospholipids in complicated pregnancy. Am J Obstet Gynecol 161: 965-969.

Hallman M, Bry K, Hoppu K, Lappi M & Pohjavuori M (1992) Inositol supplementation in premature infants with respiratory distress syndrome. N Engl J Med 326: 1233-1239.

68

Hallman M, Merritt TA & Bry K (1994) The fate of exogenous surfactant in neonates with respiratory distress syndrome. Clin Pharmacokinet 26: 215-232.

Hamvas A, Nogee LM, Mallory GB, Jr., Spray TL, Huddleston CB, August A, Dehner LP, deMello DE, Moxley M, Nelson R, Cole FS & Colten HR (1997) Lung transplantation for treatment of infants with surfactant protein B deficiency. J Pediatr 130: 231-239.

Hamvas A, Nogee LM, White FV, Schuler P, Hackett BP, Huddleston CB, Mendeloff EN, Hsu FF, Wert SE, Gonzales LW, Beers MF & Ballard PL (2004) Progressive lung disease and surfactant dysfunction with a deletion in surfactant protein C gene. Am J Respir Cell Mol Biol 30: 771-776.

Hamvas A, Trusgnich M, Brice H, Baumgartner J, Hong Y, Nogee LM & Cole FS (2001) Population-based screening for rare mutations: high-throughput DNA extraction and molecular amplification from Guthrie cards. Pediatr Res 50: 666-668.

Harrod KS, Mounday AD & Whitsett JA (2000) Adenoviral E3-14.7K protein in LPS-induced lung inflammation. Am J Physiol Lung Cell Mol Physiol 278: L631-L639.

Harrod KS, Trapnell BC, Otake K, Korfhagen TR & Whitsett JA (1999) SP-A enhances viral clearance and inhibits inflammation after pulmonary adenoviral infection. Am J Physiol 277: L580-L588.

Hartshorn KL, Crouch EC, White MR, Eggleton P, Tauber AI, Chang D & Sastry K (1994) Evidence for a protective role of pulmonary surfactant protein D (SP-D) against influenza A viruses. J Clin Invest 94: 311-319.

Hartshorn KL, Reid KB, White MR, Jensenius JC, Morris SM, Tauber AI & Crouch E (1996) Neutrophil deactivation by influenza A viruses: mechanisms of protection after viral opsonization with collectins and hemagglutination-inhibiting antibodies. Blood 87: 3450-3461.

Hartshorn KL, Sastry KN, Chang D, White MR & Crouch EC (2000) Enhanced anti-influenza activity of a surfactant protein D and serum conglutinin fusion protein. Am J Physiol Lung Cell Mol Physiol 278: L90-L98.

Hawgood S & Clements JA (1990) Pulmonary surfactant and its apoproteins. J Clin Invest 86: 1-6. Hawgood S, Ogawa A, Yukitake K, Schlueter M, Brown C, White T, Buckley D, Lesikar D &

Benson B (1996) Lung function in premature rabbits treated with recombinant human surfactant protein-C. Am J Respir Crit Care Med 154: 484-490.

Hawgood S & Poulain FR (2001) The pulmonary collectins and surfactant metabolism. Annu Rev Physiol 63: 495-519.

Hickling TP, Bright H, Wing K, Gower D, Martin SL, Sim RB & Malhotra R (1999) A recombinant trimeric surfactant protein D carbohydrate recognition domain inhibits respiratory syncytial virus infection in vitro and in vivo. Eur J Immunol 29: 3478-3484.

Holmskov UL (2000) Collectins and collectin receptors in innate immunity. APMIS Suppl 100: 1-59.

Hoover RR & Floros J (1998) Organization of the human SP-A and SP-D loci at 10q22-q23. Physical and radiation hybrid mapping reveal gene order and orientation. Am J Respir Cell Mol Biol 18: 353-362.

Horowitz AD, Elledge B, Whitsett JA & Baatz JE (1992) Effects of lung surfactant proteolipid SP-C on the organization of model membrane lipids: a fluorescence study. Biochim Biophys Acta 1107: 44-54.

Hromas R & Costa R (1995) The hepatocyte nuclear factor-3/forkhead transcription regulatory family in development, inflammation, and neoplasia. Crit Rev Oncol Hematol 20: 129-140.

69

Hu R, Xu Y & Zhang Z (2004) Surfactant protein B 1580 polymorphism is associated with susceptibility to chronic obstructive pulmonary disease in Chinese Han population. J Huazhong Univ Sci Technolog Med Sci 24: 216-8, 238.

