Tissue-specific somatic stem-cell isolation and ...en.prc.sbmu.ac.ir/uploads/181_4814_1486797464417_23-e.pdf · characterization from human endometriosis. Key roles in the initiation

Vol. 106 - No. ?? MINERVA MEDICA 1

in endometriosis endometrial and endometri-osis are such a informative tools to study of pathogenesis of gynecological diseases. Fur-thermore, endometrial stem/progenitor cells which easily obtain from tissue may be valua-ble targets for early diagnosis of endometrial disorders in the future.Key words: Endometrium - Endometriosis - Stem cells.

Human endometrium is a highly dynam-ic tissue, undergoing periodic growth

and arrested development at each menstru-al cycle.1, 2 Endometriosis is a benign, com-mon, chronic condition characterised by many distressing and debilitating symptoms as well as dyspareunia, pelvic pain, dys-menorrhea, and also infertility. Epidemio-

1Proteomics Research Center, Faculty of Paramedical Sciences,

Shahid Beheshti University of Medical Sciences, Tehran, Iran

2Tissue Engineering Department, Faculty of Advanced Medical Technologies,

Tehran University of Medical Sciences, Tehran, Iran

3Hematology Department, Tarbbiat Modares University, Tehran, Iran

4Ophthalmic Research Center, Shahid Beheshti University of Medical Sciences,

Tehran, Iran5Department of Gynecology and Obstetrics,

Tehran University of Medical Sciences, Tehran, Iran

????MINERVA MED 2015;106:1-2

S. HEIDARI-KESHEL 1, M. REZAEI-TAVIRANI 1, J. AI 2, M. SOLEIMANI 3

A. BARADARAN-RAFII 4, M. EBRAHIMI 2, R. ROOZAFZOON 2

S. RAHMANZADEH 1, R. RAEISOSSADATI 1, R. OMIDI 1, Z. GHANBARI 5

Tissue-specific somatic stem-cell isolation and characterization from human endometriosis. Key roles in the initiation of endometrial proliferative disorders

Aim. The endometrial-proliferation related diseases leads to endometrial hyperplasia, i.e., endometriosis. Endometrial progenitor and stem cells play key roles in the begin-ning of endometrial proliferative disorders. The purpose of this study was the isolation of stem cells in the endometriosis lesion as well as the evaluation and comparison of the stemness-related target genes in endometrio-sis endometrial stem cells (EESCs), normal endometrial stem cell (ESCs), endometrial lesions stem cell (ELSCs) and bone marrow mesenchymal stem cells (MSCs).Methods. EESCs, ESCs, ELSCs and MSCs were isolated. Flowcytometry and real-time PCR were utilized to detect the cell surface marker and expression pattern of 16 stem-ness genes. The proliferation of all stem cells was observed by MTT assay. The differentia-tion potential was evaluated by alizarin red, oil red O and RT-PCR method. The karyotyp-ing was performed on EESCs and ELSCs at passage 20.Results. The unique patterns of gene expres-sion were detected although EESCs, ESCs, ELSCs and MSCs have a background expres-sion of stemness-related genes. Spindle-like morphology, normal karyotype, adipogenic and osteogenic potential, significantly ex-pression of Oct4, SALL4, DPPA2, Sox2, Sox17 and also specific surface markers such as CD44, CD105, CD90, CD73 and CD146 in EESCs and ELSCs was observed.Conclusion. According to our data, stem cells

Corresponding author: M. Rezaei-Tavirani, Proteomics Research Center, Shahid Beheshti University of Medical Sci-ences, Tajrish Sq, Darband Street, Shahid Beheshti Univer-sity of Medical Sciences, 1985717443, Tehran, Iran. E-mail: [email protected]

Anno: 2015Mese: ??Volume: 106No: ??Rivista: MINERVA MEDICACod Rivista: MINERVA MED

Lavoro: 3880-MMEDtitolo breve: Tissue-specific somatic stem-cell isolation and characterization from human endometriosisprimo autore: HEIDARI-KESHELpagine: 1-2

3880-MMED

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28

2 MINERVA MEDICA ?? 2015

HEIDARI-KESHEL TISSUE-SPECIFIC SOMATIC STEM-CELL ISOLATION AND CHARACTERIZATION FROM HUMAN ENDOMETRIOSIS

malignant, non-ovarian endometriosis geni-talis externa have been published in litera-ture.13, 14 Additionally in 70 proven cases en-dometriosis prepared the ground for ovarian cancer.15 A sarcomatous degeneration of en-dometriosis is supposed to be an extremely rare event that happens due to malignant degeneration of cytogene stroma compo-nents.16 However, the combined appearance of endometriosis and epithelial or non-ep-ithelial neoplasm should not immediately lead to the conclusion of malignant metapla-sia of endometriosis. A coincidence of ovar-ian endometriosis and endometrioid ovarian cancer occurs in about 11-28% o cases.17

In our previous study, purification and identification of CD146 positive endometri-al somatic stem cell from the human normal endometrium biopsy was reported.18 In this study, we have characterized the expression of 16 stemness-related target genes and stem cell surface marker in endometriosis endometrial stem cells (EESCs), normal en-dometrial stem cell (ESCs), endometrial le-sions stem cell (ELSCs) and bone marrow mesenchymal stem cell (MSCs) groups.

