Acta Biomaterialia 62 (2017) 293–305

Contents lists available at ScienceDirect

Acta Biomaterialia

journal homepage: www.elsevier .com/locate /actabiomat

Full length article

Tumor acidity-activatable manganese phosphate nanoplatform foramplification of photodynamic cancer therapy and magnetic resonanceimaging

http://dx.doi.org/10.1016/j.actbio.2017.08.0281742-7061/� 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

⇑ Corresponding authors at: School of Pharmaceutical Sciences, ZhengzhouUniversity, 100 Kexue Avenue, Zhengzhou, Henan Province 450001, PR China.

E-mail addresses: hahalei@139.com (L. Wang), zhangzz08@126.com (Z. Zhang),zhang_yun@ymail.com (Y. Zhang).

Yongwei Hao a,b,c, Cuixia Zheng a, Lei Wang a,b,c,⇑, Jinjie Zhang a,b,c, Xiuxiu Niu a, Qingling Song a,Qianhua Feng a, Hongjuan Zhao a, Li Li a, Hongling Zhang a, Zhenzhong Zhang a,b,c,⇑, Yun Zhang a,b,c,⇑a School of Pharmaceutical Sciences, Zhengzhou University, 100 Kexue Avenue, Zhengzhou 450001, PR ChinabKey Laboratory of Targeting Therapy and Diagnosis for Critical Diseases, Zhengzhou 450001, PR ChinacCollaborative Innovation Centre of New Drug Research and Safety Evaluation, Henan Province, 100 Kexue Avenue, Zhengzhou 450001, PR China

a r t i c l e i n f o

Article history:Received 18 May 2017Received in revised form 17 August 2017Accepted 21 August 2017Available online 24 August 2017

Keywords:Amorphous porous manganese phosphatePhotodynamic therapyMagnetic resonance imaging

a b s t r a c t

Amorphous biodegradable metal phosphate nanomaterials are considered to possess great potential incancer theranostic application due to their promise in providing ultra-sensitive pH-responsive therapeu-tic benefits and diagnostic functions simultaneously. Here we report the synthesis of photosensitisingand acriflavine-carrying amorphous porous manganese phosphate (PMP) nanoparticles with ultra-sensitive pH-responsive degradability and their application for a photoactivable synergistic nanosystemthat imparts reactive oxygen species (ROS) induced cytotoxicity in synchrony with hypoxia-inducible fac-tor 1a/vascular endothelial growth factor (HIF1a/VEGF) inhibitor that suppresses tumor growth andtreatment escape signalling pathway. Carboxymethyl dextran (CMD) is chemically anchored on the sur-face of porous manganese phosphate theranostic system through the pH-responsive boronate esters.Upon the stimulus of the tumor acid microenvironment, manganese phosphate disintegrates and releasesMn2+ ions rapidly, which are responsible for the magnetic resonance imaging (MRI) effect. Meanwhile,the released photosensitizer chlorin e6 (Ce6) produces ROS under irradiation while acriflavine (ACF) inhi-bits the HIF-1a/VEGF pathway during the burst release of VEGF in tumour induced by photodynamictherapy (PDT), resulting in increased therapeutic efficacy. Considering the strong pH responsivity, MRIsignal amplification and drug release profile, the PMP nanoparticles offer new prospects for tumoracidity-activatable theranostic application by amplifying the PDT through inhibiting the HIF-1a /VEGFpathway timely while enhancing the MRI effect.

Statement of Significance

In this study, we report the synthesis of the tumor acidity-activatable amorphous porous manganesephosphate nanoparticles and their application for a photoactivable synergistic nanosystem that impartsreactive oxygen species (ROS) induced cytotoxicity in synchrony with hypoxia-inducible factor 1a/vascu-lar endothelial growth factor (HIF-1a/VEGF) inhibitor that suppresses tumor growth and treatmentescape signalling pathway. Besides, upon the stimulus of the tumor acid microenvironment, the man-ganese phosphate nanoparticles finally disintegrate and release Mn2+ ions rapidly, which are responsiblefor the magnetic resonance imaging (MRI) effect. This nanoplatform is featured with distinctive advan-tages such as ultra pH-responsive drug release, MRI function and rational drug combination exploitingthe blockage of the treatment escape signalling pathway.

� 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Combination therapy holds considerable appeal for effectivecancer treatment [1,2]. Photodynamic therapy is a clinicallyapproved non-invasive therapeutic approach that employs a

294 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

photosensitizer (PS), an appropriate exciting light and oxygen (O2)molecules through generation of cytotoxic reactive oxygen species(ROS) to attack biomolecules (e.g., DNA, biological membrane)inside cancer cells [3]. However, a fundamental challenge in oncol-ogy is that many resistance mechanisms and escape pathways ulti-mately limited the treatment efficacy. Due to the consumption ofO2 induced by PDT as well as the inherent inadequate O2 supplyfor the solid tumors, the PDT would aggravate the hypoxia phe-nomenon [4–6]. Under hypoxia, stabilization of HIF-1a occursthrough inhibition of 4-prolyl hydroxylase activity, an enzyme thatrequires oxygen to be functional. Upon stabilization, HIF-1a pro-tein was transported into the nucleus where it heterodimerizeswith HIF-1 b, forming the active HIF-1 transcription complex [7].This process finally increased the level of vascular endothelialgrowth factor (VEGF) because HIF-1a plays a pivotal role in phys-iological and pathophysiological angiogenesis by directly regulat-ing VEGF, a master regulator of angiogenesis in endothelial cells[8–11]. One previous research has demonstrated that burst releaseof VEGF following PDT is within 6 h [12]. Therefore, co-packinginteractive therapeutic agents into one system with spatiotempo-rally synchronized release would make it to synergize within thecritical time window for PDT-mediated therapy and vascularregrowth inhibition during the burst of VEGF in tumour.

The benefits of co-encapsulation of photodynamic agent andadditional agent in one single carrier have been confirmed bymany research groups in vitro and in vivo [13–16]. Porous nanoma-terials, particularly porous silicon based nanosystems, have beenpaid great attention because of their large surface area, tunablepore size and volume as well as high loading capacity for drugs,dye agents and photosensitizers (PS) [17,18]. With the rapid devel-opment of imaging approaches, such as magnetic resonance imag-ing, there is a pressing need for the development of nanomedicineof synergistic drug combination as well as diagnostic application[19,20]. Very recently, biodegradable manganese-based nanomate-rials have been successfully developed for anticancer delivery[21–23]. Manganese was introduced to the therapeutic systemssince Mn is one of the necessary elements in human body for meta-bolism and the biological system can efficiently control its uptakeand excretion, showing low toxicity and high biosafety [24,25].Moreover, our previous work also demonstrated that MnO2 basednanocarriers with tumor microenvironment-responsive MRI func-tion can be used for anticancer drug delivery [26,27]. However,the relaxivity of these systems was not high enough owing to theabsence of water molecules coordinated with Mn2+. In order toenlarge the water-accessible surface, hollow nanostructures wereintroduced, which possess a higher r1 relaxivity [28,29]. Besides,a hollow pH-responsive manganese phosphate nanosystem forcancer cells targeted MRI and therapeutic agent delivery wasinvestigated in vitro [30]. Despite these efforts, their applicationsas pH-responsive theranostic platforms by combing imaging func-tions and therapeutic agents in vivo application also require con-siderable improvement. Importantly, it was reported that thedecomposition of the pH-responsive materials in the amorphousform under the acid environment was accelerated without the lat-tice energy limitation [31]. Lattice energy is a key parameter forthe predication of the stability of ionic compounds [32]. In otherwords, the separation of manganese ions from phosphate ions ifthe material was in the crystal form would be difficult due to thelattice energy. Alternatively, the amorphous porous manganesephosphate nanoplatform would be a superior candidate as a ther-anostic nanosystem for MRI and synergistic drug combination.

