Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Research Article
Transcriptome profiling of four candidate milk genes in milk and tissue
samples of temperate and tropical cattle
Olanrewaju B. Morenikeji1,5*, Mabel O. Akinyemi4,5, Mathew Wheto3, Olawale J. Ogunshola1
Adebanjo A. Badejo2, Clifford A. Chineke1
1Department of Animal Production and Health, Federal University of Technology, Akure. Nigeria.
2Department of Food Science and Technology, Federal University of Technology, Akure. Nigeria.
3Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta,
Nigeria. 4Dept of Animal Science, University of Ibadan
5Animal Genetics and Genomics Laboratory, International Programs, College of Agriculture and
Life Sciences, Cornell University, Ithaca, NY 14853. USA.
*Correspondence
Dr. Olanrewaju B. Morenikeji, Animal Breeding and Genetics Unit,
Department of Animal Production and Health,
School of Agriculture and Agricultural Technology
Federal University of Technology, Akure, OD 234. Nigeria.
E-mail: [email protected] [email protected]
Abstract
The expression of four genes involved in milk regulation and production in bovine milk and tissue
samples were profiled using quantitative PCR to identify differential gene expression. Our goal
was focus on the differential mRNA expression of milk genes (K-CN, PRL, BLG and PIT-1) in
milk samples and different tissues from four different breeds of ecologically adapted and
geographically separated cattle species. The mRNA expression identified the four milk genes
understudied most up regulated in mammary gland and milk samples as compared with other
tissues. The expression of PIT-1 gene in the brain was identified to have influenced the expression
of PRL and K-CN in the mammary and milk samples. Among the four genes, PRL had the highest
mRNA expression (144.19-fold change) in Holstein followed by K-CN with 100.89-fold change
while the smallest relative expression for most genes in this study are in the range of 0.79 to 7.35-
fold difference. White Fulani cattle was identified to have a higher expression for K-CN, PRL and
BLG compared with Angus and Ndama cattle while Holstein cattle is on top of the list on the basis
of the gene expression and gene regulation for all the four genes in this study. Also, White Fulani
and Holstein are in the same cluster based on their mRNA expression for milk genes. Our data
showed the first evidence of the molecular identification of indigenous White Fulani cattle has the
potential for higher milk production.
Keywords: Cattle, milk genes, gene expression, quantitative PCR
Introduction
Milk production varies greatly among cattle of different breeds and prevalent environmental
condition. Compared with Bos taurus which is raised in most temperate parts of the world, Bos
indicus found in the warm regions have been termed as low yielding. Large scale genetic studies
have revealed that several genes contribute to the production of milk and its components. The
environment and the animal’s condition contribute to the expression of genes underlying the milk
traits (Cole et al. 2009, Hayes et al. 2010, Wellmann and Bennewitz 2011 and Cui et al. 2014).
Gene expression of a trait depends on which condition, at what stage, and where the gene is most
up regulated or down regulated in the animal. Thus, it is important to understand the transcriptome
profile of the gene(s) that control a trait under these conditions (Liu et al. 2015 and Yang et al.
2015). Different species have shown varying abundant mRNA expression in milk and mammary
gland tissues (Farrell et al. 2004, Cane et al. 2005, Smolenski et al. 2007 and Whelehan et al.
2014). Differential gene expressions in high and low milk producing cows at varying stages of
lactation have been studied with the use of RNA-seq technology (Cui et al., 2014 and Yang et al.,
2015). Studies have shown that the mRNA transcripts in milk could be a sign of the mammary
gland tissue trancriptome. (Farrell et al. 2004, Graulet et al. 2007, Girard and Matte 2005,
Smolenski et al. 2007, Medrano et al. 2010, Wickramasinghe et al. 2011 and Ran et al. 2016).
Medrano et al. (2010) identified similarities between the mammary gland and somatic cells in milk
and stated that most genes expressed in the mammary gland were also present in the milk somatic
cells but a higher number of gene expression was found in in the MSC compared to the mammary
gland. Also, Wickramasinghe et al. (2012) observed that milk somatic cells (MSC) have a higher
milk gene transcripts compared to that of the mammary gland. The expression patterns of tissue-
specific genes, which have important functions in milk production, could aid in identifying
potential molecular markers for cattle milk yield and qualities (Baik et al. 2009, Fu et al. 2012 and
Welkard et al. 2012). Although previous studies have identified variation in milk gene expression
in different stages of lactation but variation within strains of animal at same stage and
environmental influence has not been fully studied.
A high producing and sensitive animal can take the advantage of nonfluctuating environments but
may not perform well in poor, fluctuating environments
The expression level of milk genes and their contribution to the overall milk trait has not been
studied in Nigerian cattle. Likewise, the measurement of the environmental impact on the milk
gene expression profile is yet to be determined in indigenous cattle in Nigeria. Therefore, this
study focus on interrogating the expression profile of four candidate milk genes in bovine milk
samples, mammary tissues, liver, brain and muscle through quantitative PCR (qPCR). Also, to
examine the comparative analysis of mRNA transcription of these genes between different breeds
from the temperate and tropical cattle milk samples.
