TopoisomeraseIIfromHumanMalariaParasites · TopoII inhibitors previously developed for other non-malaria indications inhibited PfTopoII, as well as malaria parasites in culture at

Topoisomerase II from Human Malaria ParasitesEXPRESSION, PURIFICATION, AND SELECTIVE INHIBITION*

Received for publication, January 15, 2015, and in revised form June 5, 2015 Published, JBC Papers in Press, June 8, 2015, DOI 10.1074/jbc.M115.639039

Devaraja G. Mudeppa, Shiva Kumar, Sreekanth Kokkonda, John White, and Pradipsinh K. Rathod1

From the Department of Chemistry, University of Washington, Seattle, Washington 98195

Background: Topoisomerase II-disabling antibacterials and anticancer drugs exist but not antimalarials.Results: Engineered Plasmodium falciparum topoisomerase II (PfTopoII) led to a functional enzyme and to early inhibitors withantimalarial properties in cell-based assays.Conclusion: Pure, stable PfTopoII is now ready for advanced HTS and lead optimization studies.Significance: This biochemical platform should help accelerate antimalarial drug discovery.

Historically, type II topoisomerases have yielded clinicallyuseful drugs for the treatment of bacterial infections and cancer,but the corresponding enzymes from malaria parasites remainunderstudied. This is due to the general challenges of producingmalaria proteins in functional forms in heterologous expressionsystems. Here, we express full-length Plasmodium falciparumtopoisomerase II (PfTopoII) in a wheat germ cell-free transcrip-tion-translation system. Functional activity of soluble PfTopoIIfrom the translation lysates was confirmed through both aplasmid relaxation and a DNA decatenation activity that wasdependent on magnesium and ATP. To facilitate future drugdiscovery, a convenient and sensitive fluorescence assay wasestablished to follow DNA decatenation, and a stable, truncatedPfTopoII was engineered for high level enzyme production.PfTopoII was purified using a DNA affinity column. ExistingTopoII inhibitors previously developed for other non-malariaindications inhibited PfTopoII, as well as malaria parasites inculture at submicromolar concentrations. Even before optimi-zation, inhibitors of bacterial gyrase, GSK299423, ciprofloxacin,and etoposide exhibited 15-, 57-, and 3-fold selectivity for themalarial enzyme over human TopoII. Finally, it was possible touse the purified PfTopoII to dissect the different modes bywhich these varying classes of TopoII inhibitors could trap par-tially processed DNA. The present biochemical advancementswill allow high throughput chemical screening of compoundlibraries and lead optimization to develop new lines ofantimalarials.

With 300 –500 million clinical cases, each year, malariacauses more than 0.5 million deaths worldwide (1, 2). Amongthe five known human malaria parasites, Plasmodium falcipa-rum and Plasmodium vivax are the major agents of pathology.Repeated emergence of drug-resistant parasites demands acontinual search for new targets and new antimalarials (3–7).Malaria parasites proliferate through rapid asexual cell division

in humans. Starting with an estimated 10 –100 sporozoites,each incoming parasite expands exponentially to about 105 cellsin the liver and 1013 in red blood cells (8). All such parasitetransformations and growth involve continual but varying tran-scription and require smooth replication of the three parasitegenomes (nuclear, mitochondrial, and apicoplast).

In all living cells, DNA topoisomerases play a key role inproper DNA transcription, DNA replication, DNA repair, andoverall cell division (9 –15). These enzymes are responsible forrelieving DNA topological constraints that are generated dur-ing cellular activity on genomes. The obligatory requirement oftopoisomerases for cell function has been exploited to treatbacterial infections and cancer (10 –14). The fluoroquinoloneclass of inhibitors, like ciprofloxacin, target bacterial DNAgyrase and topoisomerase IV (10, 11). Newer piperidinylal-kylquinolines, like GSK299423, target bacterial gyrases (11, 14).Human topoisomerase IIs are targeted by etoposide and teni-poside (derivatives of podophyllotoxins) and doxorubicin anddaunorubicin (derivatives of anthracyclines) (12, 13).

Topoisomerases are broadly classified as type I or as type IIenzymes based on their mode of action on DNA (9, 15). Type Itopoisomerases are monomeric, metal ion-dependent, andATP-independent. They cleave a single-strand of DNA and, byswivel mechanisms, help to relax both negative and positiveDNA supercoils. Type II DNA topoisomerases are dimeric orheterotetrameric, ATP and metal ion-dependent. They bindDNA and cleave both strands to create a gate through which aneighboring duplex DNA can pass. Thus, type II enzymes canhelp to relax both negative and positive supercoils and can alsodecatenate and unknot tangled DNA (9, 15).

The malaria parasite nuclear genome codes for both type Iand type II topoisomerases. P. falciparum has two putative typeI enzymes (topoisomerase I and III) and three putative type IIenzymes (topoisomerases II and VI and DNA gyrase) (from thePlasmoDB: Plasmodium Genomics Resource and Ref. 17). Thefunctional unit of each topoisomerase I, II, and III is encoded bysingle gene, and each of topoisomerase VI and DNA gyrase isencoded by two gene products (from the PlasmoDB: Plasmo-dium Genomics Resource and Ref. 17). Even a decade aftersequencing of the malarial genome (17), biochemical functionsfor the majority of malarial topoisomerase are unrealized. Thisis directly related to the previous unavailability of dependable

* This work was supported, in whole or in part, by National Institutes of HealthGrants AI093380, AI099280, and AI089688. The authors declare that theyhave no conflicts of interest with the contents of this article.

1 Program Director of a National Institutes of Health International Center ofExcellence for Malaria Research for South Asia. To whom correspondenceshould be addressed. Tel.: 206-543-2937; Fax: 206-685-8665; E-mail:[email protected].

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 290, NO. 33, pp. 20313–20324, August 14, 2015© 2015 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

AUGUST 14, 2015 • VOLUME 290 • NUMBER 33 JOURNAL OF BIOLOGICAL CHEMISTRY 20313

by guest on September 25, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

heterologous systems to express functional malarial enzymes(18, 19). Except for the malarial DNA gyrase B (20), a subunit ofgyrase, and topoisomerase I (21), the remaining five malarialtopoisomerase genes have not been expressed successfully inheterologous expression systems. Further, gel-based assays thatare commonly used to study topoisomerase inhibitors are tedi-ous and not quantitative. Thus, in addition to obtaining pure,active enzyme, development of high throughput fluorescentassays for topoisomerases would greatly facilitate target-baseddrug development against malaria parasites (22, 23).

Recently, we demonstrated the broad utility of a wheat cell-free protein expression system to successfully express severalmalarial enzymes in functional form (24, 25). When malariagene codons are altered for expression in the wheat system, onesees improvement in the quality of functional protein and alsoincreased expression. In this report, we express milligramquantities of functional P. falciparum topoisomerase II, using awheat cell-free system and subsequently purifying the stableactive protein. A simple, sensitive fluorescent assay for topoi-somerase II was also established and, based on early work withexisting topoisomerase II inhibitors against other pathogens,we demonstrate that malarial topoisomerase II offers an oppor-tunity to identify and ultimately optimize species-specificmalarial topoisomerase inhibitors.

Experimental Procedures

Bioinformatics—Topoisomerase II proteins from P. falcipa-rum (PlasmoDB ID PF14_0316; new PlasmoDB ID PF3d7_1433500), P. vivax (PlasmoDB ID PVX_084855), Homo sapi-ens (TopoIIA: GenBankTM accession no. AAC77388.1 andTopoIIB: GenBankTM accession no. NM_001068.3), and Sac-charomyces cerevisiae (GenBankTM accession no. AAB36610.1)were aligned by ClustalW method on Genius software (Biom-atters, Ltd., Auckland, New Zealand). A model structure ofP. falciparum topoisomerase II (PfTopoII)2 was built based onthe available crystal structure of human and yeast topoisomer-ase IIs using Modeler and Rosetta tools (26, 27).

Subcloning of PfTopoII Gene into Cell-free Expression Vec-tor—Codons of the PfTopoII gene (PlasmoDB ID PF3d7_1433500) were optimized for wheat expression system andchemically synthesized with desired restriction sites on eachend of the gene (Life Technologies, Inc.). The PfTopoII syn-thetic gene and wheat cell-free plasmids were digested withrestriction enzymes and purified through gel extraction (Qia-gen). Ligated DNA samples were transformed into E. coli DH5�chemically competent cells (Life Technologies) and grownovernight on ampicillin-containing agar plates at 37 °C. Full-length gene insertion into cell-free expression plasmid was ver-ified by colony PCR (25). The active site mutant (Y829A) ofPfTopoII (PfTopoII-M) was constructed using the followingprimers: P1, 5�-AAGGACGCCTCCGCTGCGCGGGCTATC-TTTACCAAGCTCGCCTCCAGC-3� and P2, 5�-GCTGGAG-GCGAGCTTGGTAAAGATAGCCCGCGCAGCGGAGGC-

GTCCTT-3� and a QuikChange mutagenesis kit (Agilent Tech-nologies, Santa Clara, CA). The underlined bases in the primersequence represent the mutagenic site. Various truncatedforms of PfTopoII gene were also constructed based on domainassignments (see Fig. 4A) using primers listed in Table 1. Plas-mids were isolated using plasmid isolation kits (Qiagen), andtheir quality was checked and confirmed by DNA sequencing.These isolated plasmids were used for cell-free transcriptionand translation. A GFP-expressing plasmid (24, 25) was used asa positive control in wheat germ expression studies.