Hull J, Ackerman H, Isles K, Usen S, Pinder M, Thomson A & Kwiatkowski D (2001) Unusual haplotypic structure of IL8, a susceptibility locus for a common respiratory virus. Am J Hum Genet 69: 413-419.

Hull J, Thomson A & Kwiatkowski D (2000) Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax 55: 1023-1027.

Husain AN, Siddiqui NH & Stocker JT (1998) Pathology of arrested acinar development in postsurfactant bronchopulmonary dysplasia. Hum Pathol 29: 710-717.

Ikegami M, Korfhagen TR, Bruno MD, Whitsett JA & Jobe AH (1997) Surfactant metabolism in surfactant protein A-deficient mice. Am J Physiol 272: L479-L485.

Ikegami M, Korfhagen TR, Whitsett JA, Bruno MD, Wert SE, Wada K & Jobe AH (1998) Characteristics of surfactant from SP-A-deficient mice. Am J Physiol 275: L247-L254.

Ikegami M, Lewis JF, Tabor B, Rider ED & Jobe AH (1992) Surfactant protein A metabolism in preterm ventilated lambs. Am J Physiol 262: L765-L772.

Ikegami M, Whitsett JA, Jobe A, Ross G, Fisher J & Korfhagen T (2000) Surfactant metabolism in SP-D gene-targeted mice. Am J Physiol Lung Cell Mol Physiol 279: L468-L476.

Ingenito EP, Mora R, Cullivan M, Marzan Y, Haley K, Mark L & Sonna LA (2001) Decreased surfactant protein-B expression and surfactant dysfunction in a murine model of acute lung injury. Am J Respir Cell Mol Biol 25: 35-44.

Jobe AH & Bancalari E (2001) Bronchopulmonary dysplasia. Am J Respir Crit Care Med 163: 1723-1729.

Jobe AH & Ikegami M (2001) Antenatal infection/inflammation and postnatal lung maturation and injury. Respir Res 2: 27-32.

Jobe AJ (1999) The new BPD: an arrest of lung development. Pediatr Res 46: 641-643. Johansson J, Szyperski T & Wuthrich K (1995) Pulmonary surfactant-associated polypeptide SP-C

in lipid micelles: CD studies of intact SP-C and NMR secondary structure determination of depalmitoyl-SP-C(1-17). FEBS Lett 362: 261-265.

Kabha K, Schmegner J, Keisari Y, Parolis H, Schlepper-Schaeffer J & Ofek I (1997) SP-A enhances phagocytosis of Klebsiella by interaction with capsular polysaccharides and alveolar macrophages. Am J Physiol 272: L344-L352.

Kala P, Ten Have T, Nielsen H, Dunn M & Floros J (1998) Association of pulmonary surfactant protein A (SP-A) gene and respiratory distress syndrome: interaction with SP-B. Pediatr Res 43: 169-177.

Karinch AM, deMello DE & Floros J (1997) Effect of genotype on the levels of surfactant protein A mRNA and on the SP-A2 splice variants in adult humans. Biochem J 321 ( Pt 1): 39-47.

Karinch AM & Floros J (1995) 5' splicing and allelic variants of the human pulmonary surfactant protein A genes. Am J Respir Cell Mol Biol 12: 77-88.

Kaser MR & Skouteris GG (1997) Inhibition of bacterial growth by synthetic SP-B1-78 peptides. Peptides 18: 1441-1444.

Kazzi SN, Kim UO, Quasney MW & Buhimschi I (2004) Polymorphism of tumor necrosis factor-alpha and risk and severity of bronchopulmonary dysplasia among very low birth weight infants. Pediatrics 114: e243-e248.

70

Kealey C, Brown KS, Woodside JV, Young I, Murray L, Boreham CA, McNulty H, Strain JJ, McPartlin J, Scott JM & Whitehead AS (2005) A common insertion/deletion polymorphism of the thymidylate synthase (TYMS) gene is a determinant of red blood cell folate and homocysteine concentrations. Hum Genet 116: 347-353.

Keller A, Steinhilber W, Schafer KP & Voss T (1992) The C-terminal domain of the pulmonary surfactant protein C precursor contains signals for intracellular targeting. Am J Respir Cell Mol Biol 6: 601-608.

Kent A & Dahlstrom JE (2004) Chorioamnionitis/funisitis and the development of bronchopulmonary dysplasia. J Paediatr Child Health 40: 356-359.