Materials and Methods
Sample collection
Milk samples and tissues from mammary gland, liver, brain and muscle were harvested from 3
animals per breed (n = 12) of two Tropical Nigerian cattle (White Fulani and N’dama) and two
Temperate American cattle (Angus and Holstein). These breeds are representative from two
regional scenarios of environmental conditions which they are adapted to. A total of three
biological replicates, four breeds from two climatic scenarios were compared using quantitative
real-time PCR (qPCR). In brief, samples from White Fulani and N’dama cattle were obtained from
the milking herd and abattoir in Ondo State, Nigeria while that of Angus and Holstein cattle were
obtained from the milking herd and slaughter house in Pennsylvania State, United States of
America (USA). Both samples were collected during the dry (summer) season of the year. The
milk samples were obtained from cows at 90 days which is the peak stage of lactation and the
animals were of uniform age between 3 to 4 years old. The tissue samples were immediately put
into RNAlater (Ambion, TX) to protect the integrity of RNA before further laboratory analyses.
Selection of candidate genes and assay design
Based on the previously identified genes affecting milk production trait in cattle according to
Ahmadi et al. (2008), four genes which include Prolactin (PRL), Beta-lactoglobulin (BLg), kappas-
casein (K-CN) and pituitary-specific transcription factor(PIT-1) were selected and profiled for
comparative gene expression in bovine samples. Specific gene primer pairs were designed to
amplify products of 80–120 bp with an optimal melting temperature of 60oC and a GC content
between 50 and 60 %. In order to avoid genomic DNA amplification, the reverse primer for each
primer pair was designed spanning a predicted exon–exon junction and the primer pairs were
optimized using gradient PCR to validate the annealing temperatures which were calculated in the
primer design. The primer pairs and their sequences are shown in Table 1 The glyceraldehyde- 3-
phosphate dehydrogenase (GAPDH) and Beta Actin (ACTINB) genes were selected and used as
endogenous reference. SYBR Green® chemistry detection system was chosen for qPCR
amplification and quantification.
Total RNA isolation and cDNA synthesis
Triplicate tissue samples (30mg) from bovine tissues (mammary gland tissues, liver, and muscle)
were individually ground using a Qiagen Tissue Lyzer II while the TRIzol/chloroform protocol
(Life Technologies, USA) was used to extract the total RNA following the manufacturer’s
instructions and DNase treated with DNase I Amplification Grade (InvitrogenTM) before the
reverse transcription. Likewise, the milk samples were pelleted by centrifuging at 1800 rpm at
4°C for 10 minutes and RNA was extracted from the pellet of milk cells and treated with DNase I
Amplification Grade (InvitrogenTM) before the reverse transcription and purified using Qiagen
RNeasy Minikit. The quantity, quality and integrity of RNA samples were assessed by Qubit® 2.0
Fluorometer (Life Technologies, USA) and gel electrophoresis. cDNA was synthesized in 20 µl
reaction volumes with Oligo-dT and random primers using iScriptTM cDNA Synthesis Kit (Bio-
Rad) as recommended by the manufacturer for whole transcriptome analysis. The reaction mixture
was mixed and incubated at 37oC for 1 hour. The reaction was finalized by heating the mixture at
70oC for 10 minutes and chilled on ice. The integrity of the cDNA was examined by PCR and
1.5% agarose gel electrophoresis.
qPCR conditions and assay optimization
qPCR was performed using SYBR Green® detection chemistry. Three biological replicates per
breed from the same cDNA used for testing specific primer pairs of 4 selected milk genes (PRL,
BLg, K-CN and PIT-1) and the two housekeeping genes (GAPDH and ACTINB). For each gene,
the samples were run in a 96 well plate on a CFX96 TouchTM Real-Time PCR Detection Systems
(Bio-Rad). PCRs were performed in 10 µl total volumes per well containing 5 µl of 2x iQTM
SYBR® Green supermix (BioRad, Hercules, CA, USA), 1 µl of cDNA (0.05µg of RNA
equivalents), 0.5 µl (10 µM) of each gene-specific primer and 3 µl of DNase-free H2O. The
amplification conditions followed the manufacturer’s protocol. The PCR products from the assay
were run on 1.5% agarose gels to detect the specificity of the amplified fragment. This yielded a
single correct sized band. For melt curve analysis, a protocol with temperatures that varied from
65 °C to 95 °C with increments of 0.5 °C for 5 seconds and continuous fluorescent measurements
was used. The relative amount of all mRNAs was calculated using the comparative 2−ΔΔ Cq method.
Three biological replicates and two technical replicates per biological replicate were performed
for each experiment according to Robert et al. (2010). A duplicate No-template control (NTC)
reaction was run for each primer pair in all our qPCR experiments to confirm that there was no
contamination with exogenous material.
Data analysis and Results
Results of the real-time PCR data were represented as Cq values, where Cq was defined as the
threshold cycle number of PCRs at which amplified product was first detected. The amount of
target has an inverse correlation with the values of Cq (the lower the amounts of target, the higher
the Cq values and vice versa). The values of relative normalized expression were calculated for
each gene using the comparative 2−ΔΔ Cq method and a common threshold or Cqcutoff was set. The
N-fold differential expression in the target genes in each sample was expressed as 2−ΔΔ Cq. This
study defined increased mRNA expression as N-fold ≥2.0, "normal" expression as N-fold ranging
from 0.5001 to 1.9999, and decreased mRNA expression as N-fold ≤0.5.
