Title: Proteorhodopsin-like genes present in thermoacidophilic high 1

mountain microbial communities 2

3

Running title: Proteorhodopsins diversity in Colombian acidic springs 4

5

Laura C. Bohorquez 1,2, Carlos A. Ruiz-Pérez 1,2 and María Mercedes 6

Zambrano# 1,2 7

8

Affiliations: 9

1 Molecular Genetics, Corporación CorpoGen, Carrera 5 No. 66A-34, 110231, 10

Bogotá DC, Colombia. 11

2 Colombian Center for Genomics and Bioinformatics of Extreme Environments – 12

GeBiX, Carrera 5 No. 66A-34, 110231, Bogotá DC, Colombia. 13

14

#Corresponding author: M.M. Zambrano, Corporación CorpoGen, Carrera 5 No. 15

66A-34, 110231, Bogotá D.C., Colombia. Phone: +571 8050122. Fax: +571 16

3484607. Email: mzambrano@corpogen.org 17

18

19

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01683-12 AEM Accepts, published online ahead of print on 31 August 2012

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Abstract 20

Proteorhodopsin (PR) sequences were PCR-amplified from three Andean acidic 21

hot spring samples. These sequences were similar to freshwater and marine PRs, 22

they contained residues indicative of proton-pumping activity and of proteins that 23

absorb green light, and suggest that PRs might contribute to cellular metabolism in 24

these habitats. 25

26

Keywords: diversity/ hot spring/ phototrophy/ proteorhodopsin 27

28

29

30

Proteorhodopsins (PRs) are retinal-binding bacterial transmembrane light-driven 31

proton pumps that generate energy from light and are considered to play an 32

important role in carbon cycling and energy fluxes in various aquatic ecosystems 33

(3, 4, 7, 8, 10, 16). PR proteins are widespread and abundant in marine and non-34

marine habitats (2, 6, 9, 17, 21, 23) and are tuned to absorb different spectral 35

wavelengths (4, 15, 18). PRs were recently shown to enhance survival and 36

competition of marine Vibrio cells during starvation, consistent with the suggestion 37

that they must have unique functional capabilities (10). 38

39

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

The central Andean mountain range in Colombia is characterized by geothermal 40

activity and the presence of many fumaroles and hot springs located at high 41

altitude (> 3,400 m). A recent analysis of the microbial community in one of these 42

springs, El Coquito, showed the presence of chemolithoautotrophic acidophiles 43

and few phototrophic bacteria, both photoautotrophs and photoheterotrophs, 44

suggesting that primary production can be driven by chemical energy in the water 45

and by solar energy at the surface (5). Given the high exposure to solar light at the 46

surface (approximately 9 -11 mW/cm2 nm UV-B) (12), and the relatively low 47

abundance of phototrophic bacteria identified, we hypothesized that productivity in 48

these ecosystems could also be driven by energy-harvesting bacterial PRs. To 49

explore this possibility, we analyzed the diversity of PRs in several high mountain 50

acidic hot springs by PCR amplification using PR-specific primers. 51

52

Surface water samples were collected at four hot springs (A1, A2, A4 and A5) 53

located in the Nevados National Natural Park and processed as described (5). 54

These springs are all located at high altitudes and are acidic, but they differ in 55

terms of temperature and water characteristics (Table 1). PCR-amplification was 56

carried out using actinorhodopsin primers and six freshwater PR-specific primer 57

combinations (Table 2), as reported (2, 20), using both control plasmid DNA 58

(pCD1,pST84 for actinorhodopsins and pBAD.TA for freshwater primer 59

combinations) (3), and hot spring metagenomic DNAs in 50 µl reaction volumes 60

using 1U TucanTaq® DNA Polymerase (CorpoGen, Bogota, Colombia). 61

Amplification products were gel-purified (QIAquick® Gel Extraction Kit, Qiagen, 62

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Germany), cloned in pCR2.1 TOPO TA kit (Invitrogen, San Diego, CA, USA), 63

transformed into Escherichia coli DH5α cells and individual clones sequenced 64

(Macrogen, Korea). Amplification products were obtained for three hot spring DNAs 65

