Proc. Natl. Acad. Sci. USAVol. 93, pp. 5715-5719, June 1996Pharmacology

Mutation of a conserved serine in TM4 of opioid receptorsconfers full agonistic properties to classical antagonistsPATRICIA A. CLAUDEt, DIANE R. WOTTA, X. H. ZHANG, PAUL L. PRATHER, TERRY M. MCGINN,LAURIE J. ERICKSON, HORACE H. LOH, AND P. Y. LAW3-249 Millard Hall, Department of Pharmacology, Medical School, University of Minnesota, Minneapolis, MN 55455

Communicated by Avram Goldstein, Stanford University, Stanford, CA, February 9, 1996 (received for review December 27, 1995)

ABSTRACT The involvement of a conserved serine(Ser196 at the ,I-, Ser177 at the -, and Ser187 at the K-opioidreceptor) in receptor activation is demonstrated by site-directed mutagenesis. It was initially observed during ourfunctional screening of a iLx/-opioid chimeric receptor, I62,that classical opioid antagonists such as naloxone, naltrexone,naltriben, and H-Tyr-Tic[i,CH2NH]Phe-Phe-OH (TIPPa;Tic = 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid) couldinhibit forskolin-stimulated adenylyl cyclase activity in CHOcells stably expressing the chimeric receptor. Antagonists alsoactivated the G protein-coupled inward rectifying potassiumchannel (GIRK1) in Xenopus oocytes coexpressing the ,u62opioid receptor and the GIRK1 channel. By sequence analysisand back mutation, it was determined that the observedantagonist activity was due to the mutation of a conservedserine to leucine in the fourth transmembrane domain(S196L). The importance of this serine was further demon-strated by analogous mutations created in the Ix-opioid re-ceptor (MORS196L) and 6-opioid receptor (DORS177L), inwhich classical opioid antagonists could inhibit forskolin-stimulated adenylyl cyclase activity in CHO cells stably ex-pressing either MORS196L or DORS177L. Again, antagonistscould activate the GIRK1 channel coexpressed with eitherMORS196L or DORS177L in Xenopus oocytes. These datataken together suggest a crucial role for this serine residue inopioid receptor activation.

The cloning of the 6opioid receptor (DOR-1) independentlyby Evans et al. (1) and Keiffer et al. (2), followed by the cloningof the ,-opioid receptor (MOR-1; refs. 3 and 4) and K-opioidreceptor (5, 6), confirmed that opioid receptors belong to thesuperfamily of G protein-coupled receptors. Opioid receptorshave been reported to regulate many cellular effectors viapertussis toxin-sensitive G proteins. The most notable effec-tors regulated by opioid agonists are adenylyl cyclase, voltage-dependent calcium channels, and potassium channels. Inclonal cell lines such as neuroblastoma x glioma NG108-15hybrid cells or human neuroblastoma SHSY5Y cells, opioidagonists inhibit forskolin-stimulated adenylyl cyclase activity(7, 8). In NG108-15 cells or in brain hippocampal slicepreparations, opioid agonists inhibit the voltage-dependentopening of calcium channels (9, 10). In rat locus coeruleus,guinea pig submucous plexus, and hippocampal slice prepa-rations, opioid agonists have been reported to open G protein-coupled, voltage-dependent inward rectifying potassium chan-nels (11, 12). Therefore, it was not surprising that the expres-sion of cloned opioid receptors in cell lines or Xenopus oocytesresulted in agonist concentration-dependent inhibition of ad-enylyl cyclase activity, inhibition of voltage-dependent calciumchannels, and activation of G protein-coupled inward rectify-ing potassium channels (13-16).

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Recent opioid receptor chimer studies suggest the involve-ment of unique receptor domains that are specific for agonistand antagonist interactions (17-19). Results from zI/8 and §/ILchimera receptors created in our lab also support this idea(unpublished observations). However, at one of our chimericreceptor constructs, Iub2, in which the nucleotide sequence ofDOR-1 from the N-terminus up to the first extracellular loopwas replaced with a similar sequence from MOR-1, antago-nists appear to be interacting with the chimeric receptor in thesame manner as agonists and are able to produce receptoractivation. At the &,2 opioid receptor, antagonists behave asfull agonists. The purpose of this study is to demonstrate thatthe antagonist activation at the &L2 chimeric opioict receptoris due to the mutation of a conserved serine to leucine in TM4.To study G protein activation, adenylyl cyclase assays on CHOcells stably expressing the xtb2 chimeric receptors or theanalogously mutated MOR-1 and DOR-1 (MORS196L andDORS177L, respectively) and electrophysiological studies ofGIRK1 channel activation using Xenopus laevis oocytes coex-pressing the mutant opioid receptors and the GIRK1 channelwere performed. Additionally, back mutation of the iu82 TM4leucine to the wild-type serine abolishes the antagonist'sagonistic activity, demonstrating the importance of this serineresidue over a unique tertiary structure adopted by the chi-meric receptor.