Comparative gene expression variation of bovine tissues was calculated for individual genes based
on quantification cycle (Cq) values and real-time PCR efficiencies (E). The PCR efficiency (E)
for the reactions ranged from 91% to 100% for the four genes tested in this study (Table 1). Fig 1
and 2 show the specificity and reliability of the assay. The specificity of the amplifications was
indicated by the single-peak melting peaks of the PCR products while the dissociation curves
showed no peak corresponding to primer dimers or nonspecific products for any of the target genes
or endogenous control and thus validate the specificity of the assay.
Comparative gene expression analysis in bovine samples
The expression levels obtained by the real-time PCR analysis for the genes under study were
calculated as Cq and compared with the house keeping genes as internal control by the Bio-Rad
CFX manager Software. Hierarchical cluster analysis and visualization were also generated. The
mean Cq values for each sample were pooled across the four breeds so as to determine the overall
expression from all samples. It is observed from Fig 3 and 4 that the PIT-1 is strongly expressed
in brain but slightly expressed in the milk and the liver while Blg, K-CN and PRL genes are strongly
expressed in the mammary gland but moderately expressed in the milk sample. PIT-1 is also
moderately expressed in the milk sample. The clustergram in Fig.4 shows the relative normalized
expression and the hierarchical relationship of expressed genes across the samples. A closer
relatedness was observed in the expression of K-CN and PRL than Blg among the bovine samples
in this study, while PIT-1 gene is distantly related in expression as compared with other genes.
Based on these expression, mammary gland tissue and milk sample were closely related in their
gene expression than the brain and the liver.
Comparative analysis of bovine milk transcriptome in indigenous and foreign cattle breeds
In the further analysis, the expression profile of Blg, K-CN, PIT-1, and PRL genes were compared
among cattle strains using milk samples from two representative animals from hot climatic region
(N’dama and White Fulani) vs. animals from cold climatic region (Angus and Holstein). Overall,
the range of mRNA expression form the quantitative PCR method in this study was very broad
(Table 2). Among the four genes, PRL had the highest mRNA expression (144.19-fold change) in
Holstein milk sample followed by K-CN with 100.89-fold change while the smallest relative
normalize expression for most genes in this study were in the range of 0.79 to 7.35-fold difference.
From Table 2 and Figure 5, significantly lower expression of the four genes (Blg, K-CN, PIT-1
and PRL) as observed in Angus and N’dama cattle. Among the four breeds, N’dama cattle showed
the least expression of the Blg gene with relative normalized expression value of 0.79-fold while
Angus showed the least expression for K-CN gene with a value of 2.73-fold. Likewise, Table 2
and Figure 6 showed the gene regulation of the bovine milk expression in the four breeds in this
study. The expression regulation analysis revealed that PRL gene is significantly (p<0.001) down-
regulated in N’dama and White Fulani with a value of -7.31 and -5.75 respectively while K-CN
gene is significantly down regulated in Angus cattle with a regulation value of -4.49. However, K-
CN and PRL genes are significantly up regulated in Holstein cattle with a regulation value of
139.25 and 108.37 followed by PIT-1 and Blg genes with a regulation value of 54.78 and 38.06
accordingly. Also, PIT-1 and K-CN genes are significantly up regulated in White Fulani cattle with
a regulation value of 25.95 and 21.04 respectively. Holstein cattle is on top of the list based on the
gene expression for all the four genes in this study followed by the white Fulani cattle only that
the PRL gene is observed to be down regulated, while the genes were lowly expressed or down
regulated in Angus and N’dama cattle breeds (Table 2 and Figure 5). The extreme variation in
mRNA expression in this study strongly suggests that there is heterogeneity in cattle adaptation
among breeds across populations in different geographical location and that gene expression
profiles varied in animal from one region to another.
Furthermore, the comparison of milk gene expression in four breeds of animals in this study
revealed a significantly (p < 0.001) higher expression in Bos taurus animals with K-CN gene on
top of the list of expression while lesser milk gene expression was found in Bos indicus regardless
of the climatic region they come from. Also, the milk gene expression profile in animals from the
two climatic regions (2 from temperate and 2 from tropical climate regions) showed that the
animals from the temperate region had a higher milk gene expression when compared to their
tropical counterparts.
Figure 7 shows clustergram and the heat map of the mRNA expression of four genes using
hierarchical cluster of log base 2 form of the relative normalized expression of BLG, PRL, K-CN,
and PIT-1 genes in bovine milk transcriptome. The relative normalized expression falls within the
range of -7.17 and 7.17 N-fold change for all the genes. From the clustergram, it is observed that
a closer relatedness exists in the expression of K-CN and PIT-1 genes while BLG and PRL genes
are also closely related in their expression. K-CN and BLG genes are distantly related in their
expression as compared with PRL and PIT-1 genes. Based on these milk gene transcriptome,
Holstein, White Fulani and N’dama cattle breeds were closely related in their gene expression than
Angus cattle although Holstein and White Fulani cattle were more related in their milk mRNA
expression as compared to the other breeds. The heat map showed that the four genes in this study
(BLG, PRL, K-CN, and PIT-1) are strongly expressed and over represented in Holstein breed while
K-CN and PIT-1 genes were the only two genes strongly expressed in White Fulani breed. The
genes were lowly expressed and showed no change in Angus and N’dama cattle.
Discussion
The main interest of this study focused on examining differentially expressed milk genes in bovine
tissues and milk transcriptome at the peak of lactation stage; to have a deeper insight of the
comparative expression of genes from different tissue samples and comparative difference in milk
gene expression profile among four breeds of cattle from two different climatic regional scenarios.