(A5, A2 and A1) using four different primer combinations. There was no 66

amplification for actinorhodopsins in any of the samples even though 67

Actinobacteria were detected at least in site A4 by pyrosequencing (5), suggesting 68

that PR sequences were either absent or not amplifiable with the primers used. All 69

DNAs amplified using 16S rRNA gene primers 27F and 1492R (5), indicating the 70

absence of PCR inhibitors. From 433 cloned amplification products obtained with 71

four primer combinations (mixes 1, 3, 4, and 6), 91 clones (21%) corresponded to 72

PR-like partial genes after sequencing and analysis using blastn and tblastx 73

against the Genbank database (based on best hit): 84 from site A5, 5 from site A2 74

and 2 from site A1 (Table 2). These sequences showed no similarity with other 75

sequences in the databases and even though checked for chimeras manually, by 76

doing blast analysis of sequence fragments, it is possible that some of the 77

observed variability could still be due to chimeras and/or amplification errors. The 78

remaining discarded sequences had stop codons or produced hits with very low 79

scores and poor coverage using blastn and tblastx. Previous studies have also 80

shown low recovery of PR genes (5.2%) (14), which may result from the use of 81

degenerate primers. 82

83

The 91 sequences (accession numbers JN648719 to JN648809) had an average 84

length of 351 nt and similarity across the entire sequence with other putative PRs 85

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

from environmental uncultured clones. These sequences corresponded to 22 86

nucleotide sequences and 15 amino acid sequences with 43% identical sites 87

across all sequences, indicating a substantial PR diversity. A phylogenetic 88

reconstruction done with the 15 protein inferred sequences and additional 89

reference sequences showed good bootstrap support, shared features with 90

previously published phylogenetic reconstructions and clustered our sequences 91

into three groups (Figure 1). Clade hp1 was formed by 11 different PR sequences 92

from hot spring A5 and clade hp2 clustered 3 PR sequences derived from clones 93

obtained from samples A1, A2 and A5 that were closely related to a coastal water 94

clone EBAC31A08 (AF279106) (3). The PRs within clades hp1 and hp2 had 91% 95

and 94% identical amino acid sites, respectively. A single PR sequence, 96

represented by 4 different nucleotide sequences from A5 hot spring, grouped close 97

to the previously identified “freshwater clade 8” (2). Thus the PRs identified in 98

these hot springs clustered in different groups and were similar to PRs from both 99

freshwater and marine environments. 100

101

To confirm the PRs detected using degenerate primers, in particular given the 102

possible errors associated with amplification, cloning and sequencing, we designed 103

primers to specifically amplify three of the newly identified sequences: JN648793 104

(clade hp1), JN648742 (clade hp2) and JN648744 (Figure 2, Table 2). PCR 105

amplification of the same metagenomic DNAs was carried out using more stringent 106

conditions: 35 cycles at 95ºC for 1 min, 58ºC for 30 sec, and 68ºC for 45 sec. 107

These PCR products were gel-purified and sequenced (Macrogen, Korea), thus 108

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

avoiding the bias associated with sequencing single cloned sequences that might 109

harbor amplification errors. Amplification was successful with primers for 110

JN648793, using A1 and A2 DNAs, and JN648744, using A5 metagenomic DNA, 111

and the sequences obtained were identical to the original detected sequences, 112

lending support to the idea that these PR sequences are in fact present in these 113

samples and are not simply an artifact of amplification. Primers for JN648742 114

yielded only very faint amplification bands in all samples (A1, A2 and A5) and 115

insufficient amounts that could not be further sequenced. Efforts to obtain full-116

length genes from metagenomic DNAs using reported primers (13) or the genome 117

walking technique to amplify flanking regions (1) using a specific primer designed 118

within the sequences reported here, were unsuccessful. The lack of amplification of 119

full-length genes could be due to differences in the sequences themselves, 120

preventing correct primer annealing, or to problems stemming from low quantity of 121

the metagenomic DNA and its integrity after prolonged storage, since re-122

amplification with the 16S rRNA gene primers used initially was no longer efficient. 123

