TRANSFORMATION OF FINGER MILLET

“IN VITRO REGENERATION AND GENETIC

TRANSFORMATION OF FINGER MILLET

(Eleucine coracana L.) GENOTYPE GN-4”

A

THESIS

SUBMITTED TO THE

NAVSARI AGRICULTURAL UNIVERSITY

NAVSARI

IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR

THE AWARD OF THE DEGREE

OF

MASTERS OF SCIENCE

IN

PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY

BY

DABHI KIRTI ARAJANBHAI B.Sc. (Biotechnology)

DEPARTMENT OF BIOTECHNOLOGY

N.M.COLLEGE OF AGRICULTURE

NAVSARI AGRICULTURAL UNIVERSITY

NAVSARI- 396 450

GUJARAT

November-2015

Registration No. 04-0955-2011

In vitro regeneration and genetic transformation of finger millet

(Eleucine coracana L.) genotype GN-4

Name of Student

Dabhi Kirti A.

Major Advisor

Dr. Sanjay Jha

Finger millet (Eleucine coracana L.) is an important cereal crop

which constitutes about 81% of the minor millets produced in India. An

efficient in vitro plant regeneration and Agrobacterium tumefaciens

mediated genetic transformation protocol has been described for finger

millet (Eleucine coracana L.) using callus as explants. Among different

cytokinins used, kinetin (1.50 mg/l) in combination with BAP (0.50 mg/l)

produced maximum number of shoots (11.00) and shoot length (9.8 cm).

Maximum frequency of rooting and highest number of roots were

produced on half strength MS basal with NAA (1.0 mg/l).

Agrobacterium mediated genetic transformation, of finger millet

genotype GN-4 was developed by using Agrobacterium Rs-AFP2 strain

carrying marker gene hygromycine phosphotransferase II (hpt II) gene

was used. The integration of the gene was confirmed by PCR. When the

effect of the age of the callus and co-cultivation duration were evaluated,

forty five days old co-cultivated callus for five days yielded 1.33%

frequency of transformation. The morphological features of transgenic

plants did not differ from those of non transgenic plants.

ABSTRACT

Gujarat Agricultural Biotechnology Institute, Surat

Navsari Agricultural University

Navsari - 396 450

Dr. Sanjay Jha Phone no : 7600059128

Associate Professor [email protected]

(Biotechnology)

C E R T I F I C A T E

This is to certify that the thesis entitled “In vitro regeneration

and genetic transformation of finger millet (Eleucine coracana L.)

genotype GN-4” submitted by DABHI KIRTI ARAJANBHAI in partial

fulfillment of the requirement for the award of the degree of

MASTER OF SCIENCE in PLANT MOLECULAR BIOLOGY

AND BIOTECHNOLOGY of the Navsari Agricultural University

is a record of bonafide research work carried by her under my

guidance and the thesis has not previously formed the basis for the

award of any degree, diploma or other similar title .

Place: Navsari (Sanjay Jha)

Date:06 November 2015

Major Advisor

mailto:[email protected]

DECLARATION

This is to declare that the whole of the research work

reported in the thesis for partial fulfillment of the

requirements for the degree of Master of Science in PLANT

MOLECULAR BIOLOGY AND BIOTECHNOLOGY by the

undersigned is the results of investigation done by her under

direct guidance and supervision of Dr. Sanjay Jha, Associate

Professor, Gujarat Agricultural Biotechnology Institute , Surat,

Navsari Agricultural University, Navsari and that no part of

the work has been submitted for any other so far.

Place : Navsari

Date : (Dabhi K. A.)

Countersigned by

(Sanjay Jha)

Associate Professor

Gujarat Agricultural Biotechnology Institute ,

Surat, Navsari Agricultural University

ACKNOWLEDGEMENT

Writing this thesis has been fascinating and extremely rewarding. I would

like to thank a number of people who have contributed to the final result in many

different ways:

My deepest gratitude goes to Almighty God who has blessed me

abundantly to complete my research work with success. I give him all glory and

honor for all that he had done for me.

I gratefully acknowledge to work under the competent guidance of my

major advisor Dr. Sanjay jha, Associate Professor, G.A.B.I., NAU, Surat for his

advice, supervision, valuable suggestions and crucial contribution, which made

him a backbone of this research and so to this thesis. His involvement with his

originality has triggered and nourished my intellectual maturity that I will

benefit from, for a long time to come.

From the bottom of my heart, with a deep sense of requite, I owe debts of

thanks to members of my advisory committee Dr. Nilima Karmakar, Assistant

Professor, Department of Biochemistry, Dr. R. K. Parikh, Rtd. Professor,

Department of Agril. Statistics and Dr. Taslim Ahmed, Professor and Head,

Department of Plant Molecular Biology and Biotechnology for their guidance and

words of wisdom which guided me to carry out my research in a meaningful

manner.

I deem it honorable pleasure to thank my teachers Dr. R. M. Patel, Mr.

Vipul Parekh, Dr. Diwakar Singh, Dr. Chintan Kapadiya and Mr. Kiran Suthar for

their constant encouragement and for providing the needed facilities to carry out

my research. I take pleasure to acknowledge the sincere help rendered by staffs

of Department of Plant Molecular Biology and Biotechnology, made me realize

that little acts of kindness often add up to noble deeds.

I am also thankful to Director of Research & Dean P. G. Studies Dr. A. N.

Sabalpara, Principal and Dean of N. M. College of Agriculture, Dr. M. K. Arwadiya

and Principal and Dean of ASPEE College of Horticulture and Forestry, Dr. N. L.

Patel for providing me this valuable and golden opportunity to upgrade my

qualifications in the discipline of Plant Molecular Biology and Biotechnology.

I would also like to thank my seniors and juniors for their moral support

during my research work. This journey was not possible without their guidance

and provide friendly environment in lab.

I would like to sincerely thank them not only for their support but also for

welcoming me openheartedly into their communities. My mission would be

incomplete if I fail to acknowledge my beloved friends, Kailu, Chinka, Ami di,

Unnati, Vrunda, Komal, Abhilasha di, Niki di, Manisha, Dipak, suresh, Amit,

Chaitanya , Reena, Pooja, Kajal who helped me in every possible way to make my

efforts worthwhile. I will always cherish your friendship and the times that we

spent together. My special appreciation goes to Sanchit, Bhumi, Rima, Usha and

Samir for their friendship and encouragement.

I would also like to extend huge, warm thanks to my roommates Anku Di

and Pritam Di for their love, care and moral support. I admire your distinguished

helping nature and motivation.

It’s my fortune to gratefully acknowledge the support of some special one.

Words fail me to express my appreciation to my roommate Swati Di for her

support and generous care. She was always beside me during the happy and hard

moments to push me and motivate me. Thank you for your sincere

encouragement and inspiration throughout my research work and lifting me

uphill this phase of life. Thank you doesn’t seem sufficient but it is said with

appreciation and respect to you for your encouragement, understanding and

precious friendship.

Last but not least, This journey would not have been possible without the

huge love, kindness and endless support I enjoyed from my family, my parents

Mr. Arajan Dabhi and Mrs. Varsha Dabhi and my brother Kashyap who are my

pillars of hope and strength. I thank them for bearing with my long absences

away from home. I deeply appreciate their immense input into what I have

become today. Thank you for your encouragement and help when I needed it

most.

Place: Navsari

Date: 06/11/2015 (Dabhi K. A.)

CONTENTS

Sr. No. Chapters Particulars Page

No.

1. INTRODUCTION 1-4

2. REVIEW OF LITERATURE 5-15

3. MATERIALS AND METHODS 16-37

4. RESULTS AND DISCUSSION 38-60

5. SUMMARY AND CONCLUSION 61-63

6. REFERENCES I-VI

7. APPENDICES I-VI

LIST OF TABLES

Table

No.

Title Page

No.

4.1 Effect of surface sterilization agent Mercuric Chloride (HgCl2)

on contamination and establishment of finger millet seeds

40

4.2 Effect of days taken for callus formation 40

4.3 Callus formation from seed of finger millet in presence of

different growth regulators

41

4.4 Effect of different concentration of BAP and Kinetin for

multiple shoot regeneration through callus

44

4.5 Effect of different combination of cytokinin and auxin on shoot

culture and root cuture through callus

45

4.6 Effect of serial subculturing on multiple shoot regeneration

through callus

47

4.7 Effect of auxins and strength of media on induction of in vitro

rooting in finger millet

48

4.8 Effect of different potting mixture on survival of in vitro raised

plantlets of finger millet

50

4.9 Effect of different hygromycin concentrations on the callus of

control and transformed finger millet plants

54

4.10 Effect of age of the explants and co cultivation duration with

Agrobacterium on survival percentage of the isolated callus

57

4.11 Percentage generation of PCR positive plants after

transformation

60

LIST OF FIGURES

Fig.

No.

Title Page

No.

3.1 Schematic procedure for preparation of MS medium 20

3.2 General procedure followed for in vitro regeneration

of finger millet

21

3.3 A schematic diagram depicting the cascade of events

leading to Agrobacterium mediated genetic

transformation into plant.

30

4.1 Comparative real time PCR result expression of gene from

finger millet plant after transformation.

60

LIST OF PLATES

Plate

No.

Title

Page No.

4.1 Germination of finger millet seed on seed germination

media and callus initiation

42

4.2 (A) Multiple shoot initiation from callus 46

4.2 (B) Multiple shoot formation from callus 46

4.2 (C) Multiple root formation from callus 46

4.3 Hardening of finger millet plants 49

4.4 In vitro regeneration protocol for Eluecine coracana L. 51

4.5 Determination hygromycin concentration for selecting

finger millet transgenics

53

4.6 Agrobacterium mediated genetic transformation protocol

developed for finger millet

56

4.7 (A) Genomic DNA of finger millet (Eluecine coracana L.) 58

4.7 (B) Confirmation of presence of transgene hpt II (250bp) in

finger millet

58

4.7 (C) Intact total RNA were run on a 1.5% denaturing gel 58

APPENDICES

Sr. No. Title

I List of the instruments used for the study

II Composition of Murashige and Skoog (1962) medium

III Finger millet seed germination medium

IV (a) YEB (yeast extract broth) Medium

IV (b) YEP (yeast extract peptone) Medium

V Media for induction of Agrobacterium tumefaciens.

VI Media for co-cultivation of Agrobacterium tumefaciens

LIST OF ABBREVIATION

CTAB Cetyl-tri-ethyl ammonium bromide

% Per cent

@ At the rate of

µg Micro gram

µl Micro liter

µM Micro molar

½ MS Half strength Murashige and Skoog medium

0C Degree Celsius

BAP 6-Benzylaminopurine or (6-Benzyl adenine)

Bp Base pair

C.D. Critical difference

C.V. Co efficient of variance

Cm Centi meter

DNA Deoxyribonucleic acid

dNTPs 2’- deoxyribonuclotide - 5’ triphosphates

EDTA Ethylene – diamine tetra acetic acid

TE Tris EDTA

et al. Et allii ( and others)

G Gram

HgCl2 Mercuric Chloride

i. e. That is

Kb Kilo base pair

Kin Kinetin ( 6 – furfuryl amino purine)

M Molar

V Volt

mg Milligram

mg/l Milligram per liter

Min Minutes

ml Milliliter

mM Milli molar

NAA 1- Naphthalene Acetic Acid

nM Nanomolar

Ng Nanogram

O.D. Optical Density

ºC Degree Celsius

PCR Polymerase Chain Reaction

S. Em. Standard error of mean

TBE Tris-Borate EDAT

EtBr Ethidium Bromide

Tris Tris (hydroxymethyl) amino methane

RNA Ribonucleic acid

RT PCR Real Time Polymerase Chain Reaction

hptII Hygromycin phosphotransferase II

UV Ultraviolet

v/v Volume per volume or (Volume by volume)

2,4-D 2,4-Dichlorophenoxyacetic acid

CEH Casein enzyme hydrolysate

PGRs Plant Growth Regulators

INTRODUCTION

Finger millet (Eleucine coracana L.) is an important

cereal which belongs to Poaceae family and subfamily

Chloridoidae (Dida et al., 2008). Finger millet is an

allotetraploid (2n=4x=36) and Eleusine coracana sub species

coracana is an annual tetraploid (n=18) grown extensively

through the semi-arid regions of Africa and India (Werth et

al., 1994). It is grown globally on more than 4 million hectares

and is the primary food for millions of people in tropical dry

land regions. The crop is grown as food grain both in Africa

and south East Asia, mainly India and Nepal (Upadhyay et al.,

2006).

