The Vitamin D-responsive Element in the Human Osteocalcin Gene

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 265, No. 35, Issue of December 15, pp. 21881-21@88,1990 Printed in U.S. A.

The Vitamin D-responsive Element in the Human Osteocalcin Gene ASSOCIATION WITH A NUCLEAR PROTO-ONCOGENE ENHANCER*

(Received for publication, July 6, 1990)

Keiichi Ozono$, Jennifer Liao$, Sandra A. KernerS, Rebecca A. Scot& and J. Wesley Pike+41 From the Departments of SPediatrics and JCell Biology, Baylor College of Medicine, Houston, Texas 77030

A vitamin D-responsive element (VDRE) locus within the 5’ region of the human osteocalcin gene promoter contains a steroid response-like half-site immediately proximal to a consensus site for the AP-1 nuclear oncogene family. In the studies described here, internal mutagenesis of the osteocalcin promoter cou- pled to functional assays reveal that the interaction of the vitamin D receptor is limited to the proximal region of the VDRE locus. Mutations within the distal AP-1 consensus site reduce the basal activity of the promoter but have little effect on vitamin D inducibility. The absolute level of promoter activity induced by hormone, however, is dramatically reduced in the absence of an intact AP-1 site suggesting a functional synergism between the receptor and AP-l-related proteins. In vitro receptor-DNA binding studies confirm the lack of requirement for the distal component in receptor binding. These results suggest that the osteocalcin VDRE is limited to 15 nucleotides closely juxtaposed to a distal functional AP-1 site. The close association of the two sites may lead to proto-oncogene and steroid receptor interactions that result in interesting functional consequences.

Steroid hormones exert potent regulatory control over eu- karyotic development, differentiation, and cellular homeosta- sis through transcriptional control of selected gene networks (O’Malley et al., 1977; Yamamoto, 1985). This control is mediated by intracellular receptor proteins such as those for estrogen, glucocorticoids, thyroid hormone, retinoic acid, and vitamin D that bind to cognate hormonal ligands with high affinity (Jensen et al., 1968; Evans, 1988; Beato, 1989; O’Malley, 1990). As complexes, these proteins are capable of transcriptional modulation through direct interaction with unique DNA-binding sites located within promoter regions of responsive genes. Indeed, recent studies suggest that the addition of purified receptor proteins to DNA promoter tem- plates are capable of enhancing transcription in vitro when other essential components are present (Freedman et al., 1989; Klein-Hitpass et al., 1990; Kalff et al., 1990).

DNA sequence elements that confer steroid hormone re- sponsiveness to regulatable gene promoters represent cis- acting elements whose properties are consistent with those of typical enhancers (Beato, 1989). These elements take differ-

* This work was supported by Grants AR-38170 and DK-38130 from the National Institutes of Health and the Robert A. Welch Foundation. The costs of publication of this article were defraved in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

11 Established Investigator of the American Heart Association. To whom correspondence should be addressed: Dept. of Pediatrics, Bay- lor College of Medicine, 8080 N. Stadium Dr., Houston, TX 77054.

ent sequence conformations but are often identified within promoters as short repeats or palindromic sequences such as those found to mediate estrogen (Klein-Hitpass et al., 1986, 1988; Klock et al., 1987) and glucocorticoid or progesterone (Buetti and Kuhnel, 1986; Strahle et al., 1987) action. More recently, hormone-responsive elements have been identified for thyroid (Glass et al., 1987; Brent et al., 1989a, 1989b) and retinoic acid (Umesono et al., 1988; de The et al., 1990) hormones, generally as repeating units reminiscent of steroid- responsive half-sites. An understanding of the determinants by which receptors recognize and interact with these sequence elements as well as how they function together with receptors to alter transcriptional activity is a major goal of current cellular biology.

The potent actions of vitamin D on skeletal bone remod- eling have been extensively studied (Omdahl and DeLuca, 1973). The action of vitamin D on bone forming osteoblast cells is direct. Through receptor-dependent mechanisms, vitamin D regulates the expression of a variety of cell communication factors as well as collagenous and non-collagenous bone proteins that are involved in the formation of membra- nous matrix subject to eventual mineralization (Price and Baukol, 1980; Rowe and Kream, 1982; Majeska and Rodan, 1982). Osteocalcin or bone gla protein is an important exam- ple of such an induced non-collagenous component (Price and Baukol, 1980). The regulation of osteocalcin levels by vitamin D apparently occurs at the level of transcriptional control (Price and Baukol, 1980), and indeed our recent studies have demonstrated the identity of a vitamin D-responsive element (VDRE)’ lying approximately 500 bp upstream of the transcriptional start site for the human OC gene (Kerner et al., 1989). We have determined also that transcriptional induction of this promoter by vitamin D is dependent upon the presence of functional receptor when cointroduced by transfection into receptor-negative CV-1 cells (McDonnell et al., 1989b; Sone et al., 1989). These studies have provided the first direct evidence that vitamin D, through its receptor, is indeed a transcriptional activator much like retinoic acid, thyroid hormone, and the steroid hormones.

In the current studies, we further define important features of the human OC vitamin D-responsive region. We show that this element is complex, containing both a high affinity proximal site recognized by the VDR and a distal site that forms a consensus binding region for the AP-1 protein family (Lee et al., 1987; Angel et al., 1987). Our observations suggest that these binding sites do not overlap and that both function in a synergistic manner on the same DNA template.

i The abbreviations used are: VDRE, vitamin D response element; 1,25-(OH)2Da, 1.25dihvdroxwitamin D?: VDR. 1.25(OH)pD, recen- tor; hVDR, human 1,25-(OI&D3 receptor; OC,’ osteocalcin; hp, base pair(s); Hepes, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; MTV, mammary tumor virus; MTV-LTR, MTV long terminal repeat.

21881

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21882 Osteocalcin Vitamin D Response Element

EXPERIMENTAL PROCEDURES

Recombinant Steroid Receptor Expression Plasmids-Human vitamin D receptor (hVDR) was expressed utilizing the p91023b vector as previously described (Baker et al., 1988; McDonnell et al., 1989b).