Wheat Germ Cell-free Transcription and Translation—Wheat germ lysate, an essential component of the wheat cell-free protein expression system, was prepared in-house (25).Cell-free transcription, translation, and radiolabeling of pro-teins by a batch method and translation by a dialysis methodwere described earlier (25). Before purifying PfTopoII-�CTD(construct IV as shown in Fig. 4) on a double-stranded DNA-cellulose column, fresh protocols for scaled up cell-free tran-scription and translations were established (see below).

A typical scaled up transcription reaction was carried out in40 ml with 3 mg of PfTopoII-�CTD gene-carrying plasmid, 80mM HEPES-KOH, pH 7.8, 16 mM magnesium acetate, 2 mM

spermidine, 50 mM �-mercaptoethanol, 1 kilounits of ribonu-clease inhibitor (New England Biolabs), 30 kilounits of SP6RNA polymerase (New England Biolabs, Ipswich, MA), and 3mM each of GTP, ATP, CTP, and UTP. The transcription mix-ture was incubated at 37 °C for 4 h. Turbidity appears duringthe transcription process because of pyrophosphate releasedfrom nucleotide triphosphates and �-mercaptoethanol fromthe transcription mixture. At the end of transcription, such aprecipitate was removed by centrifuging at 8,000 � g for 2 min,and the supernatant was collected. To eliminate the PfTopoII-�CTD coding plasmid from mRNA, the supernatant wastreated with 1000 units of TURBO DNase and 2 ml of 10�reaction buffer (Life Technologies, Inc.) at 37 °C for 1 h. ThisDNase treatment was to digest the internal DNA transcriptiontemplates that could compete with DNA-cellulose for bind-ing to PfTopoII-�CTD. After the treatment, DNase from thePfTopoII-�CTD mRNA was denatured by phenol chloroformextraction, and the mRNA was recovered in the aqueous phaseon Phase Lock Gel (5 Prime, Inc., Gaithersburg, MD). Theaqueous phase contained PfTopoII-�CTD DNA-free mRNA,and this was ethanol-precipitated, washed with 70% ethanol,and solubilized in 15 ml of autoclaved distilled water.

Cell-free translation of purified PfTopoII-�CTD mRNA wascarried out using a dialysis reaction method (25). Starting with15 ml of PfTopoII-�CTD, 40 mg of mRNA, 1600 units of wheatgerm lysate (280 mg of protein), 8 mg of creatine kinase, 1000units of ribonuclease inhibitor, and 8 ml of 5� protein expres-sion buffer (1- protein expression buffer: 30 mM HEPES-KOH,pH 7.8, 100 mM potassium acetate, 2.7 mM magnesium acetate,5 mM DTT, 0.4 mM spermidine, 0.3 mM each of 20 amino acids,1.2 mM ATP, 0.25 mM GTP, 16 mM creatine phosphate), thevolume was adjusted to 40 ml with autoclaved distilled water.Each 20-ml portion of translation reaction mixture was placedin a 2.5 � 75-cm cellulose membrane tube (12,000 –14,000molecular weight cutoff; Spectrum Laboratories, Inc., RanchoDominguez, CA). The dialysis tubes were sealed, and the reac-

2 The abbreviations used are: PfTopoII, P. falciparum topoisomerase II; kDNA,kinetoplast catenated DNA; NAD, N-terminal ATPase domain; CRD, cleav-age reunion domain; CTD, C-terminal domain; TAE buffer, 40 mM Tris ace-tate with 1 mM EDTA at pH 8.3.

P. falciparum Topoisomerase II

20314 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 33 • AUGUST 14, 2015


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tion mixture was distributed evenly along the length of the dial-ysis tube. It was then immersed in 200 ml of 1� protein expres-sion buffer and incubated at 26 °C for 36 h. At the end,translated samples were spun at 20,000 � g for 15 min at 4 °C,and the soluble fraction was used for enzyme purification.

Gel-based Topoisomerase II Assay—The catalytic function ofcell-free translated full-length PfTopoII and its truncated vari-ations were tested based on eukaryotic type II topoisomeraseprotocols (28). A typical 40-�l reaction contained topoisomer-ase II assay buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10mM MgCl2, 5 mM DTT, and 2 mM ATP), 180 ng of kinetoplastcatenated DNA (kDNA) from the insect parasite Crithidia fas-ciculate (Topogen, Inc., Port Orange, FL), or 180 ng of super-coiled pUC18 plasmid and appropriate quantities of PfTopoII,PfTopoII-M, or GFP translated lysates. At the end of 30 min ofincubation at 26 °C, the reactions were stopped by adding 5 �lof 0.25 M EDTA. Topoisomerase II-catalyzed reaction productswere resolved from their reaction substrates on 1% agarose gelin TAE buffer (40 mM Tris acetate with 1 mM EDTA at pH 8.3)and visualized by ethidium bromide. The supercoiled pUC18plasmid for relaxation assay and as a marker was prepared usingQiagen plasmid isolation kits followed by dissolving plasmidDNA in Tris-EDTA buffer (10 mM Tris-HCl, pH 8.0, and 1 mM

EDTA) and stored at 4 °C. The relaxed plasmid marker wasprepared in 0.5 ml of relaxation buffer (50 mM Tris-HCl, pH 7.5,100 mM NaCl, and 1 mM DTT) containing 100 �g of supercoiledpUC18 plasmid and 200 units of vaccinia virus topoisomerase I(Epicenter, Madison, WI) followed by incubation at 37 °C for1 h. Topoisomerase I from the reaction mixture was denaturedby phenol chloroform extraction, and the relaxed plasmid wasrecovered in aqueous phase on the phase lock gel. The relaxedplasmid in the aqueous phase was ethanol-precipitated, dis-solved in Tris-EDTA buffer, and stored at 4 °C.

Fluorescence Assay for Topoisomerase II—The quick andconvenient fluorescence decatenation assay is based on selec-tive precipitation of large starting kDNA networks by centrifu-gation (34), followed by fluorescent quantification of releaseddecatenated DNA products in supernatant solutions usingSYBR Green I (Life Technologies, Inc.). The topoisomerase IIassays were set up as described for the gel-based decatenationassay (see above). After stopping the reactions with EDTA,samples were spun at 13,000 � g for 10 min to precipitate unre-acted kDNA. Supernatants of 30 �l were mixed with 60 �l of13,000-fold, TAE-diluted SYBR Green I and fluorescence wasmeasured on a multi-mode microplate reader, Synarge 4(BioTek Instruments, Inc., Winooski, VT). Decatenated DNAproducts from the supernatants were quantified using a DNAcalibration curve. In anticipation of using DMSO with inhibi-tors, various concentrations (v/v) of DMSO were added at thestart of decatenation assay to follow any changes in activity.Direct effects of changes in DNA fluorescence caused by sol-vent changes were assessed separately.

Purification of Cell-free Expressed PfTopoII-�CTD—Wheatcell-free translated untagged PfTopoII-�CTD was purified ondsDNA-cellulose column. To a 40-ml supernatant of PfTopoII-�CTD translated lysate, 200 ml of binding buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA and 5 mM DTT) and 300mg of dsDNA cellulose (Sigma-Aldrich) were added and mag-

netically stirred for 3 h. Sample was then loaded onto a columnand washed with 50 ml of wash buffer (50 mM Tris-HCl, pH 8.0,125 mM NaCl, 1 mM EDTA, and 5 mM DTT). DNA-boundPfTopoII-�CTD was eluted in 15 ml of high salt buffer (50 mM

Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, and 5 mM DTT).Eluted samples were concentrated and further purified on anAKTA system connected to a Sephadex G-200 column (GEHealthcare) equilibrated with high salt buffer. Column-elutedPfTopoII-CTD-containing samples were pooled, concentrated,and equilibrated with binding buffer containing 10 mM MgCl2and 2 mM ATP. Concentrated PfTopoII-�CTD protein wasquantified using the Bradford method (29) (Bio-Rad). From a40-ml translation, 0.3 mg of pure PfTopoII-�CTD protein wascollected with a specific activity of 100 mg of decatenated DNAh�1 mg�1.