Kerr MH & Paton JY (1999) Surfactant protein levels in severe respiratory syncytial virus infection. Am J Respir Crit Care Med 159: 1115-1118.

Kishor U, Madan T, Sarma PU, Singh M, Urban BC & Reid KB (2002) Protective roles of pulmonary surfactant proteins, SP-A and SP-D, against lung allergy and infection caused by Aspergillus fumigatus. Immunobiology 205: 610-618.

Koivisto M, Marttila R, Kurkinen-Räty M, Saarela T, Pokela ML, Jouppila P & Hallman M (2004) Changing incidence and outcome of infants with respiratory distress syndrome in the 1990s: a population-based survey. Acta Paediatr 93: 177-184.

Korfhagen TR, LeVine AM & Whitsett JA (1998a) Surfactant protein A (SP-A) gene targeted mice. Biochim Biophys Acta 1408: 296-302.

Korfhagen TR, Sheftelyevich V, Burhans MS, Bruno MD, Ross GF, Wert SE, Stahlman MT, Jobe AH, Ikegami M, Whitsett JA & Fisher JH (1998b) Surfactant protein-D regulates surfactant phospholipid homeostasis in vivo. J Biol Chem 273: 28438-28443.

Körkkö J, Annunen S, Pihlajamaa T, Prockop DJ & Ala-Kokko L (1998) Conformation sensitive gel electrophoresis for simple and accurate detection of mutations: comparison with denaturing gradient gel electrophoresis and nucleotide sequencing. Proc Natl Acad Sci U S A 95: 1681-1685.

Kotecha S, Wilson L, Wangoo A, Silverman M & Shaw RJ (1996) Increase in interleukin (IL)-1 beta and IL-6 in bronchoalveolar lavage fluid obtained from infants with chronic lung disease of prematurity. Pediatr Res 40: 250-256.

Kruglyak L, Daly MJ, Reeve-Daly MP & Lander ES (1996) Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet 58: 1347-1363.

Kuan SF, Rust K & Crouch E (1992) Interactions of surfactant protein D with bacterial lipopolysaccharides. Surfactant protein D is an Escherichia coli-binding protein in bronchoalveolar lavage. J Clin Invest 90: 97-106.

Kulovich MV, Hallman MB & Gluck L (1979) The lung profile. I. Normal pregnancy. Am J Obstet Gynecol 135: 57-63.

Lankenau HM (1976) A genetic and statistical study of the respiratory distress syndrome. Eur J Pediatr 123: 167-177.

Lawson PR & Reid KB (2000) The roles of surfactant proteins A and D in innate immunity. Immunol Rev 173: 66-78.

Leth-Larsen R, Garred P, Jensenius H, Meschi J, Hartshorn K, Madsen J, Tornoe I, Madsen HO, Sorensen G, Crouch E & Holmskov U (2005) A Common Polymorphism in the SFTPD Gene Influences Assembly, Function, and Concentration of Surfactant Protein D. J Immunol 174: 1532-1538.

71

LeVine AM, Elliott J, Whitsett JA, Srikiatkhachorn A, Crouch E, DeSilva N & Korfhagen T (2004) Surfactant protein-d enhances phagocytosis and pulmonary clearance of respiratory syncytial virus. Am J Respir Cell Mol Biol 31: 193-199.

LeVine AM, Gwozdz J, Stark J, Bruno M, Whitsett J & Korfhagen T (1999a) Surfactant protein-A enhances respiratory syncytial virus clearance in vivo. J Clin Invest 103: 1015-1021.

LeVine AM, Hartshorn K, Elliott J, Whitsett J & Korfhagen T (2002) Absence of SP-A modulates innate and adaptive defense responses to pulmonary influenza infection. Am J Physiol Lung Cell Mol Physiol 282: L563-L572.

LeVine AM & Whitsett JA (2001) Pulmonary collectins and innate host defense of the lung. Microbes Infect 3: 161-166.

Levine S, Klaiber-Franco R & Paradiso PR (1987) Demonstration that glycoprotein G is the attachment protein of respiratory syncytial virus. J Gen Virol 68 (Pt 9): 2521-2524.

Liley HG, White RT, Warr RG, Benson BJ, Hawgood S & Ballard PL (1989) Regulation of messenger RNAs for the hydrophobic surfactant proteins in human lung. J Clin Invest 83: 1191-1197.

