Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
1
TYPE I INTERFERON IN THE PATHOGENESIS OF SYSTEMIC LUPUS ERYTHEMATOSUS
By
HAOYANG ZHUANG
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2008
2
© 2008 Haoyang Zhuang
3
To my parents and my sister, for their endless love.
谨以此文献给我最亲爱的爸爸妈妈和姐姐
4
ACKNOWLEDGMENTS
I thank my mentor, Dr. Westley Reeves, for his guidance, patience and support. His
enthusiasm and curiosity for science inspired me constantly. I want to thank my committee, Dr.
Eric Sobel, Dr. Mark Atkinson and Dr. Daniel Driscoll, for for their encouragement, technical
support, and insightful suggestions. I truly appreciate the invaluable support both clinically and
scientifically. Dr. Driscoll provided excellent subject on the study, without which my research
could not be completed. I would like to thank Dr. Atkinson for his professional advice on
immunology. I also want to thank Dr. Clayton Mathews, who provided excellent advice for my
thesis with great patients and details.
I thank Dr. Minoru Satoh for his excellent support and perceptive critiques. I thank Dr.
Mark Siegal for providing study specimens from their clinic.I thank all the members of the
Reeves lab, Dina, Kindra, Jason, Pui, Rob, Yi, Ed, Julie, Errin, for their friendship and
encouragement. They serve as colleagues and also as family.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES...........................................................................................................................8
LIST OF FIGURES .........................................................................................................................9
LIST OF ABBREVIATIONS........................................................................................................10
ABSTRACT...................................................................................................................................13
CHAPTER
1 INTRODUCTION ..................................................................................................................15
Autoimmunity and Autoimmune Disease ..............................................................................15 Systemic Lupus Erythematosus..............................................................................................15
SLE 101 ...........................................................................................................................15 Genetics of SLE...............................................................................................................16 Environmental Factors.....................................................................................................18 Autoantibodies in SLE ....................................................................................................20 Type III hypersensitivity and SLE ..................................................................................20 Clinical Manifestations....................................................................................................22 Measurement of Disease Activity ...................................................................................24 Current Treatment ...........................................................................................................25
Anti-inflammatory Agents .......................................................................................25 Antimalarials ............................................................................................................26 Anti-cytokine Agents ...............................................................................................26 Methotrexate.............................................................................................................27 Anti-T Lymphocyte Therapy ...................................................................................27 Anti-B Lymphocyte Therapy ...................................................................................29 Intravenous Immunoglobulin (IVIG) .......................................................................29
Animal Models of SLE....................................................................................................30 Type I Interferon.....................................................................................................................31 Induction of IFN-I...................................................................................................................32
Toll Like Receptors Dependent Pathways ......................................................................32 TLR Independent Pathway ..............................................................................................34 Crosstalk of Type I Interferon and Other Cytokines .......................................................35
IFN-I is Involved In Pathogenesis of SLE..............................................................................37 Subsets of Dendritic Cells (DCs) Produce IFN-I ...................................................................38
2 MATERIAL AND METHOD................................................................................................44
Subjects...................................................................................................................................44 Reagent ...................................................................................................................................44
6
RNA Preparation ....................................................................................................................45 Real-Time PCR.......................................................................................................................45 Effect of Corticosteroids and Antimalarials on Cytokine Production ....................................46 Serological Testing .................................................................................................................46 Flow Cytometry ......................................................................................................................46 Karyotype Analysis ................................................................................................................47 Cell Enrichment ......................................................................................................................47 Flow Cytometric Cell Sorting.................................................................................................48 Electron Microscopy...............................................................................................................48 Statistical Method ...................................................................................................................49
3 RESULTS AND DISCUSSION: ASSOCIATION OF ANTI-NUCLEOPROTEIN AUTOANTIBODIES WITH TYPE I INTERFERON PRODUCTION IN SYSTEMIC LUPUS ERYTHEMATOSUS................................................................................................53
Introduction.............................................................................................................................53 Results.....................................................................................................................................54
Increased IFN-I Production and Low Peripheral Blood Dendritic Cells in SLE ............54 IFN-I and PDC/MDC Abnormalities Are not Explained by Medication Use.................55 Increased Mx1 and Low PDC/MDC Counts Are Associated With A Subset of
Autoantibodies. ............................................................................................................56 Relationship of Mx1 Expression and Dendritic Cell Counts to Disease Activity...........57
Discussion...............................................................................................................................58
4 RESULTS AND DISCUSSION: CD71+ MONOCYTES IN PERIPHERAL BLOOD FROM LUPUS PATIENTS PRODUCE INTERFERON α/β................................................70
Introduction.............................................................................................................................70 Results.....................................................................................................................................71
Low PDC Numbers Correlate with High Interferon Levels in SLE ...............................71 CD14+ Cells from SLE Patients Produce IFN-I in Response to TLR Ligands ...............72 Circulating CD71+ Monocytes in SLE Express IFN-I ....................................................73 Increased CD14+CD71+ Monocytes in Patients with Anti-U1A Antibodies ..................73 Phenotype of CD14+CD71+ Cells....................................................................................74
Discussion...............................................................................................................................74 Production of IFN-I by CD71+ Monocytes in SLE .........................................................75 Mechanism of IFN-I Production .....................................................................................77
5 RESULTS AND DISCUSSION: LUPUS-LIKE DISEASE AND HIGH INTERFERON LEVELS CORRESPONDING TO TRISOMY OF THE TYPE I INTERFERON CLUSTER ON CHROMOSOME 9P.....................................................................................86
Introduction.............................................................................................................................86 Results.....................................................................................................................................87
Pedigree ...........................................................................................................................87 Case Reports ....................................................................................................................87 Immunologic Findings.....................................................................................................89
7
Discussion...............................................................................................................................91
6 CONCLUSION AND FUTURE DIRECTIONS..................................................................100
LIST OF REFERENCES.............................................................................................................104
BIOGRAPHICAL SKETCH .......................................................................................................126
8
LIST OF TABLES
Table page
2-1 Patient demographics .........................................................................................................50
2-2 Primers for real time PCR..................................................................................................51
9
LIST OF FIGURES
Figure page
1-1 Toll like receptor signaling pathway and induction of type I interferon.. .........................41
1-2 Production of IFN-I induced by TLR independent pathway.. ...........................................42
1-3 Type I interferon signaling.................................................................................................43
3-1 Increased expression of IFN inducible genes in SLE ........................................................63
3-2 Reduced circulating PDCs and MDCs in SLE ..................................................................64
3-3 Effect of medications on Mx1 expression in SLE patients................................................66
3-4 Increased Mx1 expression correlates with autoantibody production.................................67
3-5 Decreased dendritic cell counts correlate with autoantibody production ..........................68
3-6 Relationship of Mx1 expression, PDC and MDC counts to disease severity....................69
4-1 Reduced plasmacytoid dendritic cells in SLE and correlation between CD14+CD71+ monocytes ..........................................................................................................................79
4-2 Production of IFN-I by CD14+ cells .................................................................................80
4-3 SLE monocytes express high level of TLR7, IRF7 and CD14 and produce IL-6 as well as IFNβ in response to loxoribine stimulation.. .........................................................81
4-4 Increased CD14+ CD71+ monocyte in SLE and correlation of IFN-I production.. ...........82
4-5 Production of IFN-I by CD14+CD71+ monocytes.. ...........................................................83
4-6 Percentage of CD71+ cells correlates with anti-U1A antibody production ......................84
5-1 Pedigree..............................................................................................................................95
5-2 Karyotype analysis of A, subject UB2 and B, subject B1 .................................................96
5-3 Autoantibody testing..........................................................................................................97
5-4 Type I interferon (IFN) expression. ...................................................................................98
5-5 Regulation of interferon (IFN) production . ......................................................................99
10
LIST OF ABBREVIATIONS
ADCC Antibody-dependent cellular cytotoxicity
ANA Anti-nuclear antibody
ANCA Antineutrophil cytoplasmic antibodies
APC Antigen presenting cell
BILAG the British Isles Lupus Assessment Group
CARD Caspase recruitment domains
COX Cyclooxygenase
CR1 C3b receptors 1
CRP C reactive protein
ECLAM European Consensus Lupus Activity Measurement
GN Glomerulonephritis
HCV Hepatitis C virus
HLA Human leukocyte antigen
IFN-I Type I interfereon
IFNAR Interferon α receptor
IPC Interferon producing cells
IRF Interferon regulatory factor
ISGF IFN-stimulated gene factor
ISRE IFN-stimulated response element
IVIG Intravenous immunoglobulin
LPS Lipopolysaccharide
MCP Metacarpophalangeal
MDA5 Melanoma differentiation–associated gene 5
MDC Myloid dendritic cell
11
MHC Major histocompatibility complex
NFAT Nuclear factor of activated T cells
NK Natural killer
nRNP Nuclear ribonuclear protein
NSAIDs Nonsteroidal anti-inflammatory drugs
OAS 2’5’-oligoadenylate synthetase
PBMC Peripheral blood mononuclear cell
PDC Plasmacytoid dendritic cell
PIP Proximal interphalangeal
PKR Protein kinase R
Poly (I:C) Polyinosinic–polycytidylic acid
RA Rheumatoid Arthritis
RD Repression domain
RIG-I Retinoic acid–inducible gene I
SIS SLE Index Score
SLAM Systemic Lupus Activity Measures
SLE Systemic lupus erythematosus
SLEDAI Systemic Lupus Erythematosus Disease Activity Index
SNP Single nucleotide polymorphism
SOCS Suppressors of cytokine signaling
STAT Signal Transducers and Activators of Transcription
TGF β Transforming growth factor β
TLR Toll like receptor
TICAM Toll-interleukin 1 receptor domain (TIR)-containing adaptor molecule
TIR TLR–interleukin-1 receptor
12
TIRAP Toll-interleukin 1 receptor (TIR) domain-containing adapter protein
TNF α Tumor necrosis factor α
TMPD 2,6,10,14 tetramethylpentadecane
TRAM Toll-receptor-associated molecule
TRIF TIR-domain-containing adapter-inducing interferon-β
VSV Vesicular stomatitis virus
YAA Y chromosome-linked autoimmune acceleration
13
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
TYPE I INTERFERON IN THE PATHOGENESIS OF SYSTEMIC LUPUS ERYTHEMATOSUS
By
Haoyang Zhuang
May 2008
Chair: Westley H. Reeves Major: Medical Sciences--Immunology and Microbiology
Systemic lupus erythematosus (SLE) is a chronic inflammatory autoimmune disease with
multiple organ involvements. Cytokines, such as type I interferon (IFN-I) play an important role
in the immune system, including regulating the activation and survival of B and T cells,
up-regulation of MHC II expression, and acting as adjuvant in antibody production.
In this study, we have shown that the production of IFN-I was increased in peripheral
blood mononuclear cells compared to normal controls or patients with other autoimmune disease.
The elevated production of IFN-I was associated with the autoantibodies against dsDNA,
Sm/RNP, Ro/La and was negatively associated with anti-phospholipid antibody. The increased
IFN-I production was also correlated with disease activity and renal involvement.
Paradoxically the major IFN-I producing cells, namely plasmacytoid dendritic cells (PDCs)
were decreased in SLE patients when compare to normal controls. We have shown that the
decreased number of PDCs was also correlated with certain autoantibody production. We found
a subset of monocytes which were CD14+CD71+ in lupus patients. These cells were correlated
with IFN-I production.
At last we show that over production of IFN-I could lead to a lupus like disease. We
studied two patients with an inbalanced translocation of chromosome 9 and 21 with 3 copies of
14
IFN-I cluster. These patients exhibit a lupus like disease as well as increased IFN-I production
and decreased PDC number as other SLE patients.
In conclusion, we found IFN-I was important in the pathogenesis of SLE and that
CD14+CD71+ monocytes were responsible for the IFN-I production. Over expression of IFN-I
was sufficient to induce a lupus like disease.
15
CHAPTER 1 INTRODUCTION
Autoimmunity and Autoimmune Disease
As early as 1904, Paul Ehrlich used the term autoimmunity to signify an immune response
against self and introduced the phrase “horror autotoxicus” (1). However the concept of
autoimmunity was not fully accepted until 1960. Over the years, it has become recognized that
autoimmunity is not an uncommon occurrence and is not necessarily detrimental. Thus, an
important distinction must be drawn between autoimmunity, which is indicated by the presence
of immune response to self antigen, (e.g. the formation of autoantibodies) and autoimmune
disease, which occurs when autoimmunity leads to an inflammatory response resulting in tissue
injury. Autoimmunity may be asymptomatic and it cannot be assumed that an autoimmune
response implies the existence of autoimmune disease.
Systemic Lupus Erythematosus
Systemic Lupus Erythematosus 101
Systemic lupus erythematosus (SLE) is a chronic inflammatory autoimmune disease with
multiple organ involvement. It is characterized of the production of autoantibodies against
components of the cell nucleus and cytoplasm. Currently there is no single diagnosis of SLE, and
the SLE is defined for research purposes as the presence of any 4 out of following 11 criteria:
malar rash, dicoid rash, photosensitivity, oral ulcers, arthritis, serositis, renal disorder, neurologic
disorder, hematologic disorder, immunologic disorder (anti-dsDNA, Sm, phospholipid
antibodies), and antinuclear antibodies (2).
SLE primarily affects young women and the peak of incidence occurs between the ages of
15 and 40 (2). In this age range the ratio of affected women to men is around 10:1 whereas
before or after this period the ratio is around 4:1, suggesting that estrogen plays a role in the
16
pathogenesis of SLE (3). The disease is more common among African Americans, Asians, and
Hispanics whereas the prevalence is lower in Caucasians (around 1 in 2000). The prevalence in
non-Caucasian females is as high as 1 in 200.
The frequency of autoimmune disease in first degree relatives of SLE patients is
significantly higher than in non-relatives, consistent with a genetic contribution. However, it
does not appear to follow the classical Mendelian pattern (4). Environmental factors, such as
sunlight and infections, also play important role in the pathogenesis of SLE
Genetics of SLE
Genetics factors play important roles in the pathogenesis of SLE. Twin studies show that
nomozygotic twins have a 24-58% risk of developing SLE compared to only 2-5% for dizygotic
twins (5). An individual with an affected first-degree relative is 20 times more likely to develop
autoimmune disease (6, 7).
Several genome wide linkage scans have been performed in families and large cohorts of
lupus patients. Although none of the loci revealed to be associated with lupus have been
reproduced in all the studies, seven regions show strong evidence of linkage in at least 2 studies.
These regions include 1q22-24(8, 9), 1q41-42(8), 2q32-37(9), 4p16(8, 9), 6p11-21(8-10),
11p13(11), 12p11(8, 9), 12q24(9),16q12-13(10, 11) and 19q13(8). The studies suggest potential
candidate genes for further studies. The lack of consistency among studies may be due to the fact
that SLE is a heterogeneous disease or maybe related to different ethnic compositions of the
study population.
The most studied locus is 1q22-24, which was identified in many populations (8, 9).
Studies have been focused on the low affinity Fcγ receptor gene CGR2A and B, FCGR3A and B,
which locate on Chromosome 1. FcγRIIa (CD32) is widely expressed on monocytes,
macrophages, neutrophils, dendritic cells and platelets. A single nucleotide polymorphism (SNP)
17
results in a histidine (H)/arginine (R) switch at amino acid position 131 leading to a much lower
binding affinity for IgG2, and potentially a lower capacity to clear IgG2 containing immune
complexes. Some studies showed homozygous RR individuals have higher susceptibility to SLE
(12). FcγRIIIa (CD16) is expressed primarily on monocytes, macrophages, NK cells, and some
T-cells. A valine (V) to phenylalanine (F) switch at amino acid position 158 results in a
reduction in binding affinity for IgG1 and IgG3 as well as immune complexes containing these
isotypes (13). Some studies suggest the 158F allele is associated with lupus nephritis (14) and
homozygous FF SLE patients have a higher risk for nephritis compared with the homozygous
VV patients (15, 16). In addition to the F158 allele, F176 allele which has been shown to be
associated with increased risk of SLE in both African American and European American (17, 18).
FcγRIIIb is a stimulatory receptor expressed primarily on neutrophils. It exhibits a copy number
polymorphism. However, the association between the FcγIIIb copy number and SLE has been
controversial (19). Another candidate gene on 1q23 is C reactive protein (CRP). CRP is an acute
phase protein which is up-regulated by IL-6 and inflammation. It binds to CRP receptor on
macrophages and enhances phagocytosis as well as complement binding to foreign antigens. In
some studies this CRP polymorphism is also associated with SLE (20, 21).
Major histocompatibility complex (MHC) molecule was found to be associated with lupus
20 years ago (22). The human MHC region locates on Chromosome 6p11-21. It spans 3.6 Mb of
DNA and contains over 200 genes, divided into the class I region containing HLA A, B and C,
the class II region containing HLA DR, DQ and DP and the class III region containing a variety
of immunological genes including tumor necrosis factor (TNF) and complement components C2
and C4. The association between MHC haplotype and lupus is highly consistent. An association
of HLA DR2 and DR3 with SLE has been reported in several populations, with a relative risk for
18
the development of disease of approximately two to five (23, 24). A specialcombination of
DR2/DR3 heterozygous individual has a moderate risk of developing SLE. The HLA class II
genes are also associated with the production of certain autoantibodies such as anti-Sm (small
nuclear ribonucleoprotein, as well as anti-Ro, anti-La, anti-nRNP, and anti-DNA antibodies
(25-27). C4 protein is transcribed from two genes, C4A and C4B, and also exhibits a copy
number polymorphism. The C4A null allele (C4AQ*0) has been associated with SLE in some
studies. C2Q*0 is carried on a rare DRB1*1501 containing MHC haplotype and homozygote of
C2Q*0 is associated with SLE development, yet there is no evidence for heterozygote of C2Q*0
with higher risk for lupus (28-30).
More recent studies showed increased type I interferon expression in SLE (31, 32).
Interferon regulatory factor 5 (IRF5) is an interferon regulated transcription factor that plays an
important role in the production of the proinflammatory cytokines TNFα, IL-12, and IL-6 in
response to toll-like receptor stimulation. IRF5 has a complex splicing pattern. There are three
alternative 5′UTR exons (exon1-A, exon1-B, and exon1-C). The three alternative 5′UTRs lead to
the translation of several different isoform named V1–V12. SNP rs2004640 (G<T) has an
alternative splicing site on exon1-B and leads to the expression of unique isoforms including V2,
V9 and V10 which derived from exon1-B (33). The SNP rs2004640 is the strongest association
ever reported with SLE (34). Another genetic variant (rs2280714) has been shown to regulate the
overall expression level of IRF5 (35). It has failed in analysis of association with lupus but is
linked with the risk allele of rs2004640 (36) .
Environmental Factors
Environmental factors can trigger autoimmune disease in susceptible hosts, as illustrated by
the initiation of disease by sun exposure in a subset of lupus patients. The wavelengths most
likely to induce lupus fall in the UV range: UVC (200-290 nm), UVB (290-320 nm), and UVA
19
(320-400 nm). UVB irradiation is mostly absorbed in the upper layers of the epidermis, whereas
the longer wavelength UVA is able to reach the dermis. UV exposure can induce apoptosis and
release of immune mediators, activating of resident dendritic cells and T cells (37). It has been
suggested that expression of certain self-antigens, such as Ro60/Ro52, on the surface of the
apoptotic cells may lead to antibody-mediated inflammatory responses that could play a role in
the pathogenesis of skin rashes in lupus (37, 38).
The importance of environmental factors is further illustrated by the induction of a murine
lupus syndrome by the hydrocarbon pristane (see Animal Models, below), which appears to act,
in part, through the induction of Type I interferon (IFNα and IFNβ) production (39). Many other
chemicals and drugs have been implicated as triggers of autoimmunity or autoimmune disease.
Procainamide, hydralazine, chlorpromazine, methyldopa, quinidine, minocycline, and
nitrofurantoin all have been associated with the induction of antinuclear antibodies and in cases
antineutrophil cytoplasmic antibodies (ANCA) as well as in the pathogenesis of “drug-induced
lupus”, most frequently manifested by serositis (inflammation of the pleura or pericardium) and
arthritis (40-42). Silica is recognized as a precipitating factor for scleroderma (43, 44), cigarette
smoke may aggravate rheumatoid arthritis (45), and trichloroethylene is thought to promote
lupus in animal models and possibly humans (46). Other chemical agents implicated in the
pathogenesis of autoimmunity include heavy metals such as mercury, gold, and cadmium,
pesticides, herbicides, hydrazine, and certain dyes (47) (48).
Infections also are implicated in the pathogenesis of autoimmune disease. The classic
example is rheumatic fever, which is thought to be a consequence of cross-reactivity or
“molecular mimicry” between antigens carried by certain strains of streptococci and
self-antigens of the heart. A variety of parasitic (e.g. schistosomiasis, Chagas disease) (49, 50),
20
bacterial (e.g. Helicobacter pylori, staphylococci, salmonella, Lyme borreliosis) (51, 52),
mycobacterial (e.g. tuberculosis, leprosy) (50), and viral (e.g. cytomegalovirus, Epstein-Barr
virus, hepatitis C, coxsackievirus, parvovirus B19) (53, 54) infections can be complicated by
autoimmunity. Proposed mechanisms include molecular mimicry and the chronic
over-production of cytokines, such as interferonα. Indeed, therapy with IFNα can itself lead to
the development of autoimmune diseases such as autoimmune thyroiditis and SLE.
Autoantibodies in SLE
The immunological hallmark of SLE is the production of autoantibodies. These
autoantibodies include antibodies against RNA-protein complexes (e.g. anti-Sm, RNP, Ro/SS-A,
and La/SS-B antibodies) and DNA-protein complexes (e.g. anti-double stranded DNA,
anti-histone, anti-chromatin antibodies). The target antigens are found mainly in the cell nucleus,
although in some cases (e.g. anti-ribosomal antibodies) they may be cytoplasmic.