Primary Structure of the Purified PfTopoII-�CTD—Enzymeeluted from the Sephadex G-200 column above was analyzedby mass spectrophotometry to validate its makeup. PurifiedPfTopoII-�CTD (100 �g) was dissolved in a denaturationbuffer (8 M urea, 0.1 M ammonium bicarbonate, pH 8.0, and 12mM DTT). After incubation at 37 °C for 30 min, iodoacetamidewas added to 40 mM and incubated at room temperature for 1 h.The denatured protein was then diluted 10 times with 0.1 M

ammonium bicarbonate, followed by overnight digestion at37 °C with 1 �g of trypsin (Promega, Madison, WI). Proteolysiswas stopped by adding formic acid to 0.1%. The peptides werethen analyzed with Finnigan LTQ ion trap mass spectrometer((Thermo Fisher Scientific) with Agilent 1100 capillary liquidchromatography inlet (Santa Clara, CA). Data were analyzedwith Proteome Discoverer 1.4 from Thermo Fisher Scientific.

Synthesis of GSK299423—GSK299423 synthesis was carriedout using three key intermediates (14). Oxathiolo-pyridine-car-baldehyde was derived from commercially available kojic acid(Sigma-Aldrich), and cyano-quinoline-piperidine amine wassynthesized from 4-ethenyl-6-(methyloxy)-3-quinolinecarbo-nitrile (Sigma-Aldrich). Finally, the target GSK299423 wasderived from reductive amination of the above aldehyde andthe amine provided, and its structure was confirmed by 1HNMR and electrospray ionization-MS.

Inhibitor Binding Studies—Select type II topoisomeraseinhibitors were tested on PfTopoII, PfTopoII-�CTD, andhuman TopoII� using the newly established fluorescence as-say (see above). Inhibitory activities of test compounds onPfTopoII-�CTD were tested in the presence of 100 mM NaCl inthe assay buffer. For full-length PfTopoII and human TopoII�assays, NaCl concentration was set at 150 mM. Various concen-trations of etoposide (Sigma-Aldrich), ciprofloxacin (Enzo LifeSciences, Inc., Farmingdale, NY), and GSK299423 were pre-pared in 60% DMSO. Aliquots (2 �l) of concentrated inhibitorsin 60% DMSO were added to the decatenation reaction mix-ture, and the assays were initiated by adding 0.5 �g of PfTopoII,or 1 unit of human TopoII� (Topogen, Inc., Port Orange, FL).At the end of 30 min of incubation at 26 °C, reactions werestopped by adding EDTA, and fluorescence of decatenatedDNA was measured as described (see above). Half-maximalinhibitory concentrations (IC50) for all inhibitors were calcu-lated on GraphPad Prism (GraphPad Software, Inc., La Jolla,CA).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DNA Cleavage Assay—Plasmid DNA cleavage assays werecarried out as reported (14) with a few modifications. Topoi-somerase II-catalyzed plasmid relaxation assays used solventsand buffers described above for the gel-based topoisomerase IIassays. A total volume of 20 �l, with various quantities of inhib-itors in DMSO (or plain 3% DMSO), was added to 30 ng ofpurified PfTopoII-�CTD. After 30 min at 26 °C, reactions werestopped by adding SDS to 0.2% followed by proteinase K (LifeTechnologies, Inc.) treatment for 30 min at 37 °C. Samples wereresolved overnight by 1% agarose gel electrophoresis in TAEbuffer, at 1 V/cm and visualized using ethidium bromide at0.1%.

Testing of Inhibitors on Malarial Parasites—Inhibition ofproliferation of P. falciparum clones, 3D7, Dd2, and HB3 (3, 4)or mouse L1210 cells (22) by select type II topoisomerase inhib-itors was measured by following the uptake of radioactivehypoxanthine (30).

Results

Bioinformatics Analysis of PF3d7_1433500 —A putative4419-base pair DNA sequence of P. falciparum DNA topoi-somerase II (PfTopoII) was identified on PlasmoDB (PF3d7_1433500; old ID PF14_0316). The predicted 1472-amino acidprotein sequence of PfTopoII was aligned to topoisomerase IIsof S. cerevisiae (ScTopoII) and H. sapiens (HsTopoII� andHsTopoII�) (Fig. 1A). Including an insertion of a 67-amino acidasparagine-rich sequence (between amino acids 306 and 375),PfTopoII had 40 and 36% identity to human and yeast topoi-somerase IIs, respectively. Three distinct functional domainswithin PfTopoII were identified based on available biochemicalinformation from yeast (28, 31) and human topoisomerase II(32) (Fig. 1B): a N-terminal ATPase domain (NAD), a centralDNA cleavage reunion domain (CRD), and a C-terminaldomain (CTD) with uncertain function. An essential catalytictyrosine that is directly involved in cleavage and reunion ofDNA, Tyr-805 of HsTopoII�, Tyr-821 of HsTopoII�, and Tyr-783 of ScTopoII, aligned to Tyr-829 of PfTopoII.

PF3d7_1433500 Gene Product Is a Type II Topoisomerase—Asystematic effort was devoted to conclusively demonstratetopoisomerase function from PF3d7_1433500. Just as expres-sion of functional malarial proteins in heterologous cell-basedsystems has been difficult for the malaria community (18, 19),attempts to express PfTopoII have also been difficult (33). Ourrecent success in expression of a large set of active malariaenzymes in a wheat cell-free expression system (24, 25) encour-aged us to subclone a wheat-optimized, chemically synthesizedPfTopoII gene into a cell-free expression vector for wheat-

based translation. In parallel, a vector was prepared to expressan active-site mutant (Y829A) form of PfTopoII. This served asa control for potential background topoisomerase catalyticactivity from wheat extract. Finally, a GFP-expressing vectorserved as a control to monitor the quality of the translationpreparations.

First, expression of full-length PfTopoII and PfTopoII-M(the active-site mutant) was confirmed by autoradiographyupon protein synthesis in the presence of radioactive aminoacids (Fig. 2A). The protein products were seen as single entitieswith the expected mass of 169 kDa (Fig. 2A). Next, catalyticfunction of PfTopoII was tested using scaled up, cell-free trans-lation lysates and nonradioactive amino acids. In a simple directassay, relaxed plasmid product was produced from supercoiledDNA in the presence of PfTopoII translated lysate, and onlywhen both magnesium and ATP were present (Fig. 2B). ThePfTopoII function was further confirmed by a more demandingdecatenation assay (Fig. 2C). Time-dependent release of decat-enated products from kDNA was seen from PfTopoII trans-lated lysates, but not from the active site mutant PfTopoII-Mnor from GFP translated lysates (Fig. 2D). This decatenation ofkDNA by PfTopoII was dependent on both magnesium andATP. Based on these data, we conclude that the 169-kDa full-length protein product of PF3d7_1433500 is a functionallyactive type II topoisomerase.

Fluorescence-based Decatenation Assay for TopoisomeraseII—Type II topoisomerase gel-based assays, although informa-tive about the state of the DNA substrates and products, are notwell suited for screening of many chemical inhibitors. Othershave tried alternatives such as tracking the ATPase function oftype II topoisomerase using coupled enzymes (34), supercoil-specific triplex DNA formation (35), flow injection-baseddecatenation (36), and dual color fluorescence cross-correla-tion spectroscopy (37). We sought a simple, direct, selective,and sensitive fluorescence assay that tracked the decatenationactivity of TopoII. Ideally, such an assay would be sensitive tothe full natural catalytic cycle of type II topoisomerase enzymesand not give false signals with enzymes that nick singlestrands of DNA. Below, we describe a fluorescence-baseddecatenation assay that relies on selective precipitation ofkDNA substrate networks, by centrifugation, away fromTopoII-catalyzed decatenated products (38).

During method validation, decatenation reactions were ini-tiated with PfTopoII, PfTopoII-M, and GFP translated lysatesand then stopped at various time intervals using EDTA (see“Experimental Procedures”). The aliquots were first analyzed

FIGURE 1. Protein sequence of P. falciparum topoisomerase II (PF3d7_1433500). A, confidence in the annotated DNA and predicted protein function ofPF3d7_1433500 comes in part from the highly conserved nature of this gene compared with PvTopoII, HsTopoII�, HsTopoII�, and ScTopoII. Dark boxesrepresent identical amino acids, and gaps represent insertions in some but not all species. B, overall organization of three typical functional organization ofeukaryotic topoisomerase IIs. See Fig. 4 for more details.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

on agarose gel before and after centrifugation to remove cate-nated kDNA substrate. Before centrifugation, both startingkDNA and decatenated DNA product were seen in reactionsrun with PfTopoII, but only the starting kDNA substrate wasseen in control reactions with PfTopoII-M or GFP (Fig. 3A).After centrifugation, kDNA substrate was absent in all samples(Fig. 3A). Because only the PfTopoII catalyzed reactionsshowed decatenated DNA products, the stage was set for a

rapid method to selectively detect decatenated DNA products.To visualize products as a fluorescent signal, the supernatantsamples of decatenation reactions were mixed with the DNAbinding dye, SYBR Green I. Initially, at time 0, fluorescence insamples containing kDNA, SYBR Green I, and translatedlysates of PfTopoII, PfTopoII-M, or GFP was nearly identical.