METHODSConstruction of I,&S2. Chimeric Receptor. The /,L2 opioid

receptor chimer was constructed from PCR fragments gener-ated from DOR-1 and MOR-1. To generate the DOR-1fragment from the C-terminus of the second transmembrane(TM) region to the C-terminus of the receptor, an oligode-oxynucleotide, GCGCTGGCCACTAGTACGCTGCCCTTC,which introduces the SpeI site at Thr9 and Ser'°o, was syn-thesized and used as the upstream primer in the PCR. The SP6primer was used as the downstream primer, and 20 ng ofDOR-1 subcloned in the XhoI site of pCDNA3 was used as thetemplate. The MOR-1 fragment, containing sequence fromthe N-terminus to the C-terminus of TM2, was generated withthe T7 primer as the upstream primer, and an oligodeoxynucle-otide, corresponding to the antisense sequence of amino acidsAsp14 to Pro122 (GGGCAGTGTACTAGTCGCTAAG-GCGTC), which also introduces a SpeI site at Thr"18 andSer"9, was used as the downstream primer in PCRs togetherwith 20 ng of MOR-1 subcloned in HindIII site of pRc/CMV.Each PCR contains (final concentration) 25 mM N-tris[hy-droxymethyl]methyl-3-aminopropanesulfonic acid (Taps-HCl;pH 9.3), 50 mM KCl, 2 mM MgCl2, 1 mM DTT, 0.2 mMupstream and downstream primers, 0.2 mM dNTP, and 2.5

Abbreviations: DOR-1, &opioid receptor; MOR-1, u-opioid receptor;TM, transmembrane region; DPDPE, [D-Pen2,D-Pen5]enkephalin(Pen = penicillamine); DAMGO, [D-Ala2,MePhe4,Gly5-ol]enkephalin;TIPPi, H-Tyr-Tic[q,CH2NH]Phe-Phe-OH (Tic = 1,2,3,4-tetrahydroiso-quinoline-3-carboxylic acid).To whom reprint requests should be addressed.

5715

5716 Pharmacology: Claude et al.

units of Taq polymerase (Boehringer Mannheim). PCR con-ditions were as follows: 94°C for 1 min, 56°C for 1 min, and72°C for 2 min for 25 cycles. The products were subcloned intothe pCRII vector (Invitrogen), orientation was determined,and the fragments were digested with appropriate endonucle-ases. For MOR-1, the HindIII/SpeI fragment was gel-isolatedand purified by glassmilk (GeneClean, BiolOl, La Jolla, CA).For DOR-1, the SpeI/XbaI fragment was isolated and purifiedin the same manner. The t8b2 chimer was constructed by theligation of these two DNA fragments into the pcDNA3 plasmid(Invitrogen) and digested with HindIII and XbaI using T4DNA ligase at 16°C for 30 min (TaKaRa DNA Ligation kit,PanVera, Madison, WI).

Site-Directed Mutagenesis. Construction of the 1tb2L196S,MORS196L, and DORS177L opioid receptors were carriedout by site-directed mutagenesis (Altered Sites in vitro Mu-tagenesis System, Promega). For tb2L196S, ,L82 was subclonedinto the HindIII/XbaI sites of pALTER-1 phagemid (Pro-mega). Single-stranded JL2 DNA template was isolated. Themutagenesis oligodeoxynucleotide, TGCATCTGGGTCTTG-GCTAGCGGTGTCGGGGTCCCCATC, which convertsleucine at 196 back to serine and also introduces a NheI site atAla195 and Ser'96 was synthesized. Mutagenesis was performedaccording to Promega protocol. Incorporation of the mutagen-esis oligodeoxynucleotide was confirmed by digestion withNheI. For DORS177L, DOR-1 was subcloned in the EcoRI/KpnI site of pALTER-1. A mutagenesis oligodeoxynucleotidewas synthesized in which a KpnI site was introduced at Gly'80,Val181, and Pro181 with the following sequence: TGGGTCT-TGGCTTTAGGTGTCGGGGTACCCATCATGGTCATG.For MORS196L, MOR-1 was subcloned into the pALTER-1HindIII site in an antisense orientation. The mutagenesisoligodeoxynucleotide also introduces a NheI site at Ser195 andSer'96, CAGGCAGACCGATGGCTAGCGAGAGGATCC.All chimeric and site mutagenesis constructs were stably trans-fected into CHO cells by calcium phosphate precipitation (20).