Over 95% of the SLE patients are positive for antinuclear antibodies (ANA), however the
specificity of ANA test for SLE is only around 70% (55). Normal individuals have an increased
frequency of ANA production with aging. Patients with scleroderma, polymyositis, and
Sjogren’s syndrome usually are ANA positive as well (55).
Anti-dsDNA, anti-Sm, anti-ribosomal protein, and anti-RNA helicase A antibodies are
relatively specific for SLE (55). This makes specificities useful diagnostically. In some patients
the titer of anti-dsDNA antibodies increases with disease acitivity, making anti-dsDNA antibody
a useful marker for nomitoring lupus flares and the response to therapy (56).
Type III Hypersensitivity and SLE
Tissue damage in autoimmune diseases can occur through several mechanisms, which are
analogous to three of the classical types of hypersensitivity reactions: Type II (caused by
21
autoantibodies reactive with cell surface or matrix antigens), Type III (caused by immune
complexes), and Type IV (delayed type hypersensitivity, mediated by T cells).
Autoantibodies can cause disease by forming networks of autoantibodies bound to their
antigens (immune complexes). The antigen-antibody complexes can deposit in tissues, causing
inflammatory lesions. Studies of serum sickness led to the first description of an immune
complex disease (57). Serum sickness is manifested by fever, glomerulonephritis, vasculitis,
urticaria, and arthritis, appearing 7-21 days after primary immunization or 2-4 days after
secondary immunization with a foreign protein. Two consequences of immune complex
formation are complement fixation and binding to Fc or complement receptors on phagocytes.
Clearance is facilitated by the binding of immune complexes to C3b receptors (CR1) on
erythrocytes, which retain the complexes in the circulation until their removal by the
reticuloendothelial cells of the spleen or liver.
Immune complex formation is a normal process, which removes foreign antigens from the
circulation. Removal of immune complexes by phagocytes bearing Fc or complement receptors
prevents their deposition at other sites. The efficiency of uptake of immune complexes by either
Fc receptors or CR1 is proportional to the number of IgG molecules associated with the complex.
Immune complexes can activate either the classical or the alternative complement pathway.
The classical pathway plays a major role in maintaining immune complexes in a soluble form,
preventing their deposition in tissues. C3b bound to the solubilized immune complexes promotes
their clearance by the erythrocyte complement receptor CR1. If the rate of immune complex
formation exceeds the ability to clear these complexes via Fc receptors and CR1, the immune
complexes can deposit within tissues, leading to inflammation. This efficient immune complex
transport and removal by Fc and complement receptors can be overwhelmed, however, leading
22
to tissue deposition and immune complex disease. This situation may result from overproduction
of immune complexes, blockade of phagocytosis by the reticuloendothelial system, or
complement depletion resulting in inefficient solubilization of immune complexes.
SLE is the prototype of human immune complex disease. Tissue damage in lupus is mainly
caused by immune complexes containing autoantibodies to soluble antigens. Autoantibodies
containing immune complexes, especially anti-double stranded DNA antibodies, are selectively
enriched in the renal glomeruli of patients with lupus nephritis and are thought to play a critical
role in establishing the inflammatory response. Immune complex deposition in the kidney leads
to proliferative glomerulonephritis and effacement of the normal glomerular architecture. As is
the case in serum sickness, active lupus nephritis frequently is associated with
hypocomplementemia. In addition to the kidneys (glomeruli), immunoglobulin and complement
deposits are found in blood vessels (vasculitis), skin (rashes), nervous system, and other
locations. Preformed immune complexes may become trapped in the glomerular filter or immune
complexes may develop in situ as a consequence of the interaction of cationic antigens (e.g.
histones) with heparan sulfate glycosaminoglycan in the glomerular basement membrane.
Clinical Manifestations
As mentioned above, SLE is a complex systemic disease. At onset it might just affect one
organ system with additional symptoms in other organs appearing later on. The disease typically
follows a relapsing-remitting course. Systemic symptoms include fatigue, malaise, weight loss
and anorexia and are frequently prominent.
Almost all SLE patients experience arthralgias and myaligias and eventually develop
arthritis. The most common site of swelling joins includes proximal interphalangeal (PIP) and
metacarpophalangeal (MCP) of the hands, wrists, and knees. Arthritis in lupus is usually
non-erosive and symmetric which is different from rheumatoid arthritis.
23
The malar rash (referred as “butterfly rash” which is an erythematosus rash over the cheeks
and bridge of the nose) is a typical SLE cutaneous manifestation. A more diffused
maculopapular rash can appear on any part of the body and usually exacerbated by UV or sun
light exposure. These rashes can be reversed without scarring. Discoid rashes are different kinds
of lesions which are circular with an erythemotous rim, raised and scaly with follicular plugging
and telangiectasia. It usually results in depigmentation and scar. Vasculitic skin lesions are
common. These include subcutaneous nodules, ulcers, purpura, and infarcts of skin or digits.
Renal manifestations are seen in the majority of SLE patients. Although most SLE patients
have immune complex deposited in glomeruli, not all of them have clinical nephritis. Patients
can be asymptomatic, or may present with proteinuria and edema (nephritic syndrome) or with
hematuria, pyuria, and urinary casts (nephritic syndrome). Renal involvement can be severe, and
in fact renal failure is one of the major causes of death.
Any part of the nervous system including the brain, spinal cord, cranial, and peripheral
nerves can be involved in SLE. Involvement of thecentral nervous system usually occurs with
active disease although mild mental dysfunction is more common and can be seen in the absence
of disease activity. Nervous manifestations include seizures, psychosis, headaches, focal infarcts,
and many others. Depression and anxiety are frequent.
Some SLE patients exhibit vasculitis and thrombosis. It is believed that thrombosis is
associated with production of anti-phospholipids antibodies, which promote coagulation. Anemia,
thrombocytopenia, and leucopenia (or lymphopenia) is a common finding in SLE patients.
Pericardial pain is the most frequent symptom of cardiac lupus. Pleurisy and pleural effusions are
not rare; however the most common cause of pulmonary infiltrates in patients with SLE is
infection.
24
Measurement of Disease Activity
Measurement of disease activity in SLE is challenging because of the complexity of the
disease manifestations. Almost any organ may be affected. Clinical symptoms of SLE can mimic
the appearance of many other diseases. There is no single marker that adequately reflects disease
activity.
Several systems have been developed to assess of disease activity in SLE. The most
commonly used ones are the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI),
the British Isles Lupus Assessment Group (BILAG), the Systemic Lupus Activity Measures
(SLAM), the European Consensus Lupus Activity Measurement (ECLAM), and the SLE Index
Score (SIS) by National Institute of Health.
SLEDAI is the most commonly used disease activity measure. It was initially proposed in
1992 by Bombardier et al in Canada (58). It is an index that weights the importance of different
organ involved. There are 24 organ criteria, each weighted from 1 to 8 points. The sum of the
total score falls between 0 and105 with a higher score representing more active disease. It is
relatively easy to perform and is reliable and reproducible. However the SLEDAI system does
not take into account severity already exist or partial improvement of a particular manifestation.
The SLEDAI also does not account for subjective symptoms such as fatigue or myalgia.
The SLAM index was design to assess the severity of disease (59). 32 criteria are divided
into 11 organs systems and a numeric score (1-3) is given according to the severity of
manifestation of a particular organ, and the possible score is as much as 86. Although the SLAM
is considered a measurement of severity, it gives equal weight to mild and serious manifestation.
The BILAG was developed by Symmons et al in 1988 (60). It is a comprehensive scoring
system for assessing both current lupus disease activity and changes in that activity since the
patient was last seen. It is based on the intention of the physician’s intention to treat. The newest
25
version of the BILAG was released in 2004. There are eight systems: general, mucocutaneous,
neurological, musculoskeletal, cardiorespiratory, vasculitis, renal and haematological. A score is
calculated for each system depending on the clinical features present and whether they are
new=4, worse=3, the same=2 or improving=1 in the last 4 weeks compared to the previous
measures. Scores for eight different organ systems are calculated separately.
Current Treatment
Treatments for autoimmune disease are diverse and in recent years the options have
increased rapidly. The majority of systemic autoimmune diseases, such as SLE, are treated with
immunosuppressive medications. Immunosuppressive medications can be categorized by mode
of action.
Anti-inflammatory agents
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been used since the 1800s when
salicin was extracted from willow bark (1828) and sodium salicylate (1875) and aspirin (1899)
were synthesized. A large number of these drugs, which either selectively or non-selectively
inhibit the enzyme cyclooxygenase (COX, a synthetic enzyme for prostaglandins), are currently
in use for the treatment of inflammatory disease. Although most of their anti-inflammatory
properties derive from the inhibition of prostaglandin synthesis, at high doses there is inhibition
of the transcription factor NFκB, a key mediator of inflammatory cytokine production.
Corticosteroids have a more potent effect on NFκB and consequently a greater anti-inflammatory
effect.
The anti-inflammatory properties of cortisone were discovered by Hench in 1949 (61).
Corticosteroids are a mainstay of therapy for many systemic autoimmune diseases, including
SLE, rheumatoid arthritis, and inflammatory myopathies such as polymyositis. Corticosteroid
therapy also is used for the treatment of some of the more serious organ specific autoimmune
26
diseases, such as autoimmune hemolytic anemia, autoimmune thrombocytopenia, multiple
sclerosis, and Goodpasture’s disease. Corticosteroids reduce inflammation by multiple
mechanisms of action. One major action is enhanced transcription of an inhibitor of NFκB called
IκB. IκB dimerizes with NFκB, inhibiting the production of inflammatory cytokines mediated by
this transcriptional pathway (62). In addition, corticosteroids promote the differentiation of a
subset of anti-inflammatory macrophages that produce the cytokine IL-10 (63).
Antimalarials
Antimalarials have been used for the treatment of SLE and rheumatoid arthritis (RA) since
the early 1900s. The precise mechanism of action remains uncertain, but they have been shown
to inhibit cytokine (IL-1 and IL-6) production in vitro (64). The antimalarials pass freely through
cell membranes at neutral pH, but in acidic environments, such as endosomes, they become
protonated and can no longer diffuse freely. This leads to concentration of the drug within
endosomes and the collapse of endosomal pH gradients (65). It has been proposed that the
inhibition of endosomal acidification interferes with antigen processing or alternatively, that
there is an effect on the interaction of microbial substances such as unmethylated CpG DNA or
uridine-rich RNA with endosomal Toll-like receptors (TLR9 and TLR7/TLR8, respectively) (66).
In addition to SLE and RA, antimalarials are used in the treatment of juvenile rheumatoid
arthritis, Sjogren’s syndrome, and inflammatory myopathies.
Anti-cytokine agents
The development of TNF α inhibitors in the 1990s ushered in a new era of therapy of
autoimmune disease using “biologicals” capable of interfering with the interactions between
cytokines and their receptors. The initial clinical use of TNF inhibitors such as etanercept (a
soluble recombinant TNF receptor II linked to the Fc portion of human IgG1) (67), infliximab (a
chimeric human-mouse anti-TNFα monoclonal antibody) (68), and adalimumab (a fully
27
humanized monoclonal antibody against TNFα) (69) in RA demonstrated that although multiple
cytokines may be involved in disease pathogenesis (in RA, IL-1 and IL-6 in addition to TNFα),
inhibitors of a single cytokine pathway may show therapeutic efficacy. In addition to RA, TNFα
inhibitors are used for treating inflammatory bowel disease, psoriasis and psoriatic arthritis, and
are being tested in sarcoidosis, Wegener’s granulomatosis, pyoderma gangrenosum, SLE, and
Behcet’s disease. Usage of TNFα inhibitor in SLE is controversial since TNFα has been shown
to have inhibitory effect on IFN production.
Anti-TNF therapy is only the tip of the “biological iceberg”. Recombinant IL-1 receptor
antagonist (anakinra) has been approved for the treatment of RA and numerous other cytokine
antagonists are currently in clinical trials or under development.
Methotrexate
Methotrexate is a folic acid analog used extensively for the treatment of RA. It appears that
its ability to inhibit dihydrofolate reductase is not responsible for its efficacy in RA. Instead,
activity may be related to effects on aminoimidazole-carboxamide-ribotide-transformylase,
leading to the release of adenosine, a potent anti-inflammatory molecule that inhibits neutophil
adherence to fibroblasts and endothelial cells (70). Methotrexate inhibits IL-1 and increases the
expression of TH2 cytokines (e.g. IL-4), leading to decreased production of TH1 cytokines (e.g.
interferon γ) (71).
Anti-T Lymphocyte therapy
T cells play a key role in the pathogenesis of Type IV autoimmune reactions and also are
critical for generating the T cell-dependent autoantibodies mediating Type II and Type III
autoimmune diseases. Consequently, considerable effort has gone into the development of
therapeutic agents that selectively or non-selectively target T lymphocytes. Drugs that target
primarily T cells include cyclophosphamide, azathioprine, cyclosporin A, tacrolimus, and the
28
biological CTLA4-Ig. Cyclophosphamide is an alkylating agent that substitutes alkyl radicals
into DNA and RNA. The drug is inactive by itself, but is converted to an active metabolite
responsible for its immunosuppressive effects. It is used for the treatment of lupus nephritis and
other life-threatening complications of SLE (72).
Azathioprine is a purine analog that inhibits the synthesis of adenosine and guanine. Like
cyclophosphamide, it is converted to an active metabolite (6-mercaptopurine), which inhibits the
division of activated B and T cells. Azathioprine is used in the treatment of RA, SLE,
autoimmune hepatitis, inflammatory myopathy, vasculitis, and other autoimmune disorders (73).
Unlike cyclophosphamide and azathioprine, cyclosporin and tacrolimus (FK506) have
immunosuppressive effects that are highly selective for T cells. Both agents interfere with the
phosphatase calcineurin, ultimately leading to the inhibition of the activation of the transcription
factor NFAT (nuclear factor of activated T cells). Cyclosporin binds to the intracellular protein
cyclophilin and tacrolimus to a protein called FK binding protein. The cyclosporin-cyclophilin
and tacrolimus-FK binding protein complexes bind to calcineurin, preventing its activation by
intracellular calcium, preventing the activation of NFAT (74). Although used most frequently to
prevent transplant rejection, these agents have been shown to have activity in the treatment of
RA, SLE, and certain forms of vasculitis (75).
The CTLA4 (CD152) molecule is an inhibitory receptor expressed by activated T cells that
blocks the co-stimulatory interaction between CD80 or CD86 on the surface of
antigen-presenting cells and CD28 on T cells. It acts by binding CD80/CD86 with greater
affinity than CD28. CTLA4 is expressed late in T cell activation, and serves to turn off the
activated state. CTLA4-Ig (abatacept) is a recombinant chimera of CTLA4 and the Fc fragment
29
of IgG1. CTLA4-Ig/abatacept is used for the treatment of rheumatoid arthritis and is active in
mouse models of lupus (73). Clinical trials in SLE patients are in progress.
Anti-B Lymphocyte therapy
Rituximab is a cytotoxic chimeric human-mouse monoclonal antibody with a high affinity
for CD20, a pan-B cell surface antigen. It was developed originally for the treatment of B cell
lymphomas (76). The killing of B cells by rituximab is thought to depend on both the specific
recognition of B cells by this monoclonal antibody and natural killer (NK) cell-mediated
antibody-dependent cellular cytotoxicity (ADCC) of those cells. There is considerable evidence
that the interaction of B cell-bound monoclonal antibodies with NK cell CD16 (FcγRIIIA) is a
critical event leading to ADCC following treatment with rituximab (77). Rituximab has been
shown to have activity in a variety of autoimmune diseases associated with autoantibody
production, including RA, SLE, polymyositis/dermatomyositis, Sjogren’s syndrome, and
cryoglobulinemic vasculitis (78).
Intravenous immunoglobulin (IVIG)
IVIG is a preparation of human immunoglobulin pooled from thousands of healthy
individuals. It was originally developed for replacement therapy in humoral immunodeficiency
syndromes, but has more recently become an important therapeutic modality in severe
autoimmune disorders, such as thrombocytopenic purpura, autoimmune hemolytic anemia,
neuroimmunological diseases such as Guillain-Barre syndrome, SLE, certain forms of vasculitis,
and polymyositis/dermatomyositis. The mechanism of action remains unclear, but IVIG may
block the function of Fc receptors expressed by phagocytes of the reticuloendothelial system and
also induces FcγRIIB (inhibitory Fc receptor) expression on infiltrating macrophages in the
K/BxN model of RA (79). An additional mode of action may involve the presence of
anti-idiotypic antibodies that block the antigen combining sites of pathogenic antibodies (80).
30
The duration of action is limited by the metabolism of serum immunoglobulin, and generally
IVIG is regarded as a temporary measure that is followed by more definitive therapy.
Animal Models of SLE
Spontaneous SLE models have offered an appropriate starting point to investigate the
effects of environmental agents on genetic susceptibility and autoimmune disease progression.
The NZB/W model was the first murine model described for lupus nephritis. It is the F1
hybrid of the New Zealand Black mice which develop autoimmune hemolytic anemia and New
Zealand White mice which spontaneously develop mesangial glomerulonephritis (GN) late in
life. The F1 hybrid termed NZB/W mice has disease closely resembled human lupus, including
the production of autoantibodies (ANA, anti-chromatin, anti-dsDNA) and the deposition of the
immune complexes on the glomerular basement membrane, result in a severe glomerulonephritis.
Genetic analysis has revealed three major susceptibility loci on chromosomes 1, 4 and 7 related
with SLE (81).
MRL/lpr mice develop an autoimmune disorder characterized by marked
hypergammaglobulimenia, production of autoantibodies, and very impressive lymphadenopathy.
This results from an ETn retrotransposon insertion into the Fas gene which encodes a protein
important for apoptosis (82). The defective apoptosis leads to the massive CD3+ CD4− CD8− cell
proliferation. There also are some similarities with human cutaneous lupus including
microscopic changes and IgG deposits at the dermoepidermal junction (83). The inflammatory
response in the salivary glands also makes the MRL/lpr mice a model useful for studying
Sjogren’s syndrome (84).
Unlike other mouse model and human SLE, male, but not female BXSB mice develop
severe form of lupus. This strain was created by crossing male SB/Le mice and female C57BL/6J
mice. A mutant gene located on the BXSB Y chromosome, designated Yaa (Y
31
chromosome-linked autoimmune acceleration), is responsible for the acceleration of the disease
observed in male BXSB mice. Male BXSB mice exhibit lymph node enlargement, autoimmune
hemolytic anemia, hypergammaglobulinemia, splenomegaly, production of autoantibodies and
severe glomerulonephritis (85). Recently it was found that the phenotype of mice with the Yaa
mutation results from translocation of a 4-megabase portion of the X chromosome to the Y
chromosome, leading to an increase in the expression of several genes that are normally X linked,
including TLR7. It can be shown that the autoimmune defect is due to the extra copy of TLR7 in
these mice (86).
Intraperitoneal injection of pristane (2,6,10,14 tetramethylpentadecane, TMPD) can induce
lupus like syndrome in normal mice (87). Pristane-treated BALB/c and SJL mice develop
autoantibodies characteristic of SLE, including production of autoantibodies, a severe
glomerulonephritis with immune complex deposition, mesangial or mesangiocapillary
proliferation, and proteinuria. Noticeable production of anti Sm/RNP and anti Su antibody and
“interferon signature” is seen in TMPD treated mice which closely resembled human SLE (87).
Type I Interferon
Type I interferons (IFN-I), including multiple IFNα subtypes, IFNβ, IFNω, and IFNτ, have
many immune effects. IFN-I (IFNβ) was first identified in fibroblasts by Isaacs and Lindeman in
1959 and termed “viral interference factor” (88, 89). However, Type I IFNs also are produced by
leukocytes and other cells and it has been recognized that in addition to antiviral effects, IFN-I
has protean effects on immune function and cell survival. IFN-I induces MHC class II expression
on antigen presenting cells (APCs), promotes dendritic cell (DC) maturation, and the survival of
activated T cells and antigen-activated B cells. Additionally, IFN-I can either promote or inhibit
apoptosis (90).
32
All IFN-I species bind to a single receptor composed of two subunits, IFNAR1 and
IFNAR2 (91, 92). Interactions of Type I IFNs with the IFNAR cause reciprocal
transphosphorylation of the non-receptor tyrosine kinases Tyk2 and Jak1, leading to receptor
phosphorylation and phosphorylation of transcription factor Stat1 and Stat2. IFNAR1 interacts
with Tyk2 and IFNAR2 with Jak1, Stat1, and Stat2 (93). Phosphorylation of Stat1/Stat2 leads to
the activation of interferon regulatory factors (IRFs), such as IRF-9, to form the heterotrimeric
complex IFN-stimulated gene factor 3 (ISGF3). The ISGF3 then binds to upstream regulatory
consensus sequences of IFN-α/β-inducible genes (IFN-stimulated response elements, or ISRE)
and initiates transcription of a group of interferon inducible genes (ISGs) (94) (Fig.1-3).
Up to 100 ISGs have been identified. Among them, a group of secondary anti-viral
response genes, such as the 2’5’-oligoadenylate synthetase (OAS) family, RNase L, dsRNA
dependent protein kinase (PKR), and the GTPase Mx1 (protein product MxA) are best studied
(95). MxA is a large GTPase that interferes with viral transcription and replication (96). Mx1
gene expression is tightly regulated by IFN-I but not other cytokines, making it a good candidate
for estimating IFN-I level. Additionally it has been reported that the level of the MxA protein
(determined by ELISA) can be used as a very sensitive and selective bioassay for Type I IFN
levels (97).
Induction of IFN-I
IFN-I is a key mediator of host defense to viral and bacterial infection. At least three
pathways had been shown to induce the production of IFN-I. These pathways utilize distinctive
adapter proteins: MyD88, TRIF, IPS-1 and TBK-1 (98, 99).