Among these genes, BMI1 (BMI1 poly-comb ring finger oncogene) plays a central role in the inheritance of stemness. BMI1 belongs to the polycomb group (PcG) genes and is involved in the maintenance of cellular memory through epigenetic chro-matin modifications. Recent studies have implicated a role for PcG genes in the self-renewal of stem cells, a process in which cellular memory is maintained through cell division (19). ERAS (ES cell expressed Ra) encode a Ras-membrane protein involved in proliferation and tumorigenicity of em-bryonic stem cells.20 TCL1 (T-cell leukemia/lymphoma 1A) is an oncogene involved in regulation of proliferation of embryonic stem cells and is a downstream gene ofO-CT4 (POU class 5 homeobox 1 [POU5F1, also known as OCT4]).21 UTF1 (undifferen-tiated embryonic cell transcription factor 1) encodes a tightly DNA-associated protein with transcriptional repressor activity and is expressed in embryonic pluripotent stem cells.22 All the other genes we analyzed, in-cluding OCT4, SOX2 (SRY [sex determining

logical studies shows nearly 6-10% of wom-en suffered from endometriosis around the world.3 Although there is well-established confirmation that endometriosis is consid-ered as a benign disease, it is correlated with the features of cancer cells, increased risk of malignant transformation in a neoplastic processes in approximately 1% of affected women with the entanglement of multiple developmental pathways.3 Increasing evi-dence supported a key contribution of dif-ferent stem/progenitor cell populations not only in the cyclic regeneration of eutopic endometrium, but also in the pathogenesis of some types of endometriosis.4, 5

Furthermore, in the majority of tumors stem/progenitor cells have been investigat-ed as a distinct population of cells named cancer stem cells. It is a hypothesis endo-metriosis have some similarities with can-cerous tissues including uncontrolled mi-gration and formation of a tissue implants in wrong places. In this regards, endome-triosis may be a condition between nor-mal tissue and cancer state. Identification of the stem cells isolated in patients with endometriosis can be a worthier target in studying the evolution of cancer stem cells. As it is well known, there are some mo-lecular alterations in tissue-specific stem cells that lead to a cancer stem cell. With the emphasis on these valuable stem cells, the endometrial stem cells can be a power-ful candidate in cell therapy. Moreover, pro-posed hypothetical causes of endometriosis include: retrograde menstruation, lymphatic and vascular metastases, iatrogenic direct implantation, coelomic metaplasia, embry-onic rest, and mesenchymal cell induction. Each theory, individually, fails to account for all types of endometriotic lesions, thereby implicating combined and/or type-specific mechanisms.6-8 Recent evidence supports the presence of endometrial stem/progeni-tor cells and their possible involvement in eutopic endometrial regeneration and dif-ferentiation.9-12

Interestingly, an additional novel mecha-nism for the origin of endometriotic lesions is that they arise from ectopic endometrial stem/progenitor cells. Less than 50 cases of

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28


TISSUE-SPECIFIC SOMATIC STEM-CELL ISOLATION AND CHARACTERIZATION FROM HUMAN ENDOMETRIOSIS HEIDARI-KESHEL

undergoing surgery for fibroids and who did not take exogenous hormones for three month prior to surgery. All endometriotic tissue specimens were obtained from endo-metriotic ovarian cysts (N.=6; mean age, 28 years, range 18-36 years). The presence of endometriosis was examined either clinical-ly or by ultrasound scrutiny and confirmed by the surgical findings and the postopera-tive pathological study. The patients were undergoing hysterectomy, laparoscopy, or laparotomy for benign pathologies. The pa-tients with irregular menstruation, steroid treatment, or who had received hormonal treatment for at least three months before the studies were excluded. Full thickness endometrium attached to 5 mm myome-trium was collected in the transfer media containing DMEM/HamsF-12, 4X Pen/Step antibiotics and 5% FBS (Gibco, USA), at 4 °C. Bone marrow mesenchymal stem cell was obtained from five healthy females that voluntarily donated their BM for allogene-ic hematopoietic stem cell transplantation (Talrghani hospital, Behesjti University of Medical Sciences) for which they gave writ-ten informed consents (Table I).

Isolation and culture of stem cells

Tissue samples were located in a Petri dish and hashed into small pieces (2 mm3) in the presence of Ca2+/Mg2+-free PBS and 4X Penicillin/Streptomycin (Gibco®, Life Technologies Europe BV, Monza, MB, Italy). The human stromal endometrium tissues were digested by 1 mg/mL collagenase A (Gibco®) in HEPES-buffered saline for 4 h at 37 °C with gentle pipetting every 15 min.

region Y]-box 2), SOX15 (SRY [sex deter-mining region Y]-box 15), NANOG (Nanog homeobox), SALL4 (sal-like 4), DPPA2 (developmental pluripotency associated 2), GDF3 (growth differentiation factor 3), ZFP42 (zinc finger protein 42 homolog), and KLF4 (Kruppel-like factor 4), code for transcription factors for genes involved in the preservation of stem cell pluripotency. Evidence on transcriptional profiling of stem cells indicate identification of poten-tially stemness-related genes which actively involved in the control of stem cell fates, as well as self-renewal ability and also reten-tion of an uncommitted state. Taking all to-gether, our hypothesis proposes that endo-metrial progenitor and stem cells may play key roles in the onset of these endometrial proliferative disorders. Furthermore, in en-dometriosis, endometrial stem /progenitor cell’s stemness- related genes may alter and start to establish endometriotic lesions.

Materials and methods

Patients and samples

The investigation was approved by the ethics committee of Beheshti University of Medical Sciences and written informed con-sent for participation in the study was ob-tained from each subject at the Department of Gynecology, Obstetrics and Reproduc-tive Medicine of the Vali-asr hospital, Teh-ran University of Medical Sciences. Human endometrium was obtained from hysterec-tomy samples collected from six women, aged 20-46 years (mean, 30±3.8 [±SEM])

Table I.—� Clinical characteristics of each patient.