Recombinant Reporter Plasmids-The human osteocalcin gene promoter fragment -838/+10 (relative to the start site of transcription) was cloned directly into the reporter plasmid pBL CAT3 as described earlier (Luchow and Schutz, 1987). In order to assess important regions within the vitamin D-responsive element located at approximately 500 bp upstream, a larger fragment of the promoter from -1339 to +lO was cloned directlv into BamHI and Sal1 sites of Ml3 mp18 and subjected to oligonucleotide-directed mutagenesis using 21- to 25-mer oligonucleotides as described by Kunkel(l985). Osteocalcin promoter clones bearing mutations in the VDRE locus were identified through DNA sequence analysis (Sanger et al., 1977), digested with P&I, and then transferred to pBL CAT3 as double-stranded -838/ +lO DNA fragments. All expression and reporter plasmids utilized in transfection studies were isolated and purified following ultracentrif- ugation through two sequential cesium chloride gradients.

Cell Culture and Transfections-Rat osteosarcoma-derived osteoblast-like cells (ROS 17/2.8) were cultured in Ham’s F-12 medium supplemented with 10% fetal calf serum, penicillin (100 units), and streptomycin (100 &ml). Monkev kidnev fibroblasts ((X-1) were cultured in Dulbeccc?s modified Eagles medium supplemented with the above antibiotics and 10% fetal calf serum. All cells were plated in 60-mm dishes 24 h prior to transfection protocols. ROS 17/2.8 cells were transfected using Polybrene by methods described by Kawai et al. (1984) utilizing 10 pg of reporter plasmid and 2 fig of pSV40- luciferase (de Wet et al., 1987) as internal standard. CV-1 cells were also transfected using Polybrene with 10 pg of reporter plasmid and increasing concentrations of receptor expression plasmid. Following transfection, all cells were cultured in the appropriate medium containing 5% charcoal- and resin-stripped fetal calf serum and the appropriate level of hormone. Cells were harvested 48-72 h later and assayed for protein, luciferase activity (de Wet et al., 1987), and chloramphenicol acetyltransferase activity (Gorman et al., 1982). Chloramphenicol acetyltransferase activity was normalized by either protein or luciferase activity and assessed in a l-3 h assay (ROS cells) or overnight (CV-1 cells) at 37 “C. Quantitation of chloramphenicol acetyltransferase activity was determined by radioassay of isolated thin layer chromatography spots. The magnitude of induction by hormone (fold induction) was determined by the ratio of induced to uninduced chloramphenicol acetyltransferase activity in paired plates.

Gel Retardation Analysis-Vitamin D receptor utilized for DNA bandshift assays was obtained from nuclear extracts of COS-1 cells transfected with pAV-hVDR. COS-1 cells, plated in loo-mm dishes 24 h earlier, were transfected with 20 rg of pAV-hVDR (or vector alone) per plate using diethylaminoethyl dextran methods. Cells were harvested 72 h following transfection and 2 h following exposure to lo-* M 1,25-(OH)2DR, and nuclear extracts were prepared as described (Shapiro et al. 1988). Parallel experiments with 1,25-(OH)2[3H]D, together with Western blot analysis confirmed the presence and level of intact receptor. DNA fragment -568/-413 or mutant forms of this fragment were utilized as probes. Each DNA fragment was prepared by digesting the wild-type or mutated plasmid with AccIII, labeling the ends using a filling in reaction, and then digesting with PuuII. The appropriate DNA fragment, labeled to 10’ cpm/qg, was isolated and recovered following resolution on a 4% polyacrylamide gel. DNA probe (5-20 x 10” cpm/reaction) was incubated with 0.4 pg of COS- 1 protein extract in 25 mM Tris/HCl, 15 mM Hepes, pH 7.9, 40 mM NaCl, 5 mM KCl, 3 mM MgCl,, 4.5 mM EDTA, 6% glycerol, 0.08% Tween 20, 1 mM P-mercaptoethanol, and 1 prg of poIy(dI-dC) for 20 min at room temperature and electrophoresed on a 5% polyacrylamide gel prepared in Tris/glycine buffer at 200 V constant. Gels were dried and subiected to autoradiography overnight. Oligonucleotides for competition include the -VDRE sequence 5’.TTGGTGACT- CACCGGGTGAACGGGGGCATT-3’ and the AP-I consensus 5’- CTAGTGATGACTCAGCCGGATC-3’.

Methylation Interference-Guanine nucleotide contact sites were determined as described bv Hendrickson and Schleif (1985). Plasmid containing osteocalcin promoter sequence from -568 to -413 was digested with EcoRI, labeled with ‘*P at the 3’ end of the sense strand and then digested with XbaI to release the 200.bp fragment. The probe was methylated and then incubated as described above with 50 ng of purified hVDR (>90% purity) isolated from Saccharomyces cereuisiae (McDonnell et al., 1989a) by DNA cellulose chromatogra-

phy (Sone et al., 1990) and 2 Fg of untransfected COS-1 cell nuclear extract protein prepared as above. Following electrophoresis, the receptor containing DNA probe and free unbound probe were excised, cleaved at the sites of methylation, and the fragments resolved on an 8% sequencing polyacrylamide gel. The quanine nucleotides indicated were identified through a Maxam and Gilbert sequencing reaction.

RESULTS

Possible Multiple Structures within the VDRE-Previous work by Kerner et al. (1989) led to the identification of a VDRE locus in the 5’-flanking region of the human osteocal- tin gene promoter. As illustrated in Fig. 1, the sequence of this element bears strong resemblance to that of other steroid- responsive element half-palindromes, particularly those sequences lying proximal to a hypothetical 5bp gap region. Interestingly, while the region distal to the putative gap exhibits some sequence similarity with steroid response elements, it also forms a clear consensus-binding site for the nuclear oncogene heterodimer c-jun and c-fos (Verma and Sassone-Corsi, 1987; Bohmann et al., 1987; Curran and Franza, 1988). The two inverted GGTGA repeats that form this site, together with a third found within the downstream proximal site suggest the possibility of a complex enhancer element capable of response to both steroid hormones as well as basal activators that may function through the nuclear proto-oncogene family.

The Proximal Half of the VDRE Is Essential for Vitamin D Induction-In order to evaluate the complexity of this element within the context of its own promoter, a large osteocalcin gene fragment containing sequences -838 to +10 (numbered relative to the start site) was introduced into Ml3 and nucleotide bases within or near the VDRE site located between -509 and -489 were subjected to site-directed deletion, insertion, or substitution mutagenesis. The resulting wild-type promoter fragment (-838/+10) or identical fragments containing internal mutations were then transferred to the pro- moterless vector pBL CAT3 (Luchow and Schutz, 1987) containing the structural reporter gene for chloramphenicol acetyltransferase (for examples see Fig. 2A) and evaluated for activity either in receptor containing ROS 17/2.8 (ROS) cells or through cotransfection assay in VDR-minus CV-1 cells. The basis for the latter assay is the introduction of increasing amounts of expression plasmid for human VDR cDNA (McDonnell et al., 1989b). In this assay, the reporter function is clearly dependent upon both expression of receptor as observed in Fig. 2B, as well as introduction of 1,25-(OH)zDz. When the entire VDRE locus is deleted (phOC-838 (A 513/ 487)) basal activity is reduced and hormone inducibility is lost (Fig. 2C). Full basal and inducible activity can be reconstituted into the VDRE-deleted construction by addition of the sequence extending from -512 to -485 (data not shown).