Lim BL, Wang JY, Holmskov U, Hoppe HJ & Reid KB (1994) Expression of the carbohydrate recognition domain of lung surfactant protein D and demonstration of its binding to lipopolysaccharides of gram-negative bacteria. Biochem Biophys Res Commun 202: 1674-1680.

Lin HC, Su BH, Chang JS, Hsu CM, Tsai CH & Tsai FJ (2004) Nonassociation of Interleukin 4 intron 3 and 590 Promoter Polymorphisms with Bronchopulmonary Dysplasia for Ventilated Preterm Infants. Biol Neonate 87: 181-186.

Lin S, Phillips KS, Wilder MR & Weaver TE (1996) Structural requirements for intracellular transport of pulmonary surfactant protein B (SP-B). Biochim Biophys Acta 1312: 177-185.

Lin Z, Pearson C, Chinchilli V, Pietschmann SM, Luo J, Pison U & Floros J (2000) Polymorphisms of human SP-A, SP-B, and SP-D genes: association of SP-B Thr131Ile with ARDS. Clin Genet 58: 181-191.

Linder ME, Middleton P, Hepler JR, Taussig R, Gilman AG & Mumby SM (1993) Lipid modifications of G proteins: alpha subunits are palmitoylated. Proc Natl Acad Sci U S A 90: 3675-3679.

Liu W, Bentley CM & Floros J (2003) Study of human SP-A, SP-B and SP-D loci: allele frequencies, linkage disequilibrium and heterozygosity in different races and ethnic groups. BMC Genet 4: 13.

Löfgren J, Rämet M, Renko M, Marttila R & Hallman M (2002) Association between surfactant protein A gene locus and severe respiratory syncytial virus infection in infants. J Infect Dis 185: 283-289.

Lopez BA, Newman GE, Phizackerley PJ & Turnbull AC (1989) Effect of lipid and protein fractions from fetal pulmonary surfactant on prostaglandin E production by a human amnion cell line. Eicosanoids 2: 29-32.

Madsen J, Kliem A, Tornoe I, Skjodt K, Koch C & Holmskov U (2000) Localization of lung surfactant protein D on mucosal surfaces in human tissues. J Immunol 164: 5866-5870.

Madsen J, Tornoe I, Nielsen O, Koch C, Steinhilber W & Holmskov U (2003) Expression and localization of lung surfactant protein A in human tissues. Am J Respir Cell Mol Biol 29: 591-597.

72

Makri V, Hospes B, Stoll-Becker S, Borkhardt A & Gortner L (2002) Polymorphisms of surfactant protein B encoding gene: modifiers of the course of neonatal respiratory distress syndrome? Eur J Pediatr 161: 604-608.

Malhotra A & Krilov RL (2000) Influenza and respiratory syncytial virus. Update on infection, management and prevention. Pediatr Clin North Am 47:353-372.

Manar MH, Brown MR, Gauthier TW & Brown LA (2004) Association of glutathione-S-transferase-P1 (GST-P1) polymorphisms with bronchopulmonary dysplasia. J Perinatol 24: 30-35.

Margana RK & Boggaram V (1997) Functional analysis of surfactant protein B (SP-B) promoter. Sp1, Sp3, TTF-1, and HNF-3alpha transcription factors are necessary for lung cell-specific activation of SP-B gene transcription. J Biol Chem 272: 3083-3090.

Marttila R, Haataja R, Guttentag S & Hallman M (2003a) Surfactant protein A and B genetic variants in respiratory distress syndrome in singletons and twins. Am J Respir Crit Care Med 168: 1216-1222.

Marttila R, Haataja R, Rämet M, Pokela ML, Tammela O & Hallman M (2003b) Surfactant protein A gene locus and respiratory distress syndrome in Finnish premature twin pairs. Ann Med 35: 344-352.

Mason RJ, Nielsen LD, Kuroki Y, Matsuura E, Freed JH & Shannon JM (1998) A 50-kDa variant form of human surfactant protein D. Eur Respir J 12: 1147-1155.

Mbagwu N, Bruni R, Hernandez-Juviel JM, Waring AJ & Walther FJ (1999) Sensitivity of synthetic surfactants to albumin inhibition in preterm rabbits. Mol Genet Metab 66: 40-48.

McCormack FX (1998) Structure, processing and properties of surfactant protein A. Biochim Biophys Acta 1408: 109-131.

McCormack FX, Damodarasamy M & Elhalwagi BM (1999) Deletion mapping of N-terminal domains of surfactant protein A. The N-terminal segment is required for phospholipid aggregation and specific inhibition of surfactant secretion. J Biol Chem 274: 3173-3181.