Here, we report the synthesis of amorphous porous manganesephosphate nanoparticles and their application for synergistic drugcombination in the pursuit of amplification of photodynamic can-cer therapy. As shown in Scheme 1, in such nanoparticles, chlorine6 (Ce6), a photosensitizer, was loaded for photodynamic therapy

[33]. Additionally, the nanoparticles could also enable efficientloading of acriflavine (ACF) for inhibition of HIF-1a/VEGF pathway,therefore increasing the PDT efficacy induced by Ce6 when it wasexposed to the 660 nm laser irradiation [34,35]. In order to mini-mize the premature drug release, it was highly desired to explorethe on-demand drug release strategies through capping thenanoparticles with an intelligent gatekeeper [36]. Carboxymethyldextran (CMD), a hydrophilic polymer, was chemically anchoredon the surface of porous manganese phosphate through the pH-responsive boronate esters because it has been widely used formany biomedical applications [37–39]. The CMD modification isexpected to endow photosensitising and ACF-carrying amorphousporous manganese phosphate (PMP) nanoparticles with somemer-its. On one hand, it could act as a gatekeeper by forming a denselayer around the nanoparticles, which is favorable for minimizingpremature drug release. On the other hand, with hydrophilic char-acter, CMD coating would improve the stability and biocompatibil-ity of the system. The enhanced permeability and retention (EPR)effect is a unique phenomenon of solid tumors, which is relatingto their anatomical and pathophysiological differences from nor-mal tissues. The reticuloendothelial system (RES), which isenriched in the liver and spleen, can be a major obstacle to tumordelivery of macromolecular drugs relying one EPR effect [40]. Justas PEGylation reduced the rate of RES uptake and increased the cir-culation half-life of various types of nanoparticles, CMDylation wasable to reduce nanomaterials accumulation in reticuloendothelialsystem (RES) and prolong their blood circulation time, resultingin increased chance of accumulation in the region of interest(ROI) through the EPR effect. Therefore, CMDylation thus benefitsEPR-based targeting of drugs to tumors.

2. Materials and methods

2.1. Materials

Oleic acid and manganese (II) 2, 4-pentanedionate wereobtained from Alfa Aesar (USA). Oleylamine and Acriflavine (ACF)were purchased from Xiya Reagent (Shandong, China).(3-Aminopropyl) trimethoxysilane (APTMS) was ordered fromSinopharm Chemical Reagent Co., Ltd. (Shanghai, China).Carboxymethyl dextran sodium salt (CMD) and triethyl phosphatewere obtained from Tokyo Chemical Industry (Tokyo, Japan).4-Formylphenyboronic acid was purchased from AladdinIndustrial Corporation (Shanghai, China). Ce6 was ordered fromJ&K Scientific Ltd. (Beijing, Chian). Sodium borohydride wasobtained from Sigma-Aldrich, Inc. (St Louis, MO, USA).

2.2. Synthesis and modification of PMP

The preparation of porous manganese phosphate (PMP) wasachieved by following a literature procedure with a minor modifi-cation [30]. First, oleic acid (2 mL), oleylamine (3 mL) and methyl-benzene (12 mL) were placed into a stainless steel autoclave, thendeionized water (0.2 mL), manganese (II) 2,4-pentanedionate(1 mmol) and triethyl phosphate (0.4 mL) were added into theabove reaction system. The temperature was kept at 180 �C for9 h, and the stainless steel autoclave was cooled down rapidly toroom temperature with the help of cold water, and then the lightbrown mixture was added into anhydrous ethanol (10 mL). Thesuspension was centrifuged at 12,000g for 15 min and the precip-itate was washed with anhydrous ethanol for three times. The finalproduct (PMP) was dried in a vacuum drying oven for further use.

NH2-PMP was synthesized by dispersing 34 mg of PMP inn-hexane (90 mL) with the help of sonication. APTMS (100 lL)and acetic acid (9 lL) were added into the above solution and

Scheme 1. (A) Synthesis scheme for C-PMP/Ce6/ACF nanoparticles. (B) Schematic illustration of proposed mechanism of the multifunctional PMP nanoparticles foramplification of photodynamic cancer therapy and magnetic resonance imaging.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 295

the solution was stirred for 5 min. The product was obtained bycentrifugation at 12,000g for 10 min and washed with anhydrousethanol for three times and dried in air at room temperature. Forthe preparation of PBA-PMP, NH2-PMP (100 mg) in methanol(25 mL) was added with 4-formylphenyboronic acid (2.0 mg).The mixture was stirred at room temperature for 4 h. Then sodiumborohydride (2.3 mg) in cold methanol was added into the reactionsystem in an ice bath. After the reaction for 30 min under the icebath, the solution was stirred for another 24 h at room tempera-ture. The solution was centrifuged at 12,000g for 10 min andwashed three times with anhydrous ethanol. The final productwas dried at room temperature for further use. Besides, a modelsystem, in which the starting APTMS alone was used to follow eachstep reaction by 1H NMR spectroscopy.

2.3. Preparation of Drug-loaded PMP NPs and CMD modification

Firstly, ACF (10 mg) in deionized water (3 mL) and Ce6 (10 mg)in ethanol were dispersed into PBA-PMP aqueous solution (4 mL)with a concentration of 10 mg/mL under magnetic stirring for 4 hin the dark. Then, CMD (40 mg) dissolved in deionized water(1 mL) was added into the above reaction system. The resultantsolution was then stirred for another 4 h. In order to remove thefree ACF and Ce6, the mixture was dialyzed for 6 h.

2.4. Characterization

A zetasizer Nano ZS-90 instrument (Malvern, UK) relying on thedynamic light scattering (DLS) technology and a transmission elec-tron microscope (TEM, FEI Tecnai G2 20, USA) were used for char-acterizing the nanoparticle size distribution, zeta potential andmorphology of the as-prepared nanoparticles. Powder X-raydiffraction (XRD) was carried out by using an X-ray diffractometer(X’Pert PRO MPD, PANalytical, Almelo, Netherlands). X-ray photo-electron spectroscopy (XPS) was applied for the verification ofthe Mn and P elements (Thermo ESCALAB 250XI, USA). Nitrogenadsorption-desorption isotherms were recorded on a NOVA Touchapparatus (Quantachrome Instruments, Florida, USA). A MicroMR

apparatus (0.5 T; Shanghai Niumag Electronic Technology Co.,Ltd., Shanghai, China) was employed for evaluating the imagingproperty and the longitudinal (T1) relaxivity values. The concentra-tion of ACF was measured by an HPLC. HPLC separation was carriedout on an AcclaimTM 120 C18 column (4.6 mm � 250 mm, 5 lm)maintained at 30 �C. The isocratic mobile phase was composed ofwater, methanol and acetonitrile with a ratio of 10:85:5, whichwas delivered at a flow rate of 1 mL min�1. The measuring wave-length was set at 456 nm, and the injection volume was 20 lL.The concentration of Ce6 was determined at 660 nm by an UV–Vis spectrophotometer (Shimadzu, Tokyo, Japan). The 1H NMRspectra of the APTMS derivative and CMD derivative were deter-mined by using a Bruker Avance-III-HD 400 MHz NMR Spectrome-ter (Bruker BioSpin Corp., Billerica, MA, USA).

The release measurements were carried out in phosphate-buffered saline (PBS) pH 7.4 and acetic buffer solution pH 6.0.The formulation was diluted with the release medium, and wasthen placed into pre-treated dialysis bags (MW cutoff = 8000 KDa).Each brown bottle was added with the release medium and thedialysis bags were placed into them completely. These bottles wereagitated in a shaker at 37 �C in the darkness. The samples weretaken out at predetermined intervals and replaced with an equalvolume of fresh medium. The concentrations of Ce6 and ACF weredetermined as described before. The cumulative release% wascalculated by using the following formula: Cumulative release% =F1/F0 � 100%, where F0 was the drug content in the formulationplaced in the dialysis bag, and F1 was the cumulative released drugamount in the release medium.