We initially evaluated a series of internal mutations in the gene that resulted in deletion of all or portions of the VDRE locus originally described by Kerner et al. (1989). As outlined in Table I, while the wild-type promoter or promoters containing deletions outside the VDRE were highly inducible in both ROS cells and in CV-1 cells cotransfected with VDR, deletion of the sequence from -513 to -487 resulted in complete loss of the vitamin D effect. Deletion of the distal GGTGA or GTGACTCA sequences within the VDRE locus, however, did not lead to complete loss of hormonal induction as we anticipated but exhibited 60-70% of activity when the plasmids were introduced into ROS cells and some 30% of the inducible activity of the wild-type promoter in CV-1 cells. As basal activity was reduced in all constructions that contained mutant distal elements, the total extent of promoter activity in the presence of VDR and 1,25-(OH)?Dz was also


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Osteocalcin Vitamin D Response Element 21883

A. 5' Distal Element 3' Proximal Element

______-------- gap __________-----

---------

FIG. 1. The vitamin D-responsive element in the human osteocalcin gene. A, the nucleotide sequence of the VDRE locus from -510 to -483 is presented. The sequence identified previously is underlined and the regions designated as the 5’ distal region, gap, and 3’ proximal region are indicated. The B. arrows define the three repeated sequences of GGTGA within the locus. B, the sequence of the proximal element is contrasted with the half-palindromes for estrogen, thyroid hormone, retinoic acid, and glucocorticoids.

- L

-510 5'-GGTGACTCA CCGGG TGAACGGGGGCATT-3'-483 CCACTGAGT GGCCC ACTTGCCCCCGTAA

VDRE

DNA SEQUENCE

Half palindrome

HORMONAL LIGAND

GGGTGA 1,25(OW$J3

AGGTCA ESTROGEN

AGGTC/AA T3

AGGTCA RETINOIC ACID/T3

AGAACA GLUCOCORTICOIDS/PROGESTERONE

A. r -838

I-

I 10 PhOC-838

hOC --FEiZKG+

-838 -513,-407 10 phOC-838(&X13/487)

II hOC @iFZ6J-

B.

250 phOC-838

200 c : .-

:v, 150 i-l : c 2’ w--‘ +; 100

-1.

2 50

0 0 0.02 0.1 0.5 1.0 2.0

ill _ PQ PAY-hVDA

a :.: 50 phOC-838b513/48?)

Ei; hii

2: O hnmmn o 0.02 0.1 0.5 1.0 2.0 0 )r~ pAV-hVDR

FIG. 2. Functional activity of human osteocalcin promoter constructions. A, the osteocalcin promoter wild-type fragment from -838 to f10 is shown fused to the structural gene for chloramphenicol acetyltransferase in pBL CAT3 and designated phOC-838. A similar fragment was subjected to site-directed mutagenesis in Ml3 to delete nucleotides from -513 to -487 containing the VDRE locus and designated phOC-838 (A -513/487). II, phOC-838 (10 pg) was transfected into CV-1 cells with increasing concentrations of pAV-hVDR as indicated in the presence of ethanol (a) or ethanol containing lo-’ M 1,25-(OH),Da (0) and the cells harvested and assayed for chloramphenicol acetyltransferase activity 48 h post-transfection. The experiment shown is representative of multiple assays. A relative unit of chloramphenicol acetyltransferase activity equals 0.2% conversion of substrate. C, the activity of phOC-838 (A 513/487) was assessed as in B.

reduced (see Fig. 3 for actual data in ROS cells). These data suggest that when both the proximal and distal elements are intact they function synergistically. In contrast, as with the

fragment that contained the deleted VDRE, deletion of the putative 5-bp “gap” or the proximal TGAACGGG severely compromised activity resulting in no induction by vitamin D in either ROS or CV-1 cells. Together, these results suggest to us that while an intact VDRE locus leads to maximum promoter activity in the presence of vitamin D, the proximal steroid-like element is essential for induction by vitamin D.

Nucleotide Spacing between the Proximal and Distal Ele- ments Strongly Influences Inducible Activity-Based upon the functional requirement of the proximal element for inducibility, we next evaluated several deletion and insertion mutants of the -838/+10 promoter that altered the spacing of the putative gap, in turn moving the TGAACG sequence either closer or further from the distal AP-1 consensus portion of the VDRE. As observed in Table II, introduction of two additional bases within the putative gap resulted in unaltered or possibly increased inducible activity in response to vitamin D. In contrast, deletion of either two or five nucleotides from the gap (leaving either three or zero nucleotide pairs) led to the loss of inducible activity, both in ROS and in CV-1 cells. To further define whether the latter effect was due to compression of the two sites or due to loss of nucleotide identity, the natural CCGGG gap was mutated to AAAAA, AAAGG, or CCAAA and tested. As observed in Table III, it is cIear that mutation of the two proximal G nucleotides in the gap leads to a loss of vitamin D inducibility. Thus, at least two of the nucleotides within the putative gap region are required for vitamin D function and likely contribute to interaction with the VDR.