Age Stem cell separation Phase Sample

Normal tissue Case 1 Secretory Successful 21Case 2 Proliferative Successful 22Case 3 Proliferative Fail 34Case 4 Secretory Successful 23Case 5 Proliferative Successful 26

Endometriotic ovarian Case 1 Stage 1 Successful 18Case 2 Stage 4 Successful 30Case3 Stage 3 Successful 36Case 4 Stage 1 Fail 25Case 5 Stage 2 Successful 22

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



x 106 cells were washed with HBSS+2%BSA two times and incubated with the specific antibody at concentrations recommended by the respective manufacturer. The CD44, CD105, CD90, CD146, CD133, CD31, CD34, CD45, and CD73 antibodies were utilized (abcam, Miltenyi Biotech and R&D Sys-tems). Primary antibodies were added to PBS at the concentrations recommended by the manufacturer. Incubation was executed for 30 minute. Cells were then washed twice in T-PBS. Secondary antibodies with fluo-rescent conjugates were afterwards diluted in T-PBS at the concentrations suggested by the manufacture instructions. Incubate was executed for 20 minute and cells were checked using flowcytometry (Becton Dick-inson, Germany and BD Biosciences Inc.).

Karyotype analysis

EESCs and ELSCs were collected at 80% confluence and resuspended in 10 µL of col-cemid per mililiter of media. Cells were in-cubated at 37 °C for 4 hours then cells were resuspended in 0.5 mL medium and mixed with 0.075 M KCl to a volume of 10 mL. Af-ter incubation for 15 min at 37 °C in a water bath cells were resuspended to in a total of 10 mL fixative agent (methonal:acetic acid, 3:1). G-banding was performed by equili-brating the slides in 0.3 M sodium citrate, containing 3 M NaCl for five minutes and subsequent addition of two drops of Anti-fade per slide prior to visualization (LabPro CETI, OXFORD).

Adipogenic differentiation

EESCs, ESCs, ELSCs and MSCs were seed-ed at a concentration of 4 × 104 cells/mL in a 6-well pellet (SPL Life Sciences, Korea) with 0.7 mL media per well. When the cells reached 80% confluence, they were moved to Adipogenic Induction Media contain 1 μM dexamethasone, 100 μg/mL 3-isobutyl-1 methylxanthine (IBMX), 5 μg/mL insulin, and 60 μM indomethacine, and 10% FBS in α-MEM (all from Sigma, Germany) and cul-tured for 21 days with media changes every 3-4 days. The control cells were cultured in

Cell suspensions were filtered through a 70-μm and 40-μm sieve (Becton Dickinson, Franklin Lakes, NJ, USA) to separate single cells. Single endometrial cell suspensions were culture and expansion at 37 °C and 5% CO2 incubation. For isolation of bone marrow mesenchymal stem cell, mononu-clear cells (MNCs) were separated following previously report.25 Briefly, bone marrow aspirates after dilution with equal volume of HBSS by standard density (1.077 g/mL) centrifugation using Ficoll (Sigma-Aldrich, St. Louis, MO, USA). The MNCs at the in-terface were recovered, washed, and resus-pended in the medium composed of Dul-becco’s Modified Eagle’s Medium (DMEM) with low glucose, 10% fetal bovine serum (FBS), (all from GIBCO-Invitrogen).

In-vitro colony-forming assay

The clonogenic potential of EESCs, ESCs, ELSCs and bone MSCs (passages 2, 4, 6, 8, and 10) from all donors were tested by a colony-forming unit assay. One-hundred cells were placed on a 35-mm2 dish in a complete medium. Samples were incubated for seven days in a complete medium, and then plates were stained with 3% crystal vio-let in methanol at room temperature for 10 minute. All visible colonies were counted. To assess the cell viability and proliferation of stem cells MTT assay were done. Briefly, the cells were plated in 96-well culture plates at a density of 5 × 103 cells per well for 12, 24 and 48 hours. MTT (5 mg/ml) was added to each well of the monolayer cultures and the cultures were incubated in a humidified 5% CO2 incubator at 37 °C. Three hours later, the cell morphologies and formazan salts were visualized by using an inverted optical mi-croscope. The formazan salts were dissolved with 100 µL DMSO overnight, and the optical density was measured at 575 nm by using a microplate reader (Rayto, Shenzen, China).

Identification of cell phenotypic markers by flowcytometry analyses

For fluorescent antibody cell surface de-tection of EESCs, ESCs, ELSCs and MSCs, 1

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



(Qiagen, Valencia, CA, USA). Total RNA was isolated from the cells using an RNA extrac-tion kit (Fermentas International, Burlington, Canada). RNA samples were treated with DNase I (Fermentas International) in order to avoid the genomic DNA contamination. RNA quantity was assessed by spectropho-tometry (NanoDrop; Thermo, Wilmington, DE, USA). For Reverse transcription 2 µg of total RNA was used with the Revert Aid-first strand cDNA synthesis kit (Fermentas Inter-national). The primer sequences were used are shown in Table II. Real time-PCR reac-tion was performed with SYBR® Premix Ex Taq™ (Takara Bio, Inc., Japan) which uses Taq Fast DNA Polymerase, SYBR Green I dye to detect double-stranded DNA. The reac-tion was performed with following program; 5 min of 95 °C for enzyme activation, initial denaturation for 20 sec at 95 °C, annealing temperature for 40 s, and extension at 72 °C for 1 min, followed by 40 cycles with a final extension at 72 °C. The final stage com-prises the analysis of the melt curve through a denaturing step (15′′ at 95 °C) followed by annealing (1′ at 60 °C) and ramping to 95 °C with 0.3 °C increment/step. Levels of mRNA for tested genes were quantified us-ing ∆∆CT method and normalized against human β-actin as a housekeeping gene.