2.5. Cell experiment

2.5.1. Cellular uptakeGiven the fluorescent nature of ACF, we employed the fluores-

cence of ACF to determine the internalization of the free ACF andC-PMP/Ce6/ACF NPs. Briefly, SMMC-7721 cells were seeded in 6-well plates at 3 � 105 cells per well and incubated for 12 h at37 �C. Then, the free ACF and C-PMP/Ce6/ACF NPs dispersed in cellculture medium were added at an equivalent ACF concentration of

296 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

3.3 lM. At the end of incubation, the drug-contained medium wasabandoned and each well was rinsed with PBS. Similarly, the par-allel wells in need of irradiation were subjected to a 660 nm laser(UltraFire, China) for 20 s at 3 W/cm2 after being stained with Lyso-Tracker Red (Beyotime Biotechnology, Shanghai, China) per themanufacturer’s instruction. After the treatment, a fluorescencemicroscope was used to observe the fluorescence.

2.5.2. Cytotoxicity assayIn order to evaluate the cytotoxicity of PMP-based formulations,

SMMC-7721 cells were seeded into a 96-well plate (5 � 103 cells/well) in medium (100 lL) and cultured for 12 h to allow cell adhe-sion. The cells were then treated with the tested NPs. The concen-trations of ACF and Ce6 were 1.0 lM and 1.58 lM, respectively.After incubation, the cell viability was evaluated by the methylth-iazolyldiphenyl tetrazolium bromide (MTT) assay. Each experi-ment was conducted for three independent measurements.

2.5.3. qRT-PCR and ELISA assaySMMC-7721 cells were seeded in 6-well plates at 3 � 105 cells

per well. After incubation for 12 h, the cells were then added withthe tested NPs at the relevant concentrations. After incubation for4 h, the cells in the irradiation groups were irradiated with a660 nm laser for 20 s at 3 W/cm2. After 24 h of incubation, totalRNA from cells samples was extracted by TRIzol reagent (CoWinBiosciences, Beijing, China). cDNA was synthesized with Oligo(dT)18 primer and the RT EasyTM I Reverse Transcription Kit(World’s Foregene, Chengdu, China). In order to quantify VEGFexpression, qRT-PCR analysis was performed by using Real timePCR EasyTM-SYBR Green I (World’s Foregene, Chengdu, China), andb-actin was used as the endogenous control. PCR primers for VEGFwere as follows: forward, 50 GAAGGAGGAGGGCAGAATCATCAC30;reverse, 50CACAGGATGGCTTGAAGATGTACTC 30; for b-actin were:forward, 50AGAGCTACGAGCTGCCTGAC30; reverse, 50AGCACTGTGTTGGCGTACAG30. qRT-PCR was performed with a LightCycler@ 96instrument (Roche, Switzerland). The results were calculated byusing the 2�DDCT methods.

On the other hand, the parallel cells were seeded and subjectedto PDT as described above. The cell medium was collected for eval-uating the VEGF level by using a VEGF ELISA Kit (MEIMIAN, Jiangsu,China) per the manufacturer’s instruction.

2.5.4. Apoptosis determinationSMMC-7721 cells were seeded in 6-well plates at 3 � 105 cells

per well. After incubation for 12 h, the cells were then added withthe tested NPs at the relevant concentrations. The concentrationsfor ACF and Ce6 were 1.0 lM and 1.58 lM, respectively. After incu-bation for 4 h, the cells were irradiated with a 660 nm laser for 20 sat 3 W/cm2. After incubation for 24 h, the cells were collected forsubsequent staining by Annexin-FITC/PI per the manufacturer’sinstruction. Finally, the collected cell samples were analyzed by aflow cytometry (BD Bioscience, Franklin lakes, NJ, USA).

2.5.5. ROS determinationCells were seeded and subjected to PDT as described in Sec-

tion 2.5.4. Alkaline comet assay was carried out for evaluatingthe damage to cells by the ROS. The collected cells were combinedwith molten agarose (at 37 �C) and added on the clean glass slides.After being placed in a refrigerator at 4 �C for 2 h in darkness, slideswere then immersed in pre-chilled fresh lysis solution for 2 h indarkness. Slides were then placed in a horizontal electrophoresisapparatus reservoir, which was filled with alkaline electrophoresisbuffer. The electrophoresis was carried out at 60 V for 20 min. Thenthe slides were washed twice with pure water. Finally the air-driedslides were added with PI and a fluorescence microscopy was usedto capture the images. The results were processed by using Comet

ScoreTM software (TriTek, Annandale, VA, USA) to evaluate DNAdamage by calculating the % DNA tail [41].

2.5.6. Western blottingCells were seeded and subjected to PDT as described in Sec-

tion 2.5.4. Treated cells were collected for lysis in RIPA buffer con-taining protease and phosphatase inhibitors. The total proteinconcentrations were measured by using the BCA Protein AssayKit (Beyotime Biotechnology, China). For each group, 20 lg of pro-tein was loaded onto 10% SDS-PAGE gel and was electro-transferred from the gel onto the PVDF membrane. Afterwards,the membranes were incubated with a blocking buffer (5%skimmed milk in TBST) and incubated with the primary antibodyat 4 �C for 12 h. Antibodies were measured with horseradish perox-idase (HRP)-conjugated secondary antibody. Finally, an UVP imag-ing system (Ultra violet Products Ltd., CA, USA) was used to takethe images.

2.6. In vivo imaging and antitumor efficacy

BALB/c nude mice (four weeks) were purchased from the SJALaboratory Animal Co., Ltd. (Changsha, China) and all the micereceived care in compliance with the criteria of the nationalRegulation on the Management of Laboratory Animals. TheSMMC-7721-bearing mice models were established according tothe following method. SMMC-7721 cells (1 � 107) were injectedon the right axilla of the five week-old Balb/c nude mice. Afterimplantation for one week, in order to assess the distributionbehaviour in vivo after PMP-based NPs injection to the SMMC-7721-bearing mice, NIR fluorescence in vivo imaging (CarestreamHealth, Inc., USA) was carried out. The instrument was employedto record the NIR emission spectra of mice administrated withtwo formulations, respectively. The captured images and thecorresponding X-ray images were analyzed by the BrukerMolecular Imaging Software. At the scheduled time points, MRIwas conducted on a 3.0 T clinical scanner (Siemens HealthcareSector, Erlangen, Germany).

When the tumor volume reached about 100 mm3, the micewere divided into eight groups randomly. All formulations wereintravenously injected into mice via the tail every two days,respectively. The dosage of Ce6 and ACF was 5 mg/kg and2.5 mg/kg, respectively. At the predetermined time point, thetumors of the PDT groups were irradiated with a 660 nm laser(3 W/cm2, 2 min). The mice were weighted by an electronic bal-ance and their tumor volumes were measured by a vernier caliper.The tumor volumes were calculated as V = 0.5 � a2 � b, where aand b represent the shortest and longest diameter of the tumor,respectively. After five times of treatment were completed, majororgans were subjected to the hematoxylin and eosin (H&E) stain-ing. The collected tumors were rapidly frozen at �80 �C. Then,the collected tumor samples were sliced with a cryostat micro-tome. The tumor sections were incubated with a 1:250 dilutionof CD-31 primary antibody (Proteintech, Wuhan, China) at 4 �Covernight, and then they were incubated with Alexa Fluor 488-labelled secondary antibody (1:200) for 1 h at ambient tempera-ture. Images were captured by a Nikon microscope.