The Vitamin D Receptor Binds to the Proximal Element of the VDRE in Vitro-Having mapped functionally the element essential for vitamin D induction to a proximal region within the VDRE, we assessed the ability of the VDR to bind directly to the VDRE locus itself through bandshifting experiments. We utilized nuclear extracts from COS-1 cells transfected with hVDR cDNA expression vector and pretreated for 2 h at 37 “C with 1,25-(OH)*D3 prior to harvest as a source of enriched occupied receptor. Labeled DNA fragments extending from -568 to -413 within the promoter and containing the intact or mutated VDREs were used for these studies. As observed in Fig. 44, several DNA-protein complexes were identified when extracts of transfected COS-1 cells were in-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


TABLE I Internal dissection of the osteocalcin vitamin D response element

ROS 17/2.8 cv-1

phOC-838/+10 deletion mutation” BasaP

%Stimulation’ %Stimulation’ BasaP

0.02 0.1 0.5

MpAV-hVDR -521 -510 -493 -482

AGGCTGCCTTT GGTGACTCACCGGGTGAACGGG GGCATTG 100 100 100 12 50 100 ..jGGCTGCC--- -----____---------____ --C*TTG 31 2 11 0 2 2 A---------- GGTGACTCACCGGGTGAACGGG GGCATTG NDd ND 51 73 137 178 AGGCTGCCTTT -----CTCACCGGGTGAACGGG GGCATTG 21 69 16 1 15 28 AGGCTGCCTTT G--------CCGGGTGAACGGG GGCATTG 36 73 34 9 19 32 AGGCTGCCTTT GGTGACTCA-----TGAACGGG GGCATTG 30 12 47 0 0 13 AGGCTGCCTTT GGTGACTCACCGGG-------- GGCATTG 53 10 76 0 0 2 AGGCTGCCTTT GGTGACTCACCGGGTGAACGGG -----TG ND ND 66 24 72 129

“The nucleotides shown in bold represent wild-type sequence with coordinates of -521 to -482. Internal deletion of the bases indicated by dashed lines within the DNA fragment -838 to +lO was achieved through site- directed mutagenesis.

‘Basal activity of the wild-type promoter in ROS cells transfected with 10 pg of phOC-838 was lo-12% conversion of added chloramphenicol substrate and designated 100%. The activities of all mutant promoters are indicated as a percentage of the natural sequence. The basal activity of the natural promoter in CV-1 cells transfected with 10 pg of phOC-838 and 0.5 gg of pAV-hVDR was 2-4% of added substrate and designated 100%. The activities of the mutant promoters are indicated as a percentage of the natural sequence.

’ Inducibility (fold induction) was determined as the ratio of promoter activity in the presence and absence of lo- M 1,25-(OH)2D3 (parallel transfections). Inducibility of the wild-type promoter in ROS cells was determined through transfection of 10 pg of phOC-838. Fold induction was between 5 and 6 and was designated 100% (%Stimulation). The activities of the mutant promoters are indicated as a percentage of the natural sequence from the formula (inducibility phOC,,,,, - l/inducibility phOC-838 - 1) x 100. Inducibility of the wild-type promoter in CV-1 cells was determined through transfection of 10 pg of phOC-838 and increasing concentrations of pAV- hVDR. Maximum fold induction with phOC-838 was achieved 0.5 rg of pAV-hVDR and designated 100% (%Stimulation). The activities of the mutant promoters are indicated as a percentage of the wild-type promoter from the formula (inducihility phOC,,,.t [0.5 pg pAV-hVDR] - inducibility phOC,,,.., [0.5 pg vector]/inducibility phOC-838 [0.5 yg pAV-hVDR] - inducibility phOC-838 [0.5 fig vector].

d ND, not determined.

I? St-

AP- 1 1.25COW2 Dg

+ - z $

FIG. 3. Synergism between the proximal and distal elements of the VDRE locus. Wild-type promoter (+AP-I) phOC-838/+10 (m) or mutant promoter (-AP-I) phOC-838/+10 (A510/506) (0) were transfected into ROS cells and treated with (+) or without (-) 1,25-(OH)2D3. Chloramphenicol acetyltransferase activity was assessed 48 h later. Data are indicated in relative units (as in Fig. 2) and represent the average of four transfections + S.E.

cubated with intact -568/-413 DNA as probe. The major protein DNA complex (identified as complex 3) was entirely absent from cells that remain untransfected (Fig. 4A), mock transfected, or transfected with reverse orientation plasmid (data not shown). The larger complexes designated 4 and 5 were visualized weakly from experiment to experiment in both untransfected and transfected cells. In order to test whether complex 3 represented a receptor-DNA complex, we utilized an anti-VDR monoclonal antibody known to interact immediately carboxyl to the DNA-binding domain of the VDR and to alter DNA binding (Pike, 1985). As observed in Fig. 4B, this antibody at very low concentrations specifically blocked the formation of complex 3. These results strongly suggest that this complex represents the interaction of the

VDR with DNA fragment -568/-413. Indeed, crude or highly purified vitamin D receptors from yeast extracts similarly form a complex which migrates identically with the complex 3 identified in COS-1 cell extracts (Liao et al., 1990), strongly suggesting that this complex contains the VDR.

We competed increasing concentrations of two specific oligonucleotides with the labeled -568/-413 probe to ascer- tain whether the receptor in complex 3 was associated with the internal VDRE region. As is evident in Fig. 4C, an oligonucleotide whose sequence matched that of the VDRE region from -512 to -483 alone readily competed off complex 3, suggesting that the receptor was indeed associated with that region of the DNA. In fact, the VDR bound directly to the VDRE as a single species when a labeled form of this competing oligonucleotide was similarly utilized in a bandshifting experiment (data not shown). Complexes 4 and 5, readily apparent in Fig. 4C, were also competed, suggesting that additional unidentified proteins may well bind to this region. Interestingly, an oligonucleotide consistent with the consensus sequence for AP-1 (Angel et al., 1987) and whose core sequence (TGACTCA) was identical to that in the 5’ half of the VDRE was unable to competitively decrease the signal in complex 3 or the other complexes, even at molar ratios as high as 150. Thus, in contrast to VDR binding, no AP-l-dependent DNA complexes were identified in these particular experiments, possibly because of the relatively high recombinant levels of VDR that were expressed. Experiments using extracts that contained AP-1 activity, however, did allow the identification of protein-DNA complexes unreactive to monoclonal antibody and competable with the AP-1 consensus oligonucleotide (data not shown).

In order to further test the necessity of the proximal element for VDR binding, we carried out additional bandshifting


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Osteocalcin Vitamin D Response Element

TABLE II

21885

Effect of gap length on asteocalcin vitamin D response element actiuity Activities were assessed as in Table I.

ROS 1lf2.8 cv-1

phOC-838/+10 spacing mutation Basal %Stimulation Basal

%Stimulation

0.02 0.1 0.5 pgpAV-hVDR

-510 -496 GGTGACTCA - TGAACGGG 30 12 30 0 0 13 GGTGACTCA CAG TGAACGGG 59 6 59 0 0 10 GGTGACTCA CCGGG TGAACGGG 100 100 100 12 50 100 GGTGACTCA CCCGGGG TGAACGGG 12 70 82 17 123 196

TABLE III

Effect ofgup sequence on osteocalcin vitamin D response element activity Activities were assessed as in Table I.