Adenylyl Cyclase and Receptor Binding Assays. Measure-ment of opioid ligand regulation of intracellular 3H-cAMP andchronic agonist treatment were carried out as described in Lawet al. (21). 3H-cAMP was separated from other radioactivenucleotides by Dowex and alumina column chromatography asdescribed by White and Karr (22). Each concentration-response curve was determined with at least 13 concentrationsof opioid ligand. Opioid receptor binding assays were per-formed with membranes prepared from CHO cells stablyexpressing the mutant opioid receptor constructs. Membranepreparation and binding assays were carried out as describedin Law et al. (21). Protein concentrations were determined bythe method of Lowry et al. (23). Receptor density (Bma) andKD values for [3H]diprenorphine binding were calculated usingthe LIGAND program (24), and Ki values were determined usingthe Cheng and Prussof equation, Ki = Kapp/1 + ([L*]/KD*).Each competition binding curve was determined by at least 11concentrations of opioid ligand. IC50 values and maximalinhibitory levels were determined by curve fitting of concen-tration-response and competition binding curve results usingSIGMA PLOT for Macintosh (Jandel, San Rafael, CA).Xenopus Oocyte Electrophysiology. Xenopus laevis (Xeno-

pus 1, Ann Arbor, MI) oocytes were prepared for injection asdescribed in ref. 25 with the oocytes being maintained at 18 ±1°C. The GIRK1 channel (from Henry Lester, CaliforniaInstitute of Technology, Pasadena, CA; ref. 26) was subclonedinto the EcoRI/XhoI sites of pcDNA3 (Invitrogen). Oocyteswere injected intranuclearly with 3-7 ng of cDNAs for theGIRK1 and the various opioid receptors. Oocyte nuclearinjections of cDNAs were performed as described in ref. 27 inthe presence of modified Barth's solution [90 mM NaCI, 1 mMKCl, 1.64 mM MgSO4, 1.48 mM CaC12, and 20mM Hepes (pH7.4)] supplemented with 50 mg of gentamicin per ml (Sigma).After injection, oocytes were incubated in ND96 (25) at 18°C.

Five to 10 days after oocyte injection, standard two-electrodevoltage-clamp recordings were performed at 20-22°C using theDagan TEV-200 Voltage Clamp (Dagan Instruments, Minneap-olis). Perfusion of oocytes was performed with Ringer's buffer(25) for clamping at -80 mV and high K+ buffer (16) for K+current recording and drug addition. Drugs were applied for0.25-1.0 min in high K+ buffer. Peak height ratios were deter-mined by the following formula: peak height of current inducedby antagonist treatment/peak height of current induced byagonist treatment. Peak height ratios were determined for five tosix oocytes and then averaged. Significance was determined usingSTATWORKS for Macintosh (CRICKET software).

RESULTSDemonstration of Positive Intrinsic Activity by Classical

Opioid Antagonists in the Li2 Chimeric Opioid Receptor. Weconstructed the MOR-1/DOR-1 receptor chimera, 1b82, inwhich the nucleotide sequence ofDOR-1 from the N-terminusup to the first extracellular loop was replaced with a similarsequence from MOR-1. When the l52 chimeric receptor wasstably expressed in CHO cells, it retained DOR-1 ligandselectivity with no apparent alteration in ligand potency, asdetermined by the ability of opioid receptor selective agonists,such as [D-Pen2,D-Pen5]enkephalin (DPDPE; Pen = penicil-lamine), to inhibit forskolin-stimulated adenylyl cyclase activ-ity (Fig. 1). The potency of DPDPE to inhibit forskolin-stimulated adenylyl cyclase activity at wild-type DOR-1 is 0.26+ 0.09 nM (13), whereas the potency of DPDPE at the g.2opioid chimeric receptor is 1.4 ± 0.3 nM. However, whenvarious opioid antagonists were used to determine p,b2 selec-tivity, they were not able to functionally antagonize opioidagonist activity. When assayed on their own, however, nal-triben (Fig. 1), naltrindol, naloxone, naltrexone, and DOR-1selective pseudopeptide antagonists, Tyr-Tic-Phe-Phe-OH(TIPP; Tic = 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid)and H-Tyr-Tic[q,CH2NH]Phe-Phe-OH (TIPPq), all inhibitedforskolin-stimulated adenylyl cyclase activity with potencies of1.0 ± 0.24 nM, 0.29 + 0.05 nM, 48 + 8.7 nM, 6.4 + 1.0 nM,0.49 ± 0.26 nM, and 0.49 + 0.65 nM, respectively, and with amaximal level similar to that ofDPDPE. The potencies of theseopioid antagonists were in accordance with their selectivityand potency to reverse agonist induced inhibition of adenylylcyclase (Ke) at DOR-1 (14).Back Mutation ofTM4 Leucine to Serine Removes Agonist