McCormack FX, Kuroki Y, Stewart JJ, Mason RJ & Voelker DR (1994) Surfactant protein A amino acids Glu195 and Arg197 are essential for receptor binding, phospholipid aggregation, regulation of secretion, and the facilitated uptake of phospholipid by type II cells. J Biol Chem 269: 29801-29807.

McCormack FX, Pattanajitvilai S, Stewart J, Possmayer F, Inchley K & Voelker DR (1997) The Cys6 intermolecular disulfide bond and the collagen-like region of rat SP-A play critical roles in interactions with alveolar type II cells and surfactant lipids. J Biol Chem 272: 27971-27979.

McNeely TB & Coonrod JD (1993) Comparison of the opsonic activity of human surfactant protein A for Staphylococcus aureus and Streptococcus pneumoniae with rabbit and human macrophages. J Infect Dis 167: 91-97.

Nogee LM (1998) Genetics of the hydrophobic surfactant proteins. Biochim Biophys Acta 1408: 323-333.

Nogee LM (2004) Alterations in SP-B and SP-C expression in neonatal lung disease. Annu Rev Physiol 66: 601-623.

Nogee LM, Dunbar AE, III, Wert S, Askin F, Hamvas A & Whitsett JA (2002) Mutations in the surfactant protein C gene associated with interstitial lung disease. Chest 121: 20S-21S.

Nogee LM, Dunbar AE, III, Wert SE, Askin F, Hamvas A & Whitsett JA (2001) A mutation in the surfactant protein C gene associated with familial interstitial lung disease. N Engl J Med 344: 573-579.

73

Nogee LM, Garnier G, Dietz HC, Singer L, Murphy AM, deMello DE & Colten HR (1994) A mutation in the surfactant protein B gene responsible for fatal neonatal respiratory disease in multiple kindreds. J Clin Invest 93: 1860-1863.

Northway WH, Jr., Moss RB, Carlisle KB, Parker BR, Popp RL, Pitlick PT, Eichler I, Lamm RL & Brown BW, Jr. (1990) Late pulmonary sequelae of bronchopulmonary dysplasia. N Engl J Med 323: 1793-1799.

Northway WH, Jr., Rosan RC & Porter DY (1967) Pulmonary disease following respirator therapy of hyaline-membrane disease. Bronchopulmonary dysplasia. N Engl J Med 276: 357-368.

O'Brodovich HM & Mellins RB (1985) Bronchopulmonary dysplasia. Unresolved neonatal acute lung injury. Am Rev Respir Dis 132: 694-709.

O'Riordan DM, Standing JE, Kwon KY, Chang D, Crouch EC & Limper AH (1995) Surfactant protein D interacts with Pneumocystis carinii and mediates organism adherence to alveolar macrophages. J Clin Invest 95: 2699-2710.

Ofek I, Mesika A, Kalina M, Keisari Y, Podschun R, Sahly H, Chang D, McGregor D & Crouch E (2001) Surfactant protein D enhances phagocytosis and killing of unencapsulated phase variants of Klebsiella pneumoniae. Infect Immun 69: 24-33.

Paananen R, Sormunen R, Glumoff V, van Eijk M & Hallman M (2001) Surfactant proteins A and D in Eustachian tube epithelium. Am J Physiol Lung Cell Mol Physiol 281: L660-L667.

Palaniyar N, Ikegami M, Korfhagen T, Whitsett J & McCormack FX (2001) Domains of surfactant protein A that affect protein oligomerization, lipid structure and surface tension. Comp Biochem Physiol A Mol Integr Physiol 129: 109-127.

Panickar J, Scholefield H, Kumar Y, Pilling DW & Subhedar NV (2004) Atypical chronic lung disease in preterm infants. J Perinat Med 32: 162-167.

Pelkonen AS, Hakulinen AL, Turpeinen M & Hallman M (1998) Effect of neonatal surfactant therapy on lung function at school age in children born very preterm. Pediatr Pulmonol 25: 182-190.

Pena SV & Krensky AM (1997) Granulysin, a new human cytolytic granule-associated protein with possible involvement in cell-mediated cytotoxicity. Semin Immunol 9: 117-125.

Persson A, Chang D & Crouch E (1990) Surfactant protein D is a divalent cation-dependent carbohydrate-binding protein. J Biol Chem 265: 5755-5760.