The mRNA expression profiled for the four genes in this study showed a wide range from 0.05-
fold to 100-fold difference and above. Our results reassured that the differential expression
profiles for these four genes are consistent with the previous quantitative measurement of milk
traits in cattle experiment (Ahmadi et al. 2008, Medrano et al. (2010), Jimenez-Montero et al.
2011, Wickramasinghe et al. 2012 and Yang et al. 2015).
We selected GAPDH and ACTINB as the internal control genes for this study because of the report
on their stability from other authors. It is very important to select a right housekeeping gene for
internal control during qPCR for gene expression studies. Likewise, many authors have shown that
it is a good practice to use more than one housekeeping genes when studying gene expression for
normalization in the analysis (Barber et al. 2005, Banda et al. 2007, Robert et al. 2010 and Forni
et al. 2011). The extreme variation in mRNA expression in this study strongly suggests that there
is heterogeneity in cattle adaptation among breeds across populations in different geographical
location and that genes are differentially expressed from one tissue to another in the same animal
in the same lactation stage.
Analysis of bovine milk gene transcriptome across different tissue and milk samples
The transcriptome profiles of BLG, PRL, and K-CN were strongly expressed in the mammary gland
tissue except for the PIT-1 which is lowly expressed suggesting and strengthening the role that
mammary gland plays in the milk secretion in animal’s body. The biological actions of prolactin
in mammary gland for example have been characterized extensively, where it has an essential role
both in the differentiation of the gland during pregnancy and in the regulation of milk protein gene
expression (Bayat and Houdebine 1993, Sheehy et al. 2004, Cui et al. 2014). The report of Hou et
al. (2009) and Medrano et al. (2010) corroborate the high expression of milk genes from the
mammary gland at the peak lactation stage of cows.
Several studies have established composite responses which contain multiple sites for many
transcription factors that mediate the developmental and hormonal regulation of milk gene
expression in mammary epithelial cells (Veerkamp et al. 2003 and Kuljeet et al. 2010). Rosen et
al. (2000) reported that signal transduction pathways was activated by lactogenic hormones and
cell-substratum interactions which activate transcription factors and change chromatin structure
and milk protein gene expression.
Following the mammary gland, the mRNA expression of the four genes were likewise highly
expressed in milk samples in this study buttressed the closer relatedness in the mRNA expression
profile between mammary gland and the milk sample. This is expected since the mammary gland
is the factory for the milk production. Previous studies of Medrano et al. (2010) and
Wickramasinghe et al. (2012) identified similarities in gene expression between the mammary
gland and the milk somatic cells. Bioinformatics predictions of genes encoding secreted proteins
up-regulated during lactation in the mammary gland suggest that as many as 300 different proteins
may be found in milk (Abby et al. 2009, Kuljeet et al. 2010 and Cánovas et al. 2010). However,
caseins are the major proteins in milk, representing about 80% of total milk protein content
justifying the higher expression of K-CN in the milk samples in this study. This also corroborate
the studies of Medrano et al (2010) and Wickramasinghe et al. (2012) who observed a higher
expression of K-CN in both milk and mammary gland at the 90 days of lactation.
The significantly lower expression of the four genes in the liver suggests that the organ plays a
lesser role or low participation in the whole process of milk production and that milk gene
expression profile are only localized and strongly expressed in the associated organs for milk
production. On the other hand, PIT-1 gene which was highly expressed in the brain confirms the
role of pituitary hormonal secretion and regulation of milk gene expression in the body. PIT-1 is
the critical cell specific transcription factor for the activity expression of prolactin (PRL) and
growth hormone genes (Bona et al. 2004 and Hodne et al. 2010), thyroid-stimulation hormone b-
subunit (TSH-b) (Steinfelder et al. 1991), growth hormone releasing hormone receptor (GHRHR)
genes (Lin et al. 1994). Thus it has been selected and used as candidate genetic marker for growth,
carcass and milk yield traits in many studies (Cohen et al. 1997, Ursula and Ken, 2016). PIT-1 is
responsible for pituitary development and hormone expression in mammals (Laurie et al. 1996
Hodne et al. 2010). Also, it controls transcription of prolactin (PRL), growth hormone (GH),
(Mehmannavaz et al. 2009), and PIT-1 gene itself (Rhodes et al. 1993). PIT-1 polymorphism has
been reported to be associated with milk yield and conformation traits in cattle (Riaz et al. 2008,
Medrano et al. 2010 and Ankur et al. 2015). Our study has confirmed the importance of PIT-1
gene in regulation of milk protein gene expression and has provided clue into their role in
mammary gland development and differentiation. Additionally, the significant higher expression
of PRL gene from the mammary and milk samples in this study pointed to the fact that it is
influenced by the PIT-1 gene which is also highly expressed in the brain confirming its association
in the regulation and expression of these genes. This corroborates the report of Laurie et al. (1996)
and Kuljeet et al. (2010) that PIT-1 gene affects the expression pattern of prolactin.