FIGURE 2. Wheat cell-free expression and functional characterization ofPfTopoII. A, demonstration of full-length PfTopoII protein production usingan autoradiogram of freshly translated radiolabeled GFP (translation systemcontrol), PfTopoII, and PfTopoII-M (an active site mutant) using a wheat germcell-free expression system. Total (T), pellet (P), and soluble (S) fractions wereprepared as detailed under “Experimental Procedures.” B, demonstration ofATP-dependent and Mg2�-dependent topoisomerase activity from PfTopoIIusing a gel-based plasmid relaxation assay. Electrophoretic mobility ofrelaxed plasmid product is shown in first lane marked R and that of the super-coiled substrate is shown in the second lane marked S. Successful relaxation ofsupercoiled plasmid DNA occurred when both ATP and Mg2� were presentwith PfTopoII (lane 5) but neither with GFP translated lysate (lane 6) nor with invitro translated PfTopoII with an active site mutation (lane 7). C, demonstra-tion of full decatanation (Decat.) of kinetoplast DNA by PfTopoII. Release oflow molecular weight, high mobility decatenated DNA was followed by elec-trophoresis. Time-dependent decatenation was observed when the assayincluded aliquots of freshly translated PfTopoII, but not with proportionalamounts of freshly translated GFP or PfTopoII-M or if translation extract wasleft out ((�) Ext.). M, decatenated DNA marker mobility positions.

FIGURE 3. A simple, sensitive, and selective fluorescence-based decat-enation assay for topoisomerase II. A, gel-based separation of catenatedDNA substrates and decatenated DNA before and after centrifugation. DNAdecatenated products formed by incubation with PfTopoII (lanes 5–7 and13–15) but not control lysates (GFP, mutant PfTopoII; lanes 2–3, 8 –10, 16, and17). The decatenated product remained in solution after centrifugation (lanes13–15). Catenated starting DNA was visible before centrifugation but notafter centrifugation (lanes 11–17). B, time-dependent, PfTopoII-generateddecatenated DNA products was measured by fluorescence in the superna-tant using a DNA binding dye. Control lysates (GFP or mutant PfTopoII-m)failed to generate fluorescent decatenated DNA in the supernatant. C, stim-ulation of malarial PfTopoII activity by DMSO.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

After centrifugation, as the kDNA pelleted out, more than 95%of the fluorescence decreased (Fig. 3B), which is consistent withthe data from the agarose gel (Fig. 3A). In a time-dependentanalysis of potential decatenation involving PfTopoII translatedlysates, there was a linear increase in fluorescence in the super-natant after centrifugation in the presence of PfTopoII for up to30 min. Such a response was absent in PfTopoII-M and GFPinitiated reactions. The large increase in fluorescent signal inPfTopoII catalyzed reactions, but not in PfTopoII-M or GFP,validates the sensitivity and selectivity of this fluorescencedecatenation assay.

Next, in anticipation of using this convenient assay with non-polar potential inhibitors of PfTopoII, the effect of DMSO onPfTopoII activity was tested. As the DMSO concentrationincreased from 0 to 2%, PfTopoII decatenation activity in-creased by 2-fold compared with reactions without DMSO (Fig.3C). The stimulation peaked at 3% DMSO, after which therewas a steep decrease. Complete inhibition of PfTopoII was seenwhen DMSO exceeded 9% (v/v). Controls showed no change influorescent DNA quantities with kDNA alone, GFP, orPfTopoII-M at all tested DMSO concentrations (Fig. 3C).

Stabilization and Purification of Functional PfTopoII, Lack-ing CTD—In preliminary studies, the full PfTopoII enzymebecame inactive within a few hours after early purificationsteps. The native enzyme is expected to be a dimer of a singlepolypeptide, each carrying a NAD, a CRD in the middle, and aCTD of unknown function (Fig. 4A). Gene fragments, corre-sponding to NAD, CRD, and CTD, and a combined NAD-CRDor CRD-CTD were cloned separately into a cell-free expressionvector (Table 1 and Fig. 4A). Cell-free expression from thesetruncated gene sequences yielded soluble protein (Fig. 4B). Inthe presence of 0 and 50 mM NaCl, none of constructs, includ-ing full-length PfTopoII, displayed detectable decatenationactivity (Fig. 4C). At 150 mM NaCl, maximum decatenationactivity was seen in full-length PfTopoII, and at 100 mM NaCl,the ATPase-cleavage reunion domain (NAD-CRD) showedmaximum decatenation activity.

Decatenation activity in NAD-CRD translated lysate indi-cated that the CTD of PfTopoII was dispensable for the in vitrocatalytic function of PfTopoII. The ATPase and the cleavagereunion domain were necessary and sufficient for the catalyticfunction of topoisomerase II. Hereafter, the ATPase-cleavagereunion domain (NAD-CRD) is named PfTopoII-�CTD. Inci-dentally, the NAD domain could not complement TopoII func-tion in trans to the CRD-CTD unit: when mRNAs derived fromplasmids harboring NAD and CRD-CTD gene fragments wereco-expressed in a cell-free system (sample NAD � CRD-CTDin Fig. 4B), there was no decatenation activity using 0 –200 mM

NaCl (NAD � CRD-CTD in Fig. 4C).Deletion of CTD from PfTopoII improved functional stabil-

ity and permitted purification of PfTopoII-�CTD with fulldecatenation activity. We exploited the enzymatic properties ofPfTopoII to facilitate purification. As described above, optimalsalt concentrations were required for turnover of DNA byPfTopoII. It is possible that, during the catalytic cycle, at highsalt concentrations, PfTopoII is unable to bind DNA to initiatethe cleavage reaction, and at low salt concentrations, PfTopoIIis not released from religated DNA. We further hypothesized

that PfTopoII-�CTD would bind to DNA in a magnesium-freeenvironment but not cleave DNA and that such binding couldbe reversed by higher salt concentrations. To test this “bind andrelease” strategy for enzyme purification, it was necessary tomodify the cell-free transcription protocol to minimize theamount of residual DNA plasmid/template to help promotebinding of PfTopoII-�CTD protein on DNA-cellulose. Thus,after transcription but before initiation of cell-free PfTopoII-�CTD synthesis, DNA template was digested with TurboDNase. The DNase was subsequently denatured and removed

FIGURE 4. Molecular dissection of full-length PfTopoII to isolate a pure,stable functional PfTopoII construct with full ATP and Mg2�-dependentDNA decatenation activity. A, five new combinations of the three predictedPfTopoII domains were constructed (individually and in pairs) and tested forfull topoisomerase functions. B, an autoradiogram demonstrating solubleexpression of single-sized, radiolabeled truncated derivatives of PfTopoII. Sol-ubility of the expressed proteins was confirmed by showing good represen-tation in the soluble (S) fractions compared with the total (T) fraction in thewheat germ expression system. C, demonstration of decatenation activity inthe PfTopoII-�CTD construct carrying NAD-CRD but lacking CTD. The decat-enation function of PfTopoII-�CTD domain was stimulated by 50 –100 mM

NaCl, slightly less than that required for full-length PfTopoII (100 –150 mM). D,demonstration of purity of PfTopoII-�CTD construct by SDS-PAGE, depen-dent DNA affinity chromatography (see “Experimental Procedures”).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

from mRNA transcripts by phenol-chloroform extraction.After translation, upon binding of PfTopoII-�CTD to DNA-cellulose in a magnesium-free environment, decatenationactivity in total and flow through samples was quantified. Theflow through fractions contained only 20% of the initial activity,indicating efficient binding of PfTopoII-�CTD to the DNA-cellulose column. Washing with up to 125 mM salt concentra-tion did not release PfTopoII-�CTD from the DNA column.Further increase in salt concentration to 150 –200 mM resultedin complete release of PfTopoII-�CTD from the DNA column.Final purification on a gel filtration column yielded more than90% pure dimeric PfTopoII-�CTD (Fig. 4D). The identity andamino acid sequence of purified PfTopoII-�CTD was con-firmed by mass spectroscopy (see “Experimental Procedures”).Storage of purified PfTopoII-�CTD for more than 3 weeks at4 °C in the presence of magnesium and ATP resulted in no lossin decatenation activity.

Inhibition of PfTopoII by Type II Topoisomerase Inhibitors—Type II topoisomerases are targeted by many antibacterial (10,11, 14) and anticancer agents (12, 13). Different classes of inhib-itors bind differently to type II topoisomerases with differentmode of inhibition (see Fig. 6B). After purifying functionalPfTopoII-�CTD and establishing a fluorescent assay, thepotency and selectivity of known type II topoisomerase inhibi-tors against the malaria enzyme were tested. Representativeinhibitors from each of three classes of inhibitors were cho-sen: GSK299423 (a piperidinylalkylquinoline), ciprofloxacin(a fluoroquinolone), and etoposide (a epipodophyllotoxin).GSK299423 was synthesized (Fig. 5A) as reported (14), and theother two inhibitors were from a commercial source.