124

It was interesting that most of the sequences were obtained from site A5. This 125

could be due to inefficient recovery of PR genes from the other samples due to 126

problems inherent to the DNA preparation and/or amplification with the primers 127

used. However, given the fact that with the specific primers designed here we were 128

able to amplify sequences from both A1 and A2 that were identical to those 129

originally detected in sample A5 using degenerate primers (JN648793 and 130

JN648744), it seems likely that by changing PCR conditions and primers more PR 131

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

genes can be recovered from sites A1 and A2 than originally detected. It is also 132

possible, however, that these springs harbor different microbial communities, as a 133

result of environmental variables, such as pH and temperature, and therefore vary 134

in terms of microorganisms harboring PR genes. 135

136

The hot spring PR sequences were examined for conservation of amino acid 137

residues in helix C, Asp at position 97 and Glu at 108, that are key for proton 138

pumping activity (22). The majority (90 sequences) conserved Glu108, and only 139

one sequence had a Gly at this position (Figure 2), consistent with the vast majority 140

of PRs observed to date (3, 11, 19) and suggestive of PRs that function as light-141

activated ion pumps involved in phototrophy, and not as sensory receptors. 142

However, analysis of full-length genes would be required since the conservation of 143

Asp97 could not be assessed given that the forward primer used for PCR-144

amplification included this residue close to the 3' end (20). All the PR sequences 145

also contained a non-polar Leu residue at position 105 (Figure 2), indicative of 146

green-absorbing proteins with absorption maxima (λmax) of 525 nm (15). 147

148

In this work we identified diverse and low abundance PR-like genes in 149

microorganisms from high-mountain, shallow and oligotrophic hot spring waters 150

with high exposure to UV light (12) that are predicted to encode green-absorbing 151

proteins that may harvest the available energy. Energy derived from rhodopsin 152

photosystems, which is very low compared with photosynthesis, could be 153

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

advantageous in these acidic hot springs by contributing to survival in ecosystems 154

that receive abundant sunlight and where alternative energy sources may vary or 155

be scarce (10, 11). Future work aimed at amplification and cloning of a full-length 156

gene will be required, however, to fully assess the functionality of these proteins. 157

This work extends previous inventories of PR genes and shows that they are 158

present in isolated, acidic hot spring communities where energy derived from 159

rhodopsin photosystems may complement a chemotrophic lifestyle and provide an 160

advantage to bacterial cells, helping to compensate for changing environmental 161

conditions. 162

163

Acknowledgments 164

We would like to thank Jose Salvador Montaña and Gina López for sampling and 165

processing DNA, Luisa Delgado for help with bioinformatics, Nof Atamna-Ismaeel 166

and Howard Junca for help and opinions, Sandra Baena for statistical analysis, 167

Julie Anne Maresca and Asunción Martínez from E. DeLong´s Lab for providing us 168

with the positive controls for PR genes, and A. Martínez for critical comments on 169

the manuscript. This work was financed by Colciencias – SENA (project No.6570-170

392-19990) and was done under MAVDT contract No. 15, 2008 for access to 171

genetic resources and UAESPNN Research Permit No. DTNO-N-20/2007. 172

173

References 174

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

1. Acevedo, J. P., F. Reyes, L. P. Parra, O. Salazar, B. A. Andrews, and J. A. 175

Asenjo. 2008. Cloning of complete genes for novel hydrolytic enzymes from 176

Antarctic sea water bacteria by use of an improved genome walking technique. 177

Journal of biotechnology 133:277-286. 178

2. Atamna-Ismaeel, N., G. Sabehi, I. Sharon, K. P. Witzel, M. Labrenz, K. 179

Jurgens, T. Barkay, M. Stomp, J. Huisman, and O. Beja. 2008. Widespread 180

distribution of proteorhodopsins in freshwater and brackish ecosystems. Isme J 181