Persson A, Rust K, Chang D, Moxley M, Longmore W & Crouch E (1988) CP4: a pneumocyte-derived collagenous surfactant-associated protein. Evidence for heterogeneity of collagenous surfactant proteins. Biochemistry 27: 8576-8584.

Phizackerley PJ, Town MH & Newman GE (1979) Hydrophobic proteins of lamellated osmiophilic bodies isolated from pig lung. Biochem J 183: 731-736.

Pilot-Matias TJ, Kister SE, Fox JL, Kropp K, Glasser SW & Whitsett JA (1989) Structure and organization of the gene encoding human pulmonary surfactant proteolipid SP-B. DNA 8: 75-86.

Pryhuber GS (1998) Regulation and function of pulmonary surfactant protein B. Mol Genet Metab 64: 217-228.

Quasney MW, Waterer GW, Dahmer MK, Kron GK, Zhang Q, Kessler LA & Wunderink RG (2004) Association between surfactant protein B + 1580 polymorphism and the risk of respiratory failure in adults with community-acquired pneumonia. Crit Care Med 32: 1115-1119.

74

Rämet M, Haataja R, Marttila R, Floros J & Hallman M (2000) Association between the surfactant protein A (SP-A) gene locus and respiratory-distress syndrome in the Finnish population. Am J Hum Genet 66: 1569-1579.

Sahly H, Ofek I, Podschun R, Brade H, He Y, Ullmann U & Crouch E (2002) Surfactant protein D binds selectively to Klebsiella pneumoniae lipopolysaccharides containing mannose-rich O-antigens. J Immunol 169: 3267-3274.

Seifart C, Plagens A, Brodje D, Muller B, von Wichert P & Floros J (2002a) Surfactant protein B intron 4 variation in German patients with COPD and acute respiratory failure. Dis Markers 18: 129-136.

Seifart C, Seifart U, Plagens A, Wolf M & von Wichert P (2002b) Surfactant protein B gene variations enhance susceptibility to squamous cell carcinoma of the lung in German patients. Br J Cancer 87: 212-217.

Selman M, Lin HM, Montano M, Jenkins AL, Estrada A, Lin Z, Wang G, DiAngelo SL, Guo X, Umstead TM, Lang CM, Pardo A, Phelps DS & Floros J (2003) Surfactant protein A and B genetic variants predispose to idiopathic pulmonary fibrosis. Hum Genet 113: 542-550.

Stahlman MT, Gray ME & Whitsett JA (1996) Expression of thyroid transcription factor-1(TTF-1) in fetal and neonatal human lung. J Histochem Cytochem 44: 673-678.

Stark JM, McDowell SA, Koenigsknecht V, Prows DR, Leikauf JE, Le Vine AM & Leikauf GD (2002) Genetic susceptibility to respiratory syncytial virus infection in inbred mice. J Med Virol 67: 92-100.

Stevenson DK, Wright LL, Lemons JA, Oh W, Korones SB, Papile LA, Bauer CR, Stoll BJ, Tyson JE, Shankaran S, Fanaroff AA, Donovan EF, Ehrenkranz RA & Verter J (1998) Very low birth weight outcomes of the National Institute of Child Health and Human Development Neonatal Research Network, January 1993 through December 1994. Am J Obstet Gynecol 179: 1632-1639.

Suehiro T, Morita T, Inoue M, Kumon Y, Ikeda Y & Hashimoto K (2004) Increased amount of the angiotensin-converting enzyme (ACE) mRNA originating from the ACE allele with deletion. Hum Genet 115: 91-96.

Tal G, Mandelberg A, Dalal I, Cesar K, Somekh E, Tal A, Oron A, Itskovich S, Ballin A, Houri S, Beigelman A, Lider O, Rechavi G & Amariglio N (2004) Association between common Toll-like receptor 4 mutations and severe respiratory syncytial virus disease. J Infect Dis 189: 2057-2063.

Thomas AQ, Lane K, Phillips J, III, Prince M, Markin C, Speer M, Schwartz DA, Gaddipati R, Marney A, Johnson J, Roberts R, Haines J, Stahlman M & Loyd JE (2002) Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am J Respir Crit Care Med 165: 1322-1328.

Tokieda K, Ikegami M, Wert SE, Baatz JE, Zou Y & Whitsett JA (1999a) Surfactant protein B corrects oxygen-induced pulmonary dysfunction in heterozygous surfactant protein B-deficient mice. Pediatr Res 46: 708-714.