Initially, we confirmed that full-length PfTopoII from trans-lated lysate and the truncated, purified PfTopoII-�CTD hadcomparable inhibitor binding properties (Table 2). To testpotential selectivity of GSK299423, ciprofloxacin, and etopo-side, parallel inhibition studies were carried out on HsTopoII�.GSK29942, a bacterial gyrase inhibitor, inhibited decatenationfunction of PfTopoII and PfTopoII-�CTD with a half-maximalinhibitory concentrations (IC50) of 0.6 � 0.2 and 2.5 � 0.3 �M,respectively. This compound displayed less potency towardHsTopoII� with an IC50 of 10 � 2 �M (Fig. 5B). GSK299423inhibited growth of 3D7, Dd2, and HB3 clones of P. falciparumwith IC50 of 2.0 � 0.1, 6.4 � 1.7, and 2.1 � 0.7 �M respectively,while displaying at least 50-fold less potency (EC50 � 100)against mouse lymphocytic leukemia cells (L1210) (Table 2).Ciprofloxacin, another bacterial gyrase inhibitor, was 50-fold

selective toward PfTopoII over HsTopoII�. It displayed 41-foldselectivity toward proliferating parasite cells over mouse celllines (Table 2). Etoposide, a HsTopoII� inhibitor, displayedsimilar inhibition activity on both PfTopoII and hTopoII�(Table 2). PfTopoII inhibitor binding pockets appear to be sim-ilar to bacterial Type II topoisomerases because of similaramino acids at inhibitor binding pockets and possibly becauseof similar effects from distant sites in the large, complexenzyme system.

Next, we explored the mechanisms by which each of thesecompounds blocked the complex catalytic cycle of PfTopoII.Etoposide is known to make double-stranded DNA breaksin HsTopoII-catalyzed reactions (12). On the other hand,GSK299423 creates single-stranded DNA breaks in gyrase-cat-alyzed reactions (14). To determine whether and which types ofDNA breaks are generated in malarial topoisomerase II-cata-lyzed reactions, we tested these two compounds in a plasmidrelaxation assay with purified PfTopoII-�CTD. Relaxationreactions were stopped by SDS and treated with proteinase K todigest DNA bound PfTopoII-�CTD. DNA was resolved on 1%agarose gel and visualized by ethidium bromide. In a controlreaction with PfTopoII-�CTD alone, all supercoiled plasmidwas converted into relaxed plasmid (Fig. 5C). Upon addition ofthe highest concentration (50 �M) etoposide to the relaxationreaction, plasmid not only relaxed, but also created an addi-tional DNA band (arrow), which was of similar size to a linear-ized plasmid. This suggests that etoposide-treated PfTopoIIfreezes the enzyme after making double-stranded DNA breaks,just as seen with the mammalian enzymes. As the concentra-tion of etoposide decreased, the corresponding linear plasmidband intensity decreased. In contrast, such double-strand DNAbreaks were not generated in the presence of GSK299423 ordanofloxacin (a control). Just as seen with the purified enzyme,etoposide-mediated TopoII-cleaved nuclear genomic DNAwas previously reported in P. falciparum cells (39). Together,these results confirm that etoposide can target nuclear local-ized PfTopoII and cause cell death through double-strandedDNA breaks.

Inhibition by the highest concentration (25 �M) ofGSK299423, as viewed by plasmid relaxation assay, showedcomplete inhibition of PfTopoII-�CTD but arrested PfTopoIIfunction differently compared with etoposide (Fig. 5C). Reduc-ing GSK299423 concentration down to 5 �M allowed the super-coiled DNA plasmid substrate to relax, but this created a DNAproduct with a size characteristic of a plasmid with a single-

TABLE 1Primers used to construct various truncated PfTopoIIs

Constructs(amino acid positions)

Nucleotidepositions Sequence (5�3 3�)a

NAD (1–474) 1–1422 Forward: ATACCTCGAGATGGCCAAGAACAAGACCATCGAGReverse: GATACGGCCGTCATCAGATGATGCGCTCCCGGGC

CRD (469–1212) 1405–3636 Forward: ATACCTCGAGATGGCCCGGGAGCGCATCATCReverse: GTATCGGCCGTCATCAGTTGGACTCCTCGCGGTTGGA

CTD (1206–1472) 3616–4416 Forward: ATACCTCGAGATGTCCAACCGCGAGGAGTCCAACReverse: ATAGCGGCCGTCATCAGATGTTGTAGCT

NAD-CRD (1–1212) 1–3636 Forward: ATACCTCGAGATGGCCAAGAACAAGACCATCGAGReverse: GTATCGGCCGTCATCAGTTGGACTCCTCGCGGTTGGA

CRD-CTD (469–1472) 1405–4416 Forward: ATACCTCGAGATGGCCAAGAACAAGACCATCGAGReverse: ATAGCGGCCGTCATCAGATGTTGTAGCT

a Restriction sites are shown in italics, and start and stop sites are underlined.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

stranded DNA break. The absence of similar breaks in the pres-ence of danofloxacin or etoposide (Fig. 5C) indicates thatGSK299423 allows PfTopoII to generate asymmetric single-stranded DNA breaks at the DNA binding site. Overall, theavailability of pure fully functional PfTopoII will not only allowdiscovery of new antimalarial leads and their optimization butalso inform on their potentially varying modes of action.

Discussion

With potentially decreasing efficacy of artemisinin-basedantimalarials (5, 7), there is an urgent need to identify safe,effective drugs against malaria that work through novel mech-anisms for this disease. The current global antimalarial drug

portfolio is rich in artemisinin derivatives and related syntheticendoperoxides, but with few new chemical warheads with newmodes of action (Medicines for Malaria Venture). The currentportfolio of new, upstream targets is still very limited, there is ahigh attrition rate of candidate inhibitors, and many of thesecompounds will have to be deployed jointly as part of novelcombinations.

One important way to develop new antimalarials is to iden-tify new targets based on successes with other infectious patho-gens and based on a priori knowledge of biology. Topoisomer-ase II, the target against many bacterial diseases, plays anobligatory role in cell growth. During all stages of the malaria

FIGURE 5. Inhibition of PfTopoII by chemical scaffolds known to inhibit TopoII from other cell types. A, chemical scheme for the synthesis of bacterialgyrase inhibitor, GSK299423. B, selective inhibition of PfTopoII and PfTopoII-�CTD over HsTopoII� by GSK299423. C, modes of action of different topoisomerasefunctions by examining the fates of supercoiled DNA in contact with inhibited PfTopoII. Etoposide and GSK299423 captured single- as well as double-strandedDNA breaks, as represented by appearance of nicked and linearized plasmid in PfTopoII catalyzed reactions.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

life cycle, the processes of cell maintenance, cell division, cellrepair, and cellular mating are expected to generate entangledchromatids that must be separated for normal function andgrowth. Transcription and replication around antiparallel dou-ble-stranded DNA creates topological constraints and super-coiling tension both in front of and behind DNA sequencesengaged in replication and transcription (9 –13, 15). Withoutfully functional topoisomerase II, malaria parasites would sufferfrom stalled transcription and replication and would experi-ence rapid cell death. In recent years, large scale genomic stud-ies have further affirmed the value of topoisomerase II as apotential drug target.

PfTopoII is a single copy gene on chromosome 14, and itsexpression is seen across all stages of the parasite life cycle(from the PlasmoDB: Plasmodium Genomics Resource andRefs. 41 and 42). Within malarial parasite cells, PfTopoII pro-tein is localized to the nucleus (41– 44). Extensive proteomicstudies also identified PfTopoII expression across all asexualand sexual stages of parasite (44 – 47). Pioneering studies withpartially purified parasite lysate have suggested that ATP andmagnesium-dependent decatenation activities in parasitelysates are sensitive to both prokaryotic and eukaryotic type IItopoisomerase inhibitors (48, 49). Further progress in under-standing PfTopoII function and inhibitor binding propertiesand in exploiting newer tools in drug discovery such as highthroughput screens, structure-based drug discovery, and mod-ern iterative lead optimization campaigns are hampered by lackof an active malaria target protein in large quantities.

As an extension of our long time interest in exploiting host-parasite differences in nucleotide and DNA metabolism forantimalarial discovery (24, 25, 30, 50 –52), we sought to developa robust platform for developing species-specific malarialtopoisomerase II inhibitors. By utilizing a wheat cell-free sys-tem to produce functional malaria enzymes (24, 25), it was pos-sible to express PfTopoII in functionally active form. A topoi-somerase II fluorescent assay was developed that is simple,sensitive, and selective, and we identified optimum assay sol-vents to get maximum activity from the recombinant protein.Through construction of various truncated forms of PfTopoIIgene followed by expressing in cell-free system, we learned thatdouble-strand DNA cleavage, ATP-dependent strand passageof a different DNA through the break and re-ligation of cleavedDNA by PfTopoII require a covalently connected NAD domainand CRD domain, but that the C terminus domain is expend-

able. Finally, a salt-dependent DNA affinity chromatographystep helped purify stable malarial PfTopoII-�CTD that had fulldecatenation activity.