Comparative analysis of milk genes transcriptome in milk samples of four breeds
The four genes (BLG, PRL, K-CN and PIT-1) were quantitated and identified to be most
significantly up regulated in the milk sample of Holstein cattle from the qPCR analysis. This
buttresses the fact that Holstein cattle are known to be high yielding milk animal as compared with
other breeds. Holstein cattle have been reported to have a high expression of these genes according
to the studies of Cui et al. (2014) and Yang et al (2015). Also, a significantly up regulated mRNA
expression of milk genes was observed in the White Fulani animal as compared to Angus and
N’dama animals. The up regulation of the milk genes identified White Fulani cattle to be a
potential milk producing animal from the tropical region and can be selected for improvement
through selection and breeding programme in the future. Furthermore, the milk gene transcriptome
profile as observed between Holstein and White Fulani cattle in this study justified the closer
relatedness observed in the clustering analysis though they are of different breeds and from
different regional climate but their milk gene expression patterns are similar. Also, variation in
milk gene expression of these two breeds suggest that environment could contribute to the gene
expression pattern in these two animals. Temperate climate adapted Holstein showed a
significantly higher expression than White Fulani animal being from the tropical climate. This
suggests the fact that the expression of these genes is associated with the influence of climatic
difference and adaptation of these animals in the two different regional scenarios in this study. The
high gene expression profile observed in Holstein cattle also buttress the reason why the animal is
well adapted to the colder climate and thrive well in this region compared with other breeds. This
in agreement with Rhoads et al. (2009) and Shwartz et al. (2009) that when Chinese Holstein cattle
are exposed to high ambient temperature, especially high humidity, thermoregulatory processes
were impaired and cattle cannot dissipate an adequate quantity of heat to maintain body thermal
balance or normal body temperature. Thus, their milk production and reproduction rate will sharply
decrease. On the contrary, White Fulani from the hot climatic region has a good potential for
draught and well adapted to high temperature is identified in this study for higher milk gene
expression. This potential can be improved on for a better milk production as the animal can thrive
well in the tropics.
Altogether, the results from this study indicated that the differential expression profile of milk
genes in different samples and among different breed across 2 climatic regional scenarios are
significantly different. This pointed to the fact that there are genetic differences in the gene
expression profiles at the physiological and cellular levels which have been documented in several
studies on Bos indicus and Bos taurus (Paula-Lopes et al. 2003, Hansen 2004, Lacetera et al. 2006,
Wickramasinghe et al. 2012 and Yang et al. 2015). Those studies confirm a genetic linkage
between species, breed, and individual differences to gene expression profile at the cellular level.
Interestingly, Angus and N’dama cattle from different climatic region and different breeds had a
similar significantly lower mRNA expression profile as compared to Holstein and White Fulani.
Therefore, there is a closer relatedness in the hierarchical clustering analysis between these two
breeds. These justified the reason why these two breeds are regarded as beef animal rather than
milk producing animals.
Conclusion
The gene expression profile of four milk genes using quantitative PCR showed that the genes were
differential expressed from one tissue to another in the same animal. The extreme variation in
mRNA expression in the milk among the animal breeds strongly suggests that there is
heterogeneity in cattle adaptation across populations in different geographical location.
Additionally, mammary gland strongly expressed three out of four milk genes (BLG, PRL and K-
CN) considered in this study suggesting and strengthening the role that mammary gland play in
the milk secretion in animal’s body. Also, higher expression of PRL and K-CN in both mammary
and milk samples is associated to the high expression of PIT 1 gene in the brain. Apart from
Holstein cattle, the significant up regulated expression of the milk genes in White Fulani animal
gave the first evidence of molecular identification of its potential for future selection and breeding
for a better milk producing animal especially in Nigeria that can cope with the changing climate
due to the current trend of global warming. Our results provide an insight into the potential and
identify key genes that contribute to improved milk production which could be through genomic
assisted breeding programmes that will lead to improving the economic and environmentally
suitable dairy production.
References
Abby T., Mike B. and Harjinder S. 2009 Milk Proteins: from expression to food. American
Journal of Human Biology 21, 852-860.
Ahmadi M., Mohammadi Y., Darmani-kuhi H., Osfoori R. and Qanbari S. 2008 Association of
milk protein genotypes with production traits and somatic cell count of Holstein cows.
Journal of Biological Science 8(7), 1231-1235.
Ankur C., Madhu T., Satyendra P.S., Deepak S., Sumit K., Rakesh G., Amitav B. and Vijay S.
2015 PIT-1 gene polymorphism with milk production traits in Sahiwal cattle. The Indian
Journal of Animal Sciences 85(6), 610-612.
Baik M., Etchebarne B.E., Bong J. and Vander Haar M.J. 2009 Gene expression profiling of
liver and mammary tissues of lactating dairy cows. Asian-Aust. J. Anim. Sci. 22(6), 871-884.
Banda M., Bommineni A., Thomas R.A., Luckinbill L.S. and Tucker J.D. 2007 Evaluation and
validation of house-keeping genes in response to ionizing radiation and chemical exposure
for normalizing RNA expression in real-time PCR. Mutat Res/Genet Toxicol. Environ.
Mutagen 649, 126-134.
Barber R.D., Harmer D.W., Coleman R.A. and Clark B.J. 2005 GAPDH as a housekeeping
gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiological
Genomics 21, 389-395.
Bayat S.M. and Houdebine L.M. 1993 Effect of various protein kinase inhibitors o the
induction of milk protein gene expression by prolactin. Mol. Cell Endocrinol. 92(1), 127-
134.