Tokieda K, Iwamoto HS, Bachurski C, Wert SE, Hull WM, Ikeda K & Whitsett JA (1999b) Surfactant protein-B-deficient mice are susceptible to hyperoxic lung injury. Am J Respir Cell Mol Biol 21: 463-472.

Tokieda K, Whitsett JA, Clark JC, Weaver TE, Ikeda K, McConnell KB, Jobe AH, Ikegami M & Iwamoto HS (1997) Pulmonary dysfunction in neonatal SP-B-deficient mice. Am J Physiol 273: L875-L882.

75

Tredano M, Griese M, Brasch F, Schumacher S, de Blic J, Marque S, Houdayer C, Elion J, Couderc R & Bahuau M (2004) Mutation of SFTPC in infantile pulmonary alveolar proteinosis with or without fibrosing lung disease. Am J Med Genet 126A: 18-26.

Vamvakopoulos NC, Modi WS & Floros J (1995) Mapping the human pulmonary surfactant-associated protein B gene (SFTP3) to chromosome 2p12-->p11.2. Cytogenet Cell Genet 68: 8-10.

van de Wetering JK, van Eijk M, van Golde LM, Hartung T, van Strijp JA & Batenburg JJ (2001) Characteristics of surfactant protein A and D binding to lipoteichoic acid and peptidoglycan, 2 major cell wall components of gram-positive bacteria. J Infect Dis 184: 1143-1151.

van de Wetering JK, van Golde LM & Batenburg JJ (2004) Collectins: players of the innate immune system. Eur J Biochem 271: 1229-1249.

Voorhout WF, Veenendaal T, Haagsman HP, Verkleij AJ, van Golde LM & Geuze HJ (1991) Surfactant protein A is localized at the corners of the pulmonary tubular myelin lattice. J Histochem Cytochem 39: 1331-1336.

Voorhout WF, Veenendaal T, Kuroki Y, Ogasawara Y, van Golde LM & Geuze HJ (1992) Immunocytochemical localization of surfactant protein D (SP-D) in type II cells, Clara cells, and alveolar macrophages of rat lung. J Histochem Cytochem 40: 1589-1597.

Voss T, Melchers K, Scheirle G & Schafer KP (1991) Structural comparison of recombinant pulmonary surfactant protein SP-A derived from two human coding sequences: implications for the chain composition of natural human SP-A. Am J Respir Cell Mol Biol 4: 88-94.

Wagenaar GT, ter Horst SA, van Gastelen MA, Leijser LM, Mauad T, van der Velden PA, de Heer E, Hiemstra PS, Poorthuis BJ & Walther FJ (2004) Gene expression profile and histopathology of experimental bronchopulmonary dysplasia induced by prolonged oxidative stress. Free Radic Biol Med 36: 782-801.

Walsh EE, Brandriss MW & Schlesinger JJ (1985) Purification and characterization of the respiratory syncytial virus fusion protein. J Gen Virol 66 ( Pt 3): 409-415.

Wang G, Christensen ND, Wigdahl B, Guttentag SH & Floros J (2003a) Differences in N-linked glycosylation between human surfactant protein-B variants of the C or T allele at the single-nucleotide polymorphism at position 1580: implications for disease. Biochem J 369: 179-184.

Wang WJ, Mulugeta S, Russo SJ & Beers MF (2003b) Deletion of exon 4 from human surfactant protein C results in aggresome formation and generation of a dominant negative. J Cell Sci 116: 683-692.

Warr RG, Hawgood S, Buckley DI, Crisp TM, Schilling J, Benson BJ, Ballard PL, Clements JA & White RT (1987) Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences. Proc Natl Acad Sci U S A 84: 7915-7919.

Watterberg KL, Demers LM, Scott SM & Murphy S (1996) Chorioamnionitis and early lung inflammation in infants in whom bronchopulmonary dysplasia develops. Pediatrics 97: 210-215.

Weaver TE (1998) Synthesis, processing and secretion of surfactant proteins B and C. Biochim Biophys Acta 1408: 173-179.

Weaver TE & Conkright JJ (2001) Function of surfactant proteins B and C. Annu Rev Physiol 63: 555-578.

Weis WI, Crichlow GV, Murthy HM, Hendrickson WA & Drickamer K (1991) Physical characterization and crystallization of the carbohydrate-recognition domain of a mannose-binding protein from rat. J Biol Chem 266: 20678-20686.