Existing topoisomerase inhibitors developed for otherindications can both serve as an inspiration for developinginhibitors tailored for treating malaria and provide a startingframework for developing Plasmodium TopoII inhibitors. Rep-resentatives of the three prototype bacterial and human type IItopoisomerase inhibitor classes discussed here are ciprofloxa-cin, GSK299423, and etoposide (Fig. 6A). All three type II DNAtopoisomerases were active against purified PfTopoII (Table 2and Fig. 5B). Etoposide, often used for treating human cancers,displayed no significant selective inhibition of PfTopoII over

TABLE 2Type II topo inhibitors selectively inhibit malarial enzyme

GSK299423 Ciprofloxacin Etoposide

�M �M �M

IC50 of target enzymesPfTopoII 0.6 � 0.2 35 � 9 20 � 4PfTopoII-�CTD 2.5 � 0.3 63 � 13 17 � 1hTopoII 10 � 2 199957 68Selectivity 15 50 3

EC50 of cell lines3D7 2.0 � 0.1 2454 40Dd2 6.4 � 1.7HB3 2.1 � 0.7L1210 100 174056a 0.016Selectivity 50 70 -

a EC50 values are for human macrophages.

FIGURE 6. A molecular model highlights the different opportunities forinhibitors to bind PfTopoII. A, varied structures of well known potent inhib-itors that target type II topoisomerases. B, illustration of the interplaybetween TopoII protein, its affinity for DNA, and different niches preferred bydifferent TopoII inhibitors, as illustrated by a molecular model depictingwhere DNA (gray), ciprofloxacin (cyan), etoposide (purple), and GSK299423(green) would choose to bind hsTopoII� (dark gray). Conservation and poten-tial variations in amino acids in these inhibitor binding sites in PfTopoII arediscussed in the text.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

the human enzyme. However, importantly, mechanistic studiesshowed that etoposide-inhibited PfTopoII formed double-stranded DNA breaks as seen in the plasmid relaxation assay(Fig. 5C). This in vitro result with purified enzyme is consistentwith an earlier demonstration that etoposide treatment gener-ates genome-wide DNA breaks in P. falciparum (39). Theseresults are consistent with the idea that the etoposide target isthe nuclear-localized PfTopoII, although the challenge is tounderstand how this particular class of TopoII inhibitors maybe optimized and deployed with selectivity. Ciprofloxacin,heavily used as an antibacterial, has previously been tested as anexperimental inhibitor of P. falciparum (53–56), Trypanosomabrucei (57), and Leishmania panamensis (16, 58). In those stud-ies, without structural optimization, the compound showedmore than 70-fold selective inhibition of parasite cells overhuman macrophage cells (Table 2). In our current work, cip-rofloxacin inhibited purified PfTopoII with 50-fold selec-tively over the human enzyme, raising the possibility that thecellular selectivity arises from an intrinsic difference in spe-cies-specific target binding that can be improved through leadoptimization. Even more encouraging, the bacterial gyraseinhibitor GSK299423 showed 50-fold selective growth inhibi-tion of parasite cells over mammalian cells, and a significantcomponent seems to arise from the 15-fold intrinsic selec-tivity for the malarial PfTopoII over the human enzyme. Inour mode of action studies, unlike etoposide, GSK299423-inhibited PfTopoII generated single-stranded DNA breaks(Fig. 5C), as seen with treatment of bacterial gyrase withGSK299423 (14). Although the inhibitory activity of ciprofloxa-cin and GSK299423 correlates well between purified PfTopoIIand malaria parasite, additional studies are needed to solvecrystal structures of inhibitor-bound PfTopoII and to biochem-ical characterize the remaining topoisomerases and geneticallymanipulated parasites to rule out alternate possibility.

To help visualize the different modes by which these differ-ent type II topoisomerase inhibitors may act on the malariaenzyme with selectivity over the human enzyme, a schematicmodel was generated based on the crystal structures of inhibi-tor-protein-DNA tertiary complexes of HsTopoII� (40) andbacterial DNA gyrase (14). From an end view (Fig. 6B), the DNAsubstrate (gray) is wrapped by TopoII polypeptides (dark graysurface). Ciprofloxacin (cyan) makes contact with the enzyme(dark gray surface) and the DNA (gray) (Fig. 6B). The quinolonegroup of ciprofloxacin (cyan) rests between the DNA base pairs(gray), whereas the piperazine and carboxyl groups of the quin-olone contact the topoisomerase (14). In contrast, the new bac-terial DNA gyrase inhibitor, GSK299423 (green) inhibits topoi-somerases by a different mode (Fig. 6B). After inserting thequinoline-carbonitrile group into the DNA double-helix basepairs, the oxothiolo-pyridine group of GSK299423 sits on thetopoisomerase at a noncatalytic dimeric interface of the cleav-age reunion domains (14). Finally, the polycyclic core ofetoposide (purple) sits between DNA base pairs, whereas thediacetophenone end extends into the protein topoisomerase(Fig. 6B) (40). Superimposing the PfTopoII (PF3d7_1433500)sequence on the existing crystal structures from other speciespoints to a number of malarial amino acid residues that aredifferent in the parasite enzyme compared with the human

counterpart, in addition to other distant protein variations thatlikely contribute to selectivity. In a reported crystal structureshowing the binding mode of ciprofloxacin with topoisomer-ase, the carboxyl group of the quinolone contacted Ser-84 ofgyrase A (13). The corresponding residue in PfTopoII is Ser-786(Fig. 1D). Thus, selective inhibition of PfTopoII by GSK299423over the human enzyme may be due to the shared residuesbetween parasite and the bacterial enzymes at the interface ofthe cleavage reunion domains that are responsible for bacterialgyrase inhibition. There are also differences; the crystal struc-ture of Staphylococcus aureus gyrase-bound GSK299423 (14)displayed Met-121 as one of five important residues for se-lective inhibition of enzyme. The corresponding residue inPfTopoII is Ala-827 and in HsTopoII� and HsTopoII�, it isPro-803 and Pro-819, respectively. Lessons from malarial dihy-drofolate reductase-thymidylate synthase teach us that, in addi-tion to active site host-parasite differences in drug binding,other host-parasite differences such as expression levels andnature of gene regulation can also contribute to drug selectivityin unexpected ways (30).

In summary, we have expressed functional P. falciparumtopoisomerase II and developed fast reliable methods to purifyand assay the enzyme. With existing TopoII inhibitors, we havealso demonstrated that this platform is ready for screening newmolecules, for crystallization of this high value target, and forinformative lead optimization campaigns that should lead tonew classes of potent, lasting antimalarials.

Author Contributions—D. G. M. and P. K. R. conceived the bio-chemistry experiments, analyzed the data, and wrote the manuscript.S. Ku. analyzed the structural data and assisted in writing of the man-uscript. S. Ko. synthesized key inhibitors. J. W. conducted cell-basedexperiments and helped write the manuscript.

Acknowledgments—We thank Kalyan Krishnamoorthy for the pro-tein mass spectrometry protocol and Laura Chery for critically read-ing the manuscript.

References1. Murray, C. J., Rosenfeld, L. C., Lim, S. S., Andrews, K. G., Foreman, K. J.,

Haring, D., Fullman, N., Naghavi, M., Lozano, R., and Lopez, A. D. (2012)Global malaria mortality between 1980 and 2010: a systematic analysis.Lancet 379, 413– 431

2. WHO (2014) World Malaria Report, World Health Organization, Geneva,Swtzerland

3. Rathod, P. K., McErlean, T., and Lee, P. C. (1997) Variations in frequenciesof drug resistance in Plasmodium falciparum. Proc. Natl. Acad. Sci. U.S.A.94, 9389 –9393

4. Guler, J. L., Freeman, D. L., Ahyong, V., Patrapuvich, R., White, J., Gujjar,R., Phillips, M. A., DeRisi, J., and Rathod, P. K. (2013) Asexual populationsof the human malaria parasite, Plasmodium falciparum, use a two-stepgenomic strategy to acquire accurate, beneficial DNA amplifications.PLoS Pathog. 9, e1003375

5. Dondorp, A. M., Nosten, F., Yi, P., Das, D., Phyo, A. P., Tarning, J., Lwin,K. M., Ariey, F., Hanpithakpong, W., Lee, S. J., Ringwald, P., Silamut, K.,Imwong, M., Chotivanich, K., Lim, P., Herdman, T., An, S. S., Yeung, S.,Singhasivanon, P., Day, N. P., Lindegardh, N., Socheat, D., and White, N. J.(2009) Artemisinin resistance in Plasmodium falciparum malaria. N. Engl.J. Med. 361, 455– 467