Activity from Antagonists. When complete nucleotide se-quencing of the b&2 clone was carried out, a single nucleotidemutation, C587T, was discovered. This nucleotide substitution

0iwI.'

u

.-

a:

OA

5llwE

120 r

100 r

80o

601

40 I T

10-2 10-1 1 101 102 103[Opioid Ligand], nM

FIG. 1. Inhibition of forskolin-stimulated adenylyl cyclase activityby DPDPE and naltriben in CHO cells stably expressing tb2 chimericopioid receptor. The ability of DPDPE (-0-) and naltriben (-0-) toinhibit 10 ,iM forskolin-stimulated 3H-cAMP production was asdescribed.

Proc. Natl. Acad. Sci. USA 93 (1996)

Proc. Natl. Acad. Sci. USA 93 (1996) 5717

was probably introduced by Taq polymerase used to generatethe fragments that create the t82 opioid receptor chimer. Thissingle nucleotide substitution resulted in an amino acid mu-tation, S196L, in TM4, a domain that is least conserved amongthe three opioid receptor types. However, this serine moiety isconserved in all opioid receptors cloned thus far and is locatedin the middle of TM4 helix.

If indeed the agonist-like properties that antagonists areexhibiting at the pg2 receptor chimer are caused by this aminoacid mutation and are not due to the chimeric construct, thensite-directed mutagenesis of Leu196 back to the original serineshould reverse the effects and restore characteristic antagonistproperties at the 8Lb2 receptor chimer. The tL82L196S receptorwas constructed and stably expressed in CHO cells. Expressionlevels of the stable tjL2L195S/CHO clone were 0.7 ± 0.09 pmolper mg of protein as compared to the expression levels for thestable piu2/CHO clone (2.1 ± 0.5 pmol per mg of protein).Initially, the ability of the opioid agonist DPDPE to inhibitforskolin-stimulated adenylyl cyclase activity was determinedto demonstrate that the back mutation did not alter ligandpotency or receptor activation. The potency of DPDPE toinhibit forskolin-stimulated cyclase at the Ab2L196S receptorwas similar to its potency at the zb2 receptor (1.4 ± 0.3 nM and0.41 ± 0.06 nM, respectively). Opioid antagonists were thenassayed for their ability to inhibit forskolin-stimulated adenylylcyclase activity. Opioid antagonists (naloxone and naltriben)at micromolar concentrations did not inhibit forskolin-stimulated adenylyl cyclase. However, these antagonists didreverse the adenylyl cyclase inhibitory effects of opioid agonistDPDPE (Fig. 2A). Interestingly, TIPPq retained some abilityto inhibit forskolin-stimulated adenylyl cyclase activity atmicromolar concentrations in ,/b2L197S/CHO (42% ± 1.8%).Nevertheless, TIPPi/ was able to partially reverse the inhibi-tory effects of DPDPE from 68% ± 3.1% to 37% ± 7.1%.

Additionally, antagonist properties are further demonstratedby the ability of classical opioid antagonists to induce a compen-satory increase in adenylyl cyclase activity after chronic agonisttreatment. This compensatory increase in adenylyl cyclase activityinduced by antagonists after chronic agonist treatment has beenreported in CHO cells stably expressing wild-type DOR-1 (14)

A

: 2000

.= 1500-

I 1000

500

0

I-c,

u_

and in neuro2A cells stably expressing wild-type MOR-1 (28).When CHO cells stably expressing tLb2L196S were chronicallytreated with DPDPE for 24 hr, a loss in ability of DPDPE toinhibit adenylyl cyclase was observed, indicating receptor desen-sitization (Fig. 2B). Subsequent treatment with naltriben pro-duced compensatory increases in cAMP accumulation abovecontrol level (298% ± 23%; Fig. 2B). Similar results were seenwith other antagonists assayed: naloxone, naltrexone, and TIPPq/.

Additionally, naloxone did not activate the GIRK1 channelin oocytes coinjected with pLb2L196S and the GIRK1 (Fig. 2C).However, TIPPq retained some ability to activate the GIRK1channel. This is in contrast to the tb2 chimeric opioid receptorin which the antagonists were able to fully activate the GIRK1channel in Xenopus oocytes coexpressing the L&b2 chimericreceptor and the GIRK1 channel (Fig. 2C). Taken together,these results suggest that serine in the 196 position of the ,Iz2chimeric receptor restores classical opioid antagonist properties.