Toll-like Receptors Dependent Pathways
TLRs are pattern reorganization receptors recognizing molecules that are shared by groups
of related pathogens (patterns). Thirteen TLRs have been identified in mammals (100), and these
33
receptors are the first line of host defense and play an important role in innate immunity. Each of
the TLRs responds to a specific ligand or ligands. TLR 1, 2, 4, 5, 6, and 11 are expressed on cell
surface, and detects lipids, lipoproteins or peptidoglycans shared by extracellular pathogens
including bacteria, fungi or protozoa. TLR 7, 8 are intracellular and can be activated by GU-rich
ssRNA. Intracellular TLR9 is activated by unmethylated DNA which is distinguishable from
mammalian methylated DNA. Whether TLR3 express on cell surface or intracellular is debatable,
and it binds to double stranded RNA and its analog Polyinosinic–polycytidylic acid (poly (I:C))
(PIC). TLR8/10 is expressed in humans, but not mice, and the ligand for TLR10 remains
unknown. TLRs 11, 12, and 13 are expressed in mice but not humans (100-102).
All TLRs express TLR–interleukin-1 receptor (TIR) domains which will undergo
dimerization and conformational changes upon activation. TIR domains can bind to several
specific adaptors, such as TRIF (TICAM1), TRAM (TICAM2), TIRAP (Mal), and MyD88.
Plasmacytoid dendritic cells, known as professional IFN-I producing cells, express TLR7
(both mouse and human)/TLR8 (human) and TLR9 but not TLR2, TLR3, TLR4, or TLR5 (103).
Unmethelated CpG DNA motif stimulates TLR9, and TLR9-induced IFN production is MyD88
dependent but not TRIF dependent. Lysosomal inhibitors such as chloroquine block TLR9
induced IFN-I production, indicating the reorganization of TLR9 ligand involvement of
endosome (104). In addition, single-stranded RNAs rich in GU or U sequences also stimulate
IFN-I production through interactions with TLR7 and/or TLR8. Imidazoquinolones, such as
imiquimod, also engage these receptors, stimulating IFN-I production. The activation of TLR7/8
is also dependent on MyD88 (Fig 1-1) (66, 105). Upon activation, TRL7/8/9 recruits and bind to
an adaptor protein myeloid differentiation primary response gene 88 (Myd88) after dimerization
of TIR. MyD88 in turn forms a complex with members of the IL-1 receptor–associated kinase
34
(IRAK) family (IRAK1 and IRAK4) and TRAF6, which lead to the activation of IκB kinases
(IKKs) IKKα and IKKβ. Phosphorylated IKKs degrade NF-κB inhibitor IκB, allowing nuclear
factor NF-κB to translocate into the nucleus (106, 107). Transcription factor IRF7 forms a
complex with activated MyD88, and then can be phosphorylated by IRAK1 though the MyD88
dependent pathway leads to the production of IL-6, TNFα, and IFN-I (107).
In addition to TLR7/8 and TLR9, activation by ligands of TLR3 and TLR4 can induce the
production of IFN-I as well. TRL3 uniquely signals through adaptor protein TRIF, and it is
independent of MyD88. TRIF interacts with TBK1 and IKKi which leads to the activation of
transcription factor IRF3 (108). TRIF also mediates NF-κB activation through non-TIR region
with PIP1 as well as TRAF6. TLR4 can signal through both MyD88 dependent and independent
pathway (109).
Activation of TLRs leads to initial production of IFNβ, which in turn binds to the Type I
IFN receptor (IFNAR), acting in an autocrine manner to induce the expression of a set of
secondary antiviral response genes, such as MxA/Mx1, Irf7 and Oas. Expression of these genes is
tightly regulated by IFN-I (94).
Toll-like Receptor Independent Pathway
It’s been increasingly clear that cytosolic RNA helicases, retinoic acid–inducible gene
(RIG-I) and melanoma differentiation–associated gene 5 (MDA5, also called Helicard) can
induce IFN-α/β induction independent from TLRs (110-112). RIG-I contains a extreme
C-terminal repression domain (RD), two caspase recruitment domains (CARD) in the N terminus.
In the absence of appropriate ligands, RIG-I is self locked in an autorepressed conformation
through binding of RD with CARD though linker region between the RNA helicase domains III
and IV (cis repression) (113, 114). Upon activation, RIG-I and MDA5 can bind to their RNA
35
ligand, and leads to a conformation change and dimerization of RIG-I, and become associated
with CARD to mitochondrial MAVS (also known as IPS-1, VISA or Cardif). This triggers
activation of the protein kinases TBK1 and IKKε, and in turn activates transcription factors IRF3
and IRF7, leading to IFN-α/β expression. It also activates NF-κB and AP-1 through IKKα/β/γ.
RIG-I and MDA5 are upregulated by IFN-α/β through a positive feedback mechanism (115,
116).
RIG-I recognizes cytosolic uncapped ssRNA with 5′-triphosphates which is generated by
some virus such as influenza, Sendaï virus, vesicular stomatitis virus (VSV), rabies virus, and
viruses of the Flaviviridae family, including hepatitis C virus (HCV)(117), whereas MDA5
might recognize viruses with protected 5' RNA ends, such as in picornaviruses (112, 118, 119).
Some studies suggested MDA5, but not TLR3, seems to be the dominant receptor for polyI:C in
vivo (120).
LGP2 is a RIG-I/MDA5 inhibitor which is a RNA helicase that is homologous to RIG-I
and MDA5, but lacks CARD domains. It acts in similar fashion as the RD domain of RIG-I that
blocks the RIG-I activity by binding with CARD. The RIG-I/MDA5 pathway is essential for
IFN-α/β production by fibroblasts, conventional splenic and thymic DCs and macrophages, but
not PDCs (113, 114, 121).
Crosstalk of Type I Interferon and Other Cytokines
IFN-α/β is expressed in low levels constitutively. Basal IFN-α/β expression is required for rapid
production of cytokines in response to viral infection; it also appears to be required for efficient
IFN-γ signaling (122). Not only are IFNAR-/- cells unresponsive to IFNα/β, but they are
defective in IFN-γ responses as well (123). Because these cells fail to induce dimerization of
STAT1, it is thought that IFNAR signaling induced by spontaneous low levels of IFN-α/β,
(which is not enough to activate downstream signaling events), provides docking sites on
36
tyrosine residues of IFNAR1 for more efficient STAT1 recruitment after stimulation through the
IFN-γ receptor (IFNGR). This cooperation is dependent on the interaction between the IFNAR1
chain and the IFNGR2 chains on caveolar membrane domains, which along with the increased
STAT1 recruitment leads to at least a ten fold increase of IFN-γ signaling (124). IFN-α/β
signaling also upregulates IFN-γ production by T cells favoring the induction and maintenance
of Th1 cells (124). Conversely, pretreatment of IFN-γ increases signaling through IFNAR by
upregulating STAT1 expression (124). Other studies suggest that upregulation of ISGF3 may
enhance IFN-I signaling (125). The effect of STAT1 depends on the activation of tyrosine kinase
Syk (126). Thus, type I and II IFNs reciprocally influence both the production of one another and
signaling through the respective receptors.
Type I IFNs can also influence the expression and function of a number of other cytokines.
Basal levels of IFN-α/β enhance IL-6 signaling by providing docking sites for STAT1 and
STAT3 on the phosphorylated IFNAR1 (127). In addition, IFN-I stimulates production of
anti-inflammatory cytokines, such as transforming growth factor β (TGF-β) (128), and IL-1
receptor antagonist (129).
Besides favoring the production Th1 cytokines, it also inhibits Th2 cytokines IL-4 and
IL-12 signaling by inducing SOCS-1 expression (130). A low concentration of IFN-α/β also
upregulates expression of the high-affinity IL-12Rβ2 subunit on CD4+ T cells and IL-15
expression by DCs, causing strong and selective stimulation of memory CD8+ T cells.(131)
IL-10 reduces IFN-I signaling by suppressing the phosphorylation of STAT1 favoring Th2
polarization (132). Similarly, reciprocal suppression of IFN-α/β and TNF-α production has been
reported. It has been proposed that the relative abundance of these two cytokines may influence
the type of autoimmune disease. For example, IFN-α/β predominantly leads to lupus and TNF-α
37
leads to RA (133). The successful treatment of RA with TNFα inhibitors and the fact that these
drugs can worsen SLE supports possibility (134, 135). However, the role of TNF-α in lupus is
controversial, since other studies have shown that TNF-α may also have a proinflammatory
effects in lupus. In fact, there are also reports of beneficial effects of TNF-α inhibitor in lupus
patients (136).
Type I Interferon is Involved In Pathogenesis of SLE
Several studies have suggested that IFN-I is involved in the pathogenesis of SLE. Patients treated
with IFNα for malignant carcinoid syndrome or hepatitis C infection sometimes develop
antinuclear antibodies or even overt SLE (137-139). In the course of IFNα therapy of carcinoid
tumors, as many as 22% of patients develop ANA, 8% develop anti-dsDNA antibodies, and
0.7% develops lupus (139). Serum levels of IFNα correlate with anti-dsDNA antibody levels and
disease activity in SLE and increased IFN-I expression is seen in lupus skin lesions (140).
Moreover, recent studies point to an IFN-I gene expression “signature” associated with SLE (141,
142). Our laboratory has reported that the intraperitoneal injection of pristane in BALB/c and
other non-autoimmune strains of mice results in the production of autoantibodies characteristic
of SLE, such as anti-Sm, anti-nRNP, anti-dsDNA, and anti-ribosomal P as well as immune
complex-mediated glomerulonephritis resembling lupus nephritis (87). We have found recently
that IFN-I inducible gene expression is greatly up-regulated in pristane treated mice (39).
Interestingly, TLR4 deficient mice are less susceptible to pristane induced lupus and TLR7
deficient mice are highly resistant, arguing that TLR signaling may play a role in the
pathogenesis of dysregulated IFN-I production in lupus (Lee et al, submitted).
38
Subsets of Dendritic Cells (DCs) Produce IFN-I
DCs are professional antigen presenting cells that serve as “nature’s adjuvant”. Immature DCs
reside in the periphery and after interacting with a maturation stimulus, such as TLR ligands or
TNFα, migrate to secondary lymphoid tissues where they undergo maturation (143, 144).
Maturation is accompanied by the down-regulation of phagocytic activity and a concomitant
upregulation of MHC class I and class II expression (145, 146). Thus, DCs mature from cells
specialized in “antigen sampling” to cells specialized for antigen presentation to naïve T cells
(147). DC precursors derived from bone marrow migrate to the periphery where they sample
antigen. Once they capture antigen and receive an activation signal, they migrate to secondary
lymphoid organs. Immature DCs express low levels of MHC I and II molecules, the
co-stimulatory molecules CD80 and CD86, and adhesion molecules important for their
interactions with T cells. They also express certain chemokine receptors, such as CCR1, CCR2,
CCR5, CCR6, CXCR1, and CXCR2, which mediate their migration into sites of inflammation
where the ligands for these receptors, such as MIP-1 and CCL5 (RANTES), are expressed.
Human blood contains two major subsets of DC: CD11c (-) CD123 (+) plasmacytoid dendritic
cells (PDCs) [also BDCA-2 (CD302) and BDCA-4 (CD304) positive] and CD11c (+) CD123 (-)
myeloid dendritic cells (MDCs) [also BDCA-1 (CD301) positive]. They lack lineage markers of
T cells (CD3), B cells (CD19), monocytes (CD14), and NK cells (CD56) (147, 148). Some
studies have shown that CD14+ monocytes can serve as MDC precursors, differentiating into
MDC under the influence of GM-CSF and IL-4 (149). Monocytes also differentiate into DC
when incubated with GM-CSF and IL-3, or SLE serum, and this is thought to be due to IFN-I
(150, 151).
39
Although most, if not all, nucleated cells are capable of producing IFN-I, the existence of a
minor population of cells in the peripheral blood that produces large amounts of IFN-I was
recognized about 20 years ago (152). These “interferon producing cells” (IPCs) have only
recently been shown to be PDCs (153). In response to viral infection or oligonucleotides
containing unmethylated CpG motifs, PDCs produce ~1000-fold more IFN-I than most other cell
types (153). However, MDCs also can produce large amounts of IFN-I in response to
intracellular viral infections (154-156). MDCs produce IFN-I following electroporation or
lipofection of the double-stranded (ds) RNA analog PIC in amounts comparable to that of PDCs
stimulated with CpG DNA (154). Unlike PDCs, which are activated following endosomal uptake
of bacterial DNA or ssRNA in a chloroquine-dependent manner, MDCs are activated following
cytoplasmic (non-endosomal) recognition of dsRNA mediated by the cytosolic enzyme protein
kinase R (PKR) and/or DAI (154, 157).
DCs also express different subsets of surface receptors mediating innate immunity.
Specifically, PDCs express large amounts of TLR7 and TLR9, whereas MDCs express TLR3,
TLR4, and TLR8 (147). Thus, PDCs are stimulated preferentially by viral GU-rich
single-stranded RNA and unmethylated CpG DNA, whereas MDCs are stimulated preferentially
by dsRNA and LPS. In view of the correlation between TLR expression and responsiveness of
different types of DCs to microbial stimuli, the differential expression of TLRs is likely to play a
significant role in the regulation of IFN-I production by DCs (147). There is evidence that
signaling from TLRs can vary depending on the cell type or maturation state (144).
Once activated, immature DCs down-regulate CCR1, CCR2, CCR5, CCR6, CXCR1, and
CXCR2, and up-regulate CCR7, a receptor for CCL21 (SLC) and CCR19 (ELC) (147). SLC is
produced by high endothelial venules in the secondary lymphoid organs and ELC is expressed in
40
T cell zones of the secondary lymphoid tissues. Thus, mature MDCs and PDCs migrate to SLC
and ELC, which is mediated in part by increased expression of CCR7. Strikingly, although
immature PDCs express high levels of CCR7, a maturation signal is required to couple CCR7 to
cell migration (148). MDCs respond to CCL2/MCP-1, CCL20/MIP-3α, whereas PDCs do not
respond to these chemokines, although they express the corresponding chemokine receptor (158).
Thus, not only must the appropriate receptor be expressed in order for DC migration to take
place, but the signal must be coupled to cell migration by mechanisms that remain poorly
defined.
41
Figure1-1. Toll like receptor signaling pathway and induction of type I interferon. Engagement
of TLR3 by dsRNA, TLR7/8 by ssRNA or TLR9 by CpG DNA in endosomes and of TLR4 by LPS at the cell surface mediates IFN-α/β production. TLR3 utilizes a TRIF-dependent pathway, whereas TLR7/8 induces a MyD88-dependent pathway. TLR4 can signal through both TRIF and MyD88 pathways. The activation of adaptor protein TRIF and MyD88 can in turn activate transcription factor NFκB and IRF3, which induces the production of IL-6, TNFα and type I interferon.
TLR9 TLR 7/8
TLR4
TLR3MyD88
TRIF
IL-6 TNFα IFNα/β
IRF3
LPS
dsRNA CpG ssRNA
NFκB
Cell Membrane
Endosome
42
Figure 1-2. Production of IFN-I induced by TLR independent pathway. Engagement of RNA with the cytosolic RNA helicases RIG-I and MDA5 induces activation of RIG-I/MDA5, and allow CARD disassociate with RD, and CARD in turn interacts mitochondrial adaptor MAVS (IPS-1). MAVS then activates NFκB through IKKα/β/γ with cooperation of RIP and FADD. It also induces IRF3 phosphorylation through TBK-1/IKKε. In addition, MAVS also activates MAPK and AP-1. Translocation of these transcription factors to the nucleus then induce Ifnb1 transcription.
RIG-I MDA-5 MDA-5
RIG-I CARD
CARD
CARD CARD
CARD dsRNA
MAVS (IPS-1)
Mitochondrion
TBK-1
IRF3NFκB AP-1
Production of IFN-I
FADDRIPIKKi
IKKκ
MAPKMAPK
MAPK
Cell Membrane
43
Figure 1-3. Type I interferon signaling. IFN-I bind to heterogeneous interferon receptor composed by IFNAR1 and IFNAR2, which induces conformation change of IFNAR and recruits adaptor protein Jak1 and Tyk2. Phosphorylation of Jak1 and Tyk2 in turn recruits STAT1/2. IRF9 phosphorylates STAT1 and STAT2 and form a complex with these molecules which translocates to nucleus and bind to RSRE9, inducing the transcription of downstream ISGs including Mx1, OAS etc.
IFNAR1
Jak1
STAT2STAT1
Cell Membrane IFNAR2
IFNα/β
TYK2
STAT2STAT1
IRF9
IRF9
ISRE9
Cytoplasm
Nucleus ISGs
(Mx1, OAS)
P P
P P
44
CHAPTER 2 MATERIAL AND METHOD
Subjects
Subjects seen at the University of Florida Center for Autoimmune Disease were classified
as having SLE, scleroderma, Sjogren’s syndrome, polymyositis/dermatomyositis, rheumatoid
arthritis, mixed connective tissue disease, or undifferentiated connective tissue disease using
established criteria (2). Patient demographics are summarized in Table 2-1. Disease activity was
assessed by SLEDAI and renal disease was scored as described (58). Subjects were questioned
about viral or bacterial infections within 2 weeks and medication use. Self-reported ethnicity of
each subject’s grandparents was recorded along with the subject’s birth date. These studies were
approved by the University of Florida Institutional Review Board.
Reagent
Polyinosinic-polycytidylic acid [poly (I:C)] and LPS (Salmonella minnesota Re 595) were
from Sigma-Aldrich (St. Louis, MO). CpG oligodeoxyribonucleotide (ODN #2006,) was from
Coley Pharmaceutical Group (Wellesley, Massachusetts) and CpG oligodeoxyribonucleotide
(ODN #2216, 2395, 2336) are from Invivogen (Carlsbad, CA). Serum-free lymphocyte medium
AIM-V and LMG-3 was from Invitrogen Life Technologies (Carlsbad, California). Antibodies
against Lin-FITC (a cocktail of anti-CD3, -CD14, -CD16, -CD19, -CD20, and -CD56),
CD123-PE, CD11c-APC, HLA-DR-PerCP were from BD-Biosciences (San Diego, CA).
anti-CD14-FITC, anti-CD71-PE, anti-CD36-APC, anti-CD33-APC, anti-CD45RA-PB,
anti-CD163-biotin, anti-CD62L-AF750, anti-CD64-FITC, anti-CD16-APC-Cy7 antibodies are
from eBioscience (San Diago, CA), anti-CD117-APC antibody is from Biolegend (San Diego
CA), anti-BDCA-2- FITC, anti-BDCA-4-APC, anti-CD123-APC antibodies are from Miltenyi
Auburn CA)
45
RNA Preparation
Peripheral blood from SLE patients, patients with other autoimmune disease, and healthy
controls was collected into PAXgene blood RNA tubes and total RNA was isolated using the
PAXgene RNA kit (Qiagen, Valencia, CA). In other experiments, cultured or fragmented
peripheral blood cells were lysied in Trizol reagent (Invitrogen) and RNA were isolated as
manufacture’s instruction. RNA (1 μg) was treated with DNase I (Invitrogen) to remove
genomic DNA and reverse transcribed to cDNA using Superscript First-Strand Synthesis System
(Invitrogen) for RT-PCR.
Real-Time PCR
Gene expression was determined by real-time PCR using SYBR green (Applied Biosystems,
Foster City, CA). Primers used in these experiments are listed in Table 2-2.
One μL of cDNA was added to a reaction mixture containing 3 mM MgCl2, 1 mM dNTP
mixture, 0.025 U of Amplitaq Gold, SYBR Green dye (Applied Biosystems), optimized
concentrations of specific forward and reverse primers, and DEPC-treated water in a final
volume of 20 μl. Amplification conditions were as follows: 95◦C (10 min), followed by 45 cycles
of 94◦ C (15 sec), 60◦ C (25 sec), 72◦ C (25 sec), with a final extension at 72◦ C for 8 minutes.
Transcripts were quantified using the comparative (2 –ΔΔCt) method. In some experiments, Mx1
and β-actin expression levels were determined by real-time PCR with LUX primers and platinum
PCR supermix kit (Invitrogen). Amplification conditions were as follows: 50◦ C (2 min), 95◦ C (2
min), followed by 45 cycles of 95◦ C (15 sec), 55◦ C (30 sec), 72◦ C (30 sec), and a final extension
at 72◦ C for 8 minutes.
46
Effect of Corticosteroids and Antimalarials on Cytokine Production
PBMCs from healthy controls were prepared within 2 hours of collection from heparinized
blood by Ficoll-Hypaque density gradient centrifugation. They were cultured for 6 hours at
1.5-2.5 ×106 /ml in the presence or absence of dexamethasone (0.1 or 10 μg/ml) or
hydroxychloroquine (0.1 or 10 μg/ml) or were pre-incubated with dexamethasone or
hydroxychloroquine for 1 hour before stimulation with LPS (100 ng/ml), poly (I:C) (50 μg/ml),
loxoribine (50μg/ml) or CpG ODN #2006 (10 μg/ml) for 6-hours. RNA was extracted using
TRIzol, and gene expression was measured as above.
In other experiments, PBMCs were cultured with 0.01, 0.1 or 1 μg/ml of dexamethasone for
6, 16, 48 hours. 50μl of cells were used in the following flow cytometry. The rest of cells were
lysed in Trizol and culture medium was collect for ELISA.
Serological Testing
ANA were tested by immunofluorescence using HeLa cells as substrate (serum dilution
1:160) and Alexa 488-conjugated goat anti-human γ + light chain antibodies (1:50 dilution,
Molecular Probes, Eugene, OR). Cells were mounted in Vectashield containing DAPI (Vector
Laboratories, Burlingame, CA) to stain DNA. Anti-nRNP, -Sm, -Ro (SS-A), and -La (SS-B)
autoantibodies were detected by immunoprecipitation of [35S] labeled K562 (human
erythroleukemia cell) extract as described (159). Anti-dsDNA, anti-RNP, -Sm, -Ro (SS-A), and
-La (SS-B) autoantibodies antibodies were quantified by ELISA.