6. Miller, L. H., Ackerman, H. C., Su, X. Z., and Wellems, T. E. (2013) Malariabiology and disease pathogenesis: insights for new treatments. Nat. Med.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19, 156 –1677. Ariey, F., Witkowski, B., Amaratunga, C., Beghain, J., Langlois, A. C.,

Khim, N., Kim, S., Duru, V., Bouchier, C., Ma, L., Lim, P., Leang, R., Duong,S., Sreng, S., Suon, S., Chuor, C. M., Bout, D. M., Ménard, S., Rogers, W. O.,Genton, B., Fandeur, T., Miotto, O., Ringwald, P., Le Bras, J., Berry, A.,Barale, J. C., Fairhurst, R. M., Benoit-Vical, F., Mercereau-Puijalon, O., andMénard, D. (2014) A molecular marker of artemisinin-resistant Plasmo-dium falciparum malaria. Nature 505, 50 –55

8. Kappe, S. H., Vaughan, A. M., Boddey, J. A., and Cowman, A. F. (2010)That was then but this is now: malaria research in the time of an eradica-tion agenda. Science 328, 862– 866

9. Wang, J. C. (1996) DNA topoisomerases. Annu. Rev. Biochem. 65,635– 692

10. Mitscher, L. A. (2005) Bacterial topoisomerase inhibitors: quinolone andpyridone antibacterial agents. Chem. Rev. 105, 559 –592

11. Widdowson, K., and Hennessy, A. (2010) Advances in structure-baseddrug design of novel bacterial topoisomerase inhibitors. Future Med.Chem. 2, 1619 –1622

12. Pommier, Y., Leo, E., Zhang, H., and Marchand, C. (2010) DNA topoi-somerases and their poisoning by anticancer and antibacterial drugs.Chem. Biol. 17, 421– 433

13. Nitiss, J. L. (2009) Targeting DNA topoisomerase II in cancer chemother-apy. Nat. Rev. Cancer 9, 338 –350

14. Bax, B. D., Chan, P. F., Eggleston, D. S., Fosberry, A., Gentry, D. R., Gorrec,F., Giordano, I., Hann, M. M., Hennessy, A., Hibbs, M., Huang, J., Jones, E.,Jones, J., Brown, K. K., Lewis, C. J., May, E. W., Saunders, M. R., Singh, O.,Spitzfaden, C. E., Shen, C., Shillings, A., Theobald, A. J., Wohlkonig, A.,Pearson, N. D., and Gwynn, M. N. (2010) Type IIA topoisomerase inhibi-tion by a new class of antibacterial agents. Nature 466, 935–940

15. Berger, J. M., Gamblin, S. J., Harrison, S. C., and Wang, J. C. (1996) Struc-ture and mechanism of DNA topoisomerase II. Nature 379, 225–232

16. Cortázar, T. M., Coombs, G. H., and Walker, J. (2007) Leishmania pana-mensis: comparative inhibition of nuclear DNA topoisomerase II enzymesfrom promastigotes and human macrophages reveals anti-parasite selec-tivity of fluoroquinolones, flavonoids and pentamidine. Exp. Parasitol.116, 475– 482

17. Gardner, M. J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R. W.,Carlton, J. M., Pain, A., Nelson, K. E., Bowman, S., Paulsen, I. T., James, K.,Eisen, J. A., Rutherford, K., Salzberg, S. L., Craig, A., Kyes, S., Chan, M. S.,Nene, V., Shallom, S. J., Suh, B., Peterson, J., Angiuoli, S., Pertea, M., Allen,J., Selengut, J., Haft, D., Mather, M. W., Vaidya, A. B., Martin, D. M.,Fairlamb, A. H., Fraunholz, M. J., Roos, D. S., Ralph, S. A., McFadden, G. I.,Cummings, L. M., Subramanian, G. M., Mungall, C., Venter, J. C., Carucci,D. J., Hoffman, S. L., Newbold, C., Davis, R. W., Fraser, C. M., and Barrell,B. (2002) Genome sequence of the human malaria parasite Plasmodiumfalciparum. Nature 419, 498 –511

18. Mehlin, C., Boni, E., Buckner, F. S., Engel, L., Feist, T., Gelb, M. H., Haji, L.,Kim, D., Liu, C., Mueller, N., Myler, P. J., Reddy, J. T., Sampson, J. N.,Subramanian, E., Van Voorhis, W. C., Worthey, E., Zucker, F., and Hol,W. G. (2006) Heterologous expression of proteins from Plasmodium fal-ciparum: results from 1000 genes. Mol. Biochem. Parasitol. 148, 144 –160

19. Vedadi, M., Lew, J., Artz, J., Amani, M., Zhao, Y., Dong, A., Wasney, G. A.,Gao, M., Hills, T., Brokx, S., Qiu, W., Sharma, S., Diassiti, A., Alam, Z.,Melone, M., Mulichak, A., Wernimont, A., Bray, J., Loppnau, P., Plot-nikova, O., Newberry, K., Sundararajan, E., Houston, S., Walker, J., Tem-pel, W., Bochkarev, A., Kozieradzki, I., Edwards, A., Arrowsmith, C., Roos,D., Kain, K., and Hui, R. (2007) Genome-scale protein expression andstructural biology of Plasmodium falciparum and related Apicomplexanorganisms. Mol. Biochem. Parasitol. 151, 100 –110

20. Raghu Ram, E. V., Kumar, A., Biswas, S., Chaubey, S., Siddiqi, M. I., andHabib, S. (2007) Nuclear gyrB encodes a functional subunit of the Plasmo-dium falciparum gyrase that is involved in apicoplast DNA replication.Mol. Biochem. Parasitol. 154, 30 –39

21. Roy, A., D’Annessa, I., Nielsen, C. J., Tordrup, D., Laursen, R. R., Knudsen,B. R., Desideri, A., and Andersen, F. F. (2011) Peptide Inhibition of Topoi-somerase IB from Plasmodium falciparum. Mol. Biol. Int. 2011, 854626

22. Phillips, M. A., Gujjar, R., Malmquist, N. A., White, J., El Mazouni, F.,Baldwin, J., and Rathod, P. K. (2008) Triazolopyrimidine-based dihydro-

orotate dehydrogenase inhibitors with potent and selective activity againstthe malaria parasite Plasmodium falciparum. J. Med. Chem. 51,3649 –3653

23. Coteron, J. M., Marco, M., Esquivias, J., Deng, X., White, K. L., White, J.,Koltun, M., El Mazouni, F., Kokkonda, S., Katneni, K., Bhamidipati, R.,Shackleford, D. M., Angulo-Barturen, I., Ferrer, S. B., Jiménez-Díaz, M. B.,Gamo, F. J., Goldsmith, E. J., Charman, W. N., Bathurst, I., Floyd, D.,Matthews, D., Burrows, J. N., Rathod, P. K., Charman, S. A., and Phillips,M. A. (2011) Structure-guided lead optimization of triazolopyrimidine-ring substituents identifies potent Plasmodium falciparum dihydrooro-tate dehydrogenase inhibitors with clinical candidate potential. J. Med.Chem. 54, 5540 –5561

24. Mudeppa, D. G., Pang, C. K., Tsuboi, T., Endo, Y., Buckner, F. S., Varani,G., and Rathod, P. K. (2007) Cell-free production of functional Plasmo-dium falciparum dihydrofolate reductase-thymidylate synthase. Mol.Biochem. Parasitol. 151, 216 –219

25. Mudeppa, D. G., and Rathod, P. K. (2013) Expression of functional Plas-modium falciparum enzymes using a wheat germ cell-free system. Eu-karyot. Cell 12, 1653–1663

26. Leaver-Fay, A., Tyka, M., Lewis, S. M., Lange, O. F., Thompson, J., Jacak,R., Kaufman, K., Renfrew, P. D., Smith, C. A., Sheffler, W., Davis, I. W.,Cooper, S., Treuille, A., Mandell, D. J., Richter, F., Ban, Y. E., Fleishman,S. J., Corn, J. E., Kim, D. E., Lyskov, S., Berrondo, M., Mentzer, S., Popovic,Z., Havranek, J. J., Karanicolas, J., Das, R., Meiler, J., Kortemme, T., Gray,J. J., Kuhlman, B., Baker, D., and Bradley, P. (2011) ROSETTA3: an object-oriented software suite for the simulation and design of macromolecules.Methods Enzymol. 487, 545–574

27. Sali, A., and Blundell, T. L. (1993) Comparative protein modelling by sat-isfaction of spatial restraints. J. Mol. Biol. 234, 779 – 815

28. Caron, P. R., Watt, P., and Wang, J. C. (1994) The C-terminal domain ofSaccharomyces cerevisiae DNA topoisomerase II. Mol. Cell Biol. 14,3197–3207

29. Bradford, M. M. (1976) A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle of protein-dyebinding. Anal. Biochem. 72, 248 –254