It constitutes about 81% of the minor millets produced

in India. In India, it is mainly grown in the states of Uttar

Pradesh, Bihar, Tamil Nadu, Karnataka and Andhra Pradesh

(Dida et al ., 2008). Gujarat is the fourth largest state

producing finger millet preceded by Karnataka on top, Uttar

Pradesh and Maharashtra.

1

Table 1.1: Composition of finger millets (per 100 g edible portion,

12% moisture content)

Sr. No. Particulars Finger millet

1. Carbohydrate (g) 72.6

2. Protein (g) 7.7

3. Fat (g) 1.5

4. Crude fibre (g) 3.6

5. Minerals (g) 2.7

6. Calcium (mg) 344

7. Phosphorus (mg) 250

8. Iron (mg) 6.3

9. Manganese (mg) 3.5

10. Magnesium (mg) 130

(Verma and Patel, 2013)

Finger millet grains also have a relatively higher content

of protein, carbohydrate but contains less amount of fat. It is

rich in calcium, phosphorus, iron, cysteine, tyrosine,

tryptophan and methionine as compared to other cereals.

Finger millet has superior nutritional qualities compared to

rice and wheat (Latha et al ., 2005). Finger millet is high in

dietary fiber, also has medicinal attributes and is used by

diverse communities for making special foods for diabetics,

gluten-free food for people suffering from celiac disease and

weaning foods for infants (Tylor et al., 2006). Finger millet

contains nutritionally important starch fractions (Sharavathy

et al., 2001), which are slowly digested and absorbed and

hence favorable in the diet pattern for metabolic disorders

such as diabetes, hypertension, and obesity (Asp et al.,1983;

Jenkins et al., 1985).

Despite possessing these important qualities, finger millet

has received little attention for transformation studies till

date. Finger millet is also more vulnerable to fungal blast,

which is a major constraint in finger millet production, this

2

demands genetic improvement of finger millet (Ceasar and

Ignacimuthu., 2008). Finger millet blast disease (Pyricularia

grisea) is known to cause as much as 50% losses in yields

(Latha et al ., 2005). It is the most serious disease, particularly

in eastern Africa and India. It declines finger millet grain

quality and is responsible for yield losses of up to 10% to 80%

in Kenya and Uganda and more than 50% in India (Obilana et

al., 2002).

Finger millet blast caused by Magnaporthe grisea

(Pyricularia grisea) is a great threat to finger millet

production worldwide. Agrobacterium tumefaciens has been

considered a universal vector for introducing foreign genes

into crop plants and this bacterium has facilitated the

development of many transgenic plants. Initially, monocots

were considered to be non-transformable by

Agrobacterium , since in natural conditions these plants are not

infected by Agrobacterium .

The lack of an efficient in vitro regeneration system in

monocots was a major cause for the low number of

Agrobacterium-mediated transformation events. After the

development of efficient regeneration systems and a detailed

study on the molecular events occurring during T-DNA

transfer, many laboratories have transformed monocots. These

monocots include rice, wheat, barley, maize and sorghum

(Shrawat and Lorz, 2006). However, finger millet is yet to be

added to the list of monocots transformed by Agrobacterium .

Preliminary work on finger millet transformation was

performed by (Gupta et al., 2001). In another study, a

transgenic finger millet resistant to fungal blast disease was

3

developed by inserting an antifungal gene from prawn (Latha

et al., 2005) using the biolistic method.

Development of fungal resistant finger millet by

transferring genes such as chitinase is one of the best options

available today to overcome fungal attack and improve the

yield of finger millet. So there is an urgent need for genetic

improvement of finger millet by transferring fungal resistance

genes. (Ceasar and Ignacimuthu., 2011).

The success of using transgenic approach for these insect,

pest resistance, disease resistance largely depends on an

efficient in vitro regeneration system and genetic

transformation protocol, which is rapid, reproducible and

applicable to a broad range of genotypes. Therefore, it is

necessary to develop an efficient regeneration and genetic

transformation protocol by a range of different techniques

which would widen the possibilities for developing transgenic

lines and multiplication of improved varieties.

Objectives:

(1) To standardize the protocol for in vitro regeneration of

finger millet genotype GN-4

(2) To optimize genetic transformation protocol for finger

millet genotype GN-4

4

REVIEW OF LITERATURE

Plant tissue culture has an important role to play in the production

and in the manipulation of plant for improved agronomic performance.

Achievement made by various scientists in the field of plant tissue culture

and genetic transformation in finger millet and different plant species is

reviewed in this chapter. Plant tissue culture research and development of

transgenic are multi-dimensional science that offers exciting prospects to

future improvements in crop productivity.

However, difficulty in tissue culture based regeneration and poor

reproducibility of results in the major bottleneck in genetic

transformation of finger millet. The work related to present investigation

entitled “In vitro regeneration and genetic transformation of finger millet

(Eluecine coracana L.) genotype GN-4” were described in brief as

below:

2.1 History of Plant tissue culture

In vitro technique dates back to 1902, when Haberlandt stated the

totipotency of the plant cells. Efforts to demonstrate totipotency led to the

development of the tissue culture. Major breakthrough in plant tissue

culture was seen after (Skoog and Miller,1957) put forth the concept of

hormonal control of organ formation and showed that differentiation of

roots and shoots was a function of relative concentration of auxin and

cytokinin in the medium. The earlier work of (Morel , 1960) reported on

in vitro propagation of orchid provided the stimulus for propagating the

ornamental species through tissue culture. (Murashige and Skoog, 1962)

standardized the nutrient media for tissue culture of tobacco, was a great

achievement. The medium is now widely use for most of the species.

Murashige, 1974 was instrumental in giving the techniques of in

vitro culture, the status of viable practical means for rapid and mass

5

propagation of horticultural crops. Clonal propagation through tissue

culture can be achieved in short space and time. Rapid propagation is one

of the benefits provided by this technique for economically important

crops, especially those plants which are difficult to propagate

conventionally. Plant cell, tissue and organ culture were used to study

biochemical and other aspects of plant physiology and somatic cell

genetics.

At present, plant tissue culture technique is being successfully

employed for rapid production of uniform and superior quality planting

material. In in vitro propagation, the organs and tissues are cultured

through a sequence of steps in which differential cultural and

environmental conditions are provided. (Murashige, 1974) grouped this

sequence of steps into different stages as under.

Stage-I: Explants establishment including selection of mother plant and

collection of explants

Stage-II: Rapid multiplication of shoots through increased axillary

branching / Somatic organogenesis

Stage-III: In vitro rooting

Stage-IV: Acclimatization and planting out

2.2 In vitro regeneration of finger millet

Availability of an efficient and highly reproducible system of tissue

culture regeneration is a prerequisite for genetic transformation

experiments. The effect of different levels of ammonium nitrate used as

macronutrient in the MS medium was investigated for plant regeneration

from embryogenic callus of Eleusine coracana in the presence and

absence of NAA used as growth regulator. Seeds of Eleusine coracana

were cultured on MS medium supplemented with 2.0 mg/l 2,4-D and 0.5

mg/l Kin to obtain embryogenic callus. The results indicate that addition

of higher concentrations of NH4NO3 can substitute for the growth

6

regulator requirement in the medium for plant regeneration (Poddar et

al.,1997).

Kumar et al., 2001 observed that in cereal crops, somatic

embryogenesis is the most common pathway of plant regeneration. The

induction of apical domes occurred on MS medium supplemented with

different auxins and cytokinins. The primary domes, after four weeks of

subculturing on MS + 2,4-D (0.1, 0.2 mg/l), proliferated rapidly and gave

rise to secondary and tertiary domes along with green, nodular, compact

callus. The domes on MS medium containing GA3 (1 mg/l) or NAA

(1 mg/l) gave rise to high-frequency shoot bud differentiation.

Kothari et al., 2004 studied the growth and morphogenesis of plant

tissues under in vitro conditions are largely influenced by the composition

of the culture media. Primary callus induction without ZnSO4 resulted in

improved shoot formation upon transfer of callus to normal regeneration

medium. CuSO4 increased to 5X the normal concentration in the media

for primary seed callus induction and plant regeneration resulted in a 4-

fold increase in number of regenerated shoots.

Ceasar and Ignacimuthu, 2008 reported an efficient somatic

embryogenesis and plant regeneration system was developed from shoot

apex explants of finger millet, Eleusine coracana. Eight genotypes, CO 7,

CO 9, CO 13, CO 14, GPU 26, GPU 28, GPU 45, and GPU 48 were

assessed in this study. The maximum somatic embryogenic induction, at

98.6%, was obtained from explants cultured on MS medium

supplemented with 18.0 μM 2,4-D and 2.3 μM Kin. The highest number

of shoot induction was observed after transfer of embryonic callus to

regeneration medium supplemented with 4.5 μM TDZ and 4.6 μM Kin.

Significant differences were observed between genotypes for somatic

embryogenesis and plant regeneration. GPU 45 gave the best response,

while CO 7 was the least responsive under the culture conditions tested in

7

this study. Regenerated plants were successfully rooted and grown to

maturity after hardening in soil.

Rao et al., 2009 studied genotypic differences for callus induction,

per cent frequency of plantlet regeneration and mean number of plants

formed per 200 mg callus were observed in finger millet (Eleusine

coracana). BAP was better, but kinetin is effective in finger millet for

plant regeneration. High frequency plant regeneration was noticed up to

165 to 180 days which would pave the way for genetic transformation of

finger millet.

Kothari et al., 2008 observed that basal medium constituents and

their concentration play an important role in growth and morphogenesis

of plant tissues cultured in vitro. The effect of different inorganic

nutrients (CoCl2, MnSO4, ZnSO4, CuSO4 and AgNO3) on callus induction

and plant regeneration in Eleusine coracana was examined. Significant

improvement in plant regeneration was also observed with the increase in

levels of Co and Mn. Optimization of nutrient level in the basal medium

has highly significant role in obtaining maximum regeneration response

from explants and callus culture.

Prasad et al., 2011 produced an effective protocol for the

regeneration of multiple shoots from the shoot apices. Shoot apex from

10-12 days old seedlings were collected and were inoculated onto MS

medium supplemented with various growth regulators. Proliferation of

about 8 shoots was obtained 4 mg/l BAP. The regenerated shoots were

rooted on MS medium + IBA (1mg/l). Rooted shoots were sequential

acclimatized by transferring them to sterile distilled water and tap water

before plating in various pot mixtures. A maximum of 60% survival rate

was noticed on a mixture of soil: sand: manure. (1:1:1).

Anjaneyulu et al., 2011 reported that Shoot tips of finger millet

(Eleusine coracana) were inoculated on to MS medium supplemented

8

with different concentrations and combinations of auxins [(2,4-D, NAA),

cytokinins (KN, BAP) and other growth promoters (Proline, Tryptophan,

CEH]. The higher degree of embryogenic callus formation observed with

2,4-D was at 2.5 mg/l in the presence of 0.5 mg/l of BAP. Among all the

combinations employed the highest degree of callus formation was

observed at 2.5 mg/l of 2,4-D, 0.5 mg/l of BAP, Proline (500 mg/l),

Tryptophan (250 mg/l) and CEH (300 mg/l). A maximum of 97 % of

shoot tip explants were successful in inducing callus at this combination

of growth regulators. Highest mean number of shoot buds (67%) and

good rooting was observed when embryogenic calli was subcultured on

MS medium supplemented with 1 mg/l Kin and 0.5 mg/l NAA. The

regenerated plantlets could be transferred successfully to the field with

85% survival.

Finger millet production is significantly affected by fungal disease

(Nicholas 2003). Integration of fungal resistant genes into finger millet is

needed to enhance the fungal resistance and improve the yield

(Radjacommare et al., 2004).Transgenic modification offers one method

for the introduction of fungal resistance genes but requires first the

development of efficient in vitro plant regeneration systems. The first in

vitro study in finger millet was reported in by (Rangan, 1976). The

induction of somatic embryogenesis in finger millet has been reported in

which immature inflorescences and shoot apical meristems were induced

to form somatic embryos on MS basal medium containing 2,4-D and KN

(Sivadas et al., 1990; Latha et al., 2005) and also from medium

supplemented with picloram and kinetin(George and Eapen, 1990).