Flow Cytometry
Heparinized blood was processed within 4 hours and mononuclear cells were isolated on
Ficoll-Paque Plus (Amersham Biosciences, Piscataway, NJ), washed, and resuspended in PBS +
3% fetal bovine serum. The equivalent of 0.1 ml of starting whole blood was stained with
saturating amounts of antibodies (BD Biosciences). For dendritic cell characterization, this
47
consisted of Lin-FITC (a cocktail of anti-CD3, -CD14, -CD16, -CD19, -CD20, and -CD56),
anti-CD123-PE, anti-HLA-DR-PerCP, and anti-CD11c-APC. Following incubation for 30 min at
4oC in the dark, the cells were rinsed in PBS and fixed in 2% paraformaldehyde. Samples were
run on a four-color FACSCalibur flow cytometer (BD Biosciences). At least 100,000 events
were acquired per sample. In parallel, the red blood cells from 100 μl of whole blood was lysed
(BD FACS Lysing Solution), fixed in 2% paraformaldehyde, and used to obtain a total white
blood cell count and differential (lymphocytes, monocytes, and neutrophils) by forward and side
scatter characteristics. The absolute monocyte count was calculated. These results showed
excellent correlation with results from the clinical laboratory. Data were analyzed with FCS
Express V2 (DeNovo Software, Thornhill, Ontario). Size gating was used to eliminate any
residual neutrophils or RBCs, which were typically less than 15%. MDCs and PDCs were
defined as Lin-, HLA-, DR+ cells that were either CD11c-, CD123+, (PDCs) or CD11c+, CD123-
(MDCs). Absolute numbers of dendritic cells and monocytes were calculated as a percentage of
the complete blood cell count.
Karyotype Analysis
Metaphase chromosome spreads were prepared from PHA-stimulated PBMC cultures
following standard cytogenetic procedures. Chromosome preparations were banded utilizing a
standard GTG-banding procedure. Metaphase imaging and karyotype production were facilitated
by computer assisted methods (CytoVision software, Applied Imaging). Twenty metaphase cells
were analyzed for each family member studied.
Cell Enrichment
Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque density
gradient centrifugation. Monocytes, B cells and plasmacytoid dendritic cells (PDCs) were
positively selected by anti-CD14, anti-CD19 or anti-CD304 (BDCA4) labeled magnetic
48
microbeads, respectively. The purity of the positively selected cell fractions was typically 90%
or greater.
Flow Cytometric Cell Sorting
PBMCs were isolated on Ficoll-Paque Plus (Amersham Biosciences, Piscataway, NJ),
washed and resuspended in 1ml of RPMI1640 with 10% fetal bovine serum. Cells were stained
with anti-CD14-FITC (BD science) and anti-CD71-PE (ebioscience). CD14+CD71+ and
CD14+CD71- cells were sorted with FACS Vantage SE Turbosort (BDbioscience).
Electron Microscopy
Sorted CD14+CD71+ or CD14+CD71- cells were fixed in 2% paraformaldehyde and 1%
glutaraldehyde in Tyrode buffer over night. After washing with tyrode buffer, fixed cells were
washed with 0.1 M Na cacodylate pH=7.4 for 15 min, stained with 2% osmic acid in 0.1 M Na
cacodylate buffer at 4 for 1 hour. TAAB mixture consists TAAB: ℃ Dodecenylsuccinic
anhydride: Methylnadic anhydride (Sigma-Aldrich, Inc, St. Louis, MO) 48:19:33 were prepared
in advance. Stained cells were dehydrated in graded concentration of ethanol, and immersed in
1:1 TAAB: ethanol for 1 hour, 2:1 TAAB: ethanol overnight and 100% TAAB for 2 hours, and
100% TAAB with 2,4,6-Tris(dimethylaminomethyl)phenol (dmp-30) (Sigma) for 1.5 hours
before embedded in TAAB with dmp-30 and polymerized at 60 overnight℃ . Blockes were
trimmed, sectioned to 800-900 nm, placed onto 150 mesh copper grids and allowed to air dry for
30 minutes. Sections were floated in filtered alcoholic 8% uranyl acetate for 4 min and washed
with 50% ethanol and allowed to dry for 30 min. Grids were stained with one drop of lead
citrate/grid for 60 seconds and washed with distilled water and before drying. Sections were
viewed with Zeiss EM10 electron microscope (Carl Zeiss, Inc., Peabody MA) and images were
captured by Finger Lakes digital camera (Finger Lakes Instrumentation, LLC., Lima, NY)
49
Statistical Method
All tests were done with Prism 4.03 (GraphPad software). Difference among categories
was tested with one way ANOVA or student t test. Significance was reached when P<0.05
50
Table 2-1. Patient demographics SLE Healthy Controls Other1 Number of subjects (total observations)
88 (134)
57 (69)
82 (119)
Percentage of female 94.3 83.93 85.37 Mean age (range) 36.7 (12-68) 40.05 (21-75) 47.56 (20-73) Race Black 36.77 37.50 19.75 White 41.40 44.64 70.07 Other 21.83 17.86 6.17 Percentage of taking corticosteroids 64.18 -- 33.6 Mean corticosteroid dose (range)
16.30 (2-60 mg/day)
-- 18.04 (2.5-60 mg/day)
Percentage of taking antimalarials 65.67 -- 31.93 Percentage of taking cytotoxics2 34.33 -- 27.73 1 Includes Sjogren’s syndrome (13), polymyositis/dermatomyositis (6), scleroderma (9), undifferentiated connective tissue disease (5), rheumatoid arthritis (2), positive ANA (27), and miscellaneous diagnoses (20) 2 methotrexate, azathioprine, cyclophosphamide, or mofetil mycophenolate
51
Table 2-2. Primers for real time PCR Gene mRNA start Length GC% primer Beta actin NM_001101 950 20 55 tccctggagaagagctacga
969 20 55 agcactgtgttggcgtacag CXCL 10 (IP10) NM_001565 45 20 55 ctccagtctcagcaccatga
236 20 40 caaaattggcttgcaggaat IL-6 NM_000600 306 20 45 aaagaggcactggcagaaaa
487 20 55 gctctggcttgttcctcact IL-1 beta NM_666576 226 20 55 ggcatccagctacgaatctc
419 20 45 tcgttatcccatgtgtcgaa IL-1R II NM_004633 868 20 45 tgaaggccagcaatacaaca
1022 20 50 cggttcccagaaacacctta CCL5 NM_2985 92 20 50 cgctgtcatcctcattgcta
241 20 55 gagcacttgccactggtgta ISG15 NM_5101 143 20 55 tgtcggtgtcagagctgaag
333 20 55 caccaggatgctcagaggtt SOCS1 NM_003745 821 20 45 actgggatgccgtgttattt
1068 20 60 ggtaggaggtgcgagttcag TRIF NM_014261 330 20 60 caggagcctgaggagatgag
557 20 50 tttgaccggctccagaatag TRAF6 NM_145803 641 20 50 tccagccagtctgaaagtga
658 20 45 tggacatttgtgacctgcat MyD88 NM_002468 615 20 55 gaggaggctgagaagccttt
627 20 55 gcggtcagacacacacaact IRAK4 NM_016123 487 20 60 gccacctgactcctcaagtc
705 20 45 accattgctgcaagcttctt IRAK-M NM_007199 216 20 50 ctggctggatgttcgtcata
462 20 50 ggtgacattggctgtttcct Mx1 NM_002462 1142 20 55 acctcgtgttccacctgaag
1161 20 60 gtgtgatgagctcgcgtggta Flt3l NM_001459 112 20 50 tggagcccaacaacctatct
271 20 55 ccacggtgactgggtaatct IL-8 NM_000584 281 20 45 ctgcgccaacacagaaatta
512 20 50 tctggcaaccctacaacaga GM-CSF NM_000758 196 20 50 acttcctgtgcaacccagat
215 20 55 cttggtccctccaagatgac CXCL1 NM_001511 325 20 50 gaaagcttgcctcaatcctg
425 20 55 tgagcttcctcctcccttct CXCL2 NM_002089 306 20 50 ctcaagaatgggcagaaagc
435 20 50 aggaacagccaccaataagc CCL3 NM_002983.1 136 20 50 gcaaccagttctctgcatca
250 20 50 tggctgctcgtctcaaagta CCL5 NM_002985.2 164 20 50 ctgctgctttgcctacattg
287 20 50 acacacttggcggttctttc Ly6E NM_002346.1 197 20 50 tgatgtgcttctcctgcttg
398 20 45 atggaagccacaccaacatt MCP-1 NM_002982.3 94 20 55 tctgtgcctgctgctcatag
296 20 50 agatctccttggccacaatg IFNA1 NM_024013 438 20 50 ggagtttgatggcaaccagt
450 20 55 ctctcctcctgcatcacaca
52
Table 2-2. Continued TLR7 NM_016562 245 20 50 atcttggcacctctcatgct
257 20 55 gagtgacatcacagggcaga TLR9 NM_017442.2 547 20 55 gaagggacctcgagtgtgaa
748 20 60 ctggagctcacagggtagga IL-10 NM_000572 346 20 55 cccaagctgagaaccaagac
452 20 50 gggaagaaatcgatgacagc TGF b NM_000660 1392 20 50 caacaattcctggcgatacc
1584 20 50 gaacccgttgatgtccactt
53
CHAPTER 3 RESULTS AND DISCUSSION: ASSOCIATION OF ANTI-NUCLEOPROTEIN
AUTOANTIBODIES WITH TYPE I INTERFERON PRODUCTION IN SYSTEMIC LUPUS ERYTHEMATOSUS
Introduction
Most SLE patients produce autoantibodies against ribonucleoproteins, such as the Sm/RNP,
Ro (SS-A), and La (SS-B) antigens, or deoxyribonucleoproteins such as chromatin (160-162),
often to the exclusion of other cellular antigens. It is unclear why nucleoproteins are selectively
targeted for an autoimmune response in this disease. We have reported that the RNA components
of the Sm/RNP and Ro60 antigens, U1 RNA and Y1-5 RNAs, respectively, stimulate the
production of Type I interferons (IFN-I) and induce dendritic cell maturation, hallmarks of the
adjuvant effect (163).
The Type I interferons IFNα and IFNβ promote dendritic cell maturation, primary and
memory B cell responses, and are powerful adjuvants (164). Precursors of plasmacytoid
dendritic cells (PDCs), the primary IFN-I producing cells, represent ~0.5% of peripheral blood
mononuclear cells (PBMCs) (165, 166) and express IL-3 receptors (CD123) and MHC class II,
but not CD11c or other lineage (lin) markers (165, 167). Myeloid dendritic cell (MDC)
precursors (CD11c+, CD123-, class II+, lin-) also circulate (168) and undergo maturation in
response to IFN-I (169, 170). The maturation state of MDCs is a key determinant of whether
antigen presentation is tolerogenic as in the case of self-antigens presented by immature MDCs
or immunogenic, as in the case of foreign antigens presented by MDCs activated by Toll-like
receptor (TLR) ligands (171). Double-stranded (ds) RNA and certain single-stranded (ss) RNAs
are ligands for TLR3 and TLR7/8, respectively (66, 105, 172, 173) and cellular DNA sequences
have recently been shown to activate TLR9 (174). Engagement of Toll-like receptors by these
nucleic acid ligands stimulates IFN-I production through MyD88-dependent and
54
MyD88-independent pathways. Since nucleoproteins carry endogenous TLR ligands in the form
of their associated nucleic acids, it was of interest to see if autoantibodies against the Sm/RNP,
Ro (SSA), and chromatin (dsDNA) autoantigens are associated with high levels of IFN-I.
Results
Increased IFN-I Production and Low Peripheral Blood Dendritic Cells in SLE
As total IFN-I consists of 14 IFNα isoforms plus IFNβ, the specificity of ELISA depends on
the specificities of the detection antibodies (175). Measurement of the expression of IFN-I
inducible genes such as Mx1 by real-time PCR permits an estimate of total IFN-I production and
has been shown previously to correlate with IFN-I levels (176). We first examined the stability
of mRNA from PBMCs to verify that degradation did not occur during processing. Mx1 and
β-actin mRNA from blood collected in PAXGene tubes was stable for 8 hours at room
temperature and was largely intact after 5 days at room temperature (Fig. 3-1A). When processed
immediately, Mx1 expression levels were similar in blood collected in heparinized tubes vs.
PAXGene tubes (Fig. 3-1B). However, when blood collected in heparinized tubes was incubated
at room temperature, there was a time-dependent increase in Mx1 expression suggesting that the
PBMCs became activated after blood collection (Fig. 3-1B). The increase was nearly 3-fold at 3
hours of incubation. For this reason, gene expression in this study was measured using blood
collected in PAXGene tubes.
Mx1 expression was increased up to 7000-fold in a subset of SLE patients in comparison
with healthy controls and patients with other autoimmune conditions (P < 0.0001, ANOVA;
post-test comparison data shown in the figure) (Fig. 3-1C). Expression was higher than the mean
of healthy controls in 22 % of patients and higher than the mean + 2 S.D. (= 642 units) in 22% of
SLE patients. Expression of a second IFN-I regulated gene, OAS, correlated well with Mx1 (P <
55
0.0001 Pearson’s correlation test) (Fig. 3-1D). In addition, the Mx1 expression in PBMCs
correlated well with levels of mRNA for the Type I interferon IFNβ (R2 = 0.68, P < 0.0001
Pearson’s correlation test) (Fig. 3-1E). In other experiments, we found that Mx1 expression was
induced in K562 cells by IFN-I but not by IL-6, TNFα, or IFNγ (data not shown), verifying its
specificity for IFN-I.
We next examined the numbers of circulating PDC precursors, the major IFN-I producing
cell type. Peripheral blood PDC counts (CD123+, CD11c-, lin- cells) were greatly reduced in SLE
patients (n = 126) vs. healthy controls (n = 66) as were the MDC counts (CD123-, CD11c+, lin-
cells) (P < 0.0001 for both PDCs and MDCs, unpaired t-test) (Fig. 3-2A-B). About half (52%) of
lupus patients had low PDC and MDC counts defined as values lower than 95% of controls
(abnormal < 0.66 PDCs/μl or < 1.1 MDCs/μl) whereas 20% had values lower than the mean of
healthy controls. PDC and MDC counts correlated highly with one another (P < 0.0001,
Pearson’s correlation test) (Fig. 3-2C). In contrast, monocyte counts were comparable in SLE vs.
healthy controls (Fig. 3-2D). Taken together, these data indicate that SLE is associated with high
IFN-I production and low numbers of circulating PDC and MDC precursors.
IFN-I and PDC/MDC Abnormalities are not Explained by Medication Use
The high IFN-I (Mx1) expression and the low numbers of circulating PDCs and MDCs
could be a consequence of the disease itself or of therapy. The two most common medications
used in our lupus cohort were antimalarials (mainly hydroxychloroquine) and corticosteroids
(mainly prednisone). In comparison with patients not receiving antimalarials, those receiving
antimalarials did not have higher or lower PDC/MDC counts or Mx1 expression (Fig. 3-3A).
Overall comparison of SLE patients and controls also did not reveal differences attributable to
corticosteroid treatment, but when the SLE patients were considered separately from controls,
56
both absolute PDC (P = 0.04, unpaired t-test) and MDC (P = 0.01, unpaired t-test) counts were
lower in steroid-treated patients than in patients not receiving steroids, suggesting that
corticosteroids could have a modest effect (Fig. 3-3B). There also was a trend toward higher
Mx1 expression in steroid-treated patients (P = 0.06, unpaired t-test). Thus, although the low
PDC/MDC counts were not primarily due to corticosteroid therapy, steroids may have a small
effect or else the patients with low PDC/MDC counts may be more likely to receive steroids.
To further explore the effects of pharmacotherapy, PBMCs from healthy controls were
pre-incubated for 1 hour with dexamethasone or chloroquine before adding LPS, poly (I:C), or
CpG oligodeoxyribonucleotide. As shown in Fig. 3-3C, dexamethasone (0.1-10 μg/ml) had no
effect on either basal (unstimulated) or TLR ligand-stimulated Mx1 expression. However, as
expected (177) expression of IL-6 (Fig. 3-3C) and TNFα (not shown) mRNA decreased in a
dose-dependent manner, suggesting that dexamethasone inhibited TLR4 signaling via the
MyD88/NFκB dependent pathway more than signaling via the TRIF/IRF-3 pathway. These in
vitro results are consistent with the in vivo data (Fig. 3-3B). Chloroquine (0.1-10 μM) also had
no effect on LPS- or poly (I:C)-stimulated IFN-I (Mx1) or IL-6 production (Fig. 3-3D). However,
IFN-I and IL-6 production stimulated by CpG DNA (TLR9 ligand) were inhibited in a
dose-dependent manner as expected.(104)
Increased Mx1 and Low PDC/MDC Counts Are Associated With a Subset of Autoantibodies
In view of the association between exogenous IFNα administration and antinuclear
antibodies, we investigated whether increased endogenous IFN-I production and low PDC/MDC
counts were associated with autoantibody production. SLE patients who were anti-Sm/nRNP
autoantibody positive had higher Mx1 expression than those who were negative; similarly,
patients with autoantibodies against the Ro (SSA) or La (SSB) ribonucleoproteins had higher
57
IFN-I levels than those without (P = 0.0025, ANOVA; post-test comparison data shown in the
figure) (Fig.3-4A). When Mx1 expression was sorted and the SLE patients were divided into
four equal groups (group 1 = lowest Mx1, group 4 = highest), the number of patients with
anti-Sm/RNP/Ro/La autoantibodies increased progressively, further suggesting that higher Mx1
expression was associated with a higher likelihood of having autoantibodies against
ribonucleoproteins (not shown). Autoantibodies to dsDNA also were associated with high Mx1
(P = 0.02, unpaired t-test) (Fig. 3-4B). In striking contrast, Mx1 expression was negatively
associated with anti-phospholipid antibodies (APLA, P < 0.0001, unpaired t-test) (Fig. 3-4C),
suggesting that increased IFN-I production was characteristic only of the subset of patients
producing autoantibodies against RNA-protein (anti-Sm, -RNP, -Ro/SSA, or -La/SSB) or
DNA-protein (anti-dsDNA) antigens.
Similarly, anti-dsDNA, -nRNP and -Sm antibodies were associated with low circulating
MDC counts (P = 0.02 and P = 0.03, respectively, unpaired t-test) whereas anti-phospholipid
antibodies were not (P = 0.16) (Fig. 3-5). Strikingly, anti-nRNP/Sm autoantibodies (but not
anti-dsDNA or anti-phospholipid antibodies) also were associated with low PDC counts (P <
0.0001). These data suggest that the association of autoantibody production with increased IFN-I
expression and decreased circulating PDC/MDC precursors is selective for ribonucleoprotein
(Sm, RNP, Ro60, La) and deoxyribonucleoprotein (dsDNA) antigens.
Relationship of Mx1 Expression and Dendritic Cell Counts to Disease Activity
Clinical significance of the abnormal IFN-I production and low PDC/MDC counts was
evaluated using the number of ACR SLE criteria met (a measure of extent of disease) and the
presence or absence of renal involvement. There was no apparent relationship between Mx1
expression and number of ACR criteria met or the presence of renal disease (Fig. 3-6). In
contrast, low PDC/MDC counts were strongly associated with more extensive disease and renal
58
involvement (Fig. 3-6). Thus, the disappearance of PDCs and MDCs from the peripheral blood is
associated with more severe immune complex disease.
Discussion
Autoantibodies to small ribonucleoproteins, such as the U1, U2, U4-6, and U5 small nuclear
ribonucleoproteins (snRNPs) and the cytoplasmic Ro60 (Y1-Y5) ribonucleoproteins are strongly
associated with systemic autoimmune diseases such as SLE and Sjogren’s syndrome (161, 162,
178). Over half of lupus patients produce autoantibodies against one or more of these antigens
and about 70% produce anti-dsDNA antibodies (179). Titers of these autoantibodies can be
extraordinarily high, sometimes approaching 20% of the total immunoglobulin (180). The
reasons for the striking propensity of lupus patients to produce autoantibodies against
nucleoprotein antigens remain poorly defined despite intensive study. We recently reported that
U1 RNA and the Y1-5 RNAs are immunostimulatory and others have shown that eukaryotic
DNA may be stimulatory as well (181), suggesting that one explanation for the high frequency of
autoantibodies against nucleoproteins may that they carry “endogenous adjuvant” in the form of
immunostimulatory nucleic acids. Adjuvant activity is operationally defined as the capacity to
induce proinflammatory cytokines, notably IFN-I or IL-12 and to promote dendritic cell
maturation as indicated by increased expression of CD80, CD86, class II, and CD40 and homing
to lymphoid tissues (148, 164, 182).
The present findings add support to the idea that the production of autoantibodies against
nucleoprotein autoantigens is associated with evidence of adjuvant activity. As compared with
autoantibody negative SLE patients, patients who produced anti-RNP/Sm or anti-Ro60
autoantibodies had increased Mx1 and OAS gene expression, markers of the production of IFN-I
(Fig. 3-1). Expression of IFNβ was increased as well (Fig. 3-1). These changes were specific for
59
patients with anti-nucleoprotein autoantibodies, as anti-phospholipid autoantibody positive
patients had significantly lower IFN-I expression than negative patients. Increased expression of
IFN-I inducible genes has been noted previously in SLE (141, 142, 183) and increased
production of the proteins has been reported as well (184-186), though this is seen less
consistently. The difficulty in detecting IFN-I proteins in the serum of SLE patients may relate to
interference of rheumatoid factors with sandwich-type ELISAs as well as the binding of
circulating IFN-I to IFN-I receptors, the expression of which is widespread. Because the 14 or
more Type I IFNs all interact with the same receptor (187), measurement of Mx1 gene
expression by real-time PCR affords the means of specifically assaying the bioactivity of all
Type I IFN proteins, offering significant advantages over the measurement of serum IFN-I levels
using sandwich ELISAs. This approach has been validated in patients treated with exogenous
IFNα (176) and we confirmed a strong correlation between the expression of Mx1 and the
expression of other IFN-I inducible genes (Fig. 3-1).