Serine-to-Leucine Mutation in Wild-Type MOR-1 andDOR-1 Confers Agonist Activity to Antagonists. The partici-pation of this TM4 serine moiety in opioid receptor activationwas demonstrated further by creating analogous mutations inthe wild-type MOR-1 and DOR-1. This mutation correspondsto Ser177 in DOR-1 and Ser196 in MOR-1. Thus, DORS177Land MORS196L mutated receptors were constructed, stablyexpressed in CHO cells, and assayed for their ability to inhibitadenylyl cyclase activity. It was found that classical antagonistsdid inhibit forskolin-stimulated adenylyl cyclase activity in arank order potency expected from the receptor subtype as-sayed (Fig. 3A and B; Table 1). In CHO cells stably expressingMORS196L, the potency of [D-Ala2,MePhe4,Gly5-ol]enkepha-lin (DAMGO) to inhibit forskolin-stimulated adenylyl cyclaseactivity (IC50 = 0.90 ± 0.22 nM) is similar its potency at theMOR-1 wild-type receptor (IC50 = 4.5 ± 0.6 nM; ref. 13),indicating the mutation is not greatly affecting the agonistactivation of the mutated opioid receptor. At the MORS197Lreceptor, naloxone and naltrexone inhibited forskolin-stimulated adenylyl cyclase activity by 40.0% ± 3.3% and51.0% ± 2.1%, respectively, as compared to DAMGO, whichinhibited adenylyl cyclase activity 61.0% ± 2.6%.[Cys2,Tyr3,Orn5,Pen7] -amide, a somatostatin analog that has

B

4000

3000

2000

1000

00

0u

c r

c

C_-7 aZ +

u.a

Z?

C

a

coi

b13

ctu

Q)C64

Oa c i Xr -n

L z

1.61.41.2

1.00.80.60.40.2

0

FIG. 2. I1,2L196S back mutation restores antagonistic activity to classical opioid antagonists. (A) Naltriben reverses DPDPE inhibition offorskolin-stimulated intracellular 3H-cAMP production in CHO cells stably transfected with Ab2 L196S. DPDPE (10 nM) inhibits forskolin-stimulated 3H-cAMP production to 68% ± 3.1% of control forskolin-stimulated levels. Naltriben (1 ,LM) was assayed alone to determine intrinsicactivity then assayed for its ability to reverse 10 nM DPDPE inhibition of forskolin-stimulated 3H-cAMP production. (B) Ability of naltriben toinduce a compensatory increase in intracellular 3H-cAMP after 24 hr of 100 nM DPDPE treatment in CHO cells stably expressing zb62L196S.Chronic exposure of CHO cells stably transfected with ,82L196S to DPDPE was carried out as described. Control levels represent forskolin-stimulated cAMP production in the absence of chronic DPDPE treatment. Inhibition of cAMP production by 100 nM DPDPE in control cells andlack of inhibition after 24-hr treatment with 100 nM DPDPE demonstrate receptor desensitization. (C) GIRK1 response to antagonists in oocytesexpressing various opioid chimeras. Antagonists TIPPi (1 ItM) and naloxone (1 JuM) were used for the MOR-1, with TIPPi$ (0.1 ,uM) being usedfor the DOR-1, LS2, and Lb2L196S. Agonist concentrations of DPDPE and DAMGO were 10 nM for DOR-1 and MOR-1, respectively. Significancewas calculated using Student's t test. **, P < 0.01, n = 5-6 oocytes.

Pharmacology: Claude et al.

5718 Pharmacology: Claude et al.

B

10-1 1 101 102 103 104

[Opioid Ligand], nM

- 120i-.

-3 100

80r.<

60re'

=40

2- 2010-1 1 101 102 103 104

[Opioid Ligand], nM

FIG. 3. Ability of antagonists to inhibit forskolin-stimulated intracellular 3H-cAMP production in CHO cells stably expressing (A) MORS196Land (B) DORS177L. The ability of various concentrations of naloxone (-0-), naltrexone (-*-), naltriben (-A-), and TIPPi (-A-) to inhibit 10liM forskolin-stimulated production of 3H-cAMP. (C) GIRK1 activation in response to antagonists in oocytes expressing DORS177L andMORS196L. Antagonists TIPPC (1 tLM) and naloxone (1 iM) were used for the MOR-1 and MORS196L, with TIPPq (0.1 ,jM) being used forthe DOR-1 and DORS177L. Agonist concentrations of DPDPE and DAMGO were 10 nM for DOR-1 and MOR-1, respectively. Significance wascalculated using Student's t test. **, P < 0.01; *, P < 0.056, n = 5-6 oocytes.