ROS 1712.8 cv-1

phOC-838/+10 gap mutation %Stimulation Basal %Stimulation Basal

0.02 0.1 0.5 WgpAV-hVDR

-510 -496 GGTGACTCA CCGGG TGAACGGG 100 100 100 12 50 100 GGTGACTCA AAAAA TGAACGGG 70 0

iz 2 9 9

GGTGACTCA AAAGG TGAACGGG 16 123 16 73 80 GGTGACTCA CCAAA TGAACGGG 69 8 25 7 12 16

experiments with the intact -568/-413 DNA probe as well as the same probe bearing deletions of either the entire VDRE region, or the distal or proximal sites. As illustrated in Fig. 40, VDR complex 3 was clearly formed with the intact DNA probe as well as with a probe in which the distal 5’ element (GTGACTCA) was deleted. No such binding was observed when the entire VDRE region was deleted within the DNA probe or when the 3’ proximal site was removed. These data provide direct evidence that the receptor interacts with the proximal portion of the previously defined VDRE locus in uitro. While these data do not rule out the possibility that the receptor may bind to the distal site with an affinity insuffi- cient for evaluation by bandshift experiments, this interpretation seems unlikely taken together with the above functional data.

Methylation Interference and Nucleotide Contact Sites with the VDR-To identify purine nucleotide contact sites, labeled DNA was subjected to methylation using dimethyl sulfate, incubated with VDR, and free and bound probes resolved and evaluated. As seen in Fig. 5, methylation of the three G nucleotides (-499, -498, and -497) at the 5’ side and three G nucleotides (-490, -489, and -487) at the 3’ side of the proximal element prevented VDR binding. These data suggest that nucleotide -487 may be important for function, a nucleotide base not incorporated into the VDRE oligonucleotide sequence assessed originally by Kerner et al. (1989). Indeed, recovery of full vitamin D response with phOC-838 (A513/ 487) requires the insertion of a VDRE oligonucleotide that contains this 3’-guanine nucleotide (data not shown). These data also suggest that the phOC construction in which the most 3’ sequence of the VDRE locus (GGCAT, see Table I) was deleted should, in contrast to the result, have been inac- tive. Nevertheless, deletion of those bases leads to the fortui- tous recovery of a guanine nucleotide at -487 as well as a C nucleotide at -486, likely leading to wild-type activity.

GGTGA Repeats That Form the AP-1 -binding Site Are Not Essential for Vitamin D Induction-The above experiments provide strong evidence that the distal element containing

the AP-l-binding sequence is not required for vitamin D induction. Deletion of the first GGTGA repeat or portions of both repeats that comprise the AP-1 consensus site, however, did result, in a reduction in vitamin D inducibility, particularly in CV-1 cells (Table I). As a final test of the requirement for an intact proto-oncogene-binding site in vitamin D induction, we introduced a point mutation in the AP-1 site known to dramatically reduce c-jun/c-fos affinity (Risse et al., 1989) and tested this mutant for activity. We also introduced an increasing number of nucleotides between the two repeats that form the AP-l-binding site, additional bases that also change entirely the sequence just 5’ of the second repeat that could contribute to a VDRE half-site. As observed in Table IV, while each of these mutations (with the exception of the CG mutation that creates a consensus CRE of TGACGTGA and is known to bind AP-1 (Nakabeppu et al., 1988)) caused a reduction in basal activity, none of these mutations compromised the ability of vitamin D to induce the OC promoter. Taken together with the above experiments, these results suggest that the AP-1 consensus is unlikely to form even a low affinity binding site for the VDR (undetectable by bandshift techniques) and demonstrate unequivocally that this sequence is not required for vitamin D activation within the OC promoter.

Rat and Human Homologs of the VDRE-The nucleotide sequence of the human OC promoter region that confers vitamin D response is aligned in Fig. 6 with sequences within the rat osteocalcin promoter recently shown to confer similar hormonal response (Demay et al., 1990). The G nucleotides in the human promoter that represent contact sites with the VDR are indicated. They are contrasted with contact sites on the rat promoter identified for an unknown protein in 1,25- (OH)nD&imulated ROS cells (Markose et al., 1990). From this alignment, it is clear that whereas the proximal element that confers vitamin D response has been highly conserved within both promoters, the distal AP-1 element remains a unique characteristic of the human promoter.

DISCUSSION

We describe experiments that focus upon further delinea- tion of a short DNA region located within the human osteo-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21886

A. 6.

Osteocalcin Vitamin D Response Element

4- avv-

VDR3-.

2-

I- Ii NN---- aAV-hVDR- +

VDR-OA7(ng)- g g - ;

-”

II ii I +-

pAi-hVD6 T

FIG. 4. Interaction of the VDR with osteocalcin DNA in uitro. A, identification of a protein-DNA complex unique to pAV- hVDR-transfected COS-1 cells. An osteocalcin DNA fragment from -568 to -413 was end labeled and incubated as described under “Experimental Procedures” with nuclear extracts of 1,25-(OH)*D3- treated COS-1 cells either mock transfected (-) or transfected with pAV-hVDR (+) 72 h earlier. Free and protein-bound complexes were resolved during nondenaturing gel electrophoresis. Protein-DNA complexes are designated 1-5. Complex 3 (VDR) is unique to pAV- hVDR transfected COS-1 cells. B, inhibition of complex 3 formation by an anti-VDR monoclonal antibody. Protein-DNA complexes were formed as in A from transfected COS-1 cells in the presence of increasing concentrations (ng) of anti-VDR monoclonal antibody 9A7 or an irrelevant monoclonal antibody of the same class. Protein- DNA complex 3 is specifically inhibited by anti-VDR antibody. C, VDR binds to the VDRE locus within the DNA probes -568/-413. Protein-DNA complexes were formed as in A with increasing concentrations of AP-1 oligonucleotide or an oligonucleotide whose sequence matched the osteocalcin promoter from -510 to -483. Complex 3, as well as complexes 4 and 5 were competitively reduced by the VDRE oligonucleotide alone. D, the VDR binds to the proximal element within the VDRE locus. Nuclear extracts from mock transfected (-) or pAV-hVDR transfected (+), 1,25-(OH)*D&eated CO&l cells were incubated with osteocalcin DNA probe -568/-413, or similar fragments bearing internal nucleotide deletions that removed sequences from -513/-487, -509/502, or -496/487. VDR-DNA complexes were formed with the intact wild-type DNA fragment and A 509/502, both of which contained the proximal element of the VDRE.

calcin gene promoter that modulates both basal activity and vitamin D induction. The results suggest that the originally described VDRE region is composed of a distal element that forms a consensus binding site for members of the AP-1 protein family (TGACTCA) and a proximal element that is essential for functional activation by the vitamin D receptor and its ligand. The observation that maximal levels of promoter activity are achieved when both elements are present suggests that a functional synergism likely occurs between the two cis elements and their respective transactivating proteins.