The increased Mx1 expression seen here in ~20% of adult lupus patients differs from
previous reports that virtually all children (95%) and adults (77%) with SLE over-express
IFN-inducible genes (141, 142). This likely reflects primarily differences in data analysis. In the
microarray studies, increased gene expression was defined as greater than the expression in
healthy controls (141, 142). Here, increased Mx1 was defined as greater than the mean + 2 S.D.
of the normal group. Using the former definition, ~60% of our SLE patients had increased Mx1,
a figure approximating what was reported previously. An alternative explanation is that the lower
prevalence of high IFN-I seen here was related to mRNA degradation. We think this is unlikely
because the Mx1, OAS, IFNα2, and IFNβ expression levels correlated with each other and all
were compared with β-actin expression. It would therefore be necessary to postulate that the
60
degradation was specific for interferons and IFN-I inducible genes. Moreover, all blood samples
in the present study were collected in PAXgene tubes to minimize RNA degradation. The
effectiveness of this approach is illustrated by Fig. 3-1A. Indeed, collection of blood in
heparinized tubes is a potential source of bias (Fig. 3-1B) that may have contributed to the high
frequency of elevated IFN-I inducible gene expression reported in prior studies.
Along with IFN-I production, dendritic cell activation is a hallmark of the adjuvant effect
(182). Although we have not shown directly that the production of autoantibodies against the U1
and Y1-5 ribonucleoproteins or against dsDNA is associated with dendritic cell activation, the
deficiency of circulating PDC and MDC precursors in SLE (Fig. 3-2) is likely an indirect
measure of dendritic cell activation. Activated PDCs home to lymphoid tissues (188) where they
produce IFN-I (166), which then promotes MDC maturation (127, 150). Like PDCs, MDCs
acquire chemokine receptors mediating homing to secondary lymphoid tissues (189). This may
explain the strong correlation between the numbers of circulating MDCs and PDCs (Fig. 3-2C).
Similar mechanisms may account for the PDC/MDC deficit in HIV infection (190). Although it
has been suggested that certain medications, notably corticosteroids, can cause the number of
circulating PDCs to fall (191, 192), standard doses of antimalarials or oral corticosteroids did not
have a major effect on either Mx1 expression or the numbers of circulating dendritic cell
precursors, as SLE patients had higher Mx1 expression and lower PDC and MDC counts than
healthy controls regardless of whether or not they were treated with these medications (Fig. 3-3).
It is worth noting, however, that the corticosteroid doses reported to depress PDC counts (192)
were substantially higher than the usual doses of oral prednisone. In preliminary studies, we have
confirmed that high dose methylprednisolone (1 gram IV daily for 3 days) decreases Mx1
expression and PDC/MDC counts (data not shown). However, in patients receiving a daily dose
61
of up to 60 mg of prednisone orally, the low PDC/MDC counts probably reflect either abnormal
production or increased homing to other sites. Circulating PDC/MDC precursors originate in the
bone marrow and are mobilized by G-CSF and other cytokines (193). It remains to be
determined whether the low numbers of circulating PDCs and MDCs in lupus reflects deficient
production of G-CSF or other cytokines or abnormally rapid PDC/MDC maturation and
recruitment to the periphery.
A major question raised by our findings is whether increased IFN-I production is a primary
stimulus of the production of autoantibodies to nucleoproteins or a secondary event resulting
from the endosomal processing of the nucleic acids associated with these antigens. Certainly, it
has been shown that therapy with IFNα is associated with autoimmune phenomena, including
antinuclear antibody production and the induction of overt autoimmune diseases such as
autoimmune thyroiditis and SLE (139, 194). However, the specificities of the autoantibodies
appearing during IFNα therapy have not been investigated systematically, and it is unclear
whether there is a preference for nucleoprotein antigens. Conversely, in view of the ability of U1
and Y1-5 RNA as well as unmethylated CpG DNA motifs to stimulate IFN-I production, it is
possible that the increased production of IFN-I seen in patients who produce autoantibodies to
nucleoproteins is secondary to the activation of dendritic cells due to the endosomal uptake of
these antigens (163). In this case, conditions that enhance the exposure of activated MDCs to
nucleoproteins, perhaps in the form of blebs (195) from apoptotic cells, may be critical to the
generation of autoantibodies. The two possibilities are not mutually exclusive. Mechanisms exist
to prevent the activation of B cells upon exposure to endogenous chromatin and dendritic cells
might also be susceptible to desensitization under appropriate conditions. Exposure to either
endogenous or exogenous IFNα could lead to partial activation of dendritic cell precursors
62
and/or monocytes, thereby bypassing this checkpoint. When these cells encounter nucleoprotein
autoantigens such as the U1 or Y1-5 ribonucleoproteins, they may undergo further maturation
into fully immunostimulatory MDCs capable of inciting an immune response against peptides
derived from self-antigens. In this scenario, exposure of partially activated MDCs or monocytes
to immunostimulatory small RNAs derived from self-antigens may act as a positive feedback
mechanism promoting autoimmunity, which is directed mainly against the protein components of
these antigens. Importantly, the nucleic acid components of autoantigens may also act on B cells
to promote autoantibody production. For instance, the interaction of cellular DNA from
chromatin with TLR9 acts in concert with B cell receptor interactions to promote B cell
activation. Similarly, since B cells express TLR7/8, the likely receptor for U1 and Y1-5 RNA
(163), it is likely that the RNA components of self antigens also can promote B cell activation.
Thus, IFN-I and endogenous nucleic acids with immunostimulatory properties may act together
to promote autoantibody production and the formation of immune complexes, leading to immune
complex disease. The association of high Mx1 expression and low numbers of circulating PDCs
and MDCs with both extent of disease and lupus nephritis (Fig. 3-6) is compatible with this
model.
In conclusion, immunostimulatory effects of the nucleic acid components of autoantigens on
dendritic cell activation/maturation and IFN-I production may help explain the high prevalence
of autoantibodies against nucleoprotein antigens in SLE, raising the possibility that therapy
directed against IFN-I might lower autoantibody levels and alleviate disease. Very recent studies
in mice support the potential value of this approach (196).
63
Figure 3-1. Increased expression of IFN inducible genes in SLE. A) Stability of PBMC RNA in PAXgene tubes. Whole blood was incubated in PAXgene tubes at room temperature for 2 hours to 5 days and then processed. B) Mx1 expression in heparinized blood. Blood samples were collected either in sodium heparin tubes or PAXgene tubes and incubated at room temperature for 0 to 6 hours before isolation of RNA for quantification of Mx1 expression by real-time PCR. C) Mx1 expression in SLE patients and controls. Mx1 expression (real-time PCR) in SLE patients (n = 88) was increased in comparison with healthy controls (n = 57) and patients with other diagnoses (n = 82). Levels were higher in SLE vs. controls and other diagnoses (P < 0.0001, ANOVA; P < 0.001 SLE vs. Control; P < 0.001 SLE vs. Other (Bonferroni’s multiple comparison test). Dotted line shows the mean of healthy controls + 2 S.D. (642 cells/μl). NS, not significant. D) Correlation of Mx1 and OAS expression. Mx1 gene expression correlated strongly with expression of the IFN-I inducible gene OAS (real-time PCR) in a group of 54 consecutively tested patients from the original 88 SLE patients (R2 = 0.18, P < 0.0001 Spearman rank correlation test). E) Correlation of Mx1 and IFNβ expression. Mx1 expression correlated strongly with expression of IFNβ (real-time PCR) in a group of 38 consecutively tested SLE patients (R2 = 0.68, P < 0.0001 Spearman rank correlation test).
C
SLE Control Other0
500
1000
1500
2000200045007000
Rel
ativ
e M
x1 e
xpre
ssio
n
642
NS
P < 0.001
P < 0.001
0 200 400 6000
200
400
600
Relative OAS expression
Rel
ativ
e M
x1 e
xpre
ssio
n
D R2 = 0.18 P < 0.0001
0
20
40
60
80
100
2 hrs 8 hrs 5 days
Mx1
exp
ress
ion
(% o
f orig
inal
v
0
100
200
300
400
PAXgene 0 hr 3 hr 6 hr
Mx1
exp
ress
ion
(% o
f orig
A B
0 200 4000
200
400
Relative IFNb expression
Rel
ativ
e M
x1 e
xpre
ssio
n
ER2 = 0.68 P < 0.0001
64
Figure 3-2. Reduced circulating PDCs and MDCs in SLE. Circulating PDC and MDC counts were analyzed in 33 controls and 76 SLE patients by flow cytometry. PDCs were defined as lineage- (CD3, CD14, CD16, CD19, CD20, CD56); HLA-DR+, CD123+, CD11c-. MDCs were defined as lineage-, HLA-DR+, CD123-, CD11c+. A) and B) Absolute PDC and MDC counts. The dotted lines indicate the 5th percentile of healthy control counts (0.66 cells/μl and 1.1 cells/μl for PDCs and MDCs, respectively). C) Correlation of the absolute PDC and MDC counts (P < 0.0001, Pearson’s correlation test). D) Absolute monocyte counts. Monocyte counts in SLE patients vs. controls were not significantly different.
Control SLE0
2
4
6
8
1010
30
Abs
olut
e P
DC
cou
nt (p
erμ l
)
Control SLE0
2
4
6
8
1010
30
MD
C c
ount
(per
μ l)
A
1.11 cells/μl0.66 cells/μl
Control SLE0
1
2
Mon
ocyt
e co
unt (
x103 /m
l)
C
0 10 20 300
10
20
30
PDC count (per ml)
MD
C c
ount
(per
ml)
P < 0.0001
B
D
P < 0.0001 P < 0.0001
65
66
Figure 3-3. Effect of medications on Mx1 expression in SLE patients. A) Effect of antimalarial therapy. Peripheral blood PDC and MDC counts and Mx1 expression in patients treated with antimalarials (hydroxychloroquine or quinacrine), patients not taking antimalarials, and controls. B) Effect of corticosteroid therapy. Peripheral blood PDC and MDC counts and Mx1 expression in SLE patients treated with corticosteroids vs. patients not taking steroids and controls. In each of the figures, the difference between the three groups was analyzed by ANOVA. Bonferroni’s test was used to measure the inter-group differences. C) In vitro effect of corticosteroids. PBMCs were pre-treated with dexamethasone (0, 100 ng/ml, or 10 g/ml) for 1 hour prior to stimulation with poly (I:C) (PIC, 50 g/ml), LPS (100 ng/ml), or CpG ODN (10 μg/ml) for 6 hours. Expression of Mx1 and IL-6 was measured by real-time PCR normalized to -actin. D) In vitro effect of antimalarials. PBMCs were pre-treated with chloroquine (0, 100 nM, or 10 mM) for 1 hour prior to stimulation with PIC, LPS, or CpG ODN and measurement of Mx1 and IL-6 expression as in C.
67
Figure 3-4. Increased Mx1 expression correlates with autoantibody production. A) Autoantibodies to ribonucleoproteins. Mx1 expression was increased in individuals with either anti-nRNP/Sm or anti-Ro (SS-A)/La (SS-B) (immunoprecipitation assay) vs. individuals without any of these specificities (P = 0.0025, ANOVA; P < 0.01 anti-nRNP/Sm vs. control; P < 0.05 anti-Ro/La, Bonferroni’s multiple comparison test). B) Anti-DNA autoantibodies. Mx1 expression also was increased in patients with anti-dsDNA antibody (ELISA, P = 0.02, unpaired t-test). C) Anti-phospholipid antibodies. Mx1 expression was negatively associated with the presence of anti-phospholipid antibodies (IgG or IgM anti-cardiolipin by ELISA or lupus anticoagulant, P < 0.0001, unpaired t-test).
68
Figure 3-5.Decreased dendritic cell counts correlate with autoantibody production. Absolute peripheral blood counts of myeloid dendritic cells (mDC, left) and plasmacytoid dendritic cells (pDC, right) were determined (flow cytometry) in patients who were positive or negative for anti-dsDNA antibodies (Top), anti-RNP/Sm antibodies (middle), or anti-phospholipid antibodies (APLA, bottom). MDC counts were significantly lower in anti-dsDNA and anti-RNP/Sm positive patients than in autoantibody negative patients (P = 0.02 and P = 0.03, respectively, unpaired t-test). PDC counts were significantly lower in anti-RNP/Sm positive patients than in autoantibody negative controls (P < 0.0001, unpaired t-test).
anti-dsDNA (-) anti-dsDNA (+)0
20
40
60
pDC
anti-dsDNA (-) anti-dsDNA (+)0
20
40
60
mD
C
anti sm(-) anti sm(+)0
20
40
60
pDC
anti sm(-) anti sm(+)0
20
40
60
mD
C
APLA (-) APLA (+)0
20
40
60
pDC
APLA (-) APLA (+)0
20
40
60
mD
C
dsDN
RNP/Sm
APLA
P = 0.02
P < 0.0001 P = 0.03
69
Figure 3-6. Relationship of Mx1 expression, PDC and MDC counts to disease severity. Mx1 expression (real-time PCR) and PDC/MDC counts (flow cytometry) were correlated with extent of disease (number of SLE criteria met) in 66 SLE patients (Spearman). Mx1 expression and PDC/MDC counts in SLE patients with and without renal involvement were compared by unpaired t-test.
3 4 5 6 7 8 9 100
5
10
15
20
SLE criteria
Abs
olut
e P
DC
cou
nt (p
erμ l
)
3 4 5 6 7 8 9 100
5
10
15
20
SLE criteria
Abs
olut
e M
DC
cou
nt (p
er m
l)
P=0.02 P=0.008
SLE no renal SLE renal0
2000
4000
6000
Rel
ativ
e M
x1 e
xpre
ssio
n
3 4 5 6 7 8 9 100
1500
3000
4500
6000
7500
SLE Criteria
Rel
ativ
e M
x1 e
xpre
ssio
n
P =0.6
SLE no renal SLE renal0
5
10
15
20
Abso
lute
PD
C c
ount
(per
μl)
SLE no renal SLE renal0.0
2.5
5.0
7.5
10.0
12.5
15.0
17.5
Abso
lute
MD
C c
ount
(per
μl)
P =0.5 P=0.02 P=0.014
Renal Diseas
SLE Criteri
Mx1 expression Absolute PDC count Absolute MDC count
70
CHAPTER 4 RESULTS AND DISCUSSION: CD71+ MONOCYTES IN PERIPHERAL BLOOD FROM
LUPUS PATIENTS PRODUCE INTERFERON α/β
Introduction
Most lupus patients produce abnormal high levels of interferons (IFN) α and β as indicated
by the up-regulation of a group of IFN-I-stimulated genes (ISGs) (141, 142, 183, 197). This
“interferon signature” correlates with active disease, renal involvement, and the production of
lupus-associated autoantibodies such as anti-dsDNA and anti-Sm/RNP. Therapeutic use of
recombinant IFNα is associated with a variety of autoimmune disorders including SLE (139).
Moreover, a lupus-like disease with excess IFN-I production was seen in two patients with a
chromosomal translocation resulting in trisomy of chromosome 9p, which carries the IFN-I gene
cluster (198). These observations suggest that Type I interferons (IFN-I) could be involved in the
pathogenesis of SLE.
Further evidence for a direct pathogenic role of IFN-I comes from the observation that
experimental lupus induced by tetramethylpentadecane (TMPD) is greatly attenuated in mice
lacking the Type I interferon receptor (199). Although plasmacytoid dendritic cells (PDCs) are
the most efficient IFN-I producing cells (153, 166), studies of TMPD lupus indicate that
immature monocytes bearing the marker Ly6C are responsible much of the IFN-I (200). These
cells have low phagocytic activity, express high levels of TLR7, and respond well to TLR7
ligands, but only weakly to TLR9 ligands [(200) and PY Lee, et al., Submitted].
A monocyte phagocytosis defect affecting the clearance of dying cells has been reported in
about half of lupus patients (201-203). This has been attributed to defects in the phagocytes
themselves as well as serum factors (203, 204). Since the immature interferon-producing
monocytes in TMPD-lupus also are poorly phagocytic (200), we hypothesized that similar cells
in the peripheral blood of SLE patients might be responsible for the observed monocyte
71
phagocytosis defect. Although Ly6C is not expressed by human monocytes, increased numbers
of circulating CD71+ (transferrin receptor 1+) monocytes are seen in SLE (205). CD71 is
expressed on rapidly dividing cells and is generally expressed at only low levels in
non-proliferating cells (206). Thus, CD71 may be a marker for relatively immature/proliferating
monocytes. In the present study, we show that in SLE patients, circulating monocytes bearing
CD71 produce significant amounts of IFN-I and may be the human equivalent of the Ly6Chi
monocyte subset in murine lupus.
Results
Low PDC Numbers Correlate with High Interferon Levels in SLE
In normal individuals, circulating PDCs express endosomal TLR7 and TLR9, and upon
stimulation by virus or other ligands, produce large amounts of IFN-I (182, 207). Consistent with
previous reports (197, 208), we found that PDCs are depleted from the blood of lupus patients
compared with healthy controls (Fig. 4-1A-B). Using expression of the IFN-I inducible gene
Mx1 as a measure of total IFN-I expression (mainly IFNα and IFNβ), we found a negatively
relationship between Mx1 expression and circulating PDCs (Fig. 4-1C). It has been suggested
that this apparent paradox may be explained by sequestration of the IFN-I producing cells in
affected tissues, such as the skin lesions of SLE patients (209, 210). However, we found that
peripheral blood mononuclear cells (PBMCs) from SLE patients expressed significantly higher
levels of IFNα2 than those of healthy controls (P < 0.001, Mann Whitney test) (Fig. 4-2A).
Interestingly, when PBMCs from SLE patients were fractionated into CD14+ and CD14-
populations using magnetic beads, the CD14+ subset exhibited higher IFNα2 expression than the
CD14- subset (P < 0.01, Mann-Whitney). Similarly, PBMCs from SLE patients expressed high
levels of IFNβ mRNA, a significantly higher fraction of which was found in the CD14+ subset
than in the CD14- subset (P < 0.05, Mann-Whitney) (Fig. 4-2B). In contrast, depletion of PDCs
72
had little effect on the level of IFNβ mRNA in lupus PBMCs. PBMCs and CD14+ cells from
healthy controls also expressed IFNβ, but the level was about 20-fold lower than that seen in
lupus PBMCs (Fig. 4-2C). In contrast to the SLE patients, IFNβ mRNA seemed to be associated
with PDCs in majority.
CD14+ Cells from SLE Patients Produce IFN-I in Response to TLR Ligands
Endogenous and exogenous RNA ligands can stimulate TLR7 to induce IFN-I production.
In lupus PBMCs, TLR7 expression was significantly higher than normal controls but not patients
with other autoimmune disease (Fig 4-3A) (One way ANOVA, P<0.05). Interestingly CD14+
monocytes from lupus patients expressed TLR7, but in lower level compared to B cells (Fig
4-3B). Normal CD14+ monocytes express TLR7 in very low level (data not shown). IRF7, a
transcription factor involved in TLR signaling, was expressed higher in monocytes compare to
non-monocytes (Fig. 4-3C). Flow cytometry revealed a significant stronger CD14 expression on
lupus monocytes compared to normal individuals (Fig. 4-3D). These results indicated abnormal
TLR signaling in SLE monocytes. Along this line, we stimulated PBMCs, CD14+ monocytes
and CD14- fraction with TLR3, 4, 7, 9 ligands PIC, LPS, loxoribine, or CpG 2216 for 6 hours.
As expected, CD14+ monocytes from lupus patients responded to LPS challenge and produced
cytokines such as IL-6 (Fig 4-3E). LPS stimulation also induced IFNβ expression by lupus
monocytes (Fig. 4-3F). Interestingly, lupus monocytes also responded to stimulation of
loxoribine, a TLR7 ligand. Loxoribine stimulated IFN-I production in lupus monocytes was
higher than LPS induced response (Fig. 4-3F) whereas IL-6 production in response to LPS was
higher than loxoribine (Fig. 4-3E). CpG2216 induced IFN-I production in CD14- cells
(presumably dendritic cells and B cells), whereas it did not stimulate cytokine production above
baseline in CD14+ monocytes (Fig. 4-3F).
73
Circulating CD71+ Monocytes in SLE Express IFN-I
In agreement with a previous study (205), we found increased expression of CD71 on the
surface of CD14+ monocytes from a subset of SLE patients vs. healthy controls (P = 0.01,
Mann-Whitney test) (Fig. 4-4A-C). The % of monocytes positive for CD71 negatively correlated
with the number of circulating PDCs (Fig. 4-4D) and correlated positively with the expression of
IFNβ mRNA expression in PBMCs and with interferon-inducible gene (Mx1) expression, a
marker of IFN-I protein level (P = 0.001 and P = 0.01 respectively, Spearman’s test) (Fig.
4-4E,F).
To directly examine IFN-I production by the CD14+CD71+ subset, we isolated these cells by
FACS sorting. Both CD14+CD71+ and CD14+CD71- cells expressed more IFNβ mRNA than
CD14- cells, but the highest levels were seen in CD14+CD71+ monocytes (p = 0.02, one-way
ANOVA) (Fig. 4-5A). Moreover, by electron microscopy the sorted CD14+CD71+ cells
exhibited typical monocytoid morphological features more consistent with the features of
immature monocytes than of more mature phagocytes (Fig. 4-5B). The extensive rough
endoplasmic reticulum typical of PDCs was not seen in this cell population. Longitudinal
analysis of CD71+ monocytes and Mx1 gene expression provided further evidence that CCD71+
monocytes produce physiologically significant amounts of IFN-I (Fig. 4-5C). As shown in
Figure 4-5C, the number of CD71+ monocytes closely paralleled total IFN-I levels over time.
This was not explained by an induction of CD71+ expression by IFN-I, as monocytes cultured in
vitro with IFNα failed to upregulate CD71 (data not shown).
Increased CD14+CD71+ Monocytes in Patients with Anti-U1A Antibodies
SLE patients who make autoantibodies against ribonucleoproteins such as the U
(anti-Sm/RNP) and Y (anti-Ro) ribonucleoproteins have higher IFN-I levels than patients who do
not produce these antibodies (197). Circulating CD71+ monocyte numbers were higher in
74
anti-U1A (anti-RNP) positive SLE patients than in anti-U1A negative patients (P = 0.01,
Mann-Whitney test) (Fig. 4-6). In contrast, there was no difference in the number of circulating
PDCs and myeloid dendritic cells (MDCs) (Fig. 4-6 B-C).