Cane K. N., Arnould J. P. and Nicholas K. R. 2005 Characterisation of proteins in the milk of
fur seals. Comparative Biochemistry and Physiology—Part B: Biochemistry and
Molecular Biology 141, 111 – 20.
Cánovas A., Rincon G., Islas-Trejo A., Wickramasinghe S. and Medrano J.F. 2010 SNP
discovery in the bovine milk transcriptome using RNA-Seq technology. Mamm
Genome, 21(11-12):592–598.
Cohen L.E., Wondisford F.E. and Radovick S. 1997 Role of Pit-1 in the gene expression of
growth hormone, prolactin and thyrotropin. Endocrinol. Metab. Clin. North Am. 25, 523-
540.
Cole J. B., vanRaden P. M., O’Conell J. R., van Tassell C. P. and Sonstergard T. S. 2009
Distribution and location of genetic effects for dairy traits. Journal of Dairy Science 92,
2931–2946.
Cui X., Hou Y., Yang S., Xie Y., Zhang S., Zhang Y., Zhang Q., Lu X., Liu G.E. and Sun D.
2014 Transcriptional profiling of mammary gland in Holstein cows with extremely
different milk protein and fat percentage using RNA sequencing. BMC Genomics, 15:226-
241.
Daetwyler H.D., Pong-Wong R., Villanueva B. and Woolliams J.A. 2010 The impact of
genetic architecture on genome-wide evaluation methods. Genetics 185, 1021-1031.
Farrell H. M. Jr., Jimenez-Flores R., Bleck G. T., Brown E. M., Butler J. E., Creamer L. K.,
Hicks C. L., Hollar C. M., Ng-Kwai-Hang K. F. and Swaisgood H. E. 2004 Nomenclature
of the proteins of cows’ milk sixth revision. Journal of Dairy Science 87, 1641 – 1674.
Forni S., Aguilar I. and Misztal I. 2011 Different genomic relationship matrices for single-step
analysis using phenotypic, pedigree and genomic information. Genet. Sel. Evol. 43, 1-7.
Fu J., Wolfs M.G., Deelen P., Westra H.J., Fehrmann R.S., Te Meerman G.J., Buurman W.A.,
Rensen S.S., Groen H.J., Weersma R.K., Van den Berg L.H., Veldink J., Ophoff R.A.,
Snieder H., van Heel D., Jansen R.C., Hofker M.H., Wijmenga C. and Franke L.
2012 Unraveling the regulatory mechanisms under l Robert tissue-dependent genetic
variation of gene expression. PLoS Genet. 8 e1002431.
Girard C. and Matte J. 2005. Folic acid and vitamin B12 requirements of dairy cows: A
concept to be revised. Livestock Production Science 98, 123 – 133.
Graulet B., Matte J. J., Desrochers A., Doepel L., Palin M. F. and Girard C. L. 2007 Effects of
dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early
lactation. Journal of Dairy Science 90 (7), 3442 – 3455.
Hansen P. J. 2004 Physiological and cellular adaptations of zebu cattle to thermal stress.
Animal Reproduction Science 82, 349–360.
Hayes B. J., Pryce J., Chamberlain A. J., Bowman P. J. and Goddard M. E. 2010 Genetic
architecture of complex traits and accuracy of genomic prediction: coat colour, milk-fat
percentage, and type in Holstein cattle as contrasting model traits. PloS Genetics 61,100
-139.
Hodne, K., Haug, T.M. and Weltzien, F.A. (2010) Single-cell qPCR on dispersed primary
pituitary cells—an optimized protocol. BMC Mol. Biol. 11: 82
Hou M., Li, Q. and Huang T. 2009 Microarray analysis of gene expression profiles in the
bovine mammary gland during lactation. Science China Life Science 53(2), 248-256.
Jiménez-Montero J.A., González-Recio O. and Alenda R. 2011 Genotyping strategies for
genomic selection in small dairy cattle populations. Animal 6, 1216–1224.
Kuljeet S., Richards A.E., Kara M.S. and Kerst S. 2010 Egipenetic Regulation of Milk
production in Dairy Cows. Journal of Mammary Gland Biology and Neoplasia,
15(1):101-112.
Lacetera N., Bernabucci U., Scalia D., Basiricò L., Morera P. and Nardone, A. 2006 Heat
stress elicits different responses in peripheral blood mononuclear cells from Brown Swiss
and Holstein cows. Journal of Dairy Science 89, 4606–4612.
Laurie E.C., Fredric E.W. and Sally R. 1996 Role of PIT-1 in the gene expression of growth
hormone, prolactin and thyrotropin. Endocrinology and Metabolism Clinics of North
America, 25(3):523-540.
Lin C., Lin S.C., Chang C.P. and Rosenfeld M.G. 1994 Pit-1 dependent expression of the
receptor for growth hormone releasing factor mediates pituitary cell growth. Nature 360,
765-768.
Liu, W., Lauladerkind, S.J.F., Hayman, G.T., Wang, S., Nigam, R., Smith, J.R., De Pons, J.,
Dwinell, M.R. and Shimoyama, M. 2015. Onto Mate: a test-mining tool aiding curation
at the rat genome database. Database, 1-8. Doi:10.1093/database/bau/129.
Marchini J. and Howie B. 2010 Genotype imputation for genome-wide association studies.
Nat. Rev. Genet. 11, 499-511.