The Distal Element May Enhance or Suppress-Our studies suggest that the distal AP-1 element is distinct from the vitamin D-responsive element and represents one component of several within the OC promoter that may control positively

12 8 Q

FIG. 5. Guanine nucleotide contacts within the proximal element of the VDRE determined by methylation interference. Lanes 1 and 2 represent resolved cleavage products derived from free and protein-bound probes, respectively. The nucleotide sequence of the VDRE region is indicated to the right. in which the methylated guanine nucleotides that reduce VDR-DNA interaction are indicated by asterisks. Individual bands that correspond to the indicated guanine nucleotides were determined through a sequencing reaction not. shown.

the basal activity of the OC gene. Schule et al. (1990) have carried out several experiments recently designed to alter AP- 1 activity levels in ROS cells and to assess OC promoter activity. Their studies revealed that the basal activity of the OC promoter, through the VDRE locus, was inversely corre- lated with the concentration of serum to which the cells were exposed following transfection. As high serum is known to enhance AP-l-like activity and specifically c-jun and c-fos levels (Curran and Franza, 1988, Lamph et al., 1988), it was concluded that the effect of this oncogene heterodimer (Hal- azonetis et al., 1988; Turner and Tjian, 1989; Gentz et al., 1989) on OC promoter activity was a suppressive one. This hypothesis was further supported by the observation that transfection of expression vectors for c-jun and c-fos also led to a decrease in basal OC promoter activity as well as a dramatic reduction in maximal promoter activity in response to vitamin D stimulation. Given the rather exquisite mechanisms that rapidly and transiently regulate the endogenous expression of either proto-oncogene in cells (Angel et al., 1988; Sassone-Corsi et al., 1988; Lucibello et al., 1989) as well as the complex interaction between various members of the AP- 1 family (Chiu et al., 1989; Schutte et al., 1989), a direct correlation between promoter activity and the identity and level of these factors in ROS cells will be required to substan- tiate these findings. It is of considerable interest, nevertheless, that both the tumor-promoting phorbol ester 4/3-phorbol 12,13dibutyrate and interleukin 1 have been shown to suppress vitamin D-stimulated production and osteocalcin in primary human bone cells (Evans et al., 1989), both of which may exert their activity through AP-1 (Lee et al., 1987; Chiu et al., 1988; Muegge et al., 1989).

The Proximal Element Mediates Vitamin D Action-It is clear from our studies that the proximal element within the VDRE locus is both distinct from the distal element and essential for vitamin D induction. This interpretation is based upon functional as well as direct DNA-binding studies that define the proximal region as essential to vitamin D inducibility. Our results described within the context of the osteocalcin gene promoter differ substantially from those observed by Schule et al. (1990), who evaluated the VDRE following insertion into the A MTV promoter (Umesono et al., 1988). Results of the latter studies suggest surprisingly that that


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Osteocalcin Vitamin D Response Element 21887

TABLE IV Effect of spacing mutations between AP-1 palindromic repeats

Activities were assessed as in Table I. cv-1

phOC-838/+10 AP-1 mutations %Stimulation Basal

0.02 0.1 0.5

pgpAV-hVDR

Dl D2 D3 -510 -504 -496 GGTGA C TCACCGGGTGAACGGG 100 12 50 100 GGTGA CG TCACCGGGTGAACGGG 117 80 139 113 GGTGA CGC TCACCGGGTGAACGGG 18 20 121 88 GGTGA CGCTC TCACCGGGTGAACGGG 22 21 95 99 GGTGA CGCTCTC TCACCGGGTGAACGGG 38 21 113 77 GtcGA C TCACCGGGTGAACGGG 19 36 54 80

FIG. 6. Alignment of nucleotide sequences of the rat and human osteocalcin promoters that confer vitamin D response. A hypothetical alignment of the nucleotide sequence of the vitamin D-responsive region in both the rat and human genes is illustrated. Suggested domains within the region are indicated by over- or underlines for the promoter sequences and designated Dl- 04. Asterisks indicate guanine nucleotide contacts with the VDR in the human promoter and a l,25-(OH)sDa-sensitive protein in the rat promoter. Domains 1 and 2 in the human sequence and domain 3 in the rat sequence are unique.

liuman

Dl D2 D3 D4

* * l * * *

5’-GGTGACTCACCGGGTGAACGGGGGCA’T’TGCGAGGC CCACTGAGTGGCCCACTTGCCCCCGTAACGCTCCG -510

Rat /II

-476

* * l * l

5’-TGCCCTGCACTGGGTGAATGAGGACATTACTGACC

ACGGGACGTGACCCACTTACTCCTGTAATGACTGG -466 -434

distal element represents a common response element that mediates both basal as well as vitamin D activation. As the evaluation of VDRE wild-type and mutant sequences was performed exclusively within the context of the MTV-LTR, it is possible that the promoter environment of the MTV- LTR leads to an altered emphasis of receptor-binding sites in the VDRE sequence or enhanced inducibility from low affinity binding sites that produced results that diverged from those described here. It is worth noting, however, that our studies have revealed that guanine nucleotide -487 is a contact nucleotide for VDR activation. Thus, only an oligonucleotide that extends from -512 to -485 is capable of reconstituting wild-type vitamin D induction in phOC-838/+10(A 518/483).’ The oligonucleotide used by Schule et al. (1990) extended 3’ only to nucleotide -489, and when reconstituted into the above promoter conferred at best only weak hormonal response. Thus, it is likely that the latter sequence, or indeed certain AP-1 consensus sequences alone, may represent par- tial or low affinity sites for the VDR, and are therefore inducible by vitamin D only in the context of a highly sensitive promoter such as the MTV-LTR.

Only the Proximal Vitamin D-responsive Element Is Con- served in the Rat and Human Osteocalcin Promoters: Impli- cation for Mechanism-Further insight into the structure of the proximal element in the human osteocalcin promoter derives from a sequence comparison with the rat osteocalcin promoter VDRE homolog. A 36-base pair element with three repeats was recently defined functionally in the rat gene by Demay et al. (1990). These investigators proposed that the repeats in that element (indicated by domains 01-03 in Fig. 6) corresponded to the three repeats (01-03) found in the human gene. Closer inspection of the sequence, however, reveals an alternative comparison in which domains 1 and 2

’ K. Ozone, unpublished data.