2.7. Statistical analysis

The data were presented as the mean ± standard deviation (SD).The differences between two groups and multiple groups wereanalyzed by Student’s t test and one-way ANOVA, respectively.The level of significance was set at probabilities of ⁄p < 0.05,⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 297

3. Results and discussion

3.1. Preparation and characterization of PMP NPs

Amorphous porous manganese phosphate (PMP) materials withdesignable porosity and functionality have promising applicationsin drug delivery. The successful synthesis was validated by a seriesof methods. As shown in Fig. 1A, the TEM image showed the pre-pared uniform nanoparticles were round with a size of about168 nm. TEM image of the PMP NPs at a higher magnification indi-cated some faint dots dispersed on each particle, indicating the for-mation of porous structure (Fig. 1B). Besides, the EDS alsodemonstrated the existence of Mn and P elements (Fig. 1C). Asshown in Fig. 1D, the X-ray diffraction (XRD) pattern of the PMPNPs demonstrated that the crystal form of them was amorphousdue to the observed broad peaks in the entire tested range. Thisphenomenon was beneficial because amorphous nanoparticlesexhibited good biodegradability, which is also found among theanalogous calcium phosphate nanomaterials [42–44]. Generally,Mn 2p states are used to distinguish the difference betweenMn2+ and Mn4+. The Mn 2p peaked at binding energies of641.85 kev and 653.67 kev, corresponding to the Mn 2p3/2 andMn 2p1/2 spin-orbit peaks, respectively (Fig. S1). These data sug-gested that the Mn atoms have +2 oxidation state, which matchedthe reported values of Mn (II) oxidation states [45]. As shown inFig. 1E, PMP exhibited a type of V in the International Union of Pureand Applied Chemistry (IUPAC) classification, and its surface areawas about 20.58 m2/g. Its pore size was about 3.34 nm (Fig. 1F),which is enough to load the small drug molecules because the esti-mated molecular size of ACF and Ce6 through the ChemDraw Soft-ware12.0 is about 1.25 nm and 1.53 nm, respectively.

3.2. Characterization of PMP-based theranostic NPs

The success of one drug delivery system in vivo depends largelyupon the stability of the nanoparticles. For this purpose, the CMD

Fig. 1. Characterization of manganese phosphate NPs. (A, B) TEM images of the as-prepaN2-adsorption-desorption curves of the PBA-PMP NPs. (F) Pore diameter distribution of

was employed to functionalize the surface of the drug-loadedNPs [46]. As shown in the FT-IR spectra in Fig. 2A, the characteristicpeaks at 2924.5 cm�1 and 2853.6 cm�1 corresponding to the –C–Hstretching vibration of oleic acid decreased obviously after modifi-cation with (3-Aminopropyl) trimethoxysilane (APTMS). In addi-tion, new peaks at 1053 cm�1 and 1636 cm�1 were ascribed tothe –C–N stretching vibration and the N–H deformation vibration,respectively, further supporting the successful APTMS modifica-tion. Consistent with the phenomenon observed in the inset inFig. 2A, the PMP NPs with hydrophobic surface property could onlybe suspended in hexane phase, whereas the amine PMP NPs couldbe well-dispersed in water. After the PBA modification, one newpeak at 1384 cm�1 corresponding to the –B–OH stretching vibra-tion further demonstrated the introduction of PBA. Besides, weused a model system, in which the starting APTMS alone was usedto follow each step reaction by 1H NMR spectroscopy (Fig. S2). ForAPTMS derivative, final product was vacuum dried to obtain a yel-lowish solid. 1H NMR spectroscopy was performed with the follow-ing parameters: 1H NMR (400 MHz, DMSO-d6) d 8.38 (s, 2H), 7.99(d, J = 7.4 Hz, 2H), 7.86 (d, J = 7.4 Hz, 2H), 4.22 (s, 2H), 3.68(s, 9H), 2.18 (t, J = 7.4 Hz, 2H),1.9 (s, 1H), 1.12–1.41 (m, 2H), 0.85(t, J = 6.4 Hz, 2H). Compared to the 1H NMR spectrum of CMD(Fig. S3), the new peaks at 2.94 ppm, 1.70 ppm and 0.60 ppm ofCMD derivative were attributed to the protons of the APTMSderivative. Besides, new peaks at 7.86 ppm and 7.96 ppm werethe characteristic resonances of benzene ring. Moreover, the disap-pearance of the characteristic peaks of –B–(OH)2 and 1,2-diolsfurther confirmed the formation of the boronate esters. Therefore,these results indicated that APTMS derivative was successfullyconjugated to the CMD.

Subsequently, Ce6 and ACF were introduced into PMP NPs bysoaking. Although the surface area of the PMP NPs was not bigenough, the loading efficiency of Ce6 was more than 90% whenthe ratio of the carrier and Ce6 was set at 1:1. This high efficiencyof Ce6 may be due to the electrostatic interaction between the Ce6and the unreacted APTMS on the inner pores of the nanoparticles.

red PMP NPs. (C) EDS spectrum of the PMP NPs. (D) XRD pattern of the PMP NPs. (E)PBA-PMP NPs.

Fig. 2. Characterization of the derivatives of PMP and the drug-loaded PMP NPs. (A) FT-IR spectra of PMP and its derivatives. Insets are the photographs of hexane soluble PMPNPs (a) and water soluble PMP-NH2 NPs (b), respectively. (B) N2-adsorption-desorption curves of the C-PMP/Ce6/ACF NPs and the pore diameter distribution. (C) TEM imageof C-PMP/Ce6/ACF NPs. (D) Size distribution of C-PMP/Ce6/ACF NPs. (E) Zeta potential of C-PMP/Ce6/ACF NPs. (F) Macroscopic aspect of C-PMP/Ce6 NPs (a), C-PMP/Ce6/ACFNPs (b), C-PMP/ACF NPs (c) dispersion in PBS.

298 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

In contrast, the loading efficiency of ACF was low. When the ratioof the carrier and ACF was set at 1:1, the loading efficiency ofACF was less than 50%, which may be due to the repulsion fromthe above mentioned unreacted APTMS. The loading efficiency ofCe6 and ACF reached up to 85.6% and 46.0% respectively whenthe ratio of carrier/Ce6/ACF was set at a weight ratio of 4:1:1.Recently, the hollow mesoporous nanoparticles have emerged asthe drug delivery vehicles because the hollow counterparts provedto be the drug molecules reservoir [36]. However, the weak inter-actions between the loaded drug molecules and the materialmatrix made on-demand release difficult. For our system, this highdrug loading efficiency may be related to the special feature of thePMP NPs. When these PMP NPs were immediately incubated in thePS/drug solution, the PS/drug molecules were surely to beimported and entrapped in the pores instead of the huge cavity.After being capped with CMD, the surface area decreased from20.58 m2/g to 10.18 m2/g, and the pore size distribution alsodecreased to 1.46 nm (Fig. 2B), indicating the existence of CMD.As shown in Fig. 2C, the TEM image of C-PMP/Ce6/ACF showed thatthe drug loaded NPs were evidently wrapped around by the highmolecular CMD as well as the entrapment of drug molecules. Thesedata indicated that the pores were blocked to some extent due to

the PS/drug loading as well as the capping of the gatekeeperCMD. The DLS data showed that hydrodynamic size of C-PMP/Ce6/ACF NPs was around 180.7 nm in the aqueous solution(Fig. 2D), and its PDI was about 0.21. The zeta potential was around-22.6 mv (Fig. 2E), which is beneficial to make the NPs having goodstability in vitro and in vivo. As shown in Fig. 2F, those CMDylatednanoparticles exhibited excellent dispersibility in PBS without anyprecipitation, allowing their further applications in biological sys-tems. Thus, the CMD played a critical role in our nanoplatform,which is consistent with the Resovist (ferucarbotran), a commer-cialized iron oxide nanoparticles (IONP) formulation modified withCMD [47].