Medrano J.F., Rincon G. and Islas-Trejo A. 2010 Comparative analysis of bovine milk and
mammary gland transcriptome using RNA-seq. In 9th World congress on genetics applied
to livestock production. Leipzig, German, August 1–6, paper no. 0852.
Mehmannavaz Y., Amirinia C., Bonyadi M. and Torshizi R.V. 2009 Effects of bovine
prolactin gene polymorphism within exon 4 on milk related traits and genetic trends in
Iranian Holstein bulls. African Journal of Biotechnology 8(19), 4797-4801.
Paula-Lopes F. F., Chase C.C. Jr., Al-katanani Y.M., Kriinger C.E., Rivera R.M., Tekin S.,
Majewski A.C., Ocon O.M., Olson T.A. and Hansen P. J. 2003 Genetic divergence in
cellular resistance to heat shock in cattle: differences between breeds developed in
temperate versus hot climates in responses of preimplantation embryos, reproductive tract
tissues and lymphocytes to increased culture temperatures. Reproduction 125, 285–294.
Raiz M.N., Malik N.A., Nasreen F. and Qureshi J.A. 2008 Molecular marker assisted study of
kappa-casein gene in Nili-Ravi (Buffalo) breed of Pakistan. Pakistan Vet. J. 28(3), 103-
106.
Ran L., Pier L.D. and Eveline M.I. 2016 Comparative Analysis of the miRNome of bovine
milk fat, whey and cells. PLoS ONE 11(4), 1-12.
Rhoads M. L., Rhoads R. P., VanBaale M. J., Collier R. J., Sanders S. R., Weber W. J., Crooker
B. A. and Baumgard L. H. 2009 Effects of heat stress and plane of nutrition on
lactating Holstein cows: I. production, metabolism and aspects of circulating
somatotropin. Journal of Dairy Science 92, 1986–1997.
Rhodes S.J., Chen R., DiMattia, G.E., Scully K.M., Kalla K.A., Lin S.C., Yu V.C. and
Rosenfeld M.G. 1993 A tissue-specific enhancer confers Pit-1 dependent morphogen
inducibility and autoregulation on the Pit-1 gene. Gene Development 7, 913-932.
Robert R. K., Mikael K. and Ales T. 2010 Statistical aspects of quantitative real-time PCR
experiment design. Elsevier Methods 50, 231-236.
Rosen R., Brown C., Heiman J., Leiblum S., Meston C.M., Shabsigh R., Ferguson D. and
D’Agostino R. 2000. The Female Sexual Function Index (FSFI): A multidimensional
self-report instrument for the assessment of female sexual function. Journal of Sex and
Marital Therapy 26, 191–208.
Sheehy P.A., Della-Vedova J.J., Nicholas K.R. and Wynn P.C. 2004 Hormone dependent milk
protein gene expression in bovine mammary explants from biopsies at different stage of
pregnancy. J. Dairy Res. 71(2): 135-140.
Shwartz G., Rhoads M. L., VanBaale M. J., Rhoads R. P. and Baumgard L. H. 2009 Effects of
a supplemental yeast culture on heat-stressed lactating Holstein cows. Journal of
Dairy Science 92, 935–942.
Smolenski G., Haines S., Kwan F. Y., Bond J., Farr V., Davis S. R., Stelwagen K. and
Wheeler T. T. 2007 Characterization of host defense proteins in milk using a proteomic
approach. Journal of Proteome Research 6, 207 – 215.
Steinfelder H.J., Hauser P., Nakayama Y., Radovick S., McClaskey J. H., Taylor T., Weintraub
B.D. and Wondisford F.E. 1991 Thyrotropin-releasing hormone regulation of
human TSHß expression: role of a pituitary specific transcription factor (Pit-1/GHF-1)
and potential interaction with a thyroid hormone-inhibitory element. Proceedings of
National Academy of Science USA 88, 3130-3134.
Ursula K. and Ken K.Y. 2016 Pituitary physiology and diagnostic evaluation. Williams
Textbook of Endocrinology (Thirteenth Edition), pp. 176-231.
Veerkamp R.F., Beerda B. and Vander L.T. 2003 Effects of genetic selection for milk yield on
energy balance, levels of hormones, and metabolites in lactating cattle, and possible links
to reduced fertility. Livestock Prod. Sci. 83, 257-275.
Wellmann R. and Bennewitz J. 2011 The contribution of dominance to the understanding of
quantitative genetic variation. Genetic Research 93, 139–154.
Whelehan, C.J., Reidy, A.B., Meade, K.G., Eckersall, P.D., Chapwanya, A., Narcianda, F.,
Lloyd, A.T. and O’Faralley, C. 2014. Characterization and expression profile of bovine
cathelicidin gene receptoire in mammary tissue. BMC Genomics 15,128-140.
Wickramasinghe S., Hua S., Rincon G., Islas-Trejo A., German J.B., Lebrilla C.B. and
Medrano J.F. 2011 Transcriptome Profiling of bovine milk oligosaccharide metabolism
genes using RNA-Sequencing. PloS One, 6(4):e18895.
Wickramasinghe S., Rincon G., Islas-Trejo A., Medrano J.F. 2012 Transcriptional profiling
of bovine milk using RNA sequencing. BMC Genomics, 13:45.
Yang J., Jiang J., Liu X., Wang H., Guo G., Zhang Q. and Jiang L. 2015 Differential
expression of genes in milk of dairy cattle during lactation. Animal Genetics, 47:174-180.