2:656-662. 182

3. Beja, O., L. Aravind, E. V. Koonin, M. T. Suzuki, A. Hadd, L. P. Nguyen, S. B. 183

Jovanovich, C. M. Gates, R. A. Feldman, J. L. Spudich, E. N. Spudich, and E. 184

F. DeLong. 2000. Bacterial rhodopsin: evidence for a new type of phototrophy in 185

the sea. Science 289:1902-1906. 186

4. Beja, O., E. N. Spudich, J. L. Spudich, M. Leclerc, and E. F. DeLong. 2001. 187

Proteorhodopsin phototrophy in the ocean. Nature 411:786-789. 188

5. Bohorquez, L. C., L. Delgado-Serrano, G. Lopez, C. Osorio-Forero, V. Klepac-189

Ceraj, R. Kolter, H. Junca, S. Baena, and M. M. Zambrano. 2012. In-depth 190

Characterization via Complementing Culture-Independent Approaches of the 191

Microbial Community in an Acidic Hot Spring of the Colombian Andes. Microb Ecol 192

63:103-115. 193

6. Campbell, B. J., L. A. Waidner, M. T. Cottrell, and D. L. Kirchman. 2008. 194

Abundant proteorhodopsin genes in the North Atlantic Ocean. Environ Microbiol 195

10:99-109. 196

7. de la Torre, J. R., L. M. Christianson, O. Beja, M. T. Suzuki, D. M. Karl, J. 197

Heidelberg, and E. F. DeLong. 2003. Proteorhodopsin genes are distributed 198

among divergent marine bacterial taxa. Proc Natl Acad Sci U S A 100:12830-199

12835. 200

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

8. Fuhrman, J. A., M. S. Schwalbach, and U. Stingl. 2008. Proteorhodopsins: an 201

array of physiological roles? Nat Rev Microbiol 6:488-494. 202

9. Giovannoni, S. J., L. Bibbs, J. C. Cho, M. D. Stapels, R. Desiderio, K. L. 203

Vergin, M. S. Rappe, S. Laney, L. J. Wilhelm, H. J. Tripp, E. J. Mathur, and D. 204

F. Barofsky. 2005. Proteorhodopsin in the ubiquitous marine bacterium SAR11. 205

Nature 438:82-85. 206

10. Gomez-Consarnau, L., N. Akram, K. Lindell, A. Pedersen, R. Neutze, D. L. 207

Milton, J. M. Gonzalez, and J. Pinhassi. 2010. Proteorhodopsin phototrophy 208

promotes survival of marine bacteria during starvation. PLoS Biol 8:e1000358. 209

11. Gomez-Consarnau, L., J. M. Gonzalez, M. Coll-Llado, P. Gourdon, T. Pascher, 210

R. Neutze, C. Pedros-Alio, and J. Pinhassi. 2007. Light stimulates growth of 211

proteorhodopsin-containing marine Flavobacteria. Nature 445:210-213. 212

12. IDEAM, and UPME. 2005. Mapas de índice UV para Colombia, p. 97-111, Atlás de 213

radiación solar de Colombia. Ministerio de Ambiente, Vivienda y Desarrollo 214

Territorial, Bogotá, D.C. 215

13. Jung, J. Y., A. R. Choi, Y. K. Lee, H. K. Lee, and K. H. Jung. 2008. 216

Spectroscopic and photochemical analysis of proteorhodopsin variants from the 217

surface of the Arctic Ocean. FEBS Lett 582:1679-1684. 218

14. Koh, E. Y., N. Atamna-Ismaeel, A. Martin, R. O. Cowie, O. Beja, S. K. Davy, E. 219

W. Maas, and K. G. Ryan. 2010. Proteorhodopsin-bearing bacteria in Antarctic 220

sea ice. Appl Environ Microbiol 76:5918-5925. 221

15. Man, D., W. Wang, G. Sabehi, L. Aravind, A. F. Post, R. Massana, E. N. 222

Spudich, J. L. Spudich, and O. Beja. 2003. Diversification and spectral tuning in 223

marine proteorhodopsins. Embo J 22:1725-1731. 224

16. Martinez, A., A. S. Bradley, J. R. Waldbauer, R. E. Summons, and E. F. 225

DeLong. 2007. Proteorhodopsin photosystem gene expression enables 226

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

photophosphorylation in a heterologous host. Proc Natl Acad Sci U S A 104:5590-227