2.3 Agrobacterium mediated genetic transformation

Agrobacterium tumefaciens is a gram-negative soil bacterium that

causes crown gall tumours on many dicotyledonous and some

monocotyledonous plants by transferring a part of its DNA called

transferred DNA (T-DNA) from its tumor inducing (Ti) plasmids to the

9

plant genome. The virulence (vir) region of the Ti plasmid codes for the

function of required processing and transfer of T- DNA. The discoveries

that T-DNA is coded for oncogenes which is only transferred to plant cell

genome and non virulent or disarmed strains i.e. containing T-DNA from

which oncogenes are being removed and replaced by any other gene of

interest behave in the same way as virulent strain do, that opened a new

avenues in transformation of higher plants.

Genetic engineering or transformation refers to the delivery of

DNA, encoding a desirable trait to the plant cell. In order to deliver

pieces of DNA to the plant of choice, two methods, namely physical and

biological, are used. The physical method includes particle or

microprojectile bombardment and electroporation while the only

successfully applied biological technique is Agrobacterium-mediated

transformation. Since both physical and biological methods facilitate the

transfer of the traits of importance to the plants of interest, a number of

crop improvement studies benefited from the technique. Traits commonly

employed in the transformation are those which increase resistance

against biotic and abiotic stresses or those which improve the quality of

food.

Ceasar and Ignacimuthu, 2011 studied that Agrobacterium-mediated

transformation system was developed for finger millet using shoot apex

explants. The Agrobacterium strain LBA4404 harboring binary vector

pCAMBIA1301, which contained hygromycin phosphotransferase (hptII)

as selectable marker gene and b-glucuronidase (GUS) as reporter gene,

was used for optimization of transformation conditions. Two finger millet

genotypes, GPU 45 and CO 14, were used in this study. The optimal

conditions for the Agrobacterium mediated transformation of finger

millet were found to be the co-cultivation of explants obtained on the 16th

day after callus induction (DACI), exposure of explants for 30 min to

agrobacterial inoculum and 3 days of co-cultivation on filter paper placed

10

on medium supplemented with 100 mM acetosyringone (AS). Both finger

millet genotypes were transformed by Agrobacterium. A frequency of

19% transient expression with 3.8% stable transformation was achieved

in genotype GPU 45 using optimal conditions.

Sharma et al., 2011 reported that Agrobacterium-mediated

transformation protocol has been developed for Eleusine coracana (var.

PR-202) by varying several factors which influence T-DNA delivery.

Green nodular regenerative calli with meristematic nodules of seed origin

were used as the target tissue for Agrobacterium tumefaciens-mediated

gene transfer. The highest frequency of transformation (44.4%) was

observed when callus was infected, co-cultivated and incubated at 22°C.

Incorporation of higher level of CuSO4 in the regeneration medium had

significantly positive effect on the recovery of transformed plants. PCR

analysis of T0 and T1 generation plants with nptII-specific primers

revealed the amplification of nptII gene. Southern blot analysis of six

regenerated plants confirmed selectable marker gene integration in three

plants. This is a first report on Agrobacterium-mediated genetic

transformation of finger millet and will pave the way for further studies in

this and other millet crops.

Ignacimuthu and Ceasar, 2012 reported that finger millet plants

conferring resistance to leaf blast disease have been developed by

inserting a rice chitinase (chi11) gene through Agrobacterium-mediated

transformation. Transformed plants were selected and regenerated on

hygromycin-supplemented medium. The incorporation of rice chitinase

gene in R0 and R1 progenies was confirmed by PCR and Southern blot

analyses. Expression of chitinase gene in finger millet was confirmed by

Western blot analysis with a barley chitinase antibody. A leaf blast assay

was also performed by challenging the transgenic plants with spores of

Pyricularia grisea. The frequency of transient expression was 16.3% to

11

19.3%. Stable frequency was 3.5% to 3.9. Chitinase activity ranged from

19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced

three resistant and one sensitive for hygromycin, confirming the normal

Mendelian pattern of transgene segregation. Transgenic plants showed

high level of resistance to leaf blast disease compared to control plants.

This is the first study reporting the introduction of rice chitinase gene into

finger millet for leaf blast resistance.

Latha et al., 2005 studied the reproducible protocols for in vitro

plant regeneration and genetic transformation have been established in

finger millet using particle inflow gun-mediated method. Using the

optimized protocol, >4000 plantlets were regenerated from the callus of

each shoot-tip explants within 75 days. Plasmid construct pPur,

containing uid A gene driven by CaMV 35S promoter, was used for

developing the transformation system. A gene coding for an antifungal

protein (PIN) of prawn was chemically synthesized and was cloned into

bacterial and plant expression vectors. Embryogenic calli were co-

bombarded with the construct containing pin gene (pPin 35S) and another

construct containing bar gene (pBar 35S) driven by CaMV 35S promoter.

For stable transformation, the co-bombarded calli were cultured on

phosphinothricin (PPT) - supplemented medium. This study, first of its

kind, reports the production of pin expressing transgenic finger millet

exhibiting high-level resistance to leaf blast disease.

In the era of the plant transformation was initiated when (Fraley et

al., 1983) reported the Agrobacterium mediated transformation of petunia

and tobacco. Protoplast cells were inoculated with the Agrobacterium

tumefaciens. The chimeric genes containing nopaline synthase region

joined to gene for neomycin phosphotransferase II and I. Transformed

cells proliferated on medium containing 50 mg/ml kanamycin. They

discussed that expression of NPTase I and II enzymes in plants depends

on transcription from the nopaline synthase promoter. Southern

12

hybridization was used to confirm the presence of chimeric gene in the

transformed plants.

Horsch et al., 1985 described a protocol of co-cultivating

Agrobacterium with leaf discs instead of protoplasts to overcome

problems of regeneration of the plants through protoplasts. This most

common Agro-infection methodology includes a two-day co-cultivation

of Agrobacterium (containing a selectable marker such as npt-II; which

confers resistance to the antibiotic kanamycin) with the mesophyll cells

of the leaf disc. This was followed by the culture of leaf discs on shoot

induction medium containing kanamycin resulting in production of

transgenic plantlets.

2.4 Co-cultivation with Agrobacterium culture

There are some requirements to optimize several factors like age of

the explants, concentration of infection and co-cultivation time of the

Agrobacterium as these factors affect the efficiency of transformation

(Mannan et al., 2009). A specific time period is required by

Agrobacterium for its attachment and for transfer of its T-DNA to

explant. Less infection time period, of course produces low number of

transformed explants where as more time period for explants in infection

medium may cause hypertonic conditions that bursts the cell or it may be

due to hyper activation of defense mechanism that may be lethal to cell

and hence results low frequency of transformation. Plant cell requires

some time to adopt this foreign DNA making co-cultivation time

important. Less time does not ensure integration and working of

transferred DNA while higher time can also be lethal due to overgrowth

of Agrobacterium that behaves as parasite with explants and decreases

nutrients supply.

Mondal et al., 2001 reported that the differential requirement of co-

cultivation period depend on Agrobacterium strain used for co-cultivation

13

or medium for bacterial culture. An experiment on optimization of

Agrobacterium mediated genetic transformation in Indica rice using two

important parameters: Infection time and Co-cultivation period. They

have used infection time 5, 10 and 15 minutes and co-cultivation period

2, 3 and 4 days using 50 numbers of explants in each treatment. The

transformation experiment showed that infection was most effective when

explants were inoculated for 15 minutes (72.59% GUS positive) and co-

cultivation for four days (70.37% GUS positive) with Agrobacterium

(Nazim-Ud Dowla et al.,2008).

Carvalho et al., 2004 reported that the four factors that we found

most influenced transformation were: the sensitivity of immature

sorghum embryos to Agrobacterium infection, the growth conditions of

the donor plant, type of explant and co-cultivation medium. A major

problem during the development of our protocol was a necrotic response

which developed in explants after co-cultivation. Immature sorghum

embryos proved to be very sensitive to Agrobacterium infection and we

found that the level of embryo death after co-cultivation was the limiting

step in improving transformation efficiency. The addition of coconut

water to the co-cultivation medium, the use of vigorous and actively

growing immature embryos and the removal of excess bacteria

significantly improved the survival rate of sorghum embryos and was

critical for successful transformation. Hygromycin phosphotransferase

(hpt) proved to be a good selectable marker for sorghum. They were also

found that β-glucuronidase (GUS) activity was low in most of the

transgenic plant tissues tested, although it was very high in immature

inflorescences. Although promising, the overall transformation efficiency

of the protocol is still low and further optimization will require particular

attention to be given to the number of Agrobacterium in the inoculum and

the selection of sorghum genotypes and explants less sensitive to

Agrobacterium infection.

14

Indra Arulselvi et al., 2010 studied that Sorghum ranks as the sixth

most planted crop and it is vulnerable to fungal diseases resulting in

decreased grain quality and yield loss. Agrobacterium strains used were

LBA4404 harbouring pcambia-ubi-chi11 (rice chitinase), EHA105

harbouring pcambia-ubi RC7 (rice chitinase) with bar gene and EHA105

harbouring pMKURF2 (rice chitinase gene) having hph gene for

producing fungal resistance in sorghum plants. pCRC7 harbouring

chitinase gene driven by ubiquitin promoter was found to be more

efficient than pCG11 and pMKURF2. Out of the concentrations of

acetosyringone tested, 200µM showed maximum transformation

efficiency. Out of the two selection agents tested, bialaphos was found as

a suitable selection agent. The transgenic nature of the sorghum calli and

plants were shown by transient gus expression, their ability to survive in

the selection medium and by western blot. The transformation frequency

was found to be very low.

Sharma et al., 2009 observed that conditions such as co-cultivation

period, bacterial concentration, concentration of BAP, zeatin and IAA

were optimized. Co-cultivation of explants with a bacterial concentration

of 108 cells/ml for three days on 2 mg/l BAP, followed by regeneration

on a medium containing 1 mg/ml zeatin resulted in a transformation

frequency of 41.4%. Transformation of tomato plants was confirmed by

Southern blot analysis and β-glucuronidase (GUS) assay. The protocol

developed showed very high efficiency of transformation for tomato

varieties Pusa Ruby, Arka Vikas and Sioux.

15

MATERIALS AND METHODS

The present investigation entitled “In vitro regeneration and

genetic transformation of finger millet (Eluecine coracana L.)

genotype GN-4” was carried out at the Department of Plant Molecular

Biology and Biotechnology, ASPEE College of Horticulture and

Forestry, Navsari Agricultural University, Navsari, Gujarat during the

year 2011-2015. The chapter contains the details regarding the

experimental materials used and methodology adopted during the course

of investigation.

3.1 MATERIALS

3.1.1 Source of explants

Seed material of finger millet genotype GN-4 obtained from Hill

Millet Research station, Waghai (Dang). Navsari Agricultural University,

Gujarat.

3.1.2 Chemical and Glassware

All the glassware’s required were obtained from Corning, Borosil,

Schott and Duran. The disposable plastic wares (centrifuge tubes, PCR

tubes, micro tips, etc.) from Tarsons Ltd. India, Axygen, Axiva, Future

Bioscience and Eppendorf. All the chemicals used were of analytical

reagent grade/molecular grade and were obtained from Sisco Research

Lab. (SRL), LOBA Chemicals, Sigma, Hi-Media, E-Merck, Qualigens,

Bangalore Genei, Fermentas and QIAGEN.

3.1.3 Instruments

The basic instruments required for the present study are enlisted in

Appendix-I.

16

3.2 METHODS

3.2.1 Preparation of glasswares and equipments

Glass wares and culture vessels used for preparation of media and

the contaminant purposes were cleaned in chromic acid (Potassium

dichromate in Sulphuric acid). Acid traces were removed by prolonged

and thorough washing in tap water. The glass wares and culture vessels

were then washed with detergent (Teepol, BDH) followed by thorough

washing with excess tap water and finally rinsed with glass double

distilled water and dried in an oven at 700C. Pipettes, all dissecting

equipments, filter papers were autoclaved at 1210 C for 20 min at a

pressure of 15 lbs/inch2 after wrapping in aluminum foil.