Dl D2 D3

of the rat sequence are aligned with domain 3 as well as a fourth (04) in the human sequence. In that comparison, 14/ 17 bases are identical between the two paired domains. Mar- kose et al. (1990) revealed that nuclear extracts of ROS cells treated with 1,25-(OH)2D3 contain a protein that makes contact with rat VDRE nucleotides in a fashion similar to that we have defined for the human sequence. The binding pattern suggests that the VDR was involved, although no direct evidence was presented. If so, activation of the rat gene may occur through Dl and D2, both of which are conserved and exhibit a high degree of homology with the human vitamin D-inducible domains D3 and D4. Clearly, however, domains 1 and 2 in the human sequence that comprise the AP-1 site are not apparent in the rat sequence, suggesting simply the convergence in the human promoter of two independently functioning cis elements.

The rat sequence provides additional clues as to the steroid hormone response element-like structure of the VDRE. Two degenerate but direct repeats separated by a three-base-pair gap exist in both rat and human sequences that form the consensus structure AGGT(G/C)A, highly reminiscent of natural steroid response elements. The identity between these VDRE sequences and that of the thyroid hormone response element AGGT(C/A)A (Brent et al., 1989a) in the growth hormone promoter as well as response elements for retinoic acid (Umesono et al., 1988, de The et al., 1990) are evident. This similarity is particularly interesting since the VDRE in the human OC gene is capable of mediating retinoic acid (Pike, 1990; Schule et al., 1990) but not thyroid hormone3 response in cells cotransfected with either retinoic acid or thyroid hormone receptors. Clearly, an additional level of specificity must be exerted both through the promoter itself and within the cell. Perhaps additional nuclear proteins par-

‘J. W. Pike, unpublished data.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


ticipate in the binding of the VDR to its response element. Regardless of the specificity, the fact that the VDRE is composed of two direct repeats suggests that the mechanism of binding may be different than that for the glucocorticoid or estrogen receptors, both of which often bind as homodimers (Kumar and Chambon, 1988; Tsai et al., 1988).

Synergism between the Proximal and Distal Elements and Control of Cell Growth-Despite the separate nature of the distal and proximal elements of the VDRE locus within the human OC promoter, it is clear that the presence of both are required for maximal promoter activity in the presence of vitamin D. Thus, these elements together form a locus that is responsive to both vitamin D and retinoic acid-activated nuclear receptors and whose overall activity is in turn modu- lated by physiologic factors that function through the nuclear AP-1 family. As such, it is conceivable that this site represents the focus of action of two quite different classes of regulatory factors, those capable of promoting cellular differentiation such as 1,25-(OH)2D3 (Abe et al., 1981; Hosomi et al., 1983) and retinoic acid (Strickland and Mahdavi, 1978, Breitman et al., 1980) and those whose activities lead to the stimulation of cell growth and division such as the proto-oncogenes c-jun and c-fos. This element, therefore, provides a direct mechanism for cross-communication wherein the actions of funda- mentally opposing factors can converge to coordinate the expression of a single gene. Thus, the unique transcriptional regulation of this gene promoter provides an interesting par- adigm for examining transcriptional control of cellular prolif- eration and differentiation.

REFERENCES

Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yarnazaki, T., Yoshiki, S., and Suds, T. (1981) Proc. N&l. Acad. Sci. U. S. A. 78, 4990- 4994

Angel, P., Imagawa, M., Chiu, R, Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karm, M. (1987) Cell 49, 729-739

Angel, P., Hattori, K., Smeal, T., and Karin, M. (1988) Cell 55,875-885 Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J.,

Haussler, M. R., Pike, J. W., Shine, J., O’Malley, B. W. (1988) Proc. NatI. Acad. Sci. U. S. A. 85,3294-3298

Be&o, M. (1989) Cell S&335-344 Breitman. T. R.. Selonick. S. E.. and Collins. S. J. (1980) Proc. N&l. Acad. Sci.

15’. S. A: 77, i936-2940’ Brent, G. A., Harney, J. W., Chen, Y., Warne, R. L., Moore, D. D., and Larsen,

P. R. (1989a) Mol. Endocrinol. 4,3-12.19962004 Brent, G. A., Larsen, P. R., Harney, J. W., Koenig, R. J., and Moore, D. D.

(1989b) J. Biol. Chem. 264, 178-182 Bohmann, D., Bos, T. J., Admon, A., Nishimura, T., Vogt, P. K., and Tjian, R.

(1987) Science 238.13861392 Buetti, E., and Kuhn&l, B. (1986) J. Mol. Biol. 190, 379-389 Chiu, R., Angel, P., and Karin, M. (1989) Cell 59,979-986 Curran, T., and Franza, B. R., Jr. (1988) Cell 55, 395-397 de The, H., de1 Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H., and

Dejean, A. (1990) Nature 343,177-180 Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990)

Proc. N&l. Acad. Sci. U. S. A. 87, 369-373 De Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S.

(1987) Mol. Cell. Blot. 7,725-737 Evans, D. B., Russell, R. G. G., Brown, B. L., and Dobson, P. R. M. (1989)

Biochem. Biophys. Res. Commun. 164,1076-1085 Evans, R. M. (1988) Science 240,889-895 Freedman, L. P., Luisi, B. F., Korszun, Z. R., Basavappa, R., Sigler, P. B., and

Yamamoto, K. R. (1988) Nature 334,543-546

Freedman, L. P., Yoshinaga, S. K., Vanderbilt, J. N., and Yamamoto, K. R. (1989) Science 245.298-301

Gentz, R., Rauscher, F. J., III, Abate, C., and Curran, T. (1989) Science 243, 1695-1699

Glass, C. K., France, R., Weinberger, C., Albert, V. R., Evans, R. M., and Rosenfeld, M. G. (1987) Nature 329,738-741

Gormsn, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051

Halasonetis, T. D., Georgopoulos, K., Greenberg, M. E., and Leder, P. (1988) Cd56,917-924

Hendrickson, W., and Schleif, R. (1985) Proc. N&l. Acad. Sci. U. S. A. 82, 3129-3133

Hosomi, J., Hosoi, J., Abe, E., Suds, T., and Kuroki, T. (1983) Endocrinology 113,1950-1957

Jensen, E. V., Suzuki, T., Kawashima, T., Stumpf, W. E., Jungblut, P. W., and DeSombre, E. R. (1968) Proc. N&l. Acad. Sci. U. S. A. 59,632-638

Kalff, M., Gross, B.,,and Beato, M. (1990) Nature 344,360-362 Kawai, S., and Nishizawa, M. (1984) Mol. Cell. Biol. 4,1172-1174 Kerner, S. A., Scott, R. A., and Pike, J. W. (1989) Proc. N&l. Acad. Sci. U. S.