Received 6 October 2017; revised 11 October 2018; accepted 16 October 2018
Table 1 Oligonucleotide primer sequences used for qPCR and the amplification efficiencies
Gene
symbol
5’-3’ sequence Annealing
Temperature
qPCR
amplicon
size (bp)
GC
(%)
qPCR reaction
efficiencies (%)
PRL F: ATAGGACGAGAGCTTCCTGGT
R: TTCTGCGACGAACCTTTGCT
60.89
60.82
76 55.00
52.38
94
BLg F: ATAGGACGAGAGCTTCCTGGT
R: TTCTGCGACGAACCTTTGCT
60.00 95 55.00 100
KCa F: TGGAAAGGCCAACTGAACCT
R: CCTTGTGACCGTCAGCTCTT
59.44
59.97
52 60.00
52.38
92
PIT-1 F: AAACCATCATCTCCCTTCTT
R: AATGTACAATGTGCCTTCTGA
59.19
59.75
97 63.16
55.00
100
GAPDH F: ACCACTTTGGCATCGTGGAG
R: GGGCCATCCACAGTCTTCTG
63.00 85 55.00
60.00
92
ACTINB F: GAGCGGGAAATCGTCCGTGAC
R:GTGTTGGCGTAGAGGTCCTTGC
60.00 92 62.00
59.00
94
Table 2: mRNA expression of four genes in bovine milk across two regional representative breeds
SAMPLE Target Mean Cq Normalized
Expression
Relative
Normalized
Expression
Regulation Compared to
Regulation
Threshold
P-Value Exceeds P-
Value
Threshold
ANGUS BLG 28.07 3.32 1.3 2.85 No change 0.00018 No
K-CN 30.83 8.07 2.73 -4.49 Downregulated 0.24835 Yes
PIT-1 32.62 0.14 6.34 2.55 No change 0.00061 No
PRL 28.38 2.68 7.2 1.9 No change 0.00032 No
HOLSTEIN BLG 20.14 126.4 38.06 38.06 Up regulated 0.00010 No
K-CN 16.29 27.47 100.89 139.25 Up regulated 0.00006 No
PIT-1 27.16 240.23 38.71 54.78 Up regulated 0.00001 No
PRL 16.87 288.96 144.19 108.37 Up regulated 0.00059 No
NDAMA BLG 32.42 0.02 0.79 2.92 No change 0.00011 No
K-CN 30.11 0.45 3.12 2.58 No change 0.00021 No
PIT-1 31.91 1.04 7.35 8.35 No change 0.46225 Yes
PRL 29.21 0.02 4.02 -7.31 Downregulated 0.39834 Yes
WHITEF. BLG 23.92 68.89 20.74 7.74 Up regulated 0.00007 No
K-CN 27.16 4.01 21.04 21.04 Up regulated 0.00012 No
PIT-1 28.47 61.8 25.95 25.95 Up regulated 0.00001 No
PRL 20.29 146.91 35.75 -5.75 Down regulated 0.00005 No
Exceeds P-Value Threshold: Yes, indicates not statistically significant gene expression difference at P < 0.01 level
No indicates statistically significant gene expression difference at P < 0.01 level
Mean Cq: Average or mean quantification cycle i.e. cycle at which quantification was first detected.
Fig.1 Verification of amplification specificity by single-peak melt peak of the qPCR products
Fig. 2 Verification of amplification by melt curves of the qPCR products. Melt curve analysis of the amplicons
shows a single, sharp melt curve per gene. Cq, quantification cycle; RFU, relative fluorescence units.
Fig.3 The relative normalized expression of BLG, PRL, K-CN and PIT-1 in the bovine brain, liver, milk
and mammary gland samples.
0.00
20.00
40.00
60.00
80.00
100.00
120.00
140.00
160.00
Brain Liver Milk Mammary gland
Rel
ativ
e N
orm
aliz
ed E
xpre
ssio
n
Bovine milk gene expression profile in different samples
BLG PRL K-CN PIT-1
Fig. 4 The heat map of mRNA expression of four milk genes in four bovine samples (Brain, Liver,
Mammary gland and Milk) using hierarchical cluster. Genes with increased expression are shown in red;
while those with decreased mRNA expression are in shown in green. The grid segment color indicates up
regulation (red), down regulation (green), or no change in regulation (black). The lighter the color, the
greater the degree of regulation. The relative normalized expression fall within the range of -6.79 and 6.79
N-fold change for all the genes.
Fig. 5 The expression profile of BLG, PRL, K-CN, and PIT-1 genes in bovine milk.
Fig. 6 The gene regulation pattern of BLG, PRL, K-CN, and PIT-1 genes in bovine milk.
Fig.7 Heat map showing the mRNA expression of four genes in four breeds using hierarchical cluster.
Genes with increased expression are shown in red; while those with decreased mRNA expression are in
shown in green. The grid segment color indicates up regulation (red), down regulation (green), or no change
-20
0
20
40
60
80
100
120
ANGUS N'DAMA WHITEF HOLSTEIN
Reg
ula
tio
n
Bovine Milk Gene Regulation
BLG PRL K-CN PIT-1
in regulation (black). The lighter the color, the greater the degree of regulation. The relative normalized
expression fall within the range of -7.17 and 7.17 N-fold change for all the genes.