3.2.2 Media Preparation

Stock solutions of the media ingredients were prepared in double

distilled water. Appropriate aliquots of these solutions were mixed to

prepare the media. Concentration of the macro and micro nutrients and

organic constituents of the MS (Murashige and Skoog, 1962) basal

medium are listed in Annexure-II. Stock solutions of plant growth

regulators (PGRs) were prepared and stored for maximum period of one

month. For media preparation, calculated amount of aliquots were added

from these stock solutions. Carbohydrate was weighted and added in

required quantity and allowed to dissolve. Unless mentioned, pH of all

the media adjusted to 5.7-5.8 using 1N NaOH or 1N HCL after mixing all

the constituents except the gelling agent. The final volume was made up

with distilled water. Gelling agent (agar agar or phytagel) was then added

and heated on gas stove to allow the agar/ phytagel to melt. Thoroughly

mixed molten medium (approximately 30 ml) was dispersed into sterile

culture bottles or flask. All the culture media were autoclaved for 20 mins

at 1210C and 15 lbs/inch

2. Autoclaved media was poured in sterile

petridishes inside laminar flow cabinet before gelling, as and when

required. Gibberellic acid and antibiotics used in media were filter

17

sterilized through syringe filter (0.22µM) and added aseptically to the

autoclaved medium before it was allowed to solidify.

3.2.3 Aseptic techniques

All inoculations and manipulations involving sterile culture or

media were carried out inside laminar flow cabinet. The interior of the

laminar flow was swabbed with 70 per cent ethanol. The instruments and

other materials and placed inside the laminar airflow cabinet. The cabinet

door was closed and UV lights were switched on for 20 to 30 minutes

prior to working. The hands and arms were washed with soap and water

and then swabbed with 70 per cent ethanol before carrying out plant

manipulations inside the cabinet. The equipments such as forceps,

scalpels, blade handle etc. were sterilized by dipping them in absolute

alcohol followed by flaming and cooling. This was done at the start of

inoculation and also several times during the operation. During

inoculation, first the cap or cotton plug of the culture vessel was removed

and the neck of the vessel was flamed over a spirit lamp kept in the

cabinet. The sterile and trimmed explants were quickly transferred to the

culture vessels containing suitable culture medium using sterilized

forceps.

The neck of the culture vessel was once again flamed and quickly

stoppered by cap or cotton plug. Care was taken to avoid any obstruction

of the laminar flow by placing nothing between the work area and the

source of air flow. Further, crossing over of hands and arm was avoided.

If any plant material fell on to the floor of the cabinet, it was discarded

assuming that it was contaminated. After completion of work the cabinet

was switched off, sprayed with 70 per cent ethanol and front panel

replaced.

18

3.2.4 Culture conditions

All the culture were incubated in a culture room at a temperature of

25 ± 20

C with relative humidity at 55 ± 5 per cent and kept in dark

condition for callus induction and for multiplication were exposed to a

photoperiod of 16 h and 55±5% of relative humidity (RH).

19

Figure 3.1: Schematic procedure for preparation of MS medium

20

3.3 Micro propagation procedure

General micropropagation procedure adopted in the present

investigation was illustrated in figure.

Figure 3.2: General procedure followed for in vitro regeneration of

finger millet

EXPLANT

ESTABLISHMENT ON

GROWTH MEDIUM

MULTIPLE SHOOT

REGENERATION

SURFACE STERILIZATION

AND WASHING

PROLIFERATION OF

SHOOTS

IN VITRO ROOTING

ACCLIMATIZATION

21

3.3.1 In vitro establishment of explants

3.3.1.1 Preparation and inoculation of explants

Seed material of finger millet genotype GN-4 obtained from Hill

Millet Research station, Waghai (Dang). Navsari Agricultural University,

Gujarat. Seeds were surface sterilized in 0.1% (w/v) mercuric chloride for

6 minutes followed by 4-5 times rinses in sterile deionized water. Seven

to eight seeds were placed in petriplates containing basal MS medium

(Murashige and Skoog, 1962) and incubated in the dark condition for

germination.

3.3.1.2 Standardization of surface sterilization method for seeds

In order to standardize the most effective surface sterilization

treatment of seeds, a trial was conducted using different duration for

treatments of 0.1% (w/v) mercuric chloride (HgCl2). The experiment was

repeated for three times. The details of treatments were given below:

Treatments

Sterilizing

agent

Concentration

(%)

Duration for

treatments

S1 HgCl2 0.1 2 minutes





3.3.1.3 Standardization of age of seeds to isolate callus

After standardization of sterilization method, the age of explants

used for isolating callus was examined. The experiment was repeated for

three times.

22

The details of treatments were given below:

Treatments Age of explants in days

A1 15 days

A2 30 days

A3 45 days

A4 60days

A5 75days

3.3.1.4 Standardization of callus induction

MS basal medium was used for trial which showed better response

for callus induction in the presence of different plant growth regulators

separately. Different plant growth regulators were tried to standardize the

most suitable culture medium for callus induction of finger millet. The

experiment was repeated for three times.

The details of the treatments were given below.

Treatment No. Treatments

F1 MS + 50 mg/l 2,4-D

F2 MS + 100 mg/l 2,4-D

F3 MS + 150 mg/l 2,4-D

F4 MS + 200 mg/l 2,4-D

F5 MS + 100 mg/l Proline




F9 MS + 100 mg/l CEH




24

18

23

3.3.1.5 Standardization of callus formation from finger millet seeds in

combination of different growth regulators


for callus formation. Different plant growth regulators and their

combinations were tried to standardize the most suitable culture medium

for finger millet. The combination which showed better response was

used for callus induction. The experiment was repeated for three times.


Treatment

No. Treatments

F1 MS + 100 mg/l 2,4-D + 100 mg/l Proline + 100 mg/l CEH
















24

3.3.1.6 Standardization of multiplication medium


for establishment of finger millet explants. Different plant growth

regulators were tried to standardize the most suitable culture medium for

multiplication of finger millet. The experiment was repeated for three

times.


Treatment

No. Treatments

T1 MS + 0.50 mg/l BAP




T5 MS + 0.50 mg/l KIN




3.3.1.7 Standardization of subculturing for multiplication of shoots

Basal medium was used which showed better response for

establishment of finger millet explants. Different plant growth regulators

and their combinations were tried to standardize the most suitable culture

medium for finger millet. The combination which showed better response

was used for establishment of subculturing for multiple shoot

regeneration. The experiment was repeated for three times.

25


Treatment

No. Treatments

E1 MS + 0.50 mg/l BAP + 0.50 mg/l KIN + 0.50 mg/l NAA
















3.3.1.8 Standardization of in vitro rooting medium

The trial on in vitro rooting was conducted on half and full MS

medium gelled with 0.8 per cent agar. Each medium was supplemented

with different concentrations of NAA and IBA. The experiment was

repeated for three times.

26

The details of the treatments were given below:

Treatment

No. Treatments

R1 ½ MS basal

R2 ½ MS + 0.05 mg/l NAA

R3 ½ MS + 0.10 mg/l NAA

R4 ½ MS + 0.50 mg/l NAA

R5 ½ MS + 1.00 mg/l NAA

R6 MS + 0.05 mg/l IBA




3.3.1.9 Standardization of potting mixture for hardening of in vitro

plantlets

The different potting mixtures (H) used for hardening of in vitro

raised plantlets in the experiment are appended below. Each experiment

was repeated three times.

The details of the treatments done was given below:

Treatment

No. Treatments

H1 Vermicompost

H2 Sand

H3 Coco peat

H4 Vermicompost : sand (1:1 v/v)

H5 Vermicompost : sand : Coco peat (1:1:1 v/v)

27

3.4 Agrobacterium mediated transformation and transgenic plants

regeneration:-

3.4.1 Hygromycin sensitivity test

The test was performed in order to check the sensitivity of cultured

tissues to hygromycin. Different concentration of hygromycin were added

to pre sterilized molten MS media by filter sterilizations through 0.22 µm

pore size membrane filter and the medium poured in petriplates. Isolated

callus were inoculated at different concentrations of hygromycin. Effect

of the antibiotic on callus was observed to determine its optimum

concentration in selection media.

3.4.2 Maintenance of Agrobacterium tumefaciens culture

The laboratory glycerol stocks of the bacterial culture stored at -80

0C was utilized to streak YEB medium plates containing 50mg/l

kanamycin and 10mg/l rifampicin. To achieve proper growth of A.

tumefaciens, inoculated plates were incubated at 280C under dark

conditions for 3-4 days. Then cultures were kept at low temperature

(4±20C).

3.4.3 Preparation of fresh culture of Agrobacterium tumefaciens

1. Single, isolated colonies from YEB medium plates was inoculated

individually in 50ml YEP medium containing 50mg/l kanamycin

and 10mg/l rifampicin in tubes and was grown at 28 0C with 200

rpm in an incubator shaker for 20-24 hours to make primary

culture.

2. The inoculum for secondary culture was taken from this primary

culture and inoculated to 50ml of YEP medium in 250 ml

Erlenmeyer flask harvested at 0.4-0.6 O.D. at 600nm and was

utilized for transformation experiments.

28

3.4.4 Induction of Agrobacterium tumefaciens culture:

1. The secondary culture was centrifuged at 5000 rpm for 10 minutes

at 40C.

2. The pellet resuspended in an induction medium (Annexure V) with

100μM acetosyringone and incubated for 4 hour on an incubator

shaker at 175 rpm and 26 0C temperature.

3. After this incubation period, the bacteria was centrifuged at 5000

rpm for 10 minutes and the pellet was resuspended in MSO

medium ( Annexure VI) containing 100 μM acetosyringone and

grown for 2 hours at 250C and 150 rpm in an incubator - shaker.

3.4.5 Infection and co-cultivation of the explants

30, 45 and 60 days old callus on MS medium were taken as a

source of explants. The latter were shaked with Agrobacterium culture

harboring the Rs AFP2 gene constructs and co-cultivated in dark for 3, 5

and 7 days respectively. In this method callus were infected and

inoculated with culture of the Agrobacterium tumefaciens.

3.5 Confirmation of putative transgenic finger millet plant

3.5.1 Confirmation of putative transformed plant on selection media

In the putative transgenic plants, expression of the transgene hpt II

was analyzed by first establishing the concentration of hygromycin and

cefotaxime in that hygromycin that would kill untransformed plants.

After co-cultivation, explants were washed six times with sterile

distilled water containing 250 mg/l cefotaxime. Cleaned apices were

blotted dry using a sterile paper towel and cultured on the selection

medium consisting of MS with 250mg/l cefotaxime and 40mg/l

hygromycin. Callus which was not inoculated with Agrobacterium

tumefaciens were placed on the selection medium served as a negative

control. Cefotaxime was included in the selection medium to suppress

the Agrobacterium tumefaciens growth.

29

The petridishes were incubated at a temperature of 280C under an

18 hours photoperiod and sub-cultured every 2 weeks. The process was

repeated until negative control, which was not inoculated with

A. tumefaciens,were totally dead. After this period the surviving callus

were transferred to an MS medium without hygromycin to root the plants.

Figure 3.3: A schematic diagram depicting the cascade of events

leading to Agrobacterium mediated genetic

transformation into plant

3.5.2 Confirmation of putative transformed plants through PCR

3.5.2.1 Extraction of DNA

3.5.2.1a Extraction of plant genomic DNA:

Genomic DNA isolated from leaves of plants by the CTAB method

with minor modification (Doyle and Doyle, 1990). The procedure for

DNA isolation used was as under:

1. One gram of leaf tissue was taken from the young plant, frozen in

liquid nitrogen and ground into a fine powder in a prechilled

mortar and pestle.

2. Sample were homogenized properly and the powder transferred

into 1.5ml centrifuge tube and 2 ml of the extraction buffer

30

(0.1 M Tris, pH 8.0; 0.05 M EDTA, pH 8.0; 1.5 M NaCl; 0.01 M

β-mercaptoethanol, CTAB 3%, PVP 1%) was added.

3. Mixture were homogenized properly and incubated at 650 C for 40-

45 mins.

4. Equal volume of Chloroform: Isoamyl alcohol (24:1) was added,

mixed by mild vortexing for 5-10 seconds and centrifuged at

13,000 rpm for 5 minutes at room temperature.

5. Upper phase was collected and double volume of isopropanol was

added, gently invert the tubes and keep at -200C for 2-3 hour.

6. After this DNA was pelleted by centrifugation at 13,000 rpm for 20

minutes at 40C.

7. The pellet was washed with 70 % ethanol, centrifuge at 13,000

rpm for 20 minutes at 40C.

8. Pellet was dried in dry bath at 650C

9. 50µl TE buffer was added in pellet, spin it for proper mixing

3.5.2.1b Isolation of plasmid DNA

Plasmid DNA was isolated by standard alkaline lysis method

(Sambrook et al., 1989). Isolated DNA was given RNAse treatment and

purified with phenol: chloroform method.