Statistical analysis

Statistical data analysis were performed by SPSS, independent sample t test and ANOVA to correlate gene expression levels and different categorical data. Moreover, P values <0.05 were considered to be statisti-cally significant.

Results

Isolation of endometrial stromal stem cell

All isolated cell (ESCs, EESCs, ELSCs, MSCs) were spindle-shaped with fibroblast-like morphology, scant cytoplasm and gran-ules around the nuclei, which adhered to the plastic surface of cell culture pleat (Fig-ure 1).

completed DMEM media. For staining dif-ferentiated adipocytes, cells were fixed for 15 minutes at room temperature in 70% ethanol. The cells were incubated in 2% Oil Red O reagent for 1 hour at room tem-perature. The surplus stain was removed by washing with 70% ethanol, followed by several modifications of distilled water and visualized under an inverted phase contrast microscope (LabPro CETI, Oxford, UK).

Osteogenic differentiation

EESCs, ESCs, ELSCs and MSCs were seed-ed at a concentration of 1 × 104 cells/ml in a 6-well pellet (SPL Life Sciences, Korea) with 0.7 ml media per well. After the cells adhere overnight, the medium is altered to the oste-ogenic induction media contain 0.1 µM dex-amethasone, 10 µM β-glycerophosphate, 50 μg/ml ascorbic acid, and 10% FBS in DMEM low glucose (all from Sigma, Germany). The cells were cultured for 21 days with medium changes every 3-4 days. The con-trol cells were cultured in complete DMEM. For Alizarin red S staining (Sigma, Germa-ny), the cells were fixed with 70% ethanol (Merck Chemicals, Millipore, Billerica, MA, USA) and washed with distilled water. The cells were incubated in 2% Alizarin red so-lution for 15 minutes at room temperature, washed several times with distilled water to clear stain. The cells were visualized un-der an inverted phase contrast microscope (LabPro CETI, Oxford, UK).26, 27

Reverse transcriptase-PCR and real time-PCR

RNA preparation and gene expression analysis RT-PCR for osteogenic differentia-tion was performed to evaluate the expres-sion of alkalin phosphatase (ALP), osteo-pontin, osteonectin, PPARa and ß-actin in all four groups of cells. EESCs, ESCs, ELSCs and MSCs associated genes expression as well as Pou5f1, Nanog, KLF4, ERAS, GDF3, DPPA2, SALL4, TCL1, ZFP42, UTF1, BMI1, SOX1, SOX2, SOX10, SOX15, SOX17 was performed by real-time PCR technique us-ing Rotor-Gene Q Real-Time PCR System

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



ic capacities of ESCs were 51±2.4, 79±1.1, 79±1.8, 78±3.1, and 81±0.8 colonies, in ELS-Cs: 60.8±2.6, 83±3.4, 86.5±1.2, 88.9±2.2 and 89±1.1, and then in MSC groups present that: 63±4.6, 67±3.8, 77.6±3.4, 83.3±4.3 and 80±2.1 colonies formed per 100 cells at pas-sages 2, 4, 6, 8, and 10, respectively (Figure 2). MTT results show that, rate of prolifera-tion in EESCs and ELSCs, significantly above from ESCs and MSCs (Figure 3).

Colony-forming unit and MTT assay

Colony-forming unit (CFU) provides a convenient means of assessing the clo-nogenic capacity of EESCs, ESCs, ELSCs, MSCs expanded in culture. The results in-dicate that: EESCs: 68±3.2, 88±2.3, 89±3.5, 88±3.2, and 93±3.6 colonies were formed per 100 cells at passages 2, 4, 6, 8, and 10, respectively. In comparison, the clonogen-

Table II.—� Primer sequence.

Gene name Sequence 5→3 Tm

ALP Forward: ACCATCTTTCTGCTCACTCTGReverse: GTGATACCATAGATGCGTTTGTAG

60

Osteopontine Forward: CAGTGATTTGCTTTTGCCTGTTTGReverse: GGTCTCATCAGACTCATCCGAATG

60

Osteonectin Forward: GGCAGTAGTGACTCATCCGAAGAAReverse: GGT ACT GGT GCC GTT TAT GCC TTG