Phenotype of CD14+CD71+ Cells
To further characterize the surface properties of CD14+ CD71+ monocytes, we analyzed
additional monocyte markers by flow cytometry (Fig. 4-7). The expression of HLA-DR, and
CD64 (FcγRI), and CD62L was significantly increased on the CD14+CD71+ population vs
CD14+CD71- cells (Fig. 4-7A,B). Expression of PDC marker CD123 and myeloid marker
CD11c was not upregulated on these cells (Fig. 4-7D and data not shown). The CD14+CD71+
population are negative for the PDC markers BDCA-2, BDCA-4 or MDC marker BDCA-1 (Data
not shown). These data suggested that a population of activated (CD71+, HLA-DRhi, CD62hi,
CD64+) monocytes produces substantial amount of IFN-I in SLE and that these cells do no
express high levels of surface markers characteristic of dendritic cells (CD123, CD11c)
Discussion
There is increasing evidence that IFN-I is involved in the pathogenesis of SLE, but the
source of the high levels of IFN-I in lupus is unknown. Although many cell types can produce
type I IFNs in response to viral infection, PDCs are the most efficient IFN-producing cells (153,
166). Although individual PDCs can generate up to 1000-fold more IFNα then other cell types in
response to viral infection, the frequency of circulating PDCs is greatly decreased in SLE
patients (197, 208). Nevertheless, the expression of IFN-I is significantly higher in SLE
peripheral blood than in normal controls (141, 142, 183, 197). The presence of PDCs in SLE
patients’ skin lesions has been invoked as an explanation for this paradox (209, 210). However,
recent data in TMPD-induced murine lupus indicate that most of the IFN-I is derived from an
75
immature Ly6Chi monocyte population (200). The present study was an effort to determine
whether a similar cell type might be involved in IFN-I production in human lupus. As human
monocytes do not express Ly6C, additional surface markers were evaluated. We show here that
CD14+CD71+monocytes produce a significant amount of IFN-I in SLE and may be the human
equivalent of Ly6Chi monocytes in murine lupus. Depletion of these cells from PBMC
populations using magnetic beads greatly reduced the amount of IFNα and IFNβ mRNA whereas
purified CD14+CD71+ cells exhibited higher levels of IFNβ gene expression than CD14+CD71-
or CD14- cells. Moreover, the number of circulating CD71+ monocytes correlated with IFNβ and
Mx1 expression by PBMCs, whereas the number of PDCs correlated inversely. These data
challenge the concept that PDCs are exclusively responsible for the increased level of IFN-I in
SLE.
Production of IFN-I by CD71+ Monocytes in SLE
In murine TMPD-induced lupus, the development of glomerulonephritis and autoantibodies
against the Sm/RNP and dsDNA antigens requires signaling through the Type I IFN receptor
(199). Much of the IFN-I driving these autoantibodies appears to be derived from a population of
immature (Ly6C+) monocytes (200). Elimination of dendritic cells by diphtheria toxin treatment
of CD11c-diphtheria toxin receptor (CD11c-DTR) transgenic mice has little effect on the ability
of TMPD to induce IFN-I production, whereas elimination of monocytes using clodronate loaded
liposomes nearly abrogates TMPD-induced IFN-I production (200). The IFN-I producing
monocytes have an immature phenotype (Ly6chiCD11b+Mac3+Moma2+Sca1+) and although
short-lived, are rapidly replenished from the bone marrow. Unfortunately, other than CD11b,
these markers are not expressed on human cells, necessitating the evaluation of additional
surface markers for the identification of a putative human equivalent. The human CD14+CD71+
IFN-I producing cells, like the cells found previously in mice, appear to be immature monocytes.
76
CD71 is found in proliferating cells, suggesting that the circulating CD14+CD71+ cells may have
been exported recently from the bone marrow. In addition, CD14 is down-regulated during
terminal differentiation of monocytes to either macrophages or dendritic cells. It is unclear at this
point whether, as in the mouse model (203), the CD14+CD71+ cells are somehow prevented from
undergoing maturation. However, high IFN-I levels may help maintain their phenotype because
they lose CD71 expression in culture in vitro within 4 hours, whereas the CD71+ phenotype can
be maintained in the presence of IFNα (data not shown).
Although there is considerable overlap between monocytes and dendritic cells (25,26) (211,
212), we think that the interferon producing CD14+CD71+ cells are more closely akin to
monocytes than to PDCs. These cells are strongly HLA-DR+, but surface markers characteristic
of PDCs (CD11c and CD123) are not expressed at higher levels than seen on CD14+CD71- cells
(Fig. 4-7 and data not shown). Moreover, by electron microscopy (Fig. 4-5B), these cells have
the typical appearance of immature monocytes rather than the extensive rough endoplasmic
reticulum and eccentrically placed nucleus typical of PDCs (153). Although PDCs are
considered by some investigators to be the main source of IFN-I in SLE (213), a significant
amount of IFN-I can be produced by non-PDCs from SLE peripheral blood (150). Monocyte
derived “IFN-DCs” express high levels of TLR7 and produce IFNα, as do the CD14+CD71+ cells,
but unlike the latter subset, these cells down-regulate CD14 expression (214). While we cannot
exclude the possibility that the CD14+CD71+ IFN-producing cells are IFN-DCs, the fact that
monocytes from SLE patients are more strongly CD14+ than those from healthy controls (Fig.
4-3C) and that the expression was similar on CD71+ vs. CD71- cells (Fig. 4-4) further supports
the viewpoint that the CD14+CD71+ cells are immature monocytes.
77
Mechanism of IFN-I Production
The striking correlation between the level of IFNβ mRNA on the one hand and Mx1
expression on the other with numbers of circulating CD71+ monocytes (Fig. 4-4D-E) and the
inverse relationship between the numbers of circulating PDCs and Mx1 expression (Fig. 4-1C)
raises the possibility that the much of the interferon responsible for increased IFN-inducible gene
expression in lupus PBMCs may be produced locally (i.e. in the circulation). Unfortunately, it is
difficult to evaluate the contribution of IFN-I produced at distant sites, such as lupus skin lesions
(209, 210). At present, it is not known how the CD14+CD71+ cells are triggered to produce IFN-I.
In mouse models, the importance of signaling via TLR7 is becoming increasingly clear (86, 215,
216). It is noteworthy, therefore, that the RNA components of the common lupus autoantigens
Sm/RNP (U1 RNA) and Ro60 (Y RNAs) are TLR7 ligands capable of stimulating IFN-I
production in vitro (163). It has been reported that U1 RNA exclusively stimulates IFN-I
production in CD14+ monocytes but not PDCs (217). Consistent these observations, we found a
strong association of anti-U1-A (RNP) autoantibodies with the presence of increased numbers of
CD71+ monocytes (Fig. 4-7). In addition, we found that expression of TLR7 is expressed on
lupus monocytes at levels approaching the expression of this molecule on B cells (Fig. 4-3).
Preliminary study showed that level of TLR7 in lupus monocytes was higher than on control
monocytes (data not shown). Stimulation with TLR7 ligands was able to induce IFN-I
production in lupus monocytes (Fig. 4-3F). Interestingly, we also found that IRF-7 is expressed
at high levels in monocytes from SLE patients vs. healthy controls (Fig. 4-3C). IRF-7 is an
interferon-inducible transcription factor that interacts with and is activated by MyD88/TRAF6
and is absolutely required for IFN-I production (218, 219). It is expressed constitutively at high
levels in PDCs (157, 220), but also is expressed in monocytes where it is thought to play a role in
terminal differentiation into macrophages (221-223). The high level of IRF-7 expression in
78
CD14+ cells from SLE patients suggests that, like PDCs, these cells may be poised to respond to
ligands capable of interacting with endosomal TLRs (TLR7, 8, and 9). It is of some interest,
therefore, that the activation of TLR9 by its ligands occurs in transferrin receptor
(CD71)-positive endosomes and leads to IFNα production (224). Further studies are needed,
however, to define the role if any of endosomal TLRs in activating IFN-I production by
CD14+CD71+ cells.
79
Figure 4-1. Reduced plasmacytoid dendritic cells in SLE and correlation between CD14+CD71+ monocytes. A) Flow cytometry of PDCs from SLE patients and health controls. PDCs were characterized as Lin- HLA-DR+CD11c-CD123+ cells. B) frequency of PDCs was decreased in SLE patients (n=) compare to healthy controls (n=) (p<0.01) C. Negative correlation between frequency of CD14+CD71+ monocyte and PDCs (p<0.05)
CD11C-APC
CD12
3-PE
100 101 102 103 104100
101
102
103
104 Gate 3
CD11c-APC
CD12
3-PE
100 101 102 103 104100
101
102
103
104 Gate 3
B
A SLE
0.06%
0.4%
CD11cCD123Lin
SS FS
HLADR
C
0 1 2 30
2000
4000
6000
8000
10000 P < 0.05
PDC (%)
Rel
ativ
e M
x1 e
xpre
ssio
n
SLE NHC0.0
0.5
1.0
1.5
2.0
2.5P = 0.001
(n = 75) (n = 21)
PD
C (%
)
SS
FS
0 16384 32768 49152 655360
16384
32768
49152
65536
Gate 1
HLA-DR-PerCP
LIn-
FITC
100 101 102 103 104100
101
102
103
10470.39% 12.70%
12.08% 4.83%
HLA-DR-PerCP
LIN
-FIT
C
100 101 102 103 104100
101
102
103
10420.58% 4.74%
73.74% 0.94%
_ _ _ y_
SS
FS
0 16384 32768 49152 655360
16384
32768
49152
65536
Gate 1
Healthy Control
80
Figure 4-2. Production of IFN-I by CD14+ cells. PBMCs from SLE patients or healthy were isolated from fresh peripheral blood by Ficoll. CD14+ cells and CD19+ cells were enriched by magnetic beads respectively. RNA were isolated by Trizol reagent and reverse transcripted into cDNA. Expression of A) IFN α2 or B) IFNβin lupus patients and C) IFNβin healthy controls were determined by real time PCR.
A
PBMC CD14+ CD14-1
10
100
1000
10000SLENHC
IFNα
2 ex
pres
sion
B
PBMC PDC dpl CD14+ CD14 dpl1
10
100
1000
10000 SLE
IFN
b ex
pres
sion
PBMC CD14+ CD14- CD19+ CD19-0
1000
2000
3000
IFN
b ex
pres
sion
PBMC PDC dpl CD14+ CD14 dpl0
50
100
150
200
250 Healthy controls
Rel
ativ
e IF
Nβ
expr
essi
on
C
81
Figure4-3. SLE monocytes express high level of TLR7, IRF7 and CD14 and produce IL-6 as well as IFNβ in response to loxoribine stimulation. A), TLR7 expression in monocytes from SLE patients, patients with other autoimmune disease and normal controls. (One way ANOVA). B, C), TLR7 and IRF7 expression in PBMCs, CD14+ monocytes, CD14- cells, CD19+ B cells and CD19- cells determined by real time PCR. D, CD14 expression determined by flow cytometry in normal controls and SLE patients without steroid treatment. E, F), PBMCs, CD14+ monocytes and CD14- cells were stimulated with PIC (50μg/ml), LPS (100 ng/ml), loxoribine (50 μg/ml) or CpG2216 (10μg/ml) for 6 hours. IL-6 and IFNβ expression was measured by real time PCR.
PBMC CD14+ CD14- CD19+ CD19-0
50
100
150
200
TLR
7 ex
pres
sion
PBMC CD14+ CD14- CD19+ CD19-0
50
100
150
200SLENHC
IRF
7 ex
pres
sion
SLE Other NHC0
5
10
15
20
25
TLR
7
P<0.05
ns ns
C PIC LPS LOX CpG10
100
1000
10000
100000PBMCCD14+CD14-
Rel
ativ
e IL
-6 e
xpre
ssio
n
Control SLE no steroid0
400
800
1200
n = 92P < 0.04
MFI
of C
D14
on
mon
ocyt
e
C PIC LPS LOX CpG1
10
100
1000
10000
100000PBMCCD14+CD14-
Rel
ativ
e IF
Nβ
expr
essi
on
E F
C D
A B
82
Figure 4-4. Increased CD14+ CD71+ monocyte in SLE and correlation of IFN-I production. A,B) Flow cytometry showing increased CD14+CD71+ monocyte in SLE. Upper panels, flow cytometry of monocytes in normal controls (left) and SLE patients (right). Lower panel, isotype control. Results is a representative staining of over 60 of such experiments. C) percentage of CD71+ cell of total monocytes was increased in SLE patients compare to normal controls (unpaired t-test, p<0.005). D) correlation between frequency of CD14+CD71+ monocytes and PDCs. E, F) The percentage of CD71+ monocyte was positively correlated with IFN β and Mx1 expression (Spearman’s test, p=0.003, p=0.01 respectively). Expression of IFN β and Mx1 in whole blood was determined by real time PCR.
A B
0 10 20 30 40 50 60 700.0
0.5
1.0
1.5
2.0
2.5
CD71+ monocytes(%)
PD
C (%
)D
CD71-PE
CD14
-Per
CP
100 101 102 103 104100
101
102
103
104
0.78%93.30%
0.10%5.83%
CD 7 1 -P E
CD14
-Per
CP
1 0 0 10 1 10 2 10 3 10 41 0 0
1 0 1
1 0 2
1 0 3
1 0 45 .7 1 % 1 .24 %
9 0 .1 5% 2 .90 %
IS O -P E
CD14
-Per
CP
1 0 0 1 0 1 1 0 2 1 0 3 1 0 41 0 0
1 0 1
1 0 2
1 0 3
1 0 4
0 .41 %9 2 .9 4%
0 .19 %6 .4 7 %
ISO-PE
CD14
-Per
CP
100 101 102 103 104100
101
102
103
1045.84% 0.05%
94.07% 0.05%
C
F
SLE NHC0
10
20
30
40
50
60 P= 0.01
(n = 75) (n = 21)
CD
71+
(% o
f CD
14+ )
P=0.01
E
0 10 20 30 40 50 60 700
1000
2000 P = 0.003
CD71+ monocytes (%)
Rel
ativ
e IF
Nβ
expr
essi
on
0 10 20 30 40 50 60 700
2000
4000
6000
8000
10000 P = 0.01
CD71+ monocytes (%)
Rel
ativ
e M
x1 e
xpre
ssio
n
83
Figure4-5. Production of IFN-I by CD14+CD71+ monocytes. PBMCs were isolated by Ficoll. CD14+CD71+ or CD14+CD71- monocytes were enriched by cell sorting. IFN β expression was detected by real time PCR. A), IFNβ expression in CD14+CD71+ monocytes, CD14+CD71- monocytes and CD14- cells. B), Electron microscopy of CD14+CD71+ monocytes. C), longitudinal study of Mx1 expression and CD14+ CD71+ monocytes in one lupus patients.
A B
CD14+CD71+ CD14+CD71- CD14-CD71-0
1000
2000
3000R
elat
ive
IFNβ
expr
essi
on P = 0.016
6/26 9/11 10/70
10
20
30
40
Date of sample
CD
71+ m
onoc
ytes
(%)
6/26 9/11 10/7700
900
1100
1300
Date of sample
Rel
ativ
e M
x1 e
xpre
ssio
n
C
84
Figure4-6. Percentage of CD71+ cells correlates with anti-U1A antibody production. A), CD71+ monocytes counts were significantly higher in patients with anti-U1A antibody compared to anti-U1A negative patients. B,C), MDC or PDC counts were not associated with anti-U1A antibodies.
anti-U1A (+) anti-U1A (-)0
1
2
3
MD
C (%
)
anti-U1A (+) anti-U1A(-)0
1
2
3
PD
C (%
)
anti-U1A (+) anti-U1A (-)0
20
40
60P = 0.01
CD
71+ m
onoc
ytes
(%)
A B
C
85
Figure 4-7. Characterizations of CD14+CD71+ monocyte in SLE blood. Surface expression of HLA-DR, CD64, CD62L and CD11c were determined by flow cytometry. For each individual marker, MFI was shown on the left and histogram was shown on the right.
CD14+CD71- CD14+CD71+0
100
200
300P <0.001
HLA
-DR
(MFI
)A
HLA -DR-PerCP
Cou
nt
100 101 102 103 1040
1327
40
53
CD71+CD71- Isotype
B
C
CD14+CD71+ CD14+CD71-0
50
100
150
CD
11c
(MFI
)
D
DC62L-APC-Cy7C
ount
100 101 102 103 1040
173
347
520
693
CD11C-A PC
Cou
nt
100 101 102 103 1040
4
8
12
16
CD14+CD71- CD14+CD71+0
200
400
600
CD
62L
(MFI
)
P < 0.05
CD14+CD71- CD14+CD71+0
200
400
600P = 0.005
CD
64 (M
FI)
CD62L F
Cou
nt
100 101 102 103 1040
13
25
38
50
CD64-FITC
86
CHAPTER 5 RESULTS AND DISCUSSION: LUPUS-LIKE DISEASE AND HIGH INTERFERON
LEVELS CORRESPONDING TO TRISOMY OF THE TYPE I INTERFERON CLUSTER ON CHROMOSOME 9P
Introduction
Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease characterized
by antinuclear antibodies (ANAs) and immune complex deposition in the kidneys and other
organs (225). Susceptibility is conferred by multiple genes in a manner consistent with a
threshold liability model, whereas disease onset may be influenced by environmental triggers
(226, 227). Hereditary complement deficiency, defective complement receptor function (228),
and Fc receptor polymorphisms (229) are among the genetic factors contributing to SLE.
Recent interest has focused on the role of type I interferons (IFNs), such as IFN and IFN.
Patients with SLE exhibit increased levels of IFN in the serum (184, 186), Moreover, in the
peripheral blood mononuclear cells (PBMCs) of SLE patients, IFN-inducible genes are
expressed at increased levels (141, 142, 183, 197). Therapeutic use of IFN induces ANAs or
even overt SLE in some individuals (139, 194), suggesting that IFN may play a causative role. It
is unknown whether the increased IFN production in SLE reflects a genetic defect or the action
of unidentified environmental factors.
Type I IFNs, produced by most cell types in response to viral infection, link innate
immunity with adaptive immunity (172, 230, 231). The 14 IFN genes, 4 IFN pseudogenes, and
single IFN and IFN genes are clustered on the short arm of chromosome 9 within a genomic
duplication (187, 232, 233). Decreased IFN production by cells with only 1 copy of the type I
IFN cluster may promote neoplasia (234). The present study addresses the question of whether
individuals with 3 copies of the type I IFN cluster produce high levels of type I IFN due to a
gene-dosage effect, resulting in increased susceptibility to SLE.
87
Results
Pedigree
There have been more than 150 reports of individuals with a partial or complete trisomy of
Chromosome 9 (235). About half of the cases of a partial trisomy of Chromosome 9 were the
result of a 3:1 segregation of a balanced parental translocation (236). We herein describe a
family in which 4 of the members had a balanced translocation of Chromosome 9 to
Chromosome 21, referred to as 9;21, while 2 individuals had an unbalanced translocation
resulting in trisomy of 9p, the chromosomal region encoding the type I IFN cluster (Figure 5-1).
The proband subject (designated UB1), who had an unbalanced translocation and trisomy of 9p,
was evaluated for joint pain and ANA positivity. His similarly affected half-brother (subject UB2)
was also evaluated, along with 3 relatives who had balanced translocations (subjects B1, B2, and
B3) (Figure 5-1).
Case Reports
Subject UB1, a 28-year-old white man with dysmorphia, had developmental delay,
protuberant ears, micrognathia, clubbed feet, bilateral syndactyly of the second and third toes,
bilateral camptodactyly of the third and fourth metacarpophalangeal (MCP) joints, smooth
transverse palmar creases, and profound mental retardation, as well as a history of grand mal
seizures since age 10 years that were treated with phenytoin and carbamazepine. His karyotype
was 46,XY,-21,+der(9),t(9;21)(q22.3;q21)mat, rendering him partially monosomic for the
proximal third of the long (q) arm of Chromosome 21, and partially trisomic for the short (p) arm
of Chromosome 9 as well as for the proximal portion of the q arm of Chromosome 9 (Figure
5-2A).
The subject was evaluated for polyarthralgias and progressive joint deformities as well as a
positive test result for ANAs (>1:1,280, speckled), and he was observed to have faint malar
88
erythema, livedo reticularis of the legs, and multiple reducible subluxations of the proximal
interphalangeal and MCP joints, with ulnar deviation bilaterally. Radiographs revealed
nonerosive subluxation of the MCP joints and boutonniere deformity of the third digit of the
right hand, suggestive of Jaccoud's arthropathy. Blood cell counts and renal function were
normal. The erythrocyte sedimentation rate was 51 mm/hour. Anti-RNP autoantibodies and
IgM-anticardiolipin antibodies (33 IgM phospholipid units) were detected by ELISA. Anti-Sm,
anti-Ro/SSA, anti-La/SSB, anti-dsDNA antibodies, and rheumatoid factor were not detected.
Levels of C3 and C4 were 110 and 18 arbitrary units, respectively. The subject was treated
successfully with nonsteroidal anti inflammatory agents.
Subject UB2, the 14-year-old half-brother of subject UB1, had the same chromosomal,
developmental, and physical abnormalities as those described above, with joint pain and mild
sicca symptoms (Figure 5-2A). He was observed to have facial erythema, Raynaud's
phenomenon, joint tenderness without swelling, and mild joint deformities. Hand radiographs
showed narrowing of the carpal joint spaces and diffuse bony demineralization. The subject had
a history of grand mal seizures since age 3 years that were treated with phenytoin for 8 years. At
the time of evaluation, phenytoin had been replaced with divalproex sodium and oxcarbazepine
and, 1 year later, with oxcarbazepine and levetiracetam because of poorly controlled seizures.