3.5.2.2 Estimation of quantity and quality of DNA

The quantification of DNA was carried out as per using Nanodrop

spectrophotometer and O.D was measured at 260 and 280 nm. The

quality of DNA was checked on 0.8 % (w/v) agarose gel prepared in 0.5X

TBE (Tris 45 mM, Boric Acid 45 mM and EDTA 1 mM ) containing 5 µl

of ethidium bromide (EtBr 50g/ml) per 100 ml of buffer. The already

extracted genomic DNA from the stock (5 µl) was mixed with 1 µl of 6X

agarose gel loading dye. The 5µl sample was loaded in each well using

micropippette. Gel was provided a potential difference of 5-6 V/cm for an

hour. Bands were visualized under UV light using a transilluminator.

31

The samples, which resolved into a single discrete high molecular

weight band near the well with no shearing, were considered to be of

good quality. The good quality DNA samples with a ratio of 1.8 – 2.0 at

O.D. 260/280 were retained for PCR amplification. The stocks were

diluted to a final concentration of 50 ng/µl of DNA and used for further

applications.

3.6 Polymerase Chain Reaction (PCR):

Genomic DNA isolated from leaves of plants by the CTAB method

with minor modification (Doyle and Doyle, 1990). PCR amplification of

a 1.0 kb DNA fragment of gene was carried out in Biometra thermal

cycler using the hpt II gene fragment was amplified using the forward

primer 5’ CCCTGATGGCATCCGAAGAGC 3’ and the reverse primer

5’ GAGGCAGCAGTGATGACATCC 3’. The PCR reaction mixture

contain 50 ng genomic DNA in a final volume of 20 µl containing 1x

PCR buffer, 1.2 µl MgCl2, 250 µM dNTPs, 1 µl each of primer and 0.3

units of Taq DNA polymerase. Amplification was carried out by:-

Step-I: Initial denaturation at 94 0C for 4 minutes

Step-II: followed by 30 amplification cycle at 94 0C for 50 seconds

Step-III: Final extension at 72 0C carried for 5 minutes.

The completed reactions were then held at 4 0C until

electrophoresis was done. PCR products were separated by loading 1.5

µL of each sample and 2 µl of loading buffer type II on a 1.2 % agarose

gel prepared with 0.5X TBE buffer. The sample were subject to

electrophoresis at 80-90V for 20-25 minutes in 0.5X TBE buffer. The gel

was stained with ethidium bromide and visualized under UV light.

3.7 Total RNA Isolation

Total RNA was extracted from the leaves by a modified Trizol

method. Fresh leaves (0.1 g) from plant were powdered in liquid nitrogen

using a pestle and mortar.

32

The resulting powder was transferred to a 1.5 ml tight capped

eppendorf tube with 1 ml TRIzol reagent and incubated at room

temperature for 5 minutes. 0.2 ml chloroform was added with vigorous

shaking for 30 seconds and incubated at room temperature for 2-3 min.

Tubes were centrifuged at 12000 X g at 40C for 15 min. Aqueous phase

was transferred in another eppendorf tube and 0.5 ml of isopropanol was

mixed properly. Then eppendorf tubes were kept at room temp for 10 min

and centrifuged. Supernatant was removed and RNA pellet was washed

in 1 ml 75% ethanol at 10000 X g for 5 min at 40C. Pellets were dried

about 1-2 hour then dissolved in 25-30 µl DEPC treated water and kept at

65 0C on dry bath for 10 min. The extracted RNA was loaded on 0.8%

agarose gel.

3.7.1 Quantification and quality check of RNA

The quality of RNA was checked by agarose gel electrophoresis

and quantification was carried out by Nano Spectrophotometer. The RNA

absorbs UV light very efficiently making it possible to detect and

quantify either at concentrations as low as 2.5 ng/µl. The nitrogenous

bases in nucleotides have an absorption maximum at about 260 nm. The

RNA samples with the ratio of 1.7-2.0 at O.D. 260/280 were retained for

RNA fingerprinting. RNA was separated by denaturing agarose gel

electrophoresis. The gels of 0.8% (w/v) agarose was prepared in 1.0 X

formaldehyde agarose gel buffer (Sambrook and Russell, 2001). Agarose

(0.8 gm) was dissolved in 10 ml 10x Formaldehyde Agarose gel buffer

and volume was made up to 100 ml with RNase free water. Agarose was

boiled in microwave oven and cooled to 650C in a water bath. Then 1.8

ml of 37% (12.3 M) formaldehyde and 1 µl of a 10 mg/ml ethidium

bromide form stock solution were added. Gel solution was mixed

thoroughly and poured onto gel support. Prior to running the gel, gel was

equilibrated in 1x Formaldehyde agarose gel running buffer for 30 min.

one volume of 5x loading buffer was added per 4 volumes of RNA

33

sample and Incubated for 3–5 min at 650C, chill on ice, and loaded onto

the equilibrated formaldehyde agarose gel. Gel was run in 1x

Formaldehyde agarose gel running buffer at 5V/cm till the dye reaches

three fourth of gel. RNA bands were visualized on UV Transilluminator

(GeNeiTM). When resolved by electrophoresis the 28S and 18S RNA

should exhibit at near 2:1 ratio on ethidium bromide staining indicating

that no significant degradation of RNA has occurred.

3.7.1.1 1x Formaldehyde Agarose Gel Running Buffer

100 ml 10x Formaldehyde Agarose gel buffer

20 ml 37% (12.3 M) formaldehyde

880 ml RNase-free water

3.7.1.2 5x RNA Loading Buffer

16 µl saturated aqueous bromophenol blue solution

80 µl 500 mM EDTA, pH 8.0

720 µl 37% (12.3 M) formaldehyde

2 ml 100% glycerol

3084 µl formamide

4ml 10 x Formaldehyde Agarose gel buffer

RNase-free water to 10 ml

Stability: Approximately 3 months at 4°C

3.7.2 cDNA synthesis

The cDNA was synthesized by using high capacity cDNA reverse

transcription kit which uses the random primer scheme for initiating

cDNA synthesis. Random primers ensure that the first strand synthesis

occurs efficiently with all species of RNA molecules present, including

mRNA and rRNA. A master mix for cDNA synthesis was prepared by

following method.

34

Preparation of First Strand cDNA Synthesis

Component Volume (µl)

Template RNA 2.0

Oligo (dt)18 primer 01

Water 09

Total volume 11

Reaction mixture mixed gently centrifuged briefly and incubated at

650C for 5 min. Chill on ice, spins down and placed the vial. Add the

following component in the indication order.

5X reaction Buffer 04

Ribolock TM RNase Inhibitor (20u/µl) 01

10 mM dNTP mix 02

Reverse Transcriptase (20u/µl) 02

Total 20

Mix gently and centrifuge. Incubate for 5 min at 25 0C followed by 60

min at 37 0C. Terminate the reaction by heating at 70

0C for 5 min. The

reverse transcription reaction product directly used in PCR application or

stored at -20 ºC for less than one week. For longer storage, -70 0C was

used.

3.7.3 Expression Analysis of Gene by Real-Time (RT) PCR

Real-time PCR is one of the most sensitive and reliably

quantitative methods for gene expression analysis. It has been broadly

applied to microarray verification, pathogen quantification, cancer

quantification, transgenic copy number determination and drug therapy

studies. A PCR has three phases, exponential phase, linear phase and

plateau phase. The exponential phase is the earliest segment in the PCR,

in which product increases exponentially since the reagents are not

35

limited. The linear phase is characterized by a linear increase in product

as PCR reagents become limited. The PCR will eventually reach the

plateau phase during later cycles and the amount of product will not

change because some reagents become depleted.

Real-time PCR exploits the fact that the quantity of PCR products

in exponential phase is in proportion to the quantity of initial template

under ideal conditions. During the exponential phase PCR product will

ideally double during each cycle if efficiency is perfect, i.e. 100%. It is

possible to make the PCR amplification efficiency close to 100% in the

exponential phases if the PCR conditions, primer characteristics, template

purity, and amplicon lengths are optimal. Both genomic DNA and reverse

transcribed cDNA can be used as templates for real-time PCR. The

dynamics of PCR are typically observed through DNA binding dyes like

SYBR green or DNA hybridization probes such as molecular beacons

(Strategene) or Taqman probes (Applied Biosystems). The basis of real-

time PCR is a direct positive association between a dye with the number

of amplicons.

Real-time PCR data are quantified absolutely and relatively.

Absolute quantification employs an internal or external calibration curve

to derive the input template copy number. Absolute quantification is

important in case that the exact transcript copy number needs to be

determined, however, relative quantification is sufficient for most

physiological and pathological studies. Relative quantification relies on

the comparison between expression of a target gene versus a reference

gene and the expression of same gene in target sample versus reference

samples.

3.7.8 Relative quantification of RT PCR analysis

Gene quantification was achieved using the CT (Cycle Threshold)

comparative method and is expressed as ‘‘n-fold up or down regulation of

transcription’’ in relation to a calibrator which is represented by the

36

smallest signal detectable for that specific gene. For relative

quantification by the comparative CT method, values are expressed

relative to a reference sample, called the calibrator. Real time PCR results

were expressed as CT (cycle threshold) values.

Each sample was tested in triplicate for all primers. Melting curve

analysis was performed on all samples to ensure amplification of a single

product with the expected melting temperature and the absence of primer-

dimers. The products of each primer set were tested by agarose gel

electrophoresis to verify that a single product of the expected size was

produced. Relative RNA quantities were determined with the delta-delta

(ΔΔ)Ct, according to the following formula (Dussault and Pouliot, 2006).

3.8 Statistical Analysis

Statistical methods were used for comparison of treatment mean

during optimization parameters for micropropagation. Completely

Randomized Design (CRD) were used for all the experiments. The data

were subjected to analysis of variance (ANOVA) and treatment means

were compared using the critical difference (CD) at a 1% level of

significance (Panse and Sukhatme, 1985).

37

39

RESULTS AND DISCUSSION

During the present investigation entitled "In vitro regeneration

and genetic transformation of finger millet (Eleucine coracana L.)

genotype GN-4" conducted at the Department of Plant Molecular

Biology and Biotechnology Department of Biotechnology, ASPEE

College of Horticulture and Forestry, Navsari Agricultural University,

Navsari during the period 2011-2015, efforts were made towards

standardizing the procedures for in vitro regeneration through callus and

development of Agrobacterium mediated genetic transformation protocol

for finger millet genotype GN-4. The results of the investigation are

presented and discussed in the present chapter.

4.1 Standardization of protocol for in vitro regeneration of finger

millet

While standardizing in vitro regeneration protocol, correct

procedures of surface sterilization, collecting explants from sources;

organics such as plant growth regulators, sucrose, pH, light and growth

regulator balance at various stages are crucial since all these factors are

crop development dependent. Hence, in the present investigation, all

these have been ardently studied to produce a reproducible and efficient

protocol for in vitro finger millet regeneration through seeds used as

explants.

4.1.1 Surface sterilization treatments for finger millet seeds

Even after three decades of research and development in plant

tissue culture, microbial contamination by yeasts, fungi, bacteria, viruses,

mites and thrips is still the major problem that has hampered the

establishment of truly aseptic plants and their successful micro

propagation.

38

Finger millet seeds from the field are generally laden with large

numbers of spores of fungi and bacteria. Surface sterilization with

mercuric chloride (HgCl2) has been reported by several workers as an

effective sterilant to reduce the risk of contamination in the cultures.

To obtain the optimum time for sterilization intended for proper

aseptic culture establishment and germination of the finger millet seeds,

five time intervals for seed sterilization with mercuric chloride was

studied. The surface sterilized seeds were then cultured on basal MS

medium for 10-15 days. The number of visually contaminated seeds and

the number of germinated seeds were recorded after 10-15 days.

Perusal to Table 4.1 showed that treatment S3 (0.1% HgCl2 for 6

min) gave the best surface disinfection since it showed less contamination

(10%) and higher establishment, followed by treatment S2 (15%), S4

(15%) and S5 (20%). However, treatment S1 showed high contamination

rate (45%). Although prolonged treatment with mercuric chloride (HgCl2)

reduced the contamination in culture, it also suppressed the germination

of finger millet seeds (Table 4.1). The use of anti-microbial agents (anti-

microbial as well as anti-fungal) to control contamination was the

preferred method. However, their indiscriminate use may leads to

phytotoxicity problems.

Since the treatment with 0.1% HgCl2 for 6 minutes was found to be

effective for higher establishment of explants with an optimal control on

contamination, all further experimentation for in vitro seed germination

were carried out with the same treatment.