61

PPAR-a Forward: ATGGTATGATGTGCAGAGTGTAGReverse: CACACATCATGTTAATGGTGAC

59

Beta-actin Forward: TCCCTGGAGAAGAGCTACGReverse: GTAGTTTCGTGGATGCCACA

61

Nanog Forward: GAAATCCCTTCCCTCGCCATCReverse: CTCAGTAGCAGACCCTTGTAAGC

60

Pou5f1 Forward: TCAGGTTGGACTGGGCCTAGTReverse: GGAGGTTCCCTCTGAGTTGCTT

60

KLF4 Forward: TTGGACCCGGTGTACATTCCReverse: TGGCATGAGCTCTTGGTAATGG

60

ERAS Forward: CACGGACACAGAGCCTGCReverse: CGGGTCTTCTCCCTACAGGA

60

GDF3 Forward: TGAATTGTTGGGCAGTCTGGCAReverse: GGCGCCTTATCTAAGCCCAG

60

DPPA2 Forward: CGGGACTGGTGTCAACAACTReverse: ATCTTGCCGTTGTTCAGGGT

62

SALL4 Forward: GGCGGAGAGGGCAAATAACTReverse: CACTGGAGCACCCAGCTC

61

TCL1 Forward: CCCGGATATAAAGGGTCGGCReverse: AGGTGCTGCCAAGACCATAC

60

ZFP42 Forward: CTCACAGTCCAGCAGGTGTTReverse: CACCCTTCAAAAGTGCACCG

59

UTF1 Forward: GACCAGCTGCTGACCTTGAAReverse: CATACCCAAGAACGGGGGTG

60

BMI1 Forward: AGAGATCGGGGCGAGACAAReverse: CCGATCCAATCTGTTCTGGTCA

60

SOX1 Forward: CAACCAGGACCGGGTCAAACReverse: CCTCGGACATGACCTTCCAC

59

SOX2 Forward: GGGGAAAGTAGTTTGCTGCCReverse: TAACTGTCCATGCGCTGGTT

59

SOX10 Forward: TCCACCTCACAGATCGCCTAReverse: GGTCAGAGATGGCCGTGTAG

58

SOX15 Forward: CGACTACAAGTACCGGCCTCReverse: TTGCAGTGGGAAGAGCCATAG

60

SOX17 Forward: TGGGTACGCTGTAGACCAGAReverse: ACGACTTGCCCAGCATCTTG

60

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



Osteogenic differentiation in EESCs, ESCs, ELSCs and MSCs was also investigat-ed. Cells were cultured in the presence of a high concentration of dexamethasone and β-glycerophosphate. These cells exhibited osteocyte phenotypes as evidenced by aliz-arin red staining (Figure 5A). As measured by RT-PCR, the expression of Osteonectin, osteopontin, and alkalin phosphatase after 21 days of osteogenic induction (Figure 5B).

Karyotype result for EESCs and ELSCs

Karyotype analysis was performed on EESCS and ELSCs at passage 20. After 20 continuous passages, the karyotype of EESCs and ELSCs was normal (46XX) (Figure 6).

Real time PCR analysis of stemness-related genes

We evaluated the expression of a set of 16 stemness-related genes (Pou5f1, Nanog, KLF4, ERAS, GDF3, DPPA2, SALL4, TCL1,

Immunophenotypic results

The immunophenotype of the EESCs, ESCs, ELSCs and MSCs cultures was investi-gated via flowcytometry. All cells were high-ly positive for the surface antigens CD146, CD73, CD90, and CD105. On the contrary, cells were negative for CD34, CD31, CD133 and CD45 (Figure 4).

Adipogenic and osteogenic differentiation

In previous studies, including ours, un-restricted somatic stem cells (USSC) were successfully isolated from umbilical cord blood and induced to differentiate into me-sodermal lineages.23 Following the proto-cols used in the aforementioned studies, We could differentiate EESCs, ESCs, ELSCs and MSCs into adipocytes after 21days of cul-ture in adipogenic medium, as confirmed by positive staining with oil red O (Figure 5A) and upregulated expression of PPARa mRNA (Figure 5B).

Figure 2.—CFU assays of endometrial stromal stem cells: EESCs, ESCs, ELSCs and MSCs. The results showed that number of colonies was formed per 100 cells at passages 2, 4, 6, 8, and 10, respectively.

Figure 1.—The morphologies of Endometriosis endometrial stem cells (EESCs), normal endometrial stem cell (ESCs), endometrial lesions stem cell (ELSCs) and bone marrow Mesenchymal stem cell (MSCs). Individual spindle shaped fibroblastic are also visible were continuously cultured (for 20 passages). Scale bar, 50 µm.

Figure 3.—MTT assay result for rate of proliferation of four groups, EESCs, ESCs, ELSCs and MSCs in 12, 24 and 48 h continuously culture.

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



Figure 5.—Adipogenic differentiation revealed by oil red O staining. Cells were stained with oil red O on 14 and 21 days. Osteogenic differentiation reveled by alizarin red s staining on 21 day (A). The expression levels of transcription factors on stepwise Osteogenesis and adipogenesis of endometrial stromal stem cells: EESCs, ESCs, ELSCs and MSCs. Cells were cultured on the osteogenic and adipogenic medium. After culture for 3 weeks, gene expression level was measured using reverse transcriptase-PCR analysis (B). (Scale bar, 100 µm).

Figure 4.—Flowcytometry analyses revealed that EESCs (A), ESCs (B), ELSCs (C) and MSCs (D) were positive for sur-face markers CD146, CD73, CD105, CD90, but negative for CD133, CD45, CD34 and CD31.

A

A

C

DB

B

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



Figure 6.—Karyotype analysis of EESCs and ELSCs. A: Karyotype analysis of EESCs at passage 20 represented a normal 44XX karyotype. B: Karyotype analysis of ELSCs at passage 20 represented a normal 44XX karyotype.

A

B

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



four category of cell samples. We highlight-ed the possible presence of stem cells in all the endometrium and endometriotic sam-ples through the expression of stemness-related genes such as Oct4, Nanog, KLF4, ERAS, GDF3, DPPA2, SALL4, TCL1, ZFP42, UTF1, BMI1, SOX1, SOX2, SOX10, SOX15 and SOX17.

Oct4, Sox17 and Sox2 genes showed a lower percentages of expression in ESCs and MSCs samples. Conversely, Nanog, SALL4, KLF4 and BMI1 mRNAs were high-ly expressed in ESCs and MSCs group as a healthy samples. Other gene, Sox17 were found to be expressed in ELSC. Sox10 showed a higher frequency of expres-sion in MSC than in another groups. In this expression pattern all OCT4, DPPA2, SALL4, SOX2, SOX17genes was statistically significant (P<0.05) (Table III). No signifi-cant differences were observed in the ex-pressed genes between the four groups of samples, such as ERAS, BMI1, ZFP42, Sox15, UTF1, TCL1 and KLF4. Moreover, results indicated that GDF3 mRNA was not expressed in any of the samples and

ZFP42, UTF1, BMI1, SOX1, SOX2, SOX10, SOX15 and SOX17) in EESCs, ESCs, ELSCs and MSCs samples by Real-Time PCR meth-od. Overall results are indicated in Figure 7. The remaining genes we examined (Oct4 and Sox2) showed higher percentages of expression in EESCs samples. Conversely, Nanog, SALL4, ZFP42 and Sox1 mRNAs were expressed in ESCs. Other genes, such as TCL1, Sox15 and Sox17 were found to be expressed in ELSCs. ERAS and Sox10 showed a slightly higher frequency of ex-pression in MSC than in another group. No significant differences were observed in the number of expressed genes between the four groups of samples, such as BMI1, UTF1, DPPA2 and KLF4. Results pointed out that GDF3 mRNA was not expressed in any of the samples and ZFP42 mRNA not ex-press in EESC and ELSC groups.