3.3. In vitro release and MRI evaluation

The release behaviours of the drug-loaded PMP NPs were inves-tigated by the dialysis method. As shown in Fig. 3A, the release per-centages of ACF and Ce6 for C-PMP/Ce6/ACF NPs after incubationfor 8 h at pH 7.4 were 49.2% and 47.8%, respectively. We inferredthat the CMD modification on the surface partially blocked thepores containing drug molecules, leading to the release of Ce6and ACF in a slow manner. However, the NPs showed a more rapid

Fig. 3. In vitro release and T1-weighted MRI evaluation. (A) In vitro drug release. (B)Plots of T1�1 with C-PMP/Ce6/ACF NPs dispersed in PBS at different Mn concentra-tions. (C) T1-weighted MRI images of C-PMP/Ce6/ACF NPs dispersed in PBS atdifferent Mn concentrations. (D) TEM image after the treatment of C-PMP/Ce6/ACFNPs with acid solution for 0.5 h.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 299

release profile at pH 6.0 in comparison to that at pH 7.4, indicatingthe highly pH-responsive release property. Therefore, the key fac-tors including crystalline form and type of surface functionalgroups may contribute to the rapid drug release. On one hand,the CMD was easily detached from the nanoparticles because itwas introduced through the borate ester bonds between boronicacids and idols, which are easily to break under the acid environ-ment [48,49]. On the other hand, the amorphization of the PMP

NPs was also critical for the separation of manganese ions andphosphate ions without the limitation of the lattice energy, whichfurther promoted the drug release. According to our priorresearches, manganese ions could be used as the T1-weighted con-trast agents [50]. It is expected that the imaging property would beimproved when the acid triggered the manganese ions release. Asshown in Fig. 3B, the r1 relativity value was measured to be1.9 mM�1 s�1 and 4.8 mM�1 s�1 at pH 7.4 and pH 6.0, respectively.At pH 7.4, it was inevitable for the water molecules to access theexposedMn2+ on the surface of the nanoparticles due to the incom-pletely coating as well as the large surface of the nanoparticles,which lead to the self-imaging property. However, at pH 6.0, ther1 relativity value was measured to be 4.8 mM�1 s�1 because of alot of released Mn2+ ions, which enlarged the water-accessible sur-face [51]. The r1 relativity of free Mn2+ was determined with avalue of 5.2 mM�1 s�1, Therefore, the r1 value of our system atpH 6.0 was comparable to that of free Mn2+, indicating our systemunder in vitro mimic microenvironment still showed the potentialfor positive MRI. Besides, the T1-weighted MRI images in Fig. 3Calso demonstrated the enhanced imaging function of our systemin pH 6.0 PBS compared to that in pH 7.4 PBS. In order to testour hypothesis, the TEM image of the C-PMP/Ce6/ACF was furthercaptured as shown in Fig. 3D. As expected, fewer nanoparticles andsome dissolved PMP matrix/fragments could be traced at pH 6.0.Thus, these data indicated that low pH stimulus could cause thedissolution of PMP NPs, which not only promoted the drug release,but also rendered the amplification of the imaging signal relying onmanganese ions.

3.4. Cellular uptake and in vitro efficiency

In order to explore the intracellular drug release behaviour ofC-PMP/Ce6/ACF NPs, its drug localization was investigated by fluo-rescencemicroscopy. As shown in Fig. 4A, green fluorescence signalwas observed in the SMMC-7721 cells in both the free ACF groupand C-PMP/Ce6/ACF NPs group. However, the fluorescence of freeACF group was stronger than that of C-PMP/Ce6/ACF NPs at 1 h.One possibility was that ACF is a small molecule that diffuses intocells easily while C-PMP/Ce6/ACF NPs entered in the cells throughthe energy-dependent endocytosis. As the incubation timeincreased to 4 h, the fluorescence of C-PMP/Ce6/ACF was strongerthan that of free ACF group. Previous study of the interactionbetween CMD and cancer cells had revealed that CMDylatednanoparticles selectively attached to cancer cells to some extent,which is associated with the fact that the three-dimensional dex-tran hydroxyl network shell pointed to the endocytotic mecha-nisms of uptake [52]. Thus, the CMD may also affect theinteraction between the drug-loaded nanoparticles and tumor cells.The cellular fluorescence after a 660 nm laser irradiation was fur-ther studied. As shown in Fig. 4B, the green fluorescence decreasedto some extent for both groups due to the quenching effect inducedby the light treatment. Moreover, the green ACF fluorescence wasseparated from the endosomes/lysosomes, suggesting the success-ful endosomal/lysosomal escape. This phenomenon could beexplained by the increased inner osmotic pressure due to a lot offresh manganese ions and phosphate ions as well as the ROS gener-ation by Ce6 under the irradiation. The survival rate of cells incu-bated with the C-PMP was almost 100% when the particleconcentration was less than 50 lg/ml (Fig. S4). Therefore, theC-PMP had no obvious cytotoxicity and was suitable as drug carri-ers. Fig. 4C showed the cell inhibition rates of SMMC-7721 cellsafter treatment with different formulations. As expected, theC-PMP/Ce6/ACF plus irradiation showed the strongest anticancereffect compared to any other drug-loaded PMP NPs. Photodynamictherapy (PDT) is believed to aggravate hypoxic conditions to tumorcells, resulting in the overexpression of angiogenic markers such as

Fig. 4. Cellular uptake and in vitro efficiency. (A) Cellular uptake. (B) Fluorescence image of treated cells. Note: (a) ACF + laser group; (b) C-PMP/Ce6/ACF NPs + laser group. (C)Cell inhibition. (D) Quantitative real-time PCR (qRT-PCR) determination of the levels of VEGF in SMMC-7721 cells treated with different formulations. (E) VEGF proteinexpression in SMMC-7721 cells treated with different formulations. Scale bar: 20 lm.

300 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

vascular endothelial growth factor (VEGF) [53]. The levels of VEGFwere determined by using qRT-PCR and ELISA assay, respectively.Compared to other groups, C-PMP/Ce6/ACF NPs plus irradiationcould significantly decrease VEGF mRNA by about 40% and effec-tively inhibited the expression of the VEGF protein in SMMC-7721cells. These results were attributed to the intracellular fate ofC-PMP/Ce6/ACF NPs, which possessed high cellular uptake andrapid lysomal escape, as well as synergistic effect of ACF and ROS.

On the basis of the excellent results of the cell inhibition, the cellapoptosis was determined. As shown in Fig. 5A, the C-PMP/Ce6 NPsin the dark have lower toxicity to SMMC-7721 cells compared withthe irradiation group. However, cells apoptosis was induced inmore and more cells by the C-PMP/Ce6/ACF NPs plus laser group.Comet assaywas further carried out for evaluating the DNA damageinduced by the ROS. As shown in Fig. 5B and Fig. S5, only naturalDNA retained round shape, while damaged DNA migrated awayfrom the nucleus, depending on the molecular weight of its frag-ments. For the groups without irradiation, such as C-PMP/Ce6 NPsand C-PMP/Ce6/ACF NPs, a little damage was observed since mostof the DNA remained round. After irradiation, obvious tail couldbe observed, indicating the damaged DNA migration. These resultsfurther confirmed that the enhanced photocytotoxicity of C-PMP/Ce6/ACF NPs resulted from DNA damage by singlet oxygen genera-tion as well as the effect of ACF. In order to better understand theapoptotic signalling pathway, the main apoptotic regulators suchas anti-apoptotic protein Bcl-2 and apoptotic protein Bax wereevaluated by Western blotting. As shown in Fig. 5C, the C-PMP/Ce6 NPs and C-PMP/Ce6/ACF NPs plus the 660 nm irradiation ledto the lower Bcl-2/Bax ratios. Overall, there was enough potencyfor the C-PMP/Ce6/ACF NPs to achieve the enhanced PDT effect inthe presence of the 660 nm laser irradiation.

3.5. In vivo NIR imaging and MRI

The biodistribution of C-PMP/Ce6/ACF NPs was monitored by anear-infrared fluorescence imaging system. As shown in Fig. 6A, nosignificant fluorescent signals were detected at the tumor site inthe free Ce6 group because of the lack of targetability. In contrast,strong fluorescence signals were observed in the tumors of micetreated with C-PMP/Ce6/ACF NPs. The nanoparticles accumulationat the tumor site increased with the time extended, indicating thatthe nanoparticles remained in circulation and could accumulateinto the tumor effectively. This feature might be attributed to thehydrophilic CMD, which could potentially escape macrophagecapture to some extent. Importantly, after 24 h, C-PMP/Ce6/ACFNPs were still retained in the tumor tissue, which may be due tothe special interaction of CMD and the tumor cells. Among allthe observed time points, the fluorescence intensity at the tumorsite reached the maximum level after 8 h injection. Thus, theT1-weighted MRI image was obtained at the same time point. Asshown in Fig. 6B and C, the appreciable whitening phenomenoncould be easily observed at the tumor site compared to that ofthe control mice. Consequently, the C-PMP/Ce6/ACF NPs couldaccumulate at the tumor site to some extent and could provideinformation about the tumor when it was used as a T1 MRI contrastagent.