4.1.2 Standardization for establishment of age of explants

4.1.2.1 Effect of age of seeds to isolate callus

To determine optimum age of seeds for callus isolation, seeds of

variety GN-4 were grown in vitro. The results of the establishment of

callus isolated at different ages of seeds (15, 30, 45, 60 and 75). Perusal

to Table 4.2 revealed that variation in seedling age at the time of explants

39

preparation affected establishment of callus. The best result was found

when 45 days old seeds showed 53.53 per cent callus.

Table 4.1: Effect of surface sterilizating agent mercuric chloride

(0.1% HgCl2) on contamination and establishment of

finger millet seeds.

Tr. No. Surface sterilizing agent Establishment

(%)

Contamination

(%)

Death (%)

S1 HgCl2 for 2 minutes 35.0 45.0 20.0





* Treatments were repeated three times.

Table 4.2: Effect of days taken for callus formation

Treatment No. Days taken for callus

Formation Establishment (%)

A1 15 days 25.82

(19.0)

A2 30 days 39.61

(40.7)

A3 45 days 53.53

(64.7)

A4 60 days 50.77

(60.0)

A5 75 days 40.20

(41.7)

S.Em. ± 0.48

C.D. at 5% 1.40

C.V. % 2.27


40

Table 4.3: Callus formation from seed of finger millet in presence of

different growth regulators

Tr. No. Plant growth regulators (mg/l) with MS (%) of callus

formation 2,4-D Proline CEH

F1 50 - - 27.96

(22.0)

F2 100 - - 51.17

(60.7)

F3 150 - - 44.43

(49.0)

F4 200 - - 35.25

(33.3)

F5 - 100 - 30.22

(25.3)

F6 - 300 - 42.13

(45.0)

F7 - 500 - 55.35

(67.7)

F8 - 700 - 48.06

(55.3)

F9 - - 100 28.66

(23.0)

F10 - - 300 58.28

(72.3)

F11 - - 500 47.10

(53.7)

F12 - - 700 41.94

(44.7)

S.Em. ± 0.767

C.D. at 5%

2.23

C.V. % 3.90


The table 4.3 indicate that plant growth regulators used for the

better callus induction was achieved in media supplemented with 2,4-D,

proline and CEH. MS basal medium with the combination of plant

growth regulators 2,4-D 100 mg/l, Proline 300 mg/l and CEH 500 mg/l

gave the best result for callus induction from seeds.

41

42

Age and the physiological stage at which explants were isolated

had significant effect on the establishment of shoots from the callus

explants. Five weeks old callus used as explants material were cultured

on MS medium to establish an efficient regeneration protocol for finger

millet.

Thus, isolation of callus from five weeks old callus produced

highest establishment percentage. Hence, for further investigations, five

weeks old callus were used for in vitro regeneration of finger millet.

4.1.3 Standardization of multiplication medium

4.1.3.1 Effect of plant growth regulators on shoot multiplication of

finger millet

In order to unearth the suitable and optimal auxin and cytokinin

concentration for in vitro regeneration of finger millet, basal MS media

was fortified with two cytokinins (i.e. BAP and Kin) at various

concentration (0.50, 1.0, 1.50 and 2.0 mg/l).The data on multiple shoot

regeneration through callus response to different levels of cytokinins at

various concentrations on per cent response to multiplication, number of

shoots and length of shoot was presented in (Table 4.5).Perusal of the

table revealed that there was a significant difference in response to type

and concentration of the cytokinins used on multiplication and length of

shoots.

Maximum number of explants responded towards shoot

multiplication (37.35%) in M1 with 0.50 mg/l BAP and (33.25%) in M7

with 1.50 mg/l Kin. The numbers of shoots per explants (9.7) and

maximum shoot length (9.8 cm) were found highest in M1 followed by

M7 was observed (Table 4.5).

43

Table4.4: Effect of different concentrations of BAP and Kinetin for

multiple shoot regeneration through callus.

Tr. No. Cytokinin (mg/l) Multiplication

(%)

No. of

shoots

Length of

shoots (cm) BAP Kin

M1 0.50 - 37.35

(36.8) 9.7 9.8

M2 1.00 - 28.90

(23.4) 7.7 5.8

M3 1.50 - 27.53

(21.4) 7.3 5.5

M4 2.00 - 25.14

(18.1) 6.3 4.9

M5 - 0.50 24.40

(17.1) 5.7 3.9

M6 - 1.00 23.38

(15.7) 4.0 4.6

M7 - 1.50 33.25

(30.1) 11.0 8.9

M8 - 2.00 21.78

(13.8) 6.0 5.9

S.Em.

±

0.34 0.18 0.23

C.D. at

5% 0.99 0.52 0.68

C.V. % 4.00 1.99 2.84

*Data were recorded after 3 weeks of inoculation.

It was evident from the table that cytokinins used for the better

multiplication and good quality of shoots as well as good proliferation

rate was achieved in media supplemented with BAP and Kin.

44

Table 4.5: Effect of different combination of cytokinins and auxins on

shoot culture and root culture through callus

Tr. No.

Cytokinin + Auxins (mg/l)

with MS Culture

rooted

(%)

No. of

shoots

No. of

roots/shoot BAP Kin NAA

E1 0.50 0.50 0.50 20.65

(12.33) 3.3 2.8

E2 0.50 0.50 1.00 24.26

(16.67) 3.8 3.8

E3 0.50 0.50 1.50 23.31

(16.00) 5.6 5.4

E4 0.50 0.50 2.00 22.79

(15.00) 5.0 5.8

E5 0.50 1.00 0.50 24.18

(17.33) 4.4 5.2

E6 0.50 1.00 1.00 27.89

(21.67) 5.8 5.8

E7 0.50 1.00 1.50 25.92

(19.33) 6.0 5.5

E8 0.50 1.00 2.00 27.66

(21.67) 7.0 6.0

E9 0.50 1.50 0.50 32.37

(29.00) 8.3 8.3

E10 0.50 1.50 1.00 39.30

(39.33) 11.0 12.0

E11 0.50 1.50 1.50 34.72

(39.33) 9.6 9.4

E12 0.50 1.50 2.00 30.44

(25.00) 8.0 8.0

E13 0.50 2.00 0.50 26.00

(19.67) 6.4 6.1

E14 0.50 2.00 1.00 22.79

(15.00) 5.4 5.0

E15 0.50 2.00 1.50 18.96

(10.67) 4.6 4.4

E16 0.50 2.00 2.00 15.83

(7.33) 3.1 3.4

S.Em. ± 0.30 0.20 0.17

C.D. at 5%

0.87 0.58 0.48

C.V. % 1.99 2.43 2.05

Table 4.5 showed the effect of combination of cytokinins and

auxins on the shoot and root culture. The result achieved MS

supplemented with BAP 0.50mg/l+ Kin 1.50mg/l+ NAA 1.00mg/l gave

45

46

the best result for number of shoots (11.00) and number of roots/shoot

(12.00).

4.1.3.2 Effect of serial subculturing on multiple shoot regeneration

through callus.

The objective of any micro propagation protocol is to produce

maximum number and good quality of plants making the protocol

economic. To establish the exact number of subcultures to produce

maximum number of superior quality plants, the best growth regulator

combination of previous experiment were used in three cycles of

subculture. Among the different subcultures, Multiplication rate gradually

increased till third subculture afterwards it showed declining trend and

even the length of shoot after third subculture decreased gradually.

Table 4.6: Effect of serial subculturing on multiple shoot

regeneration through callus.

No. of subculture No. of Shoots Length of shoots (cm)

1 4.0

(11.54)

4.2

(11.87)

2 6.7

(14.95)

6.9

(15.23)

3 9.3

(17.78)

9.8

(18.21)

4 7.3

(15.70)

7.5

(15.93)

5 4.5

(12.29)

4.5

(12.29)

S.Em. ± 0.28 0.17

C.D. at 5% 0.81 0.50

C.V. % 3.82 2.33

4.1.4 Effect of auxins and strength of the media on induction of in

vitro rooting finger millet

Rooting parameters were significantly influenced by the

type and concentration of auxins. From the different auxin

concentration used, half strength of MS medium supplemented

47

with 1mg/l NAA recorded significantly minimum days to initiate

the root, maximum rooting per cent and number of root/shoot.

Table 4.7: Effect of auxins and strength of the media on induction of in

vitro rooting in finger millet

Tr. No.

Auxin (mg/l) with ½

MS Rooting

(%)

Days taken for

root initiation

No. of

roots/plant NAA IBA

R1 ½ MS - 34.04

(31.33) 7.7 5.3

R2 0.50 - 43.66

(47.67) 7.3 6.3

R3 1.00 - 47.49

(54.33) 6.0 12.3

R4 1.50 - 45.19

(50.33) 6.3 7.0

R5 2.00 - 49.99

(58.67) 8.7 8.3

R6 - 0.50 29.33

(24.00) 9.0 5.7

R7 - 1.00 26.08

(19.33) 8.3 4.7

R8 - 1.50 27.74

(21.67) 9.7 5.0

R9 2.00 33.83

(31.00) 7.7 4.3

S.Em. ± 0.51 0.26 0.25

C.D. at 5% 1.47 0.77 0.72

C.V. % 2.34 3.76 2.94

48

49

Table 4.8: Effect of different potting mixtures on survival of in vitro

raised plantlets of finger millet

Treatment

No.

Treatments Survival (%) of

plantlets

Days taken for

new sprouting

H1 Vermicompost 39.24

(40.0) 7.8

H2 Sand 22.01

(24.0) 8.3

H3 Coco peat 27.36

(35.4) 7.0

H4 Vermicompost : Sand (1:1 v/v) 35.77

(54.7) 6.0

H5 Vermicompost : Sand : Coco

peat (1:1:1 v/v)

44.51

(74.0) 4.4

S.Em. ± 0.53 0.21

C.D. at 5 % 1.57 0.61

C.V. % 2.51 2.78

After three weeks of incubation on rooting medium, the in vitro

raised plantlets of finger millet with well developed 10-15 roots were

taken out from the culture tubes. The roots were washed thoroughly to

remove adhering agar. The rooted plantlets of finger millet were then

transplanted in plastic cups (200 ml) containing combination of different

potting mixtures. The plantlets were initially covered with transparent

plastic cups. Then they were transplanted in plastic cups having different

potting mixture after drenching it with 1.0 per cent bavistin.

The results obtained on survival per cent in hardening and plant

growth were presented in Table 4.8. The maximum survival (44.51%) of

plantlets with minimum days for new sprouting (4.4 days) was reported in

Vermicompost : Sand : Coco peat (1:1:1 v/v).

50

51

4.2 Standardization of protocol for Agrobacterium mediated genetic

transformation

4.2.1 Determination of hygromycin concentration for selecting

transgenic finger millet plants

The use of proper concentration of antibiotics used in the selection

medium is essential in transformation experiments, in which the

antibiotics serves as the selective agent that allows only transformed cells

or plants to survive. Hygromycin has been extensively used as a selective

antibiotic in transformation experiments, mainly because several plant

transformation vectors include hygromycin phosphotransferase II (hpt II)

as selectable marker gene. Only transformed cells can grow in the

presence of hygromycin.

In this experiment, callus were transferred on to a medium

containing hygromycin at 20, 40, 60, 80 and 100 mg/l after pre-culturing

in MS medium+1.50 mg/l kinetin + 0.50 BAP for 7 days. Five callus

were placed in each petridish and replicated three times for each

concentration. Over a period of three weeks, the number of elongated

shoots were counted and recorded in each week.

The control (0 mg/l) grew very well in MS media. Shoot

elongation was significantly decreased on MS media containing

hygromycin in a dose dependent manner. The minimum lethal

concentration to kill all the callus in three weeks was 20mg/l. The higher

level of hygromycin (60 mg/l, 80mg/l and 100mg/l) killed all the apices

within two weeks (Table 4.9). Therefore, a concentration of 40mg/l

hygromycin was used to select transgenic apices in this experiment.

52

53

Table 4.9: Effect of different hygromycin concentrations on the callus

of control and transformed finger millet plants.

Tr. No.