His serum was anti-Ro positive (by ELISA) and negative for anti-Sm, anti-RNP, anti-La,
anti-dsDNA, rheumatoid factor, and anticardiolipin antibodies. The levels of C3 and C4 were 99
and 31 arbitrary units, respectively. There was no change in his ANA status after phenytoin was
changed to divalproex/oxcarbazepine or when levetiracetam was substituted for divalproex. The
patient achieved relief of symptoms following treatment with artificial tears and nonsteroidal
antiinflammatory agents.
89
The karyotype of the mother of these 2 patients (subject B1 in Figure 5-1) was
46,XX,t(9;21)(q22.31;q21.2), consistent with a balanced translocation involving the long arm of
Chromosome 9 and the long arm of Chromosome 21 (breakpoints 9q22.31 and 21q21.2) (Figure
2B). The subject was healthy, without evidence of autoimmunity. In addition to her 2 sons
(subjects UB1 and UB2), the mother had a male child with a balanced translocation at 9;21
(subject B2 in Figure 5-1), a male child who died neonatally, and 2 miscarriages (solid circles in
Figure 1). One of the mother's siblings also had a balanced translocation (subject B3 in Figure
5-1). Similar to subject B1, subjects B2 and B3 had no developmental abnormalities, seizures, or
autoimmunity. There was no other family history of autoimmunity.
Immunologic Findings
ANA patterns were speckled and nuclear (in subject UB1) and cytoplasmic (in subject
UB2) (Figure 5-3A). Sera from their healthy mother (subject B1) (Figure 5-3A) and from
subjects B2 and B3 (results not shown) did not contain ANAs. Analysis of serum autoantibodies
by radioimmunoprecipitation confirmed the presence of serum anti-RNP and anti-Ro 60
autoantibodies in subjects UB1 and UB2, respectively (Figure 5-3B). Anti-Ro 60 antibodies
remained detectable in the half-brother (subject UB2) after valproic acid was discontinued
(results not shown). In contrast, sera from healthy relatives B1, B2, and B3 showed an
autoantibody pattern similar to that in nonautoimmune controls (Figure 5-3B, right). Anti-Ro 52
autoantibodies were undetectable in the sera from subjects UB1, UB2, B1, B2, and B3 (results
not shown).
Because subjects UB1 and UB2 were both receiving anticonvulsant medications, some of
which have been associated with a low risk of drug-induced lupus syndrome (40), their sera were
tested for autoantibodies characteristic of the drug-induced lupus syndrome (anti-ssDNA and
antichromatin). Tests of the sera of subjects UB1 and UB2 as well as the sera of family members
90
B1, B2, and B3 all yielded negative results (not shown) for these autoantibodies associated with
drug-induced lupus.
The absence of autoantibodies that are usually found in drug-induced lupus and the
presence of autoantibodies that are not associated with drug-induced lupus (anti-RNP and
anti-Ro 60) along with the continued production of anti-Ro 60 in subject UB2 after
anticonvulsant therapy was changed led us to investigate other potential explanations for the
development of lupus-like disease and serologic changes in both of the subjects with an
unbalanced translocation compared with the absence of these features in their relatives with a
balanced translocation. In view of recent evidence implicating IFN in the pathogenesis of SLE
(139, 194, 237), it was notable that the IFN cluster is located on the short arm of Chromosome 9
(9p21) (Figure5-2) (187, 232).
Karyotype analysis indicated that subjects UB1 and UB2 were trisomic for the IFN cluster
(Figure 5-2A). Coincidentally, genes for the 2 chains of the type I IFN receptor (IFNAR1 and
IFNAR2) as well as the IFN-inducible genes Mx1 and Mx2 are located on Chromosome 21, but
these were not involved in the translocation (i.e., subjects UB1 and UB2 had 2 copies of each).
We therefore investigated IFN 4 and IFN expression in PBMCs from subjects UB1 and
UB2 and their healthy mother (subject B1) in comparison with that in the PBMCs from 10 SLE
patients and 10 normal healthy controls (Figures 5-4A and B). In comparison with controls,
IFN 4 and IFN expression was increased in the PBMCs from subjects UB1 and UB2 and was
increased in those from the patients with SLE (Figures 5-4A and B). Expression of IFN 4 and
IFN in subjects UB1 and UB2 was increased 7-8-fold over the mean value in healthy controls.
In contrast, the mother (subject B1) expressed IFN 4 and IFN messenger RNA (mRNA) at
normal levels. Not only was type I IFN mRNA expression increased in the PBMCs from subjects
91
UB1 and UB2, but IFN protein expression was increased as well, since the expression of Mx1, a
gene induced specifically by IFN (176), also was increased in the PBMCs from subjects UB1
and UB2 and in those from the SLE patients, as compared with those from healthy controls and
subject B1 (Figure 5-4C).
Expression of the β-chain of IFNAR2 is down-regulated upon binding of IFNα/β (238).
The levels of IFNAR2 in the PBMCs from subjects UB1, UB2, and the SLE patients were
somewhat decreased compared with those in healthy controls and subject B1 (results not shown).
Comparison of subjects UB1, UB2, and B1 with SLE patients and healthy controls did not reveal
significant differences in the levels of IL-6 (Figure 5-4D) or TNFα (results not shown).
Subject UB2 exhibited persistently high levels of IFN, since blood samples obtained 10
months apart showed similar IFNα4, IFNβ, and Mx1 expression (Figure 5-5A). Circulating
plasmacytoid dendritic cells, the major IFN-producing cell type, were examined in subjects UB1
and UB2 by flow cytometry (Figure 5-5B). It is known that SLE patients have low numbers of
circulating plasmacytoid dendritic cells compared with healthy controls (150, 194), probably
reflecting activation and migration to secondary lymphoid tissues (190). Subjects UB1 and UB2
had plasmacytoid dendritic cell counts that were lower than those in healthy controls (n = 10)
and comparable with those in SLE patients (n = 10). Unexpectedly, subject B1 also had low
numbers of circulating plasmacytoid dendritic cells (Figure 5-5B).
Discussion
We describe herein a pedigree with a chromosomal translocation involving Chromosomes
9 and 21. Three individuals with a balanced translocation (subjects B1, B2, and B3) had no signs
of autoimmunity. Two other family members (subjects UB1 and UB2) had chromosome
aberrations due to a 1:3 segregation (1 of the 4 translocated chromosomes segregated to one pole,
while 3 segregated to the other pole), leading to trisomy of chromosome 9p and the proximal arm
92
of 9q as well as monosomy of the proximal arm of 21q. Remarkably, both patients with trisomy
of 9p presented with lupus-like autoimmunity and abnormalities in the regulation of type I IFN.
We hypothesize that their autoimmunity may have been related to having 3 copies of the type I
IFN cluster located on the p arm of chromosome 9 (187, 232).
It is unlikely that the presence of lupus-like disease in 2 family members with an
unbalanced translocation and its absence in 3 relatives with a balanced translocation was
coincidental. Since subjects UB1 and UB2 had different fathers, a genetic predisposition to
autoimmunity, if present, would most likely have been derived from the mother. However,
neither the mother nor any maternal relatives had evidence of autoimmunity. Although their
mother had low numbers of circulating plasmacytoid dendritic cells, as has been seen in patients
with SLE (150, 197), unlike subjects UB1 and UB2, the mother did not express high levels of
IFN 4 or IFN mRNA (Figures 5-4 A and B), nor was there increased type I IFN signaling, as
indicated by the low Mx1 expression (Figure 5-4C). Thus, although it is possible that subject B1
had an abnormality in regulating plasmacytoid dendritic cells, she appeared to have normal
regulation of type I IFN production. The most likely interpretation is that the autoimmune
phenotype exhibited by subjects UB1 and UB2 was related to the presence of 3 copies of the
type I IFN gene cluster.
A previous report of lupus-like disease in a patient with the karyotype
46,XX,-6,+der(6),+t(6,9)pat, which resulted in a partial trisomy of Chromosome 9 (239, 240),
further supports the idea that the lupus-like disease was related to a chromosomal abnormality.
Similar to subjects UB1 and UB2, this patient with a translocation 6;9 had seizures. Although her
lupus-like disease was attributed to anticonvulsant therapy with sodium valproate (239), this
would be a rare occurrence, and definitive evidence supporting the diagnosis of drug-induced
93
lupus was not presented. It is unlikely that subjects UB1 and UB2 had drug-induced lupus.
Subject UB1 was taking phenytoin, which is associated with a low risk of drug-induced lupus
(40), whereas subject UB2 initially received phenytoin, but it was replaced with sodium
valproate/oxcarbazepine and subsequently with levetiracetam. Sodium valproate is associated
only anecdotally with drug-induced lupus (239, 241-243), and the anti-Ro 60 autoantibodies
persisted after sodium valproate was replaced by oxcarbazepine and levetiracetam, neither of
which is associated with drug-induced lupus (244). Since the lupus-like syndrome and
autoantibody production did not abate when the anticonvulsant regimen was altered, and since
the autoantibodies classically associated with drug-induced lupus (anti-ssDNA and antichromatin)
(40) were not detected, whereas subjects UB1 and UB2 both produced autoantibodies (anti-RNP,
anti-Ro 60) not associated with drug-induced lupus, we conclude that subjects UB1 and UB2 did
not have drug-induced lupus.
Because Chromosome 9p was involved in the translocation (187, 232) and the patients
with trisomy of the type I IFN cluster had higher levels of IFN4α, IFNβ, and Mx1 than did their
mother or healthy controls (Figure 5-4), we suggest that increased gene dosage may have
promoted lupus-like disease by enhancing IFN production. It is often assumed that genes present
in 3 copies in trisomic individuals will be expressed at a 1.5-fold higher level relative to euploid,
a prediction that has been formally tested in the case of chromosome 21 (245). The mean
overexpression of all aneuploid genes on chromosome 21 was very close to the predicted
1.5-fold increase in a mouse Down syndrome model. However, only 37% of the genes were
expressed at the theoretical value of 1.5-fold, whereas 45% were significantly underexpressed.
Interestingly, 18% were overexpressed (levels significantly higher than 1.5-fold). Our data
(Figures 5-4-5) are consistent with the possibility that the type I IFNs (on Chromosome 9) may
94
be among the genes overexpressed in trisomic individuals. It is possible that this is related to the
positive feedback regulation of type I IFN production, i.e., interaction of secreted type I IFN with
the type I IFN receptor stimulates the production of additional type I IFN (246). Another issue is
the fact that alterations in gene expression measured at the transcript level may not always be
accurately reflected at the protein level (247). However, the strikingly high Mx1 expression
(induced by IFN protein binding to the IFN receptor) strongly suggests that in this case,
increased transcript level was closely tied to increased protein level.
Subjects UB1 and UB2 may exemplify individuals having a genetic defect that affects the
regulation of type I IFN production and promotes susceptibility to SLE. The data are consistent
with the possibility that other genetic polymorphisms, point mutations, or chromosomal
abnormalities affecting type I IFN production may be associated with lupus (31). Some patients
treated with recombinant IFN develop ANAs, SLE, or autoimmune thyroiditis (139, 194), and
disease is accelerated in lupus-prone mice treated with IFNα (237). However, increased type I
IFN also is associated with idiopathic SLE (141, 142, 183, 184, 186). Thus, the high levels of
IFN exhibited by subjects UB1 and UB2 could be either the cause of their lupus or secondary to
lupus. Although it is impossible to completely exclude the possibility that the increased IFN
expression was secondary to lupus, the fact that disease was restricted only to family members
with a partial trisomy of 9p supports a causal role.
In summary, disordered regulation of type I IFN was found in association with a
chromosomal translocation resulting in trisomy of the type I IFN cluster. Individuals with
trisomy of 9p developed a lupus-like syndrome, whereas their relatives with the balanced
translocation showed no evidence of autoimmunity. The data support the idea that abnormal
regulation of type I IFN production is involved in the pathogenesis of SLE (160).
95
Figure5-1. Pedigree. Diagram of the kindred, indicating individuals with an unbalanced translocation 9;21 resulting in trisomy of chromosome 9p (subjects UB1 and UB2) and with a balanced translocation 9;21 (subjects B1, B2, and B3). The maternal grandmother of subjects UB1 and UB2 was also known to have a balanced translocation (not shown). Miscarriages are indicated as solid circles. The proband (index case) is indicated with an arrow.
t9;21 (unbalanced trisomy 9p)
t9;21 (balanced translocation)
unaffected
UB1 UB2
B1
B2
B3
96
Figure 5-2. Karyotype analysis of subject UB2 and subject B1. A) The karyotype of subject UB2 was determined by GTG-banding (similar to that of subject UB1 [not shown]). Right, diagram of 9;21 and the derivative chromosomes 9 and 21 from subjects UB1 and UB2. Chromosome 9 is shown in dark hatching and chromosome 21 in light hatching. Chromosome bands 9p21 (type I interferon [IFN-I] gene cluster), 21q22.11 (IFN-I receptors 1 and 2), and 21q22.3 (Mx1, Mx2) are shown as dark bands on their respective chromosomes. B) The karyotype of subject B1 (the mother of subjects UB1 and UB2) was determined by GTG-banding. Right, diagram of 9;21 and the derivative chromosomes from subjects B1, B2, and B3.
97
Figure 5-3. Autoantibody testing. A) Fluorescence antinuclear antibody test. HeLa cells were stained with sera from subjects UB1, UB2, and B1 (1:160) followed by Alexa-conjugated goat anti-human IgG and 4 ,6-diamidino-2-phenylindole staining as described in patients and methods. Subject UB1, nucleoplasmic immunofluorescence pattern. Subject UB2, cytoplasmic pattern. Subject B1, no difference from control normal human serum (not shown). B) Immunoprecipitation. Serum samples from subjects UB1, UB2, and B1, B2, and B3 were used to immunoprecipitate proteins from 35S-methonine/cysteine-labeled K562 cell extract followed by analysis on 12.5% sodium dodecyl sulfate-polyacrylamide gels. Radiolabeled proteins were detected by fluorography. Sm = anti-Sm reference serum; Ro/La = anti-Ro/SSA/anti-La/SSB reference serum; Ro = anti-Ro/SSA reference serum; N = normal human serum. Positions of the U1 small ribonucleoprotein antigens A, B /B, C, D1/D2/D3, E, F, and G as well as the 200K (doublet) U5 small ribonucleoprotein antigens are indicated. Anti-Sm antibodies immunoprecipitate A-G plus 200K, whereas anti-RNP antibodies immunoprecipitate only A-G. Positions of the Ro60 and La/SSB antigens are also indicated.
98
Figure 5-4. Type I interferon (IFN) expression. Peripheral blood mononuclear cells (PBMCs) were isolated as described in patients and methods. Expression of IFN 4 (A), IFN (B), the IFN-inducible gene Mx1 (C), and interleukin-6 (IL-6) (D) was analyzed by real-time polymerase chain reaction. Total RNA was isolated from PBMCs (subjects UB1, UB2, and B1) and from patients with systemic lupus erythematosus (SLE) and 10 healthy controls (NHC).
SLE NHC B1 UB2 UB10
25
50
75
100
Mx1
exp
ress
ion
SLE NHC B1 UB2 UB10
25
50
75
100
IL-6
exp
ress
ion
SLE NHC B1 UB2 UB10
200
400
600IF
Nα
4 ex
pres
sion
SLE NHC B1 UB2 UB10
25
50
75
100
IFNβ
expr
essi
on
A
C
B
D
D
99
Figure 5-5. Regulation of interferon (IFN) production. A) Gene expression pattern in subject UB2 remains similar over time. RNA was isolated from peripheral blood mononuclear cells (subject UB2) on 2 separate occasions 10 months apart, and Mx1, IFN , IFN 4, IFNAR2, interleukin-6 (IL-6), and tumor necrosis factor (TNF ) gene expression was measured by real-time polymerase chain reaction. B) Low numbers of circulating plasmacytoid dendritic cells (PDC). Numbers of circulating plasmacytoid dendritic cells (Lin-,HLA-DR+,CD123+,CD11c-) in peripheral blood of subjects UB1, UB2, and B1 and from 10 patients with systemic lupus erythematosus (SLE) and 10 healthy controls (NHC) were enumerated by flow cytometry. Bars show the median, boxes indicate the 25th and 75th percentiles, and bars outside the boxes indicate the 10th and 90th percentiles.
UB2 UB2 B10
100
200
Mx1IFNbIFNa4IFNAR2IL-6TNFa
1000
2000R
elat
ive
expr
essi
onA
NHC SLE B1 UB1 UB20.0
0.4
0.8
1.2
Per
cent
age
of P
DC
B
100
CHAPTER 6 CONCLUSION AND FUTURE DIRECTIONS
The main goal of this research was to study the role of IFN-I and IFN-I producing cells in
the pathogenesis of SLE. IFN-I levels were assessed using real-time PCR to measure IFN-I
inducible gene expression. IFN-I producing cells were characterized in the peripheral blood of
lupus patients and finally, individuals with a trisomy of chromosome 9p (location of the Type I
interferon gene cluster) provided a natural model to study the effects of IFN-I over-production in
the pathogenesis of lupus.
We found that IFN-I is up-regulated in patients with SLE in comparison with healthy
controls and patients with other autoimmune disease. Abnormally high IFN-I inducible gene
expression (Mx1) was seen in about 30% of lupus patients. The high IFN-I levels were not
associated with age, race or gender. Common treatments of SLE (low-does corticosteroids,
antimalarials) did not have significant effects on IFN-I levels although high does of
corticosteroids (e.g. 1 gram of methylprednisolone IV daily for 3 days) did reduce IFN-I
expression dramatically. High IFN-I levels in SLE were associated with the production of certain
autoantibodies, such as ANA, anti-dsDNA, anti-Sm/RNP antibodies and was negatively
associated with antiphospholipid antibodies. High IFN-I levels were also associated with active
disease. The numbers of PDCs, the most efficient IFN producing cells, as well as MDCs were
significantly decreased in lupus circulation. We further demonstrated that low PDC/MDC counts
were correlated with production of anti-Sm/RNP antibodies and negatively associated with
antiphospholipid antibodies. Low PDC/MDC counts were seen in patients with renal
involvement as well as more extensive disease.
Secondly, we found increased numbers of circulating CD14+CD71+ monocytes in SLE
compared with healthy controls. The numbers of these cells were negatively correlated with PDC
101
numbers and positively with IFN-I levels in lupus patients. These cells produced significantly
higher IFN-I in compared with CD14+CD71- or CD14- cells. We also found increased TLR7
expression on lupus monocytes. Stimulation with the TLR7 ligand loxoribine induced IFN-I as
well as IL-6 production by lupus monocytes. Stimulation of LPS (TLR4 ligand) also stimulated
IFN-I by SLE monocytes, but less efficiently than loxoribine. We also found that the numbers of
CD14+CD71+ monocytes were higher in patients with antibodies against U1 small nuclear
ribonucleoproteins (snRNPs), suggesting that endogenous RNA ligands for TLR7 might play a
role in the pathogenesis of the “interferon signature” in SLE patients..
Finally we reported a pedigree with a chromosomal translocation involving chromosomes
9 and 21. Three individuals with a balanced translocation had no signs of autoimmunity. Two
other family members had chromosome aberrations due to a 1:3 segregation resulting in trisomy
of the proximal arm of 9q including the IFN-I cluster which is located on 9p22 as well as
monosomy of the proximal arm of 21q. Both patients with trisomy of 9p presented with
lupus-like autoimmunity and production of ANA as well as anti Sm/RNP or anti-Ro60
antibodies. Both patients had higher IFN-I levels than the normal family members with balanced
translocation or normal controls. IFN-I levels were comparable to those found in idiopathic lupus.
Interestingly both patients had low dendritic cell numbers, similar to SLE patients, and this was
also seen in their mother’s peripheral blood (balanced translocation 9:21 without autoimmunity).
Type I interferon is important cytokine in both innate and adaptive immunity. In addition
to its antiviral effects, IFN-I also induces MHC class II expression on antigen presenting cells,
promotes dendritic cell (DC) maturation and survival and the survival of activated T cells and
antigen-activated B cells. The high IFN-I levels as well as low dendritic cell count might be
explained by the maturation of DCs. It has been proposed that upon maturation, PDCs upregulate
102
expression of chemokine receptor CCR7 and become responsive to chemokines such as SLC and
ELC, resulting in migration out of the circulation and into secondary lymphoid tissues. Further
studies of the distribution as well as maturation of dendritic cells, monocytes, and macrophages
in skin, kidney and other lymphoid tissues will be helpful to understand the fate of IFN-I
producing cells in SLE. Gene expression assays and immunostaining of IFN-I in these tissues
could be used to define the origin of IFN-I directly.
A monocyte phagocytosis defect affecting the clearance of dying cells has been reported in
about half of lupus patients. In the TMPD-lupus model, immature interferon producing
monocytes also are poorly phagocytic. We hypothesized that similar cells in the peripheral blood
of SLE patients might be responsible for the observed monocyte phagocytosis defect. To test this
hypothesis, phagocytosis assays will be carried out in the future using purified CD14+CD71+
monocytes and CD14+CD71- monocytes.
Genomic variability exists in different scales, including SNP, small insertion and deletions,
and large scale chromosome structure variations. Here we reported patients with unbalanced
translocation between Chromosome 9 and 21 developed a lupus like disease, suggesting gene
dosage effect of IFN cluster was responsible for the increased risk of SLE. With recent
development of gene array technology, several studies have revealed the existence of copy
number variants of small DNA regions (248, 249). This phenomenon exists abundantly not only
under pathogenic conditions but also in normal individuals. To test the hypothesis that the
elevated production of IFN-I in subgroup of SLE patients might due to copy number variants of
IFN cluster, microarray experiments of regions related to IFN cluster will be performed.
In conclusion, IFN-I produced by a novel population of immature CD71+) monocytes
appear to be a significant factor in the pathogeneisis of SLE.
103
104
LIST OF REFERENCES
1. Silverstein, A. M. 2001. Autoimmunity versus horror autotoxicus: the struggle for recognition. Nat Immunol 2:279-281.
2. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271-1277.