5595. 228

17. Rusch, D. B., A. L. Halpern, G. Sutton, K. B. Heidelberg, S. Williamson, S. 229

Yooseph, D. Wu, J. A. Eisen, J. M. Hoffman, K. Remington, K. Beeson, B. 230

Tran, H. Smith, H. Baden-Tillson, C. Stewart, J. Thorpe, J. Freeman, C. 231

Andrews-Pfannkoch, J. E. Venter, K. Li, S. Kravitz, J. F. Heidelberg, T. 232

Utterback, Y. H. Rogers, L. I. Falcon, V. Souza, G. Bonilla-Rosso, L. E. 233

Eguiarte, D. M. Karl, S. Sathyendranath, T. Platt, E. Bermingham, V. Gallardo, 234

G. Tamayo-Castillo, M. R. Ferrari, R. L. Strausberg, K. Nealson, R. Friedman, 235

M. Frazier, and J. C. Venter. 2007. The Sorcerer II Global Ocean Sampling 236

expedition: northwest Atlantic through eastern tropical Pacific. PLoS Biol 5:e77. 237

18. Sabehi, G., B. C. Kirkup, M. Rozenberg, N. Stambler, M. F. Polz, and O. Beja. 238

2007. Adaptation and spectral tuning in divergent marine proteorhodopsins from 239

the eastern Mediterranean and the Sargasso Seas. Isme J 1:48-55. 240

19. Sabehi, G., A. Loy, K. H. Jung, R. Partha, J. L. Spudich, T. Isaacson, J. 241

Hirschberg, M. Wagner, and O. Beja. 2005. New insights into metabolic 242

properties of marine bacteria encoding proteorhodopsins. PLoS Biol 3:e273. 243

20. Sharma, A. K., K. Sommerfeld, G. S. Bullerjahn, A. R. Matteson, S. W. 244

Wilhelm, J. Jezbera, U. Brandt, W. F. Doolittle, and M. W. Hahn. 2009. 245

Actinorhodopsin genes discovered in diverse freshwater habitats and among 246

cultivated freshwater Actinobacteria. Isme J 3:726-737. 247

21. Sharma, A. K., O. Zhaxybayeva, R. T. Papke, and W. F. Doolittle. 2008. 248

Actinorhodopsins: proteorhodopsin-like gene sequences found predominantly in 249

non-marine environments. Environ Microbiol 10:1039-1056. 250

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

22. Spudich, J. L., and K.-H. Jung. 2005. Microbial Rhodopsins: Phylogenetic and 251

Functional Diversity, p. 1-24. In W. R. Briggs and J. L. Spudich (ed.), Handbook of 252

photosensory receptors. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. 253

23. Stingl, U., R. A. Desiderio, J. C. Cho, K. L. Vergin, and S. J. Giovannoni. 2007. 254

The SAR92 clade: an abundant coastal clade of culturable marine bacteria 255

possessing proteorhodopsin. Appl Environ Microbiol 73:2290-2296. 256

24. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. 257

MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 258

evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-259

2739. 260

261

Figure Legends 262

Figure 1. Neighbor-Joining phylogenetic tree constructed using 15 inferred PR 263

protein hot spring sequences and 70 reported sequences. Sequences were aligned 264

using ClustalW and the phylogeny was constructed using the Neighbor-Joining 265

algorithm with 1000 bootstrap replicates with the program MEGA (24). Sequences 266

from hot spring samples are shown in grey boxes, indicating site (A1, A2 or A5), 267

followed by accession number and number of represented different nucleotide 268

sequences (in parenthesis). The number in parenthesis for clade hp1 indicates the 269

unique PR amino acid sequences. Hot spring clades (hp) and previously reported 270

clades (hatched boxes) are indicated (2). Bootstrap values greater than 50% are 271

shown. Known phylogenetic affiliations are indicated, G-Prot, 272

Gammaproteobacteria; A-Prot, Alphaproteobacteria. 273

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

274

Figure 2. Multiple alignment of PR amino acid sequences of eBAC31A08 and 275

representative hot springs sequences from each hp clade. Positions are based on 276

the eBAC31A08 protein numbering (3). Residues 97 and 108 are marked with an 277

arrow, and position 105 is boxed. Transmembrane helices (3) are indicated, as well 278

as the position of the degenerate primers (grey boxes) and the specific primers 279

designed in this study (underlined sequences). 280

281

282

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 1. Characteristics of the sites sampled 283