Concentration of

Antibiotic

Survival (%) of

control plants

Survival (%) of

transformed

plants Hygromycin (mg/l)

H1 0 53.14

(64.0)

51.16

(60.7)

H2 20 28.65

(23.0)

33.03

(29.7)

H3 40 9.97

(3.0)

12.72

(4.9)

H4 60 8.50

(2.2)

9.26

(2.6)

H5 80 5.15

(0.8)

6.08

(1.1)

H6 100 0.43

(0.0)

1.59

(0.2)

S.Em. ± 0.38 0.29

C.D. at

5%

1.1 0.84

C.V. % 4.36 2.96

4.2.3 Effect of concentration of Agrobacterium tumifaciens and

duration of co-cultivation

Efficient transformation parameters were analyzed by using

different A. tumefaciens concentrations (Absorbance at O.D600 is 0.2, 0.4,

0.6, 0.8 and 1.0) and duration of co-cultivation (3, 5 and 7 days). seventy

five callus were placed in each treatment combination with three

replications. The survival per cent of transformed plants after co-

cultivation and frequency of transformation was recorded. Both

Agrobacterium tumefaciens concentrations had a significant effect on

transformation frequency.

The highest survival of transformed plants and frequency of

positive plants were observed at O.D600=0.6. The transfer T-DNA from

Agrobacterium tumefaciens to plant cells is a complicated process and it

54

takes time. The highest observed survival per cent transformed plants

were 48 and frequency of transformed plant was 2.2, which occurred at

O.D600=0.6 and 5 days co-cultivation. Co-cultivation with Agrobacterium

tumefaciens for 3 days was not long enough to maximize the transfer

event. Increasing the Agrobacterium tumefaciens concentration did not

always increase the transformation frequency. This may be due to

Agrobacterium tumefaciens over growth problems. Therefore, O.D600=0.6

and 5 days co-cultivation were selected as the efficient transformation

parameters in the investigation.

4.2.4 Effect of age of seeds to isolate callus and co-cultivation

condition

The data pertaining to survival percentage of germinating seeds to

isolate callus and for co-cultivation duration of culture was presented in

the Table-4.10. The effect of the age of callus on survival percentage was

found to be significant. Maximum survival percentage was found for

forty five days old callus (53.22%) as compared to thirty days (33.44%)

and sixty days (39.89%) age of seedlings.

The effect of co-cultivation duration was found to be significant. Co-

cultivation duration for five days gave maximum survival percentage

(57.00%) of the callus. Increasing co-cultivation duration above five days

drastically reduced the survival percentage.

The survival percentage for five days of the co-cultivation and

forty five days old callus gave higher survival percentage (49.03%). The

reduction in the survival percentage (34.65%) was observed in case of

thirty days old callus and three days of the co-cultivation duration.

55

56

Table 4.10: Effect of the age of the explant (days after germination

of seeds) and co-cultivation duration with Agrobacterium

on survival percentage of the isolated callus.

Tr. No.

Age of

seedling

(Days)

Co-cultivation (Duration in days)

Mean C1 C2 C3

3 5 7

I1 30 32.33

(34.65)

34.33

(35.87)

33.67

(35.46)

33.44

I2 45 50.67

(45.38)

57.00

(49.03)

52.00

(46.15)

53.22

I3 60 38.33

(39.23)

41.33

(40.01)

40.00

(38.25)

39.89

Mean 39.43 41.63 40.28

S. Em ± 0.73

C.D. 5% 1.03

C.V.% 3.14

4.4 Production of Putative Transgenic Plants

Presence of hpt II was confirmed by PCR amplification. The

callus were co-cultivated with Agrobacterium tumefaciens for five days.

After co-cultivation, the callus were transferred to MS medium with 40

mg/l hygromycin and 250 mg/l cefotaxime and established multiple shoot

regeneration. Under hygromycin selection pressure, most of the callus

killed and some of the callus that were initially green killed gradually,

leaving only a few green callus.

Callus were transferred to fresh media after every two weeks. After

six weeks of selection, surviving shoots were transferred to MS media

without hygromycin to induce rooting. Rooting of the transformed shoot

apices occurred when they were transferred from hygromycin selection

medium to hygromycin free medium. Further, hardening of the

transformed plants required optimization in the pots.

57

58

The morphological features of the transgenic plants did not differ

from those of non-transgenic plants. Out of a total of 200 explants,

Agrobacterium tumefaciens treated callus placed on hygromycin

selection, two regenerated plants grew and were transferred to further

culturing while others died.

4.4.1 Molecular characterization of transformed plants

Presence of transgene were confirmed by PCR amplification of

the genes for hpt II. DNA isolated from the leaves of putative transgenic

plants, a non-transgenic control plant, and plasmid isolated from

Agrobacterium strain Rs-AFP2 was used as template DNA (control) for

PCR amplification of the hpt II gene. The presence of a band in samples

from transformed plants confirmed the integration of the hpt II gene and

the presence of a band at 500 bp in samples from transformed plants

confirmed the integration of the gene. Amplification of this fragment 250

band 500 bp was not observed in non transformed control plants.

4.4.1.1 PCR analysis of putative transgenic plants

Age of the isolated callus and co-cultivation duration was found to

influence the frequency of transformation. Forty five days old callus gave

higher frequency of transformation (1.33%) while thirty days and sixty

days old callus gave 0.66% and 0.33 % frequency of transformation

respectively.

Co-cultivation duration for five days on an average gave maximum

frequency of transformation (1.33%) while co-cultivation period for three

days and seven days gave 0.33% and 1% frequency of transformation. No

transformants obtained with thirty days seedling and three days of co-

cultivation duration.

The maximum frequency of transformation was obtained for 45

days old callus and five days of co-cultivation. From above described

treatments, 30 and 60 days age of seedling and co-cultivation for three

days gave low frequency of transformation.

59

Table 4.11: Percentage generation of PCR positive plants after

transformation.

Tr. No.

Age of

seedling

(Days)

Co-cultivation (Duration in days)

Mean C1 C2 C3

3 5 7

I1 30 0 1 0 0.33

I2 45 1 2 1 1.33

I3 60 1 1 1 1.00

Mean 0.66 1.33 0.66

4.7 Real time PCR assays:

Intact total RNA were run on a 1.5% denaturing gel which showed

sharp 28S and 18S rRNA bands. The 28S rRNA band was two times

intense than the 18S rRNA band. The 2:1 ratio (28S:18S) indicated that

the RNA was intact. The relative quantification real time PCR was

performed. Amplification plots and dissociation curves were generated.

Single melt curve generation showed that only specific product was

generated.

The product specificity and its expression was confirmed by agarose gel

electrophoresis based on amplification plot using threshold line value of

individual primer mean CT value of all samples.

Figure-4.1: Comparative real time PCR result expression of gene

from finger millet plant after transformation.

60

5

SUMMARY AND CONCLUSION

The present investigation on “In vitro regeneration and genetic

transformation of finger millet (Eleusina coracana L.) genotype GN-4” is

summarized and concluded in this chapter.

1. An efficient in vitro protocol for finger millet genotype GN-4

has been developed.

Seeds were surface sterilized in laminar air flow chamber using

0.1% (w/v) mercuric chloride for 6 minutes followed by 4-5 times rinsing

in sterile deionized water proved to be the treatment and eight to ten

treated seeds were placed in plastic petriplates containing basal MS

medium gelled 0.8 per cent agar at pH 5.8, containing 30 gm/l sucrose as

carbon source proved best for initiation.

The culture petriplates were inoculated in an air conditioned

culture room at 26 ± 2 0C temperature with a relative humidity of 55 ± 5

per cent in dark condition. After five weeks of incubation, the in vitro

established explants were transferred for multiplication in MS medium

supplemented with 0.5 mg/l BAP and 1.50 mg/l Kin. The multiple shoots

obtained were separately transferred to fresh medium containing MS +

0.5 mg/l BAP + 1.50 mg/l Kin for proliferation in three cycles on the

same proliferation medium. Then, separated individual shoots were

transferred to half strength MS medium containing 1 mg/l NAA for in

vitro rooting. Approximately after three weeks the well rooted plantlets

were ready for acclimatization.

Plantlets from culture tube were removed carefully and adhering

agar from roots ten removed by thorough washing in tap water. The well

61

developed in vitro raised plantlets were transplanted for hardening in

plastic glasses containing vermicompost, sand and cocopeat. The potting

mixture was drenched with half strength liquid MS medium at 2-3 days

interval.

2. A Protocol has been developed for Agrobacterium–mediated

genetic transformation of finger millet

Agrobacterium strain Rs-AFP2 harboring the marker gene hptII

was used for Agrobacterium mediated genetic transformation. Isolated

colonies of bacteria from YEB medium plated were inoculated

individually in 10 ml YEP medium containing 50 mg/l kanamycin and 10

mg/l rifampicin in flask and was grown at 280C with shaking at 200 rpm

in an inocubator shaker for 20-24 hours to establish primary culture. The

inoculum for secondary culture was taken from this primary culture and

inoculated to 50 ml of YEP medium harvested at 0.4 - 0.6 O.D. at 600

nm. The secondary culture was centrifuged at 5000 rpm for 10 minutes at

4°C. The pellet was then re-suspended in an induction medium containing

100mM acetosyringone and incubated for 4-6 hours on an incubator-

shaker at 175 rpm and 260C temperature.

The bacterial culture was centrifuged at 5000 rpm for 10 minutes

and resulting pellet was re-suspended in MSO medium containing 100

mM acetosyringone and grown for 2 hours at 25 0C with shaking at 150

rpm in an incubator-shaker. Then, callus explants from 45 days old

germinated seedling of finger millet (cultured on MS medium) was

infected with Agrobacterium tumefaciens harbouring the Rs-AFP2 gene

construct containing marker gene hptII and co-cultivated in dark for 5

days.

After 5 days co-cultivation, explants were washed six times with

sterile distilled water containing 250mg/l cefotaxime. The cleaned callus

were blotted dry using a sterile tissue paper towel and cultured on the

62

selection medium consisting of MS with 250 mg/l cefotaxime and 40

mg/l hygromycine. The petridishes were incubated at a temperature of 28

0C under an 18 hours photoperiod and thereafter sub-cultured every 2

week. The leaves of surviving shoot apices were removed to isolate DNA

and RNA for confirmation of transformed plants with PCR and rt PCR

for reaction.

Conclusion

In recent years, there has been a focus in the development of

regeneration and genetic transformation protocol for which efficient in

vitro procedure are desirable. The present endeavour was to establish

efficient in vitro regeneration protocol as well as genetic transformation

protocol in finger millet. Thus, transformation protocol has been

developed in GN-4, where upto 1.33% transformation efficiency has been

achieved. Henceforth, to improve transformation efficiency and

hardening of in vitro plants, further investigation is required.

63

REFERENCES

Anjaneyulu, E.; Attitalla, I. H. and Balaji, M. (2011). An Efficient

protocol for callus induction and plant regeneration in finger millet

(Eleusine coracana L.). World Appl. Sci. J., 12 (7) : 919-923.

Asp, N. G.; Johansson, C. G.; Miller, H. and Siljestron, M. (1983). Rapid

enzymatic assay of insoluble and soluble dietary fiber. J. Agric.

Food Chem., 31 : 476-479.

Carvalho, C. H.; Zehr, U. B.; Gunaratna, N.; Anderson, J.; Kononowicz,

H. H.; Hodges, T. K. and Axtell, J. D. (2004). Agrobacterium-

mediated transformation of sorghum: factors that affect

transformation efficiency. Genet. Mol. Biol., 27(2) : 259-269.

Ceasar, A. S. and Ignacimuthu, S. (2008). Efficient somatic

embryogenesis and plant regeneration from shoot apex explants of

different indian genotypes of finger millet (Eleusine coracana L.)

Gaertn. In Vitro Cell. Dev. Biol.-Plant., 44 : 427–435.

Ceasar, S. A. and Ignacimuthu, S. (2011). Agrobacterium-mediated

transformation of finger millet (Eleusine coracana L.) Gaertn.

using shoot apex explants. Plant Cell Rep., 30 : 1759–1770.

Dida, M. M.; Srinivasachary, S.; Ramakrishnan, J. L.; Bennetzen, M. D.

and Devos, K. (2008). Population structure and diversity in finger

millet (Eleusine coracana L.) germplasm. Tropical Plant Biol., 1 :

131-141.

Doyle, J. J. and Doyle, J. L. (1990). Isolation of plant DNA from fresh

tissue. Focus., 12 : 13-15.

Dussault, A. and Pouliot, M. (2006). Rapid and simple comparison of

messenger RNA levels using real-time PCR. Biol. Proced Online.,

8 : 1-10.

I

Fraley, R. T.; Roger, S. G.; Horsch, R. B.; Sanders, P. R.; Hoffman, N. L.

and Woo, S. C. (1983). Expression of bacterial gene in plant cells.

Proc. Natl. Acad. Sci., 80 : 4803-4807.