3.6. In vivo antitumor efficacy

Encouraged by the promising results of combination therapyin vitro, we studied the in vivo antitumor efficiency of the C-PMP/Ce6/ACF system. As shown in Fig. 7A, the body weights of micetreated with all the PMP-based formulations barely changed

Fig. 5. Assay of the altered cell functions. (A) Cell apoptosis of SMMC-7721 cells for 24 h: (a) Control; (b) C-PMP + laser; (c) C-PMP/ACF; (d) C-PMP/ACF + laser; (e) C-PMP/Ce6;(f) C-PMP/Ce6 + laser; (g) C-PMP/Ce6/ACF; (h) C-PMP/Ce6/ACF + laser; (B) Comet assay on SMMC-7721 cells with different treatments. Scale bar: 20 lm. (C) Western blotting.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 301

during the duration of the study. Besides, the histopathologicalanalysis of major organs sections stained with H&E (Fig. S6)showed there was no pathological variation in the major organs,confirming excellent biocompatibility of all the tested nanoparti-cles. On one hand, the good biocompatibility might be attributedto the confinement and retention of Mn2+ ions in the nanoparticlesat pH 7.4. On the other hand, the flexible CMD coating on the sur-face of PMP NPs could hinder the capture of the nanoparticles byphagocytotic cells, which further attributed to the excellent bio-compatibility. Manganese neurotoxicity could occur in humans fol-lowing exposure to high levels of manganese in the air or water.

Manganese neurotoxicity is associated with elevated brain levelsof manganese, especially in the human caudate-putamen, globuspallidus, substantia nigra, and subthalamic nuclei [54]. One earlierstudy showed that the loss of cells in globus pallidus and caudateputamen as well as in frontal cortex of rats was significantly higher(p < 0.05) for manganese phosphate exposure group [55]. More-over, old age and gender influence the pharmacokinetics of inhaledmanganese sulfate and manganese phosphate in rats [56]. How-ever, the disturbance and impairments of biological functionsinduced by nanoparticles are closely relating to the particle sizeand surface chemistry [57]. Therefore, despite the inspiring

Fig. 6. The ability of PMP-based NPs to deliver theranostic ingredients in vivo. (A) In vivo near-infrared (NIR) fluorescence images of SMMC-7721 tumor-bearing nude mice atdifferent times after intravenous injection of C-PMP/Ce6 NPs (a) and free Ce6 (b). (B) In vivo T1-weighted MRI images of control mouse (a) and experimental mouse (b). (C)Average MRI signalintensity of each group.

302 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

therapeutic performance of C-PMP/Ce6/ACF, its potential long-term toxicity in vivo should be well evaluated prior to finding itsway into clinical applications.

In order to evaluate the therapeutic efficiency of various groups,the volumes of the SMMC-7721 tumors were measured over thetherapeutic period. As shown in Fig. 7B, the tumors in the controlgroup grew rapidly with a V/V0 value of 8.2 ± 0.6 at the end of thestudy. When the tumor-bearing mice were treated with C-PMPplus irridiation or C-PMP/Ce6, no obvious tumor inhibition wasobserved. However, the tumor volumes of all the laser irradiationgroups decreased after five times injections, which mainly attribu-ted to the effect of the PDT effect. Remarkably, the tumors from theC-PMP/Ce6/ACF plus irradiation group were inhibited continuouslyand showed the smallest average tumor volume with a V/V0 valueof 2.7 ± 0.4, indicating the strongest antitumor effect of the com-bined therapy. The enhanced efficacy of the C-PMP/Ce6/ACF plus

irradiation highlighted the critical function of co-packaging inter-active therapeutic agents into one system. The requirement forco-loading to get optimal efficacy is most likely owing to the rapidmicrovessel damage and shutdown by both ROS and ACF simulta-neously. In order to test our hypothesis, microvessel formation wasevaluated by immunostaining with anti-CD31 antibody. Represen-tative tumor microvessel densities in each group are shown inFig. 7C. ACF-based formulations significantly impaired themicrovessels formation, especially for the C-PMP/Ce6/ACF group.The results suggested that the altered tumor growth was directlycorrelated with altered microvessel formation apart from the PDTeffect. In addition, in order to further evaluate the effect of differ-ent therapeutic formulations, hematoxylin-eosin (H&E) stainingwas carried out to observe the tumor cell morphologies (Fig. 7D).As expected, the shrinkage of nuclei, nuclear fragmentation, anddecrease of the tumor cells density was observed after the

Fig. 7. Anticancer activities of PMP-based formulations in vivo. (A) Changes in body weights of animals as a function of time. (B) Volumetric changes of the SMMC-7721 tumorwith a schedule of multiple doses. (C) Representative fluorescence images of tumor sections after immunofluorescence staining. Note: (a) Control; (b) C-PMP + laser;(c) C-PMP/ACF; (d) C-PMP/Ce6 + laser; (e) C-PMP/Ce6/ACF; (f) C-PMP/Ce6/ACF + laser. Scale bar: 100 lm. (D) Representative H&E-stained tumor sections from differentgroups: (a) Control; (b) C-PMP + laser; (c) C-PMP/ACF; (d) C-PMP/ACF + laser; (e) C-PMP/Ce6; (f) C-PMP/Ce6 + laser; (g) C-PMP/Ce6/ACF; (h) C-PMP/Ce6/ACF + laser; Scale bar:50 lm.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 303

therapeutic process, suggesting the occurrence of cell apoptosis.Among all the therapeutic groups, such phenomena were obviousfor the C-PMP/Ce6/ACF plus laser group. These histological assaysfurther demonstrated the superiority of our combination therapeu-tic nanosystem.

4. Conclusions

In summary, this organic-inorganic hybrid theranosticnanoplatform for tumor combination therapy was constructedwith the entrapment of photosensitizer Ce6 and ACF in the porouspores of PMP NPs. The resultant C-PMP/Ce6/ACF NPs were featuredwith distinctive advantages such as ultra pH-responsive drugrelease, MRI function and rational drug combination exploitingthe blockage of the treatment escape signalling pathway. The com-plementarity and superiority of the combination were confirmedin vitro and in vivo. The present work provides new strategies for

the design and construction of the tumor acidity-activatable ther-anostic platforms for amplification of the photodynamic cancertherapy and magnetic resonance imaging simultaneously.

Acknowledgments

This research was financially supported by the National NaturalScience Foundation of China (Nos. 81572991, 81673021, and81573364), the China Postdoctoral Science Foundation (No.2014M562002 and 2015T80783), and Outstanding Young TalentResearch Fund of Zhengzhou University (1421331073).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.actbio.2017.08.028.

304 Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305

References

[1] Y. Wang, Y. Xie, J. Li, Z.H. Peng, Y. Sheinin, J. Zhou, D. Oupicky, Tumor-penetrating nanoparticles for enhanced anticancer activity of combinedphotodynamic and hypoxia-activated therapy, ACS Nano 11 (2017) 2227–2238.

[2] L. Yang, S. Zhang, X. Ling, P. Shao, N. Jia, M. Bai, Multilayer photodynamictherapy for highly effective and safe cancer treatment, Acta Biomater. 5 (2017)271–280.

[3] Z. Zhou, J. Song, L. Nie, X. Chen, Reactive oxygen species generating systemsmeeting challenges of photodynamic cancer therapy, Chem. Soc. Rev. 45(2016) 6597–6626.

[4] L. Feng, L. Cheng, Z. Dong, D. Tao, T.E. Barnhart, W. Cai, M. Chen, Z. Liu,Theranostic liposomes with hypoxia-activated prodrug to effectively destructhypoxic tumors post-photodynamic therapy, ACS Nano 11 (2017) 927–937.

[5] S. Gao, G. Wang, Z. Qin, X. Wang, G. Zhao, Q. Ma, L. Zhu, Oxygen-generatinghybrid nanoparticles to enhance fluorescent/photoacoustic/ultrasoundimaging guided tumor photodynamic therapy, Biomaterials 112 (2017) 324–335.