Discussion

We characterized the mRNA level of a panel of 16 stemness-related genes in these

Figure 7.—RT-PCR results comparing relative gene expression levels in four cell lines; ESCs (A),EESCs (B), ELSCs (C) and MSCs (D).

A

D

B

C

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



on the level of BMI1 protein. All together, these studies suggest a strong correlation of BMI1 with the differentiation and growth of stem cells.38

According to Figure 7, results indicated that Sox1 in all of the groups except for ESC is down-regulated. The expression of Sox2 in EESCs was higher than ELSCs and MSCs (ELSCs and MSCs had an equal expression) and also ESCs had the minimal expression in comparison to others. Members of the SoxB1 subgroup such as Sox1 and Sox2 are involved in neural induction during em-bryogenesis. Sox1 plays a critical role in the development of neural precursors from un-differentiated embryonic stem cells and em-bryonal carcinoma cultures in vitro. Sox2 associates with Oct3/4 act to maintain self-renewal potency of embryonic stem cells. Above data represent the important role of SoxB1subgroub in function of our four mention class of studied cells.39

Sox17 were strongly expressed in all four groups. Sox17 is required for the mainte-nance of fetal and neonatal HSCs but is dispensable in adult hematopoiesis. A few general conclusions can be drawn from this study and other studies examining different Sox genes in stem/progenitor cells. Further-more, most Sox factors are expressed in multiple stem/progenitor cell types or tis-sues and many Sox factors act redundantly in the maintenance of stem cells.

In this study, we also focused on investi-gating the expression of the developmental pluripotency-associated 2 (DPPA2) gene, which was recently identified to be highly expressed in ES cells. DPPA2 is expressed only in the early embryonic cells, primordi-al germ cells (PGCs) and other pluripotent cells.44 Hence, it is considered as a pluri-potency marker gene.45 Some recent stud-

ZFP42 mRNA not express in EESC and ELSC groups.

As we know, OCT4 is a protein mem-ber of the POU transcription factor fam-ily is expressed in pluripotent cells and its down-regulation is associated with loss of pluripotency;23, 28, 34 accumulation our data and other previous studies show that OCT4 expressed in all the endometrium samples (EESCs, ESCs and ELSCs), but in EESCs its expression was dramatically higher than EL-SCs and ESCs.

SALL4 expression in EESCs and ELSCs groups were similar but it was lower than the ESCs group. Amalia Forte et al, was analyzed the level of SALL4 expression in paired ectopic and eutopic endometrial tis-sue from the patients, identifying SALL4-positive cells were only in ectopic endo-metrium.35 They considered that differential expression of SALL4 between endometrial and endometriotic tissues could not be re-lated to a translational mechanism of reg-ulation of SALL4 expression, but could be depended to the very low amount expres-sion of SALL4 protein in endometrium.35 Unlike the findings by Forte et al., our re-sults showed that SALL4 is highly expressed in normal ESCs.

As it is clear that BMI1 plays crucial role for self-renewal, differentiation, prevention of senescence and immortalize cells. It is reported that Bmi1 plays an important role during proliferation of stem and progenitor cells derived from normal and abnormal en-dometrial stem cell. As it shows in chart 7our result shows that the expression of BMI1 is upregulated in MSCs and ELSCs and also it is downregulated in ESCs, EESCs. More-over, the self-renewal and maintenance of hematopietic stem cells (HSCs) and neural stem cells (NSCs) were reported to depend

Table III.—�Expression pattern of gens was statistically significant (P<0.05).

EESCs ESCs ELSCs MSC

Oct4DPPA2SALL4Sox2Sox17

++++++++++++++++++++++++++

++++++++

+++++++++++++

++++++

+++++

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



netic and epigenetic alterations, including an imbalance of miRNA expression, histone and DNA modifications and also chromo-somal aberrations.

Endometrial stem cells likely play an im-portant role in the physiologic and patho-logic uterine biology. Physiologically, they are supposed to involve in the response to tissue injury and disease. However, they may also be involved in the pathology of the reproductive tract such as endometri-osis. The study of endometrial stem cells is unique as the tissue can be easily ob-tained from discarded sources and may be an untapped supply for developing new cell based therapeutic strategies. Although overall data obtained in this study suggest a possible role of stem cells in the patho-genesis of endometriosis, further meticu-lous investigation is required to support the hypothesis.

References

1. Spencer TE, Dunlap KA, Filant J. Comparative devel-opmental biology of the uterus: insights into mecha-nisms and developmental disruption. Mol Cell Endo-crinol 2012;354:34-53.

2. Gargett CE, Nguyen HP, Ye L. Endometrial regenera-tion and endometrial stem/progenitor cells. Rev En-docr Metab Disord 2012;13:235-51.

3. Benoit L, Arnould L, Cheynel N, Diane B, Causeret S, Machado A et al. Malignant extraovarian endometrio-sis: a review. Eur J Surg Oncol 2006;32:6-11.

4. Liu H, Jiang Y, Jin X, Zhu L, Shen X, Zhang Q et al. CAPN 7 promotes the migration and invasion of human endometrial stromal cell by regulating matrix metalloproteinase 2 activity. Reprod Biol Endocrinol 2013;11:1477-7827.