Sample A1 A2 A5 A4

Date of sampling 07/04/2008 07/04/2008 08/04/2008 09/04/2008 Ecosystem* HAF HAF-SP SP SP Location 4°58'13.2'' N

75°22'42'' W 4°58'10.3'' N 75°22'38.6'' W

4°54'32.8'' N 75°18'19'' W

04°52'27''N 75°15'51.4''W

Altitude (m) 3464 3876 4363 3973 DAPI counts (cells ml-1) 2.09 × 105 9.16 × 104 2.42 × 104 2.35 ×105

Temperature (°C) 56.9 56.8 35 28.9 pH 2.03 2.04 3.12 2.7 Acidity (CaCO3) (mg L-1) 3633 4525 500 500 Chloride (Cl-) (mg L-1) 653 841 139 56.6 Sulfates (SO4

2-) (mg L-1) 2681 3239 1052 1003 Calcium (Ca2+) (mg L-1) 195 247 256 320 Sodium (Na+) (mg L-1) 413 531 122 45.2 Magnesium (Mg2+) (mg L-1) 282 247 134 55.3 Potassium (K+) (mg L-1) 60.8 74.3 13.5 9.25 Nitrates (NO3

-) (mg L-1) 2.44 0.51 ≤ 0.19 0.89 Total hardness (CaCO3) (mg L-1) 1192 1461 1285 1224 Total Phosphate (PO4) (mg L-1) 1.89 2.76 0.25 0.1 Total Iron (mg L-1) 56 69.4 25.8 8.27 Total suspended solids (mg L-1) 13.6 138 28.4 ≤ 8.01 Total solids (mg L-1) 7039 8854 3124 2620 Total dissolved solids (mg L-1) 6032 7049 2561 2280

284

* Ecosystems: HAF, High Andean Forest; SP, Superpáramo; 285 286

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

287 Table 2. Primers used in this study 288 289 Degenerate Primers used for initial amplifications*

Mix Forward primer (5' - 3') Reverse primer (5' - 3') Recovered with PCR ** Positive PRs**

1 RYIDW MGNTAYATHGAYTGG GWAIYP GGRTADATNGCCCANCC A1(95), A2(54), A5(104) A2(5), A5(84)

2 RYIDW GWSIYP GGRTADATNSWCCANCC none

3 RYIDW GWAVYP GGRTANACNGCCCANCC A1 (120) A1 (2)

4 RYVDW MGNTAYGTNGAYTGG GWSIYP A1 (21) No

5 RYVDW GWVIYP GGRTADATNACCCANCC none

6 RYVDW GWAVYP A1 (39) No

7 YRYVDW TAYMGNTAYGTNGAYTGG WGVYPI ATNGGRTANACNCCCCA none

8 YRYADW TAYMGNTAYGCNGAYTGG WGVYPI none

Specific Primers designed to amplify PR sequences from metagenomic DNA PR

sequence Primers Sequence (5' - 3')

Recovered with PCR

JN648742 JN648742-F TTCTACTTAATTCTTGCTGCT A1, A2, A5 JN648742-R GCCCAGCCAAAGATGATAATA

JN648793 JN648793-F CTATCTGATCCTTTCCGCCAT A1, A2 JN648793-R ATATAGCCCAGCCGAAGGTGA

JN648744 JN648744-F CTGATTACCGTTCCGCTCCTG A5 JN648744-R ATCCGATTGTGACGATCCAGC

*Primers were taken from Atamna-Ismaeel et al, 2008 (2) and Sharma et al, 2009 (20)

**Numbers in parenthesis indicate the number obtained at each site 290

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on March 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from