[6] Q. Chen, L. Feng, J. Liu, W. Zhu, Z. Dong, Y. Wu, Z. Liu, Intelligent albumin-MnO2

nanoparticles as pH-/H2O2-responsive dissociable nanocarriers to modulatetumor hypoxia for effective combination therapy, Adv. Mater. 28 (2016) 7129–7136.

[7] M.M. Vleugel, A.E. Greijer, A. Shvarts, P. van der Groep, M. van Berkel, Y.Aarbodem, H. van Tinteren, A.L. Harris, P.J. van Diest, E. van der Wall,Differential prognostic impact of hypoxia induced and diffuse HIF-1 alphaexpression in invasive breast cancer, J. Clin. Pathol. 58 (2005) 172–177.

[8] D. Shweiki, A. Itin, D. Soffer, E. Keshet, Vascular endothelial growth factorinduced by hypoxia may mediate hypoxia-initiated angiogenesis, Nature 359(1992) 843–845.

[9] N. Solban, Mechanistic investigation and implications of photodynamictherapy induction of vascular endothelial growth factor in prostate cancer,Cancer Res. 66 (2006) 5633–5640.

[10] B.Q. Spring, R. Bryan Sears, L.Z. Zheng, Z. Mai, R. Watanabe, M.E. Sherwood, D.A. Schoenfeld, B.W. Pogue, S.P. Pereira, E. Villa, T. Hasan, A photoactivablemulti-inhibitor nanoliposome for tumour control and simultaneous inhibitionof treatment escape pathways, Nat. Nanotechnol. 11 (2016) 378–387.

[11] Y. Kim, H.J. Nam, J. Lee, D.Y. Park, C. Kim, Y.S. Yu, D. Kim, S.W. Park, J. Bhin, D.Hwang, H. Lee, G.Y. Koh, S.H. Baek, Methylation-dependent regulation of HIF-1a stability restricts retinal and tumour angiogenesis, Nat. Commun. 7 (2016)10347.

[12] S.K. Chang, I. Rizvi, N. Solban, T. Hasan, In vivo optical molecular imaging ofvascular endothelial growth factor for monitoring cancer treatment, Clin.Cancer Res. 14 (2008) 4146–4153.

[13] Y. Hao, L. Wang, Y. Zhao, D. Meng, D. Li, H. Li, B. Zhang, J. Shi, H. Zhang, Z.Zhang, Y. Zhang, Targeted imaging and chemo-phototherapy of brain cancerby a multifunctional drug delivery system, Macromol. Biosci. 15 (2015) 1571–1585.

[14] Y. Yi, H.J. Wang, X.W. Wang, Q.L. Liu, M. Ye, W.H. Tan, A. Smart,Photocontrollable drug release nanosystem for multifunctional synergisticcancer therapy, ACS Appl. Mater. Interf. 9 (2017) 5847–5854.

[15] S.S. Lucky, K.C. Soo, Y. Zhang, Nanoparticles in photodynamic therapy, Chem.Rev. 115 (2015) 1990–2042.

[16] D.K. Chatterjee, L.S. Fong, Y. Zhang, Nanoparticles in photodynamic therapy: anemerging paradigm, Adv. Drug Deliv. Rev. 60 (2008) 1627–1637.

[17] Y. Yan, J. Fu, T. Wang, X. Lu, Controlled release of silyl ether camptothecin fromthiol-ene click chemistry-functionalized mesoporous silica nanoparticles, ActaBiomater. 51 (2017) 471–478.

[18] M.S. Kang, R.K. Singh, T.-H. Kim, J.-H. Kim, K.D. Patel, H.-W. Kim, Opticalimaging and anticancer chemotherapy through carbon dot created hollowmesoporous silica nanoparticles, Acta Biomater. 55 (2017) 466–480.

[19] M. Gao, F. Fan, D. Li, Y. Yu, K. Mao, T. Sun, H. Qian, W. Tao, X. Yang, Tumoracidity-activatable TAT targeted nanomedicine for enlargedfluorescence/magnetic resonance imaging-guided photodynamic therapy,Biomaterials 133 (2017) 165–175.

[20] J.P. Celli, B.Q. Spring, I. Rizvi, C.L. Evans, K.S. Samkoe, S. Verma, B.W. Pogue, T.Hasan, Imaging and photodynamic therapy: mechanisms, monitoring, andoptimization, Chem. Rev. 110 (2010) 2795–2838.

[21] P. Huang, X.Q. Qian, Y. Chen, L.D. Yu, H. Lin, L.Y. Wane, Y.F. Zhu, J.L. Shi,Metalloporphyrin-encapsulated biodegradable nanosystems for highlyefficient magnetic resonance imaging-guided sonodynamic cancer therapy, J.Am. Chem. Soc. 139 (2017) 1275–1284.

[22] H.H. Fan, Z.L. Zhao, G.B. Yan, X.B. Zhang, C. Yang, H.M. Meng, Z. Chen, H. Liu, W.H. Tan, A smart DNAzyme-MnO2 nanosystem for efficient gene silencing,Angew. Chem. Int. Ed. 54 (2015) 4801–4805.

[23] I. Brigger, C. Dubernet, P. Couvreur, Nanoparticles in cancer therapy anddiagnosis, Adv. Drug Deliv. Rev. 54 (2002) 631–651.

[24] J. Li, Z. Zhao, J. Feng, J. Gao, Z. Chen, Understanding the metabolic fate andassessing the biosafety of MnO nanoparticles by metabonomic analysis,Nanotechnology 24 (2013) 455102.

[25] L. Yu, Y. Chen, M. Wu, X. Cai, H. Yao, L. Zhang, H. Chen, J. Shi, Manganeseextraction, strategy enables tumor-sensitive biodegradability and theranosticsof nanoparticles, J. Am. Chem. Soc. 138 (2016) 9881–9894.

[26] Y. Hao, B. Zhang, C. Zheng, M. Niu, H. Guo, H. Zhang, J. Chang, Z. Zhang, L.Wang, Y. Zhang, Multifunctional nanoplatform for enhanced photodynamic

cancer therapy and magnetic resonance imaging, Colloids Surf., B Biointerf.151 (2017) 384–393.

[27] Y. Hao, L. Wang, B. Zhang, H. Zhao, M. Niu, Y. Hu, C. Zheng, H. Zhang, J. Chang, Z.Zhang, Multifunctional nanosheets based on folic acid modified manganeseoxide for tumor-targeting theranostic application, Nanotechnology 27 (2015)025101.

[28] T.L. Ha, H.J. Kim, J. Shin, G.H. Im, J.W. Lee, H. Heo, J. Yang, C.M. Kang, Y.S. Choe, J.H. Lee, I.S. Lee, Development of target-specific multimodality imaging agent byusing hollow manganese oxide nanoparticles as a platform, Chem. Commun.(Camb.) 47 (2011) 9176–9178.

[29] J. Shin, R.M. Anisur, M.K. Ko, G.H. Im, J.H. Lee, I.S. Lee, Hollow manganese oxidenanoparticles as multifunctional agents for magnetic resonance imaging anddrug delivery, Angew. Chem. Int. Ed. Engl. 48 (2009) 321–324.

[30] J. Yu, R. Hao, F. Sheng, L. Xu, G. Li, Y. Hou, Hollow manganese phosphatenanoparticles as smart multifunctional probes for cancer cell targetedmagnetic resonance imaging and drug delivery, Nano Res. 5 (2012) 679–694.

[31] S. Kumar, B. Linehan, Y.C. Tseng, A new combination approach of CI jet andQESD to formulate pH-susceptible amorphous solid dispersions, Int. J. Pharm.466 (2014) 368–374.

[32] D.T. Liu, S.Y. Zhang, Z.J. Wu, Lattice energy estimation for inorganic ioniccrystals, Inorg. Chem. 42 (2003) 2465–2469.