5. Cervello I, Mirantes C, Santamaria X, Dolcet X, Mat-ias-Guiu X, Simon C. Stem cells in human endometri-um and endometrial carcinoma. Int J Gynecol Pathol 2011;30:317-27.

6. Gargett CE. Uterine stem cells: what is the evidence? Hum Reprod Update 2007;13:87-101.

ies have identified a human homologue of DPPA2, namely DPPA2, which is a cancer/testis (CT) gene expressed in some tumour tissues such as non-small cell lung can-cer.44, 45

In the healthy samples (MSCs and ESCs), Nanog, KLF4, SALL4, BMI1 were up-regulat-ed and Sox17, Sox2 and Oct4 were down-regulated (Table IV). It is evident that, these stem cells, despite of their differences pres-ent specific morphology, expression of sur-face markers specific for mesenchymal stem cells, capability of differentiation, karyotyp-ing and gene expression, follow the same patterns of gene expression. Since cancer cells and ES cells are known to share some common characteristics with regard to self-renewal, proliferation and indefinite growth, we suggest that adult abnormal stem cell arising from mutation(s) and aberrant repair can be contributed to aging and susceptibil-ity to cancer in these self-renewing popula-tions. These Stem cell abnormality may be responsible for initiation of endometriosis and been correlated with impaired stem cell activity.

Conclusions

The contribution of stem cells to endome-triosis has been hypothesized in a lot of stud-ies and reviews.42, 43 The presence of stem cells in endometriosis endometrial and en-dometriosis implant provide a new insights into the basic mechanisms of gynecological diseases which are related to cell prolifera-tion, such as endometrial carcinoma.

Changes in stem cell populations in en-dometriotic lesions are associated with ge-

Table IV.—� Up/Down regulated genes in healthy samples (MSCs and ESCs).

ESCs MSCs

NanogKLF4SALL4BMP1Sox17Sox2Oct4

↑↑↑↑↓↓↓

↑↑↑↑↓↓↓

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



Roodsari M, Ronaghi A, Ebrahimi M et al. The heal-ing effect of unrestricted somatic stem cells loaded in collagen-modified nanofibrous PHBV scaffold on full-thickness skin defects. Artif Cells Nanomed Bio-technol 2014;42:210-6.

25. Zeinali R, Biazar E, Keshel SH, Tavirani MR, Asadi-pour K. Regeneration of full-thickness skin defects using umbilical cord blood stem cells loaded into modified porous scaffolds. Asaio J 2014;60:106-14.

26. Biazar E, Heidari Keshel S, Tavirani MR, Jahandideh R. Bone reconstruction in rat calvarial defects by chi-tosan/hydroxyapatite nanoparticles scaffold loaded with unrestricted somatic stem cells. Artif Cells Na-nomed Biotechnol 2014;23:23.

27. Biazar E, Heidari Keshel S, Rezaei Tavirani M, Ja-handideh R. Bone formation in calvarial defects by injectable nanoparticular scaffold loaded with stem cells. Expert Opin Biol Ther 2013;13:1653-62.

28. Biazar E, Keshel SH. The healing effect of stem cells loaded in nanofibrous scaffolds on full thickness skin defects. J Biomed Nanotechnol 2013;9:1471-82.

29. van den Boom V, Kooistra SM, Boesjes M, Geverts B, Houtsmuller AB, Monzen K et al. UTF1 is a chroma-tin-associated protein involved in ES cell differentia-tion. J Cell Biol 2007;178:913-24.

30. Okuda A, Fukushima A, Nishimoto M, Orimo A, Yamagishi T, Nabeshima Y et al. UTF1, a novel tran-scriptional coactivator expressed in pluripotent em-bryonic stem cells and extra-embryonic cells. Embo J 1998;17:2019-32.

31. Chuva de Sousa Lopes SM, van den Driesche S, Car-valho RL, Larsson J, Eggen B, Surani MA et al. Altered primordial germ cell migration in the absence of transforming growth factor beta signaling via ALK5. Dev Biol 2005;284:194-203.

32. Kristensen DM, Nielsen JE, Skakkebaek NE, Graem N, Jacobsen GK, Rajpert-De Meyts E et al. Presumed pluripotency markers UTF-1 and REX-1 are expressed in human adult testes and germ cell neoplasms. Hum Reprod 2008;23:775-82.

33. Noguchi M, Ropars V, Roumestand C, Suizu F. Proto-oncogene TCL1: more than just a coactivator for Akt. Faseb J 2007;21:2273-84.

34. Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ, Andrews PW. OCT4 spliced variants are differentially ex-pressed in human pluripotent and nonpluripotent cells. Stem Cells 2008;26:3068-74.

35. Forte A, Schettino MT, Finicelli M, Cipollaro M, Co-lacurci N, Cobellis L et al. Expression pattern of stemness-related genes in human endometrial and endometriotic tissues. Mol Med 2009;15:392-401.

36. Yu F, Li J, Chen H, Fu J, Ray S, Huang S et al. Kruppel-like factor 4 (KLF4) is required for maintenance of breast cancer stem cells and for cell migration and invasion. Oncogene 2011;30:2161-72.

37. Rowland BD, Bernards R, Peeper DS. The KLF4 tu-mour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene. Nat Cell Biol 2005;7:1074-82.

38. Siddique HR, Saleem M. Role of BMI1, a stem cell factor, in cancer recurrence and chemoresist-ance: preclinical and clinical evidences. Stem Cells 2012;30:372-8.

39. Alcock J, Sottile V. Dynamic distribution and stem cell characteristics of Sox1-expressing cells in the cere-bellar cortex. Cell Res 2009;19:1324-33.