76

Wert SE, Dey CR, Blair PA, Kimura S & Whitsett JA (2002) Increased expression of thyroid transcription factor-1 (TTF-1) in respiratory epithelial cells inhibits alveolarization and causes pulmonary inflammation. Dev Biol 242: 75-87.

Wert SE, Yoshida M, LeVine AM, Ikegami M, Jones T, Ross GF, Fisher JH, Korfhagen TR & Whitsett JA (2000) Increased metalloproteinase activity, oxidant production, and emphysema in surfactant protein D gene-inactivated mice. Proc Natl Acad Sci U S A 97: 5972-5977.

White MR, Crouch E, Chang D & Hartshorn KL (2001) Increased antiviral and opsonic activity of a highly multimerized collectin chimera. Biochem Biophys Res Commun 286: 206-213.

Whitsett JA (2002) Genetic basis of familial interstitial lung disease: misfolding or function of surfactant protein C? Am J Respir Crit Care Med 165: 1201-1202.

Whitsett JA, Wert SE & Trapnell BC (2004) Genetic disorders influencing lung formation and function at birth. Hum Mol Genet 13 Spec No 2: R207-R215.

Willet KE, Jobe AH, Ikegami M, Newnham J, Brennan S & Sly PD (2000) Antenatal endotoxin and glucocorticoid effects on lung morphometry in preterm lambs. Pediatr Res 48: 782-788.

Wood S, Yaremko ML, Schertzer M, Kelemen PR, Minna J & Westbrook CA (1994) Mapping of the pulmonary surfactant SP5 (SFTP2) locus to 8p21 and characterization of a microsatellite repeat marker that shows frequent loss of heterozygosity in human carcinomas. Genomics 24: 597-600.

Wright JR (1990) Clearance and recycling of pulmonary surfactant. Am J Physiol 259: L1-12. Wright JR (2005) Immunoregulatory functions of surfactant proteins. Nat Rev Immunol 5: 58-68. Wu H, Kuzmenko A, Wan S, Schaffer L, Weiss A, Fisher JH, Kim KS & McCormack FX (2003)

Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability. J Clin Invest 111: 1589-1602.

Yanamandra K, Loggins J & Baier RJ (2004) The Angiotensin Converting Enzyme Insertion/Deletion polymorphism is not associated with an increased risk of death or bronchopulmonary dysplasia in ventilated very low birth weight infants. BMC Pediatr 4: 26.

Yang L, Naltner A, Kreiner A, Yan D, Cowen A, Du H & Yan C (2003) An enhancer region determines hSP-B gene expression in bronchiolar and ATII epithelial cells in transgenic mice. Am J Physiol Lung Cell Mol Physiol 284: L481-L488.

Yoon BH, Romero R, Jun JK, Park KH, Park JD, Ghezzi F & Kim BI (1997) Amniotic fluid cytokines (interleukin-6, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8) and the risk for the development of bronchopulmonary dysplasia. Am J Obstet Gynecol 177: 825-830.

Yoon BH, Romero R, Kim KS, Park JS, Ki SH, Kim BI & Jun JK (1999) A systemic fetal inflammatory response and the development of bronchopulmonary dysplasia. Am J Obstet Gynecol 181: 773-779.

Zhang L, Hartshorn KL, Crouch EC, Ikegami M & Whitsett JA (2002a) Complementation of pulmonary abnormalities in SP-D(-/-) mice with an SP-D/conglutinin fusion protein. J Biol Chem 277: 22453-22459.

Zhang L, Ikegami M, Crouch EC, Korfhagen TR & Whitsett JA (2001) Activity of pulmonary surfactant protein-D (SP-D) in vivo is dependent on oligomeric structure. J Biol Chem 276: 19214-19219.

Zhang L, Ikegami M, Dey CR, Korfhagen TR & Whitsett JA (2002b) Reversibility of pulmonary abnormalities by conditional replacement of surfactant protein D (SP-D) in vivo. J Biol Chem 277: 38709-38713.

77

Ziadeh SM & Badria LF (2000) Effect of mode of delivery on neonatal outcome of twins with birthweight under 1500 g. Arch Gynecol Obstet 264: 128-130.

Zimmerman JJ (1995) Bronchoalveolar inflammatory pathophysiology of bronchopulmonary dysplasia. Clin Perinatol 22: 429-456.

Zsengeller ZK, Wert SE, Bachurski CJ, Kirwin KL, Trapnell BC & Whitsett JA (1997) Recombinant adenoviral vector disrupts surfactant homeostasis in mouse lung. Hum Gene Ther 8: 1331-1344.