[33] Z. Dong, L. Feng, W. Zhu, X. Sun, M. Gao, H. Zhao, Y. Chao, Z. Liu, CaCO3

nanoparticles as an ultra-sensitive tumor-pH-responsive nanoplatformenabling real-time drug release monitoring and cancer combination therapy,Biomaterials 110 (2016) 60–70.

[34] R. Weijer, M. Broekgaarden, M. Krekorian, L.K. Alles, A.C. van Wijk, C. Mackaaij,J. Verheij, A.C. van der Wal, T.M. van Gulik, G. Storm, M. Heger, Inhibition ofhypoxia inducible factor 1 and topoisomerase with acriflavine sensitizesperihilar cholangiocarcinomas to photodynamic therapy, Oncotarget 7 (2016)3331–3346.

[35] M. Broekgaarden, R. Weijer, M. Krekorian, B. van den Ijssel, M. Kos, L.K. Alles, A.C. van Wijk, Z. Bikadi, E. Hazai, T.M. van Gulik, M. Heger, Inhibition of hypoxia-inducible factor 1 with acriflavine sensitizes hypoxic tumor cells tophotodynamic therapy with zinc phthalocyanine-encapsulating cationicliposomes, Nano Res. 9 (2016) 1639–1662.

[36] Q. Feng, Y. Zhang, W. Zhang, X. Shan, Y. Yuan, H. Zhang, L. Hou, Z. Zhang,Tumor-targeted and multi-stimuli responsive drug delivery system for near-infrared light induced chemo-phototherapy and photoacoustic tomography,Acta Biomater. 38 (2016) 129–142.

[37] X. Deng, Z. Yin, Z. Zhou, Y. Wang, F. Zhang, Q. Hu, Y. Yang, J. Lu, Y. Wu, W.Sheng, Y. Zeng, Carboxymethyl dextran-stabilized polyethylenimine-poly(epsilon-caprolactone) nanoparticles-mediated modulation of microRNA-34aexpression via small-molecule modulator for hepatocellular carcinomatherapy, ACS Appl. Mater. Interf. 8 (2016) 17068–17079.

[38] D.G. You, V.G. Deepagan, W. Um, S. Jeon, S. Son, H. Chang, H.I. Yoon, Y.W. Cho,M. Swierczewska, S. Lee, M.G. Pomper, I.C. Kwon, K. Kim, J.H. Park, ROS-generating TiO2 nanoparticles for non-invasive sonodynamic therapy ofcancer, Sci. Rep. 6 (2016) 23200.

[39] E. Kim, J.M. Kim, L. Kim, S.J. Choi, I.S. Park, J.Y. Han, Y.C. Chu, E.S. Choi, K. Na, S.S.Hong, The effect of neutral-surface iron oxide nanoparticles on cellular uptakeand signaling pathways, Int. J. Nanomed. 11 (2016) 4595–4607.

[40] J. Fang, H. Nakamura, H. Maeda, The EPR effect: unique features of tumor bloodvessels for drug delivery, factors involved, and limitations and augmentationof the effect, Adv. Drug Deliv. Rev. 63 (2011) 136–151.

[41] I. Postiglione, F. Barra, S.M. Aloj, G. Palumbo, Photodynamic therapy with 5-aminolaevulinic acid and DNA damage: unravelling roles of p53 and ABCG2,Cell Prolif. 49 (2016) 523–538.

[42] W. Chu, Y. Huang, C. Yang, Y. Liao, X. Zhang, M. Yan, S. Cui, C. Zhao, Calciumphosphate nanoparticles functionalized with alendronate-conjugatedpolyethylene glycol (PEG) for the treatment of bone metastasis, Int. J. Pharm.516 (2017) 352–363.

[43] G. Balasundaram, M. Sato, T.J. Webster, Using hydroxyapatite nanoparticlesand decreased crystallinity to promote osteoblast adhesion similar tofunctionalizing with RGD, Biomaterials 27 (2006) 2798–2805.

[44] P. Mi, D. Kokuryo, H. Cabral, H.L. Wu, Y. Terada, T. Saga, I. Aoki, N. Nishiyama, K.Kataoka, A pH-activatable nanoparticle with signal-amplification capabilitiesfor non-invasive imaging of tumour malignancy, Nat. Nanotechnol. 11 (2016)724–730.

[45] C.V.K. Sharma, C.C. Chusuei, R. Clerac, T. Moller, K.R. Dunbar, A. Clearfield,Magnetic property studies of manganese-phosphate complexes, Inorg. Chem.42 (2003) 8300–8308.

[46] C. Fortier, E. Louvier, Y. Durocher, G. De Crescenzo, Tailoring the surface of agene delivery vector with carboxymethylated dextran: a systematic analysis,Biomacromolecules 16 (2015) 1671–1681.

[47] H.R. Neves, R.A. Bini, J. Barbosa, C. Salmon, L.C. Varanda, Dextran-coatedantiferromagnetic MnO nanoparticles for a T-1-MRI contrast agent with highcolloidal stability, Part. Part. Syst. Charact. 33 (2016) 167–176.

[48] Y. Hao, C. Zheng, L. Wang, Y. Hu, H. Guo, Q. Song, H. Zhang, Z. Zhang, Y. Zhang,Covalent self-assembled nanoparticles with pH-dependent enhanced tumorretention and drug release for improving tumor therapeutic efficiency, J.Mater. Chem. B 5 (2017) 2133–2144.

[49] J.J. Liu, Z. Luo, J.X. Zhang, T.T. Luo, J. Zhou, X.J. Zhao, K.Y. Cai, Hollowmesoporous silica nanoparticles facilitated drug delivery via cascade pHstimuli in tumor microenvironment for tumor therapy, Biomaterials 83 (2016)51–65.

Y. Hao et al. / Acta Biomaterialia 62 (2017) 293–305 305

[50] Y. Hao, L. Wang, B. Zhang, H. Zhao, M. Niu, Y. Hu, C. Zheng, H. Zhang, J. Chang, Z.Zhang, Y. Zhang, Multifunctional nanosheets based on folic acid modifiedmanganese oxide for tumor-targeting theranostic application,Nanotechnology 27 (2016) 025101.

[51] T. Kim, E.J. Cho, Y. Chae, M. Kim, A. Oh, J. Jin, E.S. Lee, H. Baik, S. Haam, J.S. Suh,Y.M. Huh, K. Lee, Urchin-shaped manganese oxide nanoparticles as pH-responsive activatable T1 contrast agents for magnetic resonance imaging,Angew. Chem. Int. Ed. Engl. 50 (2011) 10589–10593.

[52] Q.Y. Huang, L.L. Zhang, X.Y. Sun, K. Zeng, J. Li, Y.N. Liu, Coating ofcarboxymethyl dextran on liposomal curcumin to improve the anticanceractivity, RSC Adv. 4 (2014) 59211–59217.

[53] R.L. Lecaros, L. Huang, T.C. Lee, Y.C. Hsu, Nanoparticle delivered VEGF-A siRNAenhances photodynamic therapy for head and neck cancer treatment, Mol.Ther. 24 (2016) 106–116.

[54] P.K. Pal, A. Samii, D.B. Calne, Manganese neurotoxicity: a review of clinicalfeatures, imaging and pathology, Neurotoxicology 20 (1999) 227–238.

[55] F. Salehi, G. Carrier, L. Normandin, G. Kennedy, R.F. Butterworth, A. Hazell, G.Therrien, D. Mergler, S. Philippe, J. Zayed, Assessment of bioaccumulation andneurotoxicity in rats with portacaval anastomosis and exposed to manganesephosphate: a pilot study, Inhalation Toxicol. 13 (2001) 1151–1163.

[56] D.C. Dorman, B.E. McManus, M.W. Marshall, R.A. James, M.F. Struve, Old ageand gender influence the pharmacokinetics of inhaled manganese sulfate andmanganese phosphate in rats, Toxicol. Appl. Pharmacol. 197 (2004) 113–124.

[57] L. Yildirimer, N.T. Thanh, M. Loizidou, A.M. Seifalian, Toxicology and clinicalpotential of nanoparticles, Nano Today 6 (2011) 585–607.