30. Zhang, K., and Rathod, P. K. (2002) Divergent regulation of dihydrofolatereductase between malaria parasite and human host. Science 296,545–547

31. Schmidt, B. H., Osheroff, N., and Berger, J. M. (2012) Structure of a topoi-somerase II-DNA-nucleotide complex reveals a new control mechanismfor ATPase activity. Nat. Struct. Mol. Biol. 19, 1147–1154

32. Meczes, E. L., Gilroy, K. L., West, K. L., and Austin, C. A. (2008) Theimpact of the human DNA topoisomerase II C-terminal domain on activ-ity. PLoS One 3, e1754

33. Cheesman, S. J. (2000) The topoisomerases of protozoan parasites. Para-sitol. Today 16, 277–281

34. Singh, P. K., Chan, P. F., Hibbs, M. J., Vazquez, M. J., Segura, D. C.,Thomas, D. A., Theobald, A. J., Gallagher, K. T., and Hassan, N. J. (2011)High-yield production and characterization of biologically active GST-tagged human topoisomerase II� protein in insect cells for the develop-ment of a high-throughput assay. Protein Expr. Purif 76, 165–172

35. Taylor, J. A., Burton, N. P., and Maxwell, A. (2012) High-throughput mi-crotitre plate-based assay for DNA topoisomerases. Methods Mol. Biol.815, 229 –239

36. Barnabé, N., and Hasinoff, B. B. (2001) High-throughput fluorescenceflow-injection topoisomerase II inhibition assay. J. Chromatogr. B BiomedSci. Appl. 760, 263–269

37. Jahnz, M., Medina, M. A., and Schwille, P. (2005) A novel homogenousassay for topoisomerase II action and inhibition. Chembiochem 6,920 –926

38. Sahai, B. M., and Kaplan, J. G. (1986) A quantitative decatenation assay fortype II topoisomerases. Anal. Biochem. 156, 364 –379

39. Kelly, J. M., McRobert, L., and Baker, D. A. (2006) Evidence on the chro-mosomal location of centromeric DNA in Plasmodium falciparum frometoposide-mediated topoisomerase-II cleavage. Proc. Natl. Acad. Sci.U.S.A. 103, 6706 – 6711

40. Wu, C. C., Li, T. K., Farh, L., Lin, L. Y., Lin, T. S., Yu, Y. J., Yen, T. J., Chiang,C. W., and Chan, N. L. (2011) Structural basis of type II topoisomerase




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

inhibition by the anticancer drug etoposide. Science 333, 459 – 46241. Cheesman, S., McAleese, S., Goman, M., Johnson, D., Horrocks, P., Ridley,

R. G., and Kilbey, B. J. (1994) The gene encoding topoisomerase II fromPlasmodium falciparum. Nucleic Acids Res. 22, 2547–2551

42. Cheesman, S., Horrocks, P., Tosh, K., and Kilbey, B. (1998) Intraerythro-cytic expression of topoisomerase II from Plasmodium falciparum is de-velopmentally regulated. Mol. Biochem. Parasitol. 92, 39 – 46

43. Oehring, S. C., Woodcroft, B. J., Moes, S., Wetzel, J., Dietz, O., Pulfer, A.,Dekiwadia, C., Maeser, P., Flueck, C., Witmer, K., Brancucci, N. M., Nie-derwieser, I., Jenoe, P., Ralph, S. A., and Voss, T. S. (2012) Organellarproteomics reveals hundreds of novel nuclear proteins in the malaria par-asite Plasmodium falciparum. Genome Biol. 13, R108

44. Florens, L., Liu, X., Wang, Y., Yang, S., Schwartz, O., Peglar, M., Carucci,D. J., Yates, J. R., 3rd, and Wu, Y. (2004) Proteomics approach reveals novelproteins on the surface of malaria-infected erythrocytes. Mol. Biochem.Parasitol. 135, 1–11

45. Lasonder, E., Janse, C. J., van Gemert, G. J., Mair, G. R., Vermunt, A. M.,Douradinha, B. G., van Noort, V., Huynen, M. A., Luty, A. J., Kroeze, H.,Khan, S. M., Sauerwein, R. W., Waters, A. P., Mann, M., and Stunnenberg,H. G. (2008) Proteomic profiling of Plasmodium sporozoite maturationidentifies new proteins essential for parasite development and infectivity.PLoS Pathog. 4, e1000195

46. Silvestrini, F., Lasonder, E., Olivieri, A., Camarda, G., van Schaijk, B., San-chez, M., Younis Younis, S., Sauerwein, R., and Alano, P. (2010) Proteinexport marks the early phase of gametocytogenesis of the human malariaparasite Plasmodium falciparum. Mol. Cell. Proteomics 9, 1437–1448

47. Lindner, S. E., Swearingen, K. E., Harupa, A., Vaughan, A. M., Sinnis, P.,Moritz, R. L., and Kappe, S. H. (2013) Total and putative surface proteom-ics of malaria parasite salivary gland sporozoites. Mol. Cell. Proteomics 12,1127–1143

48. Auparakkitanon, S., and Wilairat, P. (2000) Cleavage of DNA induced by9-anilinoacridine inhibitors of topoisomerase II in the malaria parasitePlasmodium falciparum. Biochem. Biophys. Res. Commun. 269, 406 – 409

49. Chavalitshewinkoon, P., Leelaphiwat, S., and Wilairat, P. (1994) Partialpurification and characterization of DNA topoisomerase II from Plasmo-

dium falciparum. Southeast Asian J. Trop. Med. Public Health 25, 32–3650. Pang, C. K., Hunter, J. H., Gujjar, R., Podutoori, R., Bowman, J., Mudeppa,

D. G., and Rathod, P. K. (2009) Catalytic and ligand-binding characteris-tics of Plasmodium falciparum serine hydroxymethyltransferase. Mol.Biochem. Parasitol. 168, 74 – 83

51. Hekmat-Nejad, M., and Rathod, P. K. (1996) Kinetics of Plasmodiumfalciparum thymidylate synthase: interactions with high-affinity me-tabolites of 5-fluoroorotate and D1694. Antimicrob. Agents Chemother.40, 1628 –1632

52. Ganesan, K., Ponmee, N., Jiang, L., Fowble, J. W., White, J., Kamchon-wongpaisan, S., Yuthavong, Y., Wilairat, P., and Rathod, P. K. (2008) Agenetically hard-wired metabolic transcriptome in Plasmodium falcipa-rum fails to mount protective responses to lethal antifolates. PLoS Pathog.4, e1000214

53. Weissig, V., Vetro-Widenhouse, T. S., and Rowe, T. C. (1997) Topoi-somerase II inhibitors induce cleavage of nuclear and 35-kb plastid DNAsin the malarial parasite Plasmodium falciparum. DNA Cell Biol. 16,1483–1492

54. Dahl, E. L., and Rosenthal, P. J. (2007) Multiple antibiotics exert delayedeffects against the Plasmodium falciparum apicoplast. Antimicrob AgentsChemother. 51, 3485–3490

55. Goodman, C. D., Su, V., and McFadden, G. I. (2007) The effects of anti-bacterials on the malaria parasite Plasmodium falciparum. Mol. Biochem.Parasitol. 152, 181–191

56. Mahmoudi, N., Ciceron, L., Franetich, J. F., Farhati, K., Silvie, O., Eling, W.,Sauerwein, R., Danis, M., Mazier, D., and Derouin, F. (2003) In vitro activ-ities of 25 quinolones and fluoroquinolones against liver and blood stagePlasmodium spp. Antimicrob. Agents Chemother. 47, 2636 –2639

57. Nenortas, E., Kulikowicz, T., Burri, C., and Shapiro, T. A. (2003) Antit-rypanosomal activities of fluoroquinolones with pyrrolidinyl substitu-tions. Antimicrob. Agents Chemother. 47, 3015–3017

58. Romero, I. C., Saravia, N. G., and Walker, J. (2005) Selective action offluoroquinolones against intracellular amastigotes of Leishmania (Vian-nia) panamensis in vitro. J. Parasitol. 91, 1474 –1479




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

K. RathodDevaraja G. Mudeppa, Shiva Kumar, Sreekanth Kokkonda, John White and Pradipsinh

PURIFICATION, AND SELECTIVE INHIBITIONTopoisomerase II from Human Malaria Parasites: EXPRESSION,

doi: 10.1074/jbc.M115.639039 originally published online June 8, 20152015, 290:20313-20324.J. Biol. Chem.

10.1074/jbc.M115.639039Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/290/33/20313.full.html#ref-list-1

This article cites 57 references, 13 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M115.639039

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;290/33/20313&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/290/33/20313

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=290/33/20313&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/290/33/20313

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/290/33/20313.full.html#ref-list-1

http://www.jbc.org/

Documents

TopoisomeraseIIfromHumanMalariaParasites · TopoII inhibitors previously developed for other non-malaria indications inhibited PfTopoII, as well as malaria parasites in culture at