high MOR-1 selectivity (29), does not inhibit adenylyl cyclase,though it does reverse DAMGO-induced inhibition of fors-kolin-stimulated adenylyl cyclase (data not shown). As forCHO cells expressing DORS177L, the classical opioid antag-onists inhibit forskolin-stimulated adenylyl cyclase activity by-45% (naloxone, 46.0 ± 6.6%; naltrexone, 50.0 + 3.1%;naltriben, 39.0 ± 2.1%; and TIPPqi, 45.0 ± 5.1%). Interest-ingly, DPDPE and deltorphin II have minimal activity inDORS177L. Radioligand binding assays (unpublished obser-vations) show that these peptide agonists have high affinitiesfor DORS177L but have no acute agonistic or antagonisticactivity in the inhibition of forskolin-stimulated adenylyl cy-clase. The reason for this is not apparent and should beinvestigated further.

Again, activation of these mutant receptors by antagonistsresulted in regulation of effectors other than adenylyl cyclase.In oocytes expressing the MORS196L receptor and the GIRK1channel, both DAMGO and naloxone were able to activate theGIRK1 channel. Similarly, both the agonist DPDPE and the

Table 1. Comparison of potency of opioid antagonistsKe (nM) IC5o, (nM)

Antagonist MOR-1 DOR-1 MORS196L DORS177L

Naloxone 3.6 + 0.5* 59.4 ± 14.7t 4.1 ± 0.5 17 ± 5.8Naltrexone ND ND 0.63 ± 0.18 8.5 ± 2.6Naltriben 20.7 ± 4.3 0.54 + 0.12t 28 ± 21 7.0 ± 1.7TIPPf >10,000 0.85 + 0.08 > 10,000 5.3 ± 2.7

The data compare the potency of opioid antagonists to inhibitforskolin-stimulated adenylyl cyclase activity in CHO cells stablyexpressing MORS196L and DORS177L and their potency to reverseagonist inhibition of forskolin-stimulated adenylyl cyclase activity inCHO cell stably expressing MOR-1 and DOR-1. ICso values wereobtained as described. Ke values of the antagonists at wild-typeMOR-1 and DOR-1 were calculated from the concentrations ofantagonists to reverse 5 nM etorphine inhibition of forskolin-stimulated 3H-cAMP production. Bmax and 3H-diprenorphine bindingaffinities, respectively, are as follows: MOR-1 (1.64 pmol per mg ofprotein, 0.23 ± 0.02 nM; ref. 13), DOR-1 (1.42 pmol per mg of protein,0.68 ± 0.7 nM; ref. 14), MORS197L (0.93 pmol per mg of protein, 3.8± 2.2 nM), and DORS177L (0.13 pmol per mg of protein, 0.25 + 0.17nM). ND, not determined.*Data obtained from ref. 13.tData obtained from ref. 14.

antagonist TIPPi activated the GIRK1 channel in oocytescoexpressing GIRK1 and DORS177L (Fig. 3C). This demon-strates that DPDPE is able to activate the DORS177L recep-tor, even though it was not able to do so in our stably expressingCHO cell clone. Nevertheless, this single amino acid mutationat the putative TM4 domain of MOR-1 and DOR-1 results inthe activation of various G proteins and effectors by classicalopioid antagonists.

DISCUSSIONThese results indicate that a single point mutation in TM4 ofMOR-1 and DOR-1 is sufficient to produce full agonist effectsfrom antagonists. We have demonstrated that the antagonist-to-agonist phenomena we observed with the ab82 opioid chi-meric receptor was reproducible in the wild-type MOR-1 andDOR-1 with a single point mutation of the analogous serine toleucine in TM4. Preliminary results in Xenopus oocytes coex-

pressing the GIRK1 channel and the K-opioid receptor withthe analogous mutation of serine to leucine at position 187(KORS187L) indicates that KORS187L is also activated by theopioid antagonists naloxone and naltrexone, but not by nor-

binaltorphimine (norBNI), a naltrexone dimer (unpublishedobservations). Additionally, it was demonstrated that therestoration of the leucine to the wild-type serine in the it&2chimeric receptor (ibS2L196S) removed agonistic propertiesfrom the classical opioid antagonists.