40. Sarkar A, Hochedlinger K. The sox family of tran-scription factors: versatile regulators of stem and pro-genitor cell fate. Cell Stem Cell 2013;12:15-30.

41. Maruyama M, Ichisaka T, Nakagawa M, Yamanaka S. Differential roles for Sox15 and Sox2 in transcrip-

7. Bongso A, Richards M. History and perspective of stem cell research. Best Pract Res Clin Obstet Gynae-col 2004;18:827-42.

8. Shostak S. (Re)defining stem cells. Bioessays 2006;28:301-8.

9. Maruyama T, Masuda H, Ono M, Kajitani T, Yoshimu-ra Y. Human uterine stem/progenitor cells: their pos-sible role in uterine physiology and pathology. Re-production 2010;140:11-22.

10. Patel AN, Park E, Kuzman M, Benetti F, Silva FJ, Al-lickson JG. Multipotent menstrual blood stromal stem cells: isolation, characterization, and differentiation. Cell Transplant 2008;17:303-11.

11. Schwab KE, Chan RW, Gargett CE. Putative stem cell activity of human endometrial epithelial and stromal cells during the menstrual cycle. Fertil Steril 2005;2:1124-30.

12. Kato K, Yoshimoto M, Adachi S, Yamayoshi A, Arima T, Asanoma K et al. Characterization of side-popula-tion cells in human normal endometrium. Hum Re-prod 2007;22:1214-23.

13. Kato K, Yoshimoto M, Adachi S, Yamayoshi A, Arima T, Asanoma K et al. Characterization of side-popula-tion cells in human normal endometrium. Hum Re-prod 2007;22:1214-23.

14. Shamsuddin AK, Villa Santa U, Tang CK, Mohamed NC. Adenocarcinoma arising from extragonadal en-dometriosis 14 years after total hysterectomy and bilateral salpingo-oophorectomy for endometriosis: report of a case with ultrastructural studies. Am J Ob-stet Gynecol 1979;133:585-6.

15. Kobayashi F, Monma C, Nanbu K, Konishi I, Sagawa N, Mori T. Rapid growth of an ovarian clear cell car-cinoma expressing LH/hCG receptor arising from en-dometriosis during early pregnancy. Gynecol Oncol 1996;62:309-13.

16. Crum CP, Wible J, Frick HC, Fenoglio CM, Richart RM, Williamson S. A case of extensive pelvic endometrio-sis terminating in endometrial sarcoma. Am J Obstet Gynecol 1981;140:718-9.

17. Lan C, Huang X, Lin S, Cai M, Liu J. Endometrial stromal sarcoma arising from endometriosis: a clin-icopathological study and literature review. Gynecol Obstet Invest 2012;74:288-97.

18. Heidari-Keshel S. Purification and identification of CD146 positive endometrial somatic stem cell from human normal endometrium biopsy and gene ex-pression criteria. Artif Cells Nanomed Biotechnol 2014 [in press].

19. Iwama A, Oguro H, Negishi M, Kato Y, Nakauchia H. Epigenetic regulation of hematopoietic stem cell self-renewal by polycomb group genes. Int J Hematol 2005;81:294-300.

20. Kameda T, Thomson JA. Human ERas gene has an upstream premature polyadenylation signal that re-sults in a truncated, noncoding transcript. Stem Cells 2005;23:1535-40.

21. Matoba R, Niwa H, Masui S, Ohtsuka S, Carter MG, Sharov AA et al. Dissecting Oct3/4-regulated gene networks in embryonic stem cells by expression pro-filing. PLoS One 2006;20(1).

22. Kooistra SM, Thummer RP, Eggen BJ. Characteriza-tion of human UTF1, a chromatin-associated protein with repressor activity expressed in pluripotent cells. Stem Cell Res 2009;2:211-8.

23. Keshel SH, Soleimani M, Tavirani MR, Ebrahimi M, Raeisossadati R, Yasaei H et al. Evaluation of unre-stricted somatic stem cells as a feeder layer to sup-port undifferentiated embryonic stem cells. Mol Re-prod Dev 2012;79:709-18.

24. Keshel SH, Biazar E, Rezaei Tavirani M, Rahmati

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28



cancer/testis gene BORIS and the pluripotency struc-tural gene OCT4, in human preimplantation develop-ment. Mol Hum Reprod 2008;14:347-55.

Funding.—This work was supported by the Proteomics Research center (132-1015), and the author’s gratefully ac-knowledge colleagues in proteomics research center (Ma-soumeh Mossavi, Dr naebali ahmadi), Shahid Beheshti Uni-versity of medical sciences. This project is part of the PhD thesis of Saeed Heidari-Keshel.

Conflicts of interest.—The authors certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

Received on April 10, 2014.Accepted for publication on December 15, 2014.

tional control in mouse embryonic stem cells. J Biol Chem 2005;280:24371-9.

42. Sampson JA. Metastatic or embolic endometriosis, due to the menstrual dissemination of endome-trial tissue into the venous circulation. Am J Pathol 1927;3:93-110.

43. Chan RW, Schwab KE, Gargett CE. Clonogenicity of human endometrial epithelial and stromal cells. Biol Reprod 2004;70:1738-50.

44. Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry DL, Yanagimachi R et al. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 2003;130:1673-80.

45. Monk M, Hitchins M, Hawes S. Differential expres-sion of the embryo/cancer gene ECSA(DPPA2), the

PROOF

MIN

ERVA M

EDICA

PROFF ID.indd 1 10/09/10 14:28

Documents

Tissue-specific somatic stem-cell isolation and ...en.prc.sbmu.ac.ir/uploads/181_4814_1486797464417_23-e.pdf · characterization from human endometriosis. Key roles in the initiation