A. 06,4455-4459 Klein-Hitpass, L., Schorpp, M., Wagner, U., and Ryffel, G. U. (1986) Cell 46,

1053-1061 Klein-Hitpass, L., Ryffel, G. U., Heitlinger, E., and Cato, A. C. B. (1988) Nucleic

Acids Res. 16,647-663 Klein-Hitpass, L., Tsai, S. Y., Weigel, N. L., Allan, G. F., Riley, D., Rodriguez,

R., Schrader, W. T., Tsai, M-J., and O’MaIley, B. W. (1990) Cell 60, 247- 257

Klock, G., Strahle, U., and Schutz, G. (1987) Nature 329, 734-736 Kumar, V., and Chambon, P. (1988) Cell 55,145156 Kunkel, T. A. (1985) Proc. NatI. Acad. Sci. U. S. A. 82,488-492 Lee, W., Mitchell, P., and Tjian, R. (1987) Cell 49, 741-752 Lian, J. B., Coutts, M., and Canalis, E. (1985) J. Biol. Chem. 260.8706-8710 Liao, J., Ozone, K., Sone, T., McDonnell, D. P., and Pike, J. W. (1990) Proc.

N&l. Acad. Sci. U. S. A., in ress Lucibello, F. C., Lowag, C., J euberg, M., and Muller, R. (1989) Cell 69, 999-

1007 Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 15, 13 McDonnell, D. P., Pike, J. W., Drutz, D. J., Butt, T. R., and O’Malley, B. W.

(1989a) Mol. Cell. Biol. 9, 3517-3523 McDonnell, D. P., Scott, R. A., Kerner, S. A., O’MaIley, B. W., and Pike, J. W.

(1989b) Mol. Endocrinol. 3,635-644 Majeska, R. J., and Rodan, G. A. (1982) J. Biol. Chem. 25’7,3362-3365 Markose, E. R., Stein, J. L., Stein, G. S., and Lian, J. B. (1990) Proc. Natl.

Acad. Sci. U. S. A. 87, 1701-1705 Muegge, K., Williams, T. M., Kant, J., Karin, M., Chiu, R., Schmidt, A.,

Siebenlist, U., Young, H. A., and Durum, S. K. (1989) Scrence 246,249-251 Nakabeppu, Y., Ryder, K., and Nathans, D. (1988) Cell 55.907-915 O’MaIley, B. W. (1990) Mol. Endocrinol. 4, 363-369 O’Malley, B. W., Towle, H. C., and Schwartz, R. J. (1977) Anno. Reu. Genet.

11,239-275 Omdahl, J. L., and DeLuca, H. F. (1973) Physiol. Reu. 63.327-372 Pike, J. W. (1984) J. Biol. Chem. 259,1167-1173 Pike J. W. (1990) in Calcium Re u&ion and Bone Metabolism (Cohn, D.V.,

Glbrieux F. H., and Martin, %. Amsterdam

J, eds) Vol. 10, pp. 127-136, Elsevier,

Price, P. A., and Baukol, S. A. (1980) J. Biol. Chem. 255, 11660-11663 Risse, G., Jooss, K., Neuberg, M., Bruller, H-J., and Muller, R. (1989) EMBO

J. 8,3825-3832 Rowe, D. W., and Kream, B. E. (1982) J. Biol. Chem. 257,8009-8015 Saneer. F.. Nicklen. S.. and Coulson. A. R. (1977) Proc. N&l. Acad. Sci. U. S.

A-74,5463-546? Sassone-Corsi, P., Sisson, J. C., and Verma, I. M. (1988) Nature 334,314-319 Schule, R., Kazuhiko, U., Mangelsdorf, D., Bolado, J., Pike, J. W., and Evans,

3) Cell 61,497-504 R. M. (199t Schfitte, J., \

Cell 59,987-997 liallet, J., Nau, M., Segal, S., Fedorko, J., and Minna, J. (1989)

Shapiro, D., Sharp, P. A., Wahli, W. W., and Keller, M. (1988) DNA 7,47-55 Sane, T., Scott, R. A., Hughes, M. R., Malloy, P. J., Feldman, D., O’Malley, B.

W., and pike, J. W. (19841 .I Rid fhom C?fid 3n3RL3n3.14 SOY T., McDonnell, I

_ _ _ “ , - . I - “ “ . _ . I . . _ . - - - , I - - - - I - - ” _

1. P., O’Malley, B. W., and Pike, J. W. (1990) J. Biol. !hem.,266,21997-22003 shle. V.. Klock. G.. and Schutz. G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,

Strickland, S., and Mahdavi, V. (1978) Cell 15, Tsai, S. Y., Carlstedt-Duke, J. A., Weigel, N. L

393-403

A., Tsai, M. J., and G’Malley, B. W. (1988) C Tsai, S. Y., Tsai, M. J., and 0 Malley, B. W. (1: Turner, R., and Tjian, R. (1989) Science 243, 1 Umesono, K., Giguere, V., Glass, C. K., Rosen

(1988) Nature 336,262-265

,., Dahlman, K., Gustafsson, J. elf F&,361-369 #89)Cell57,443-448 689-1694 feld, M. G., and Evans, R. M.

Verma, I. M., and Sassone-Corsi, P. (1987) Cell 51,513-514 Yamamoto, K. R. (1985) Annu. Reu. &net. 19, 209-252


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

K Ozono, J Liao, S A Kerner, R A Scott and J W Pikea nuclear proto-oncogene enhancer.

The vitamin D-responsive element in the human osteocalcin gene. Association with

1990, 265:21881-21888.J. Biol. Chem.

http://www.jbc.org/content/265/35/21881Access the most updated version of this article at

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/265/35/21881.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/content/265/35/21881

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;265/35/21881&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/265/35/21881

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=265/35/21881&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/265/35/21881

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/265/35/21881.full.html#ref-list-1

http://www.jbc.org/

Documents

The Vitamin D-responsive Element in the Human Osteocalcin Gene