It has been demonstrated that overexpression of G protein-coupled receptors may induce the receptors to interact with Gproteins that they normally would not. For example, overexpres-sion of the a2-adrenergic receptor in CHO cells induces receptorcoupling not only with Gi,, but also with Gs,, a G protein withwhich receptors do not normally interact (30). However, thereceptor densities of the /x82 chimera, MORS196L, andDORS177L in the stably expressing CHO cells (1.4 pmol permg of protein, 0.93 pmol per mg of protein, and 0.13 pmol permg of protein, respectively) are similar to densities ofwild-typeMOR-1 and DOR-1 stably transfected into CHO cells (1.64pmol per mg of protein and 1.42 pmol per mg of protein,respectively) that demonstrate no antagonist-positive intrinsicactivity (13, 14), indicating that receptor density is not a

probable mechanism for receptor activation by antagonists in

A

-120

% 100

-

: 80-

60

-,

_ 40

_10

C

_ ( )03.2.

,e 0.1

-

t-,

XI

Proc. Natl. Acad. Sci. USA 93 (1996)

Proc. Natl. Acad. Sci. USA 93 (1996) 5719

this study. However, the low receptor density seen in theDORS177L stably expressing CHO cells may be a factor in theinability of this clonal cell line to induce the inhibition ofadenylyl cyclase activity with DPDPE.

Interestingly, both peptide (TIPPi) and alkaloid antagonists(naloxone, naltrexone, and naltriben) were capable of activatingthe mutant opioid receptors, tb2, MORS196L, and DORS177L.The inability of [Cys2,Tyr3,Orn5,Pen7]-amide to activate theMORS196L receptor may be due more to its lack of structuralsimilarity to opioid agonists than to its peptide structure.Recently published studies in which chimeric opioid receptorswere created to characterize the ligand binding site within theopioid receptor (31-34) have indicated that peptide andalkaloid selectivity are located at distinct TMs. However, asboth peptide and alkaloid agonists are able to activate wild-type opioid receptors, so both peptide and alkaloid antagonistsare capable of activating the mutated opioid receptors.Though the mechanism by which antagonists can activate

the mutant opioid receptors is unknown, the apparent reten-tion of potency and affinity suggests that ligand-receptorinteractions are not being altered. This implicates a change inthe receptor itself that allows for activation by antagonists. Asmentioned above, the mutated TM4 serine is conserved inMOR-1, DOR-1, and K-opioid receptors cloned to date.Therefore, mutation of the serine to a nonhydrogen-bondingleucine may cause a disruption in the receptor tertiary struc-ture leading to a more permissive receptor activation state.There is no indication, however, that the mutated receptors areconstitutively active.The hypothesis that the leucine-to-serine mutation releases

hydrogen bonding within the receptor is supported by prelim-inary data from our laboratory, in which the serine of MOR-1has been mutated to threonine (MORS196T), another hydro-gen-bonding amino acid residue. The MORS196T receptor isnot activated by opioid antagonists when stably expressed inCHO cells, indicating that hydrogen bonding is an importantfunction of the amino acid residue at this position. If this istrue, then a counterhydrogen-bonding residue must existwithin TM4 or a putative adjoining TM (TM3 or TM5).Further mutagenesis studies are required to identify otherresidues that may be involved.

It is not currently known what structural qualities makes anopioid ligand an antagonist versus an agonist, though manyhypotheses have been formulated over the years. Our TM4serine-to-leucine mutated opioid receptor model demon-strates that antagonists with high structural homology toagonists (i.e., naloxone, naltrexone, naltriben, and TIPPi) arecapable of agonist activity if the receptor will allow it. Thismodel brings us one step closer to understanding the mecha-nisms of opioid receptor activation that would aid in the designof more selective antagonists.

This research is support in part by National Institutes of Health GrantsDA07339, DA05695, DA01583, DA07234-07, and K05-DA-70554.

1. Evans, C. J., Keith, D. E., Jr., Morrison, H., Magendzo, K. &Edwards, R. H. (1992) Science 258, 1952-1954.

2. Kieffer, B. L., Befort, K., Gaveriaux-Ruff, C. & Hirth, C. G.(1992) Proc. Natl. Acad. Sci. USA 89, 12048-12052.

3. Chen, Y., Mestek, A., Liu, J., Hurley, J. A. & Yu, L. (1993) Mol.Pharmacol. 44, 8-12.

4. Fukuda, K., Kato, S., Mori, K., Hishi, M. & Takeshima, H. (1993)FEBS Lett. 327, 311-314.

5. Meng, F., Xie, G.-X., Thompson, R. C., Mansour, A., Goldstein,A., Watson, S. J. & Akil, H. (1993) Proc. Natl. Acad. Sci. USA 90,9954-9958.