George L. and Eapen S. (1990). High frequency plant regeneration

through direct shoot development and somatic embryogenesis in

immature inflorescence cultures of finger millet (Eleusine

coracana L.) Gaertn. Euphytica., 48 : 269–274.

Gupta, P.; Raghuvanshi, S. and Tyagi, A. (2001). Assessment of the

efficiency of various gene promoters via biolistics in leaf and

regenerating seed callus of millets, Eleusine coracana and

Echinochloa crusgalli. Plant Biotechnol., 18 : 275–282.

Horsch, R. B.; Fry, J. E.; Roger, S. G. and Fraley, R. T. (1985). A simple

and general method for transferring genes into plants. Science., 227

: 1229-1231.

Ignacimuthu, S. and Ceasar A. S. (2012). Development of transgenic

finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast

disease. J. Biosci., 37(1) : 1-14.

Indra Arulselvi, P.; Michael, P.; Umamaheswari S. and Krishnaveni, S.

(2010). Agrobacterium mediated transformation of sorghum

bicolor for disease resistance. Int. J. Pharm. Bio. Sci., 1(4) : 272-

281.

Jenkins, D. J.; Wolever, T. M. and Kalmusky, J. (1985). Low glycemic

index foods in the management of hyperlipidemia. Am. J. Clin.

Nutr., 42 : 604-617.

Kothari, A. C.; Sharma, M.; Kachhwaha, S. and Kothari, S. L. (2008).

Micronutrient optimization results into highly improved in vitro

plant regeneration in kodo (Paspalum scrobiculatum L.) and finger

(Eleusine coracana L.) Gaertn. millets. Plant Cell Tiss Organ

Cult., 94 : 105–112.

II

Kothari, S. L.; Agarwal, K. and Kumar, S. (2004). Inorganic nutrient

manipulation for highly improved in vitro plant regeneration in

finger millet–(Eleusine coracana L.) Gaertn. In Vitro Cell. Dev.

Biol.–Plant., 40(5) : 515–519.

Kumar, S.; Agarwal, K. and Kothari, S. L. (2001). In vitro induction and

enlargement of apical domes and formation of multiple shoots in

finger millet, (Eleusine coracana L.) Gaertn. and crowfoot grass,

(Eleusine indica L.) Gaertn. Curr. Sci., 81(11) : 1482-1485.

Latha, A. M.; Rao, K. V. and Reddy, V. D. (2005). Production of

transgenic plants resistant to leaf blast disease in finger millet

(Eleusine coracana L.) Gaertn. Plant Sci., 169 : 657-667.

Mannan, A.; Syed, T. N. and Mirza B. (2009). Factors affecting

Agrobacterium tumefaciens mediated transformation of Artemisia

absinthium L. Pak. J. Bot. 41(6) : 3239-3246.

Mondal, T. K.; Bhattacharya, A; Ahuja, P. S. and Chand, P. K. (2001).

Transgenic tea [(Camellia sinensis L.) O.kuntze cv. Kangar Ja]

plant obtained by Agrobacterium mediated transformation of

somatic embryos. Plant cell rep., 20 : 712-720.

Morel, G. (1960). Producing virus free cymbidiums. Amer. Orchid. Soc.

Bull., 29 : 595-497.

Murashige, T. (1974). Plant propagation through tissue culture. Annu.

Rev. Plant Physiol., 22 : 135-165.

Murashige, T. and Skoog F. (1962). A revised medium for rapid growth

and bioassays with tobacco tissue culture. Physiol Plant., 15 : 473-

497.

Nazim-Ud-Dowla1, M. A. N.; Ahmed, N. U. and Hassan, L. (2008).

Optimization of Agrobacterium-mediated genetic transformation in

indica Rice. Thai J. Agric. Sci., 41(3-4) : 127-133.

Nicholas J. T. (2003). On the trail of a cereal killer: Exploring the biology

of Magnaporthe grisea. Annu Rev Microbiol., 57 : 177–202.

III

Obilana, A. B.; Manyasa, E. O.; Kibuka, J. G. and Ajanga, S. (2002).

Finger millet blast samples collection in Kenya: passport data,

analyses of disease incidence and report of activities. ICRISAT.

Panse, V. G. and Sukhatme, P. V. (1985). Statistical analysis for

agricultural workers. ICAR, New Delhi.

Poddar, K.; Vishnoi, R. K. and Kothari, S. L. (1997). Plant regeneration

from embryogenic callus of finger millet (Eleusine coracana L.)

Gaertn. on higher concentrations of NH4NO3 as a replacement of

NAA in the medium. Plant Sci., 129 : 101–106.

Prasad, M. G.; Jaffar, S. K.; Ramu, A. and Kondala Rao, M. (2011).

Efficient regeneration protocol for ragi. IJSID., 1(2) : 283-287.

Radjacommare R.; Ramanathan A.; Kandan A.; Sible G. V. and

Samiyappan, R. (2004). Purification and anti-fungal activity of

chitinase against Pyricularia grisea in finger millet. World. J.

Microb. Biot., 20 : 251–256.

Rangan T. S. (1976). Growth and plant regeneration in tissue culture of

some Indian millets; Papsalum scorbiculatum (L.); (Eleusine

coracana L.) Gaertn. and Pennisetum typhoideum Pers.

Pflawzenphysiol., 78 : 208–216.

Rao, M. A.; Kumar, S. I.; Sekhar, N. P.; Reddy, P. S. and Polavarapu, R.

(2009). High frequency plant regeneration from callus cultures of

two finger millet (Eleusine coracana L.) cultivars. Curr. Trends.

Biotechnol. Pharm., 3(1) : 85-89.

Sambrook, J. and D, Russell. (2001). "Molecular Cloning: A Laboratory

Manual", 3rd edition. Cold Spring Harbor Laboratory Press. Cold

Spring Harbor, NY. 7.32.

Sambrook, J.; Fritch, E. F. and Maniatis, T. (1989). Molecular cloning a

laboratory manual, 2nd edn. cold spring harbor laboratory press,

cold spring harbor, NewYork.

VI

Sarker, S. R.; Hossain, M. and Shirin, F. (2009). Precise incubation

period for the Agrobacterium‐mediate transformation efficiency in

potato (Solanum tuberosum) cvs. Cardinal and Atlas. Plant Tiss

Cult. Biotech., 19(2) : 227‐235.

Sharavathy, M.; Urooj, A. and Puttaraj, S. (2001). Nutritionally important

starch fractions in cereal based indian food preparations. Food

Chem., 70 : 107-111.

Sharma, M. K.; Solanke, A. U.; Jani, D.; Singh, Y. and Sharma, A. K.

(2009). A simple and efficient Agrobacterium-mediated procedure

for transformation of tomato. J. Biosci., 34 : 423–433.

Sharma, M.; Kothari, A. C.; Chugh, S. J. and Kothari, S. L. (2011).

Factors influencing Agrobacterium tumefaciens-mediated genetic

transformation of (Eleusine coracana L.) Gaertn. Plant Cell Tiss

Organ Cult., 105 : 93–104.

Shrawat, A. K. and Lorz, H. (2006). Agrobacterium-mediated

transformation of cereals: a promising approach crossing barriers.

Plant Biotechnol J., 4 : 575–603.

Sivadas P.; Kothari S. L. and Chandra, N. (1990). High frequency

embryoid and plantlet formation from tissue culture of the finger

millet-(Eleusine coracana L.). Gaertn. Plant Cell Rep., 9 : 93–96.

Skoog, F. and Miller, C. O. (1957). Chemical regulation of growth and

organ formation in plant tissues cultivated in vitro. Sym Soc. Exp

Biol., 11 : 118-131.

Tylor, J. R.; Schober, T. J. and Bean, S. R. (2006). Novel food and non-

food uses for sorghum and millets. J. Cereal Sci., 44 : 252-271.

Upadhyaya, H. D.; Gowda, C. L.; Pundir, R. P.; Reddy, V. G. and Singh,

S. (2006). Development of core subset of finger millet germplasm

using geographical origin and data on 14 quantitative traits. Genet.

Resour. Crop Evol., 53 : 679-685.

V

Verma, V. and Patel, S. (2013). Production enhancement, nutritional

security and value added products of millets of bastar region of

Chhattisgarh. Int. J. Res. Chem. Environ., 2(3) : 102-106.

Werth, C. R.; Hilu, K. W. and Langner, C. A. (1994). Isozymes of

Eleucine (Gramineae) and the origin of finger millet. Am. J. Bot.,

81 : 1186-1190.

VI

APPENDIX-I

List of the instruments used for the study

Sr. No.

Name of the Instrument

Company’s name

1. Weighing balance Vibra , Japan

2. Laminar air flow Genetix, India

3. pH meter Analab, India

4. Spectrophotometer Shimadzu, Japan

5. Water bath LabTech, Korea

6. Electrophoresis unit Banglore Genei ,India

7. Power pack Wealtec corp., Taiwan

8. Micro-pipettes Eppendorf, Germany

9. Centrifuge Sigma, Germany

10. Rotatory shaking incubator Kuhner, Germany

11. Microwave oven LG Convection, India

12. UV Transilluminator Banglore Genei ,India

13. Gel documentation Biorad, USA

14. Deionised Water system Merck-Millipore,

Germany

15. Thermo Cyclers (PCR) Eppendorf, Germany

16. Dry bath Labnet, USA

17. Vertical autoclave Equitron, Mumbai

18. Laminar air flow Genetix, India

19. -80 oC Deep freeze LabTech, Korea

I

APPENDIX-II

Composition of Murashige and Skoog (1962) medium

Constituents Final concentration in medium in mg/l

(A) Macronutrients

NH4NO3 1650

KNO3 1900

MgSO4.7H2O 370

KH2PO4 170

(B) Micronutrients

H3BO3 6.20

KI 0.83

Na2MoO4.2H2O 0.25

COCl2.6H2O 0.025

MnSO4.4H2O 22.30

ZnSO4.7H2O 8.60

CuSO4.5H2O 0.025

(C) Iron Sources

FeSO4.7H2O 27.85

Na2EDTA 37.85

(D) CaCl2.2H2O 440

(E) Vitamins

Thiamine.HCl 0.1

Pyridoxine.HCl 0.5

Nicotinic acid 0.5

(F) Carbon Sources

Sucrose 30,000

Myo-inositol 100

Clerigel 2,250

II

III

II

APPENDIX-III

Finger millet seed germination medium

Sr.

No.

Components Concentration

1. MS (Macronutrients, Micronutrients,

Iron source) As per Appendix-II

2. B5 vitamins As per Appendix-II

3. Myo inositol 100 mg/l

4. Sucrose 30 g/l

5. MgCl2 0.750 g/l

6. Casien hydrosylate 0.3 g/l

7. L-Proline 0.5 g/l

8. 2,4-D (1 mg%) 25.5 ml

9. pH 5.80

IV III

APPENDIX-IV (a) & (b)

(a) YEB (yeast extract broth) Medium

Sr.

No.

Components Concentration g/l

1. Beef extract 10.0

2. Yeast extract 2.0

3. Peptone 10.0

4. MgSO4.7H2O 0.1

5. Sucrose 10.0

6. Agar 15.0

7. pH 7.2

(b) YEP (yeast extract peptone) Medium

Sr. No. Components Concentration g/l

1. Yeast extract 10

2. Peptone 10

3. NaCl 5

4. pH 7.2

V IV

APPENDIX-V

Media for induction of Agrobacterium tumefaciens.

Sr. No. Chemicals Concentration g/l

1. NH4Cl 1.0

2. MgSO4.7H2O 0.3

3. KCl 0.15

4. CaCl2 0.01

5. FeSO4.7H2O 0.0025

6. KH2PO4 0.272

7. MES* 0.390

8. Glucose 5.0

9. pH 7.2

MES* (2N morpholino ethane sulfonic acid)

APPENDIX-VI

Media for co-cultivation of Agrobacterium tumefaciens

Sr. No. Composition Concentration

10. MS (Macronutrients, Micronutrients,

Iron source)

As per Appendix-II

11. Vitamins As per Appendix-II

12. MES 193 mg/l

13. Glucose 2 %

14. pH 5.65

VI

V

C E R T I F I C A T E

This is to certi fy that I have no objection to

supply one copy of any part of this thesis at a t ime to any

scientist through reprographic process for rendering

reference services in a l ibrary or documentat ion centre.

Place : Navsari

Date : 06/11/2015 (Dabhi K. A.)

Documents

TRANSFORMATION OF FINGER MILLET