6. Yasuda, K., Raynor, K., Kong, H., Breder, C., Takeda, J., Reisine,T. & Bell, G. I. (1993) Proc. Natl. Acad. Sci. USA 90, 6736-6740.

7. Sharma, S., Nirenberg, M. & Klee, W. (1975) Proc. Natl. Acad.Sci. USA 72, 590-594.

8. Yu, V. C. & Sadee, W. (1988) J. Pharmacol. Exp. Ther. 245,350-355.

9. Hescheler, J., Rosenthal, W., Trautwein, W. & Schultz, G. (1987)Nature (London) 325, 445-447.

10. Jin, W., Lee, N. M., Loh, H. H. & Thayer, S. A. (1992) Mol.Pharmacol. 42, 1083-1089.

11. Wimpey, T. L. & Chavkin, C. (1991) Neuron 6, 281-289.12. North, R. A., Williams, J. T., Surprenant, A. & Christie, M. J.

(1987) Proc. Natl. Acad. Sci. USA 84, 5487-5491.13. Chakrabarti, S., Prather, P. L., Yu, L., Law, P.-Y. & Loh, H.

(1995) J. Neurochem. 64, 2534-2543.14. Law, P. Y., McGinn, T. M., Wick, M. J., Erickson, L. J. & Loh,

H. H. (1994) J. Pharmacol. Exp. Ther. 271, 1686-1694.15. Piros, E., Prather, P., Loh, H., Law, P.-Y., Evans, C. & Hales, T.

(1995) Mol. Pharmacol. 47, 1041-1049.16. Henry, D.J., Grandy, D. K., Lester, H.A., Davidson, N. &

Chavkin, C. (1995) Mol. Pharmacol. 47, 551-557.17. Kong, H., Raynor, K., Yasuda, K., Moe, S., Portoghese, P., Bell,

G. & Reisine, T. (1993) J. Biol. Chem. 268, 23055-23058.18. Surratt, C., Johnson, P., Moriwaki, A., Seidleck, B., Blaschak, C.,

Wang, J. B. & Uhl, G. (1994) J. Biol. Chem. 269, 20548-20553.19. Xue, J.-C., Chen, C., Zhu, J., Kunapuli, S. P., De Riel, J. K., Yu,

L. & Liu-Chen, L.-Y. (1995) J. Biol. Chem. 270, 12977-12979.20. Chen, C. A. & Okayama, H. (1988) Biotechniques 6, 632-638.21. Law, P. Y., Hom, D. S. & Loh, H. H. (1983) Mol. Pharmacol. 24,

413-424.22. White, A. A. & Karr, G. (1978) Anal. Biochem. 85, 451-460.23. Lowry, O. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J.

(1951) J. Biol. Chem. 193, 265-268.24. Rodbard, D. & Munson, P. J. (1980) Anal. Biochem. 107, 220-

239.25. Birnbaum, A. K., Wotta, D. R., Law, P. Y. & Wilcox, G. L. (1995)

Mol. Brain Res. 28, 72-80.26. Dascal, N., Schreibmayer, W., Lim, N. F., Wang, W., Chavkin, C.,

DiMagno, L., Labarca, C., Kieffer, B., Gaveriaux-Ruff, C.,Trollinger, D., Lester, H. A. & Davidson, N. (1993) Proc. Natl.Acad. Sci. USA 90, 10235-10239.

27. Hames, B. D. & Higgins, S. J. (1984) Transcription and Transla-tion: A Practical Approach (IRL, Oxford), pp. 49-69.

28. Chakrabarti, S., Law, P. Y. & Loh, H. H. (1995) Mol. Brain Res.30, 269-278.

29. Gulya, K., Pelton, J., Hruby, V. & Yamamura, H. (1986) Life Sci.38, 2221-2229.

30. Eason, M. G., Kurose, H., Holt, B. D., Raymond, J. R. & Liggett,S. B. (1992) J. Biol. Chem. 267, 15795-15801.

31. Minami, M., Tatsuhiro, O., Nakagawa, T., Katao, Y., Aoki, Y.,Katsumata, S. & Satoh, M. (1995) FEBS Lett. 364, 23-27.

32. Onogi, T., Minami, M., Katao, Y., Nakagawa, T., Aoki, Y., Toya,T., Katsumata, S. & Satoh, M. (1995) FEBS Lett. 357, 93-97.

33. Meng, F., Hoversten, M. T., Thompson, R. C., Taylor, L.,Watson, S. T. & Akil, H. (1995)J. Biol. Chem. 270, 12730-12736.

34. Fukuda, K., Kato, S. & Mori, K. (1995) J. Biol. Chem. 270,6702-6709.

Pharmacology: Claude et al.