3. Formiga, F., I. Moga, M. Pac, F. Mitjavila, A. Rivera, and R. Pujol. 1999. Mild presentation of systemic lupus erythematosus in elderly patients assessed by SLEDAI. SLE Disease Activity Index. Lupus 8:462-465.
4. Fessel, W. J. 1988. Epidemiology of systemic lupus erythematosus. Rheum Dis Clin North Am 14:15-23.
5. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachman, P. Roy-Burman, A. Walker, and T. M. Mack. 1992. A revised estimate of twin concordance in systemic lupus erythematosus. Arthritis Rheum 35:311-318.
6. Hochberg, M. C. 1987. The application of genetic epidemiology to systemic lupus erythematosus. J Rheumatol 14:867-869.
7. Sestak, A. L., T. S. Shaver, K. L. Moser, B. R. Neas, and J. B. Harley. 1999. Familial aggregation of lupus and autoimmunity in an unusual multiplex pedigree. J Rheumatol 26:1495-1499.
8. Moser, K. L., B. R. Neas, J. E. Salmon, H. Yu, C. Gray-McGuire, N. Asundi, G. R. Bruner, J. Fox, J. Kelly, S. Henshall, D. Bacino, M. Dietz, R. Hogue, G. Koelsch, L. Nightingale, T. Shaver, N. I. Abdou, D. A. Albert, C. Carson, M. Petri, E. L. Treadwell, J. A. James, and J. B. Harley. 1998. Genome scan of human systemic lupus erythematosus: evidence for linkage on chromosome 1q in African-American pedigrees. Proc Natl Acad Sci U S A 95:14869-14874.
9. Gray-McGuire, C., K. L. Moser, P. M. Gaffney, J. Kelly, H. Yu, J. M. Olson, C. M. Jedrey, K. B. Jacobs, R. P. Kimberly, B. R. Neas, S. S. Rich, T. W. Behrens, and J. B. Harley. 2000. Genome scan of human systemic lupus erythematosus by regression modeling: evidence of linkage and epistasis at 4p16-15.2. Am J Hum Genet 67:1460-1469.
10. Gaffney, P. M., W. A. Ortmann, S. A. Selby, K. B. Shark, T. C. Ockenden, K. E. Rohlf, N. L. Walgrave, W. P. Boyum, M. L. Malmgren, M. E. Miller, G. M. Kearns, R. P. Messner, R. A. King, S. S. Rich, and T. W. Behrens. 2000. Genome screening in human systemic lupus erythematosus: results from a second Minnesota cohort and combined analyses of 187 sib-pair families. Am J Hum Genet 66:547-556.
105
11. Gaffney, P. M., G. M. Kearns, K. B. Shark, W. A. Ortmann, S. A. Selby, M. L. Malmgren, K. E. Rohlf, T. C. Ockenden, R. P. Messner, R. A. King, S. S. Rich, and T. W. Behrens. 1998. A genome-wide search for susceptibility genes in human systemic lupus erythematosus sib-pair families. Proc Natl Acad Sci U S A 95:14875-14879.
12. Yap, S. N., M. E. Phipps, M. Manivasagar, S. Y. Tan, and J. J. Bosco. 1999. Human Fc gamma receptor IIA (FcgammaRIIA) genotyping and association with systemic lupus erythematosus (SLE) in Chinese and Malays in Malaysia. Lupus 8:305-310.
13. Leppers-van de Straat, F. G., W. L. van der Pol, M. D. Jansen, N. Sugita, H. Yoshie, T. Kobayashi, and J. G. van de Winkel. 2000. A novel PCR-based method for direct Fc gamma receptor IIIa (CD16) allotyping. J Immunol Methods 242:127-132.
14. Oh, M., M. A. Petri, N. A. Kim, and K. E. Sullivan. 1999. Frequency of the Fc gamma RIIIA-158F allele in African American patients with systemic lupus erythematosus. J Rheumatol 26:1486-1489.
15. Seligman, V. A., C. Suarez, R. Lum, S. E. Inda, D. Lin, H. Li, J. L. Olson, M. F. Seldin, and L. A. Criswell. 2001. The Fcgamma receptor IIIA-158F allele is a major risk factor for the development of lupus nephritis among Caucasians but not non-Caucasians. Arthritis Rheum 44:618-625.
16. Kobayashi, T., S. Ito, K. Yamamoto, H. Hasegawa, N. Sugita, T. Kuroda, S. Kaneko, I. Narita, K. Yasuda, M. Nakano, F. Gejyo, and H. Yoshie. 2003. Risk of periodontitis in systemic lupus erythematosus is associated with Fcgamma receptor polymorphisms. J Periodontol 74:378-384.
17. Yun, H. R., H. K. Koh, S. S. Kim, W. T. Chung, D. W. Kim, K. P. Hong, G. G. Song, H. K. Chang, J. Y. Choe, S. C. Bae, J. E. Salmon, D. H. Yoo, T. Y. Kim, and S. Y. Kim. 2001. FcgammaRIIa/IIIa polymorphism and its association with clinical manifestations in Korean lupus patients. Lupus 10:466-472.
18. Zuniga, R., S. Ng, M. G. Peterson, J. D. Reveille, B. A. Baethge, G. S. Alarcon, and J. E. Salmon. 2001. Low-binding alleles of Fcgamma receptor types IIA and IIIA are inherited independently and are associated with systemic lupus erythematosus in Hispanic patients. Arthritis Rheum 44:361-367.
19. Aitman, T. J., R. Dong, T. J. Vyse, P. J. Norsworthy, M. D. Johnson, J. Smith, J. Mangion, C. Roberton-Lowe, A. J. Marshall, E. Petretto, M. D. Hodges, G. Bhangal, S. G. Patel, K. Sheehan-Rooney, M. Duda, P. R. Cook, D. J. Evans, J. Domin, J. Flint, J. J. Boyle, C. D. Pusey, and H. T. Cook. 2006. Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature 439:851-855.
20. Szalai, A. J., M. A. McCrory, G. S. Cooper, J. Wu, and R. P. Kimberly. 2002. Association between baseline levels of C-reactive protein (CRP) and a dinucleotide repeat polymorphism in the intron of the CRP gene. Genes Immun 3:14-19.
106
21. Russell, A. I., D. S. Cunninghame Graham, C. Shepherd, C. A. Roberton, J. Whittaker, J. Meeks, R. J. Powell, D. A. Isenberg, M. J. Walport, and T. J. Vyse. 2004. Polymorphism at the C-reactive protein locus influences gene expression and predisposes to systemic lupus erythematosus. Hum Mol Genet 13:137-147.
22. Goldberg, M. A., F. C. Arnett, W. B. Bias, and L. E. Shulman. 1976. Histocompatibility antigens in systemic lupus erythematosus. Arthritis Rheum 19:129-132.
23. Salmon, J. E., R. P. Kimberly, A. Gibofsky, and M. Fotino. 1986. Altered phagocytosis by monocytes from HLA-DR2 and DR3-positive healthy adults is Fc gamma receptor specific. J Immunol 136:3625-3630.
24. Kachru, R. B., W. Sequeira, K. K. Mittal, M. E. Siegel, and M. Telischi. 1984. A significant increase of HLA-DR3 and DR2 in systemic lupus erythematosus among blacks. J Rheumatol 11:471-474.
25. Hamilton, R. G., J. B. Harley, W. B. Bias, M. Roebber, M. Reichlin, M. C. Hochberg, and F. C. Arnett. 1988. Two Ro (SS-A) autoantibody responses in systemic lupus erythematosus. Correlation of HLA-DR/DQ specificities with quantitative expression of Ro (SS-A) autoantibody. Arthritis Rheum 31:496-505.
26. Dumortier, H., M. Abbal, M. Fort, J. P. Briand, A. Cantagrel, and S. Muller. 1999. MHC class II gene associations with autoantibodies to U1A and SmD1 proteins. Int Immunol 11:249-257.
27. Sanchez, M. L., K. Katsumata, T. Atsumi, F. I. Romero, M. L. Bertolaccini, A. Funke, O. Amengual, E. Kondeatis, R. W. Vaughan, A. Cox, G. R. Hughes, and M. A. Khamashta. 2004. Association of HLA-DM polymorphism with the production of antiphospholipid antibodies. Ann Rheum Dis 63:1645-1648.
28. Schur, P. H., I. Meyer, M. Garovoy, and C. B. Carpenter. 1982. Associations between systemic lupus erythematosus and the major histocompatibility complex: clinical and immunological considerations. Clin Immunol Immunopathol 24:263-275.
29. Christiansen, F. T., R. L. Dawkins, G. Uko, J. McCluskey, P. H. Kay, and P. J. Zilko. 1983. Complement allotyping in SLE: association with C4A null. Aust N Z J Med 13:483-488.
30. Fielder, A. H., M. J. Walport, J. R. Batchelor, R. I. Rynes, C. M. Black, I. A. Dodi, and G. R. Hughes. 1983. Family study of the major histocompatibility complex in patients with systemic lupus erythematosus: importance of null alleles of C4A and C4B in determining disease susceptibility. Br Med J (Clin Res Ed) 286:425-428.
31. Sigurdsson, S., G. Nordmark, H. H. Goring, K. Lindroos, A. C. Wiman, G. Sturfelt, A. Jonsen, S. Rantapaa-Dahlqvist, B. Moller, J. Kere, S. Koskenmies, E. Widen, M. L. Eloranta, H. Julkunen, H. Kristjansdottir, K. Steinsson, G. Alm, L. Ronnblom, and A. C. Syvanen. 2005. Polymorphisms in the tyrosine kinase 2 and interferon regulatory factor 5 genes are associated with systemic lupus erythematosus. Am J Hum Genet 76:528-537.
107
32. Graham, R. R., S. V. Kozyrev, E. C. Baechler, M. V. Reddy, R. M. Plenge, J. W. Bauer, W. A. Ortmann, T. Koeuth, M. F. Gonzalez Escribano, B. Pons-Estel, M. Petri, M. Daly, P. K. Gregersen, J. Martin, D. Altshuler, T. W. Behrens, and M. E. Alarcon-Riquelme. 2006. A common haplotype of interferon regulatory factor 5 (IRF5) regulates splicing and expression and is associated with increased risk of systemic lupus erythematosus. Nat Genet 38:550-555.
33. Mancl, M. E., G. Hu, N. Sangster-Guity, S. L. Olshalsky, K. Hoops, P. Fitzgerald-Bocarsly, P. M. Pitha, K. Pinder, and B. J. Barnes. 2005. Two discrete promoters regulate the alternatively spliced human interferon regulatory factor-5 isoforms. Multiple isoforms with distinct cell type-specific expression, localization, regulation, and function. J Biol Chem 280:21078-21090.
34. Garnier, S., P. Dieude, L. Michou, S. Barbet, A. Tan, S. Lasbleiz, T. Bardin, B. Prum, and F. Cornelis. 2007. IRF5 rs2004640-T allele, the new genetic factor for systemic lupus erythematosus, is not associated with rheumatoid arthritis. Ann Rheum Dis 66:828-831.
35. Sanchez, F. O., M. V. Linga Reddy, K. Sakuraba, M. Stahle, and M. E. Alarcon-Riquelme. 2008. IFN-Regulatory Factor 5 Gene Variants Interact with the Class I MHC Locus in the Swedish Psoriasis Population. J Invest Dermatol.
36. Cunninghame Graham, D. S., H. Manku, S. Wagner, J. Reid, K. Timms, A. Gutin, J. S. Lanchbury, and T. J. Vyse. 2007. Association of IRF5 in UK SLE families identifies a variant involved in polyadenylation. Hum Mol Genet 16:579-591.
37. Shilyansky, J., P. Jacobs, K. Doffek, and S. L. Sugg. 2007. Induction of cytolytic T lymphocytes against pediatric solid tumors in vitro using autologous dendritic cells pulsed with necrotic primary tumor. J Pediatr Surg 42:54-61; discussion 61.
38. Cavanagh, L. L., R. S. Barnetson, A. Basten, and G. M. Halliday. 1997. Dendritic epidermal T-cell involvement in induction of CD8+ T cell-mediated immunity against an ultraviolet radiation-induced skin tumor. Int J Cancer 70:98-105.
39. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethyl-pentadecane (pristane). Am J Pathol 168:1227-1240.
40. Rubin, R. L. 2005. Drug-induced lupus. Toxicology 209:135-147.
41. Elkayam, O., M. Yaron, and D. Caspi. 1999. Minocycline-induced autoimmune syndromes: an overview. Semin Arthritis Rheum 28:392-397.
42. Bonaci-Nikolic, B., M. M. Nikolic, S. Andrejevic, S. Zoric, and M. Bukilica. 2005. Antineutrophil cytoplasmic antibody (ANCA)-associated autoimmune diseases induced by antithyroid drugs: comparison with idiopathic ANCA vasculitides. Arthritis Res Ther 7:R1072-1081.
108
43. Reiser, K. M., and J. A. Last. 1979. Silicosis and fibrogenesis: fact and artifact. Toxicology 13:51-72.
44. Haustein, U. F., V. Ziegler, K. Herrmann, J. Mehlhorn, and C. Schmidt. 1990. Silica-induced scleroderma. J Am Acad Dermatol 22:444-448.
45. Askling, J., C. M. Fored, L. Brandt, E. Baecklund, L. Bertilsson, N. Feltelius, L. Coster, P. Geborek, L. T. Jacobsson, S. Lindblad, J. Lysholm, S. Rantapaa-Dahlqvist, T. Saxne, and L. Klareskog. 2005. Risks of solid cancers in patients with rheumatoid arthritis and after treatment with tumour necrosis factor antagonists. Ann Rheum Dis 64:1421-1426.
46. Khan, M. F., B. S. Kaphalia, B. S. Prabhakar, M. F. Kanz, and G. A. Ansari. 1995. Trichloroethene-induced autoimmune response in female MRL +/+ mice. Toxicol Appl Pharmacol 134:155-160.
47. Bigazzi, P. E. 1994. Autoimmunity and heavy metals. Lupus 3:449-453.
48. Vial, T., B. Nicolas, and J. Descotes. 1996. Clinical immunotoxicity of pesticides. J Toxicol Environ Health 48:215-229.
49. Pujol, F. H., and I. M. Cesari. 1990. Antigenicity of adult Schistosoma mansoni alkaline phosphatase. Parasite Immunol 12:189-198.
50. Sewell, D. L., E. K. Reinke, L. H. Hogan, M. Sandor, and Z. Fabry. 2002. Immunoregulation of CNS autoimmunity by helminth and mycobacterial infections. Immunol Lett 82:101-110.
51. Moran, A. P., and M. M. Prendergast. 2001. Molecular mimicry in Campylobacter jejuni and Helicobacter pylori lipopolysaccharides: contribution of gastrointestinal infections to autoimmunity. J Autoimmun 16:241-256.
52. Lo, W. F., A. S. Woods, A. DeCloux, R. J. Cotter, E. S. Metcalf, and M. J. Soloski. 2000. Molecular mimicry mediated by MHC class Ib molecules after infection with gram-negative pathogens. Nat Med 6:215-218.
53. Gharavi, A. E., S. S. Pierangeli, and E. N. Harris. 2003. Viral origin of antiphospholipid antibodies: endothelial cell activation and thrombus enhancement by CMV peptide-induced APL antibodies. Immunobiology 207:37-42.
54. Garzelli, C., A. Pacciardi, F. Basolo, and G. Falcone. 1989. Mechanisms other than polyclonal B cell activation possibly involved in Epstein-Barr virus-induced autoimmunity. Clin Exp Immunol 76:412-416.
55. Smeenk, R., T. Westgeest, and T. Swaak. 1985. Antinuclear antibody determination: the present state of diagnostic and clinical relevance. Scand J Rheumatol Suppl 56:78-92.
56. Hahn, B. H. 1998. Antibodies to DNA. N Engl J Med 338:1359-1368.
109
57. Silverstein, A. M. 2000. Clemens Freiherr von Pirquet: explaining immune complex disease in 1906. Nat Immunol 1:453-455.
58. Bombardier, C., D. D. Gladman, M. B. Urowitz, D. Caron, and C. H. Chang. 1992. Derivation of the SLEDAI. A disease activity index for lupus patients. The Committee on Prognosis Studies in SLE. Arthritis Rheum 35:630-640.
59. Liang, M. H., S. A. Socher, W. N. Roberts, and J. M. Esdaile. 1988. Measurement of systemic lupus erythematosus activity in clinical research. Arthritis Rheum 31:817-825.
60. Symmons, D. P., J. S. Coppock, P. A. Bacon, B. Bresnihan, D. A. Isenberg, P. Maddison, N. McHugh, M. L. Snaith, and A. S. Zoma. 1988. Development and assessment of a computerized index of clinical disease activity in systemic lupus erythematosus. Members of the British Isles Lupus Assessment Group (BILAG). Q J Med 69:927-937.
61. Hench, P. 1950. Effects of cortisone in the rheumatic diseases. Lancet 2:483-484.
62. Barnes, P. J., and M. Karin. 1997. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336:1066-1071.
63. Berrebi, D., S. Bruscoli, N. Cohen, A. Foussat, G. Migliorati, L. Bouchet-Delbos, M. C. Maillot, A. Portier, J. Couderc, P. Galanaud, M. Peuchmaur, C. Riccardi, and D. Emilie. 2003. Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an anti-inflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10. Blood 101:729-738.
64. Ertel, W., M. H. Morrison, A. Ayala, and I. H. Chaudry. 1991. Chloroquine attenuates hemorrhagic shock-induced suppression of Kupffer cell antigen presentation and major histocompatibility complex class II antigen expression through blockade of tumor necrosis factor and prostaglandin release. Blood 78:1781-1788.
65. Fox, R. I., and H. I. Kang. 1993. Mechanism of action of antimalarial drugs: inhibition of antigen processing and presentation. Lupus 2 Suppl 1:S9-12.
66. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale, A. Iwasaki, and R. A. Flavell. 2004. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A 101:5598-5603.
67. Moreland, L. W., S. W. Baumgartner, M. H. Schiff, E. A. Tindall, R. M. Fleischmann, A. L. Weaver, R. E. Ettlinger, S. Cohen, W. J. Koopman, K. Mohler, M. B. Widmer, and C. M. Blosch. 1997. Treatment of rheumatoid arthritis with a recombinant human tumor necrosis factor receptor (p75)-Fc fusion protein. N Engl J Med 337:141-147.
68. Lipsky, P. E., D. M. van der Heijde, E. W. St Clair, D. E. Furst, F. C. Breedveld, J. R. Kalden, J. S. Smolen, M. Weisman, P. Emery, M. Feldmann, G. R. Harriman, and R. N. Maini. 2000. Infliximab and methotrexate in the treatment of rheumatoid arthritis. Anti-Tumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group. N Engl J Med 343:1594-1602.
110
69. Weinblatt, M. E., E. C. Keystone, D. E. Furst, L. W. Moreland, M. H. Weisman, C. A. Birbara, L. A. Teoh, S. A. Fischkoff, and E. K. Chartash. 2003. Adalimumab, a fully human anti-tumor necrosis factor alpha monoclonal antibody, for the treatment of rheumatoid arthritis in patients taking concomitant methotrexate: the ARMADA trial. Arthritis Rheum 48:35-45.
70. Johnston, A., J. E. Gudjonsson, H. Sigmundsdottir, B. R. Ludviksson, and H. Valdimarsson. 2005. The anti-inflammatory action of methotrexate is not mediated by lymphocyte apoptosis, but by the suppression of activation and adhesion molecules. Clin Immunol 114:154-163.
71. Segal, R., M. Dayan, H. Zinger, and E. Mozes. 1995. Methotrexate treatment in murine experimental systemic lupus erythematosus (SLE); clinical benefits associated with cytokine manipulation. Clin Exp Immunol 101:66-72.
72. Ginzler, E. M., M. A. Dooley, C. Aranow, M. Y. Kim, J. Buyon, J. T. Merrill, M. Petri, G. S. Gilkeson, D. J. Wallace, M. H. Weisman, and G. B. Appel. 2005. Mycophenolate mofetil or intravenous cyclophosphamide for lupus nephritis. N Engl J Med 353:2219-2228.
73. Zimmerman, R., J. Radhakrishnan, A. Valeri, and G. Appel. 2001. Advances in the treatment of lupus nephritis. Annu Rev Med 52:63-78.
74. Lee, M., and J. Park. 2006. Regulation of NFAT activation: a potential therapeutic target for immunosuppression. Mol Cells 22:1-7.
75. Manger, K., J. R. Kalden, and B. Manger. 1996. Cyclosporin A in the treatment of systemic lupus erythematosus: results of an open clinical study. Br J Rheumatol 35:669-675.
76. McLaughlin, P., C. A. White, A. J. Grillo-Lopez, and D. G. Maloney. 1998. Clinical status and optimal use of rituximab for B-cell lymphomas. Oncology (Williston Park) 12:1763-1769; discussion 1769-1770, 1775-1767.
77. Cragg, M. S., and M. J. Glennie. 2004. Antibody specificity controls in vivo effector mechanisms of anti-CD20 reagents. Blood 103:2738-2743.
78. Eisenberg, R., and D. Albert. 2006. B-cell targeted therapies in rheumatoid arthritis and systemic lupus erythematosus. Nat Clin Pract Rheumatol 2:20-27.
79. Crow, A. R., S. Song, J. W. Semple, J. Freedman, and A. H. Lazarus. 2001. IVIg inhibits reticuloendothelial system function and ameliorates murine passive-immune thrombocytopenia independent of anti-idiotype reactivity. Br J Haematol 115:679-686.
80. Shoenfeld, Y., L. Rauova, B. Gilburd, F. Kvapil, I. Goldberg, J. Kopolovic, J. Rovensky, and M. Blank. 2002. Efficacy of IVIG affinity-purified anti-double-stranded DNA anti-idiotypic antibodies in the treatment of an experimental murine model of systemic lupus erythematosus. Int Immunol 14:1303-1311.
111
81. Morel, L., and E. K. Wakeland. 1998. Susceptibility to lupus nephritis in the NZB/W model system. Curr Opin Immunol 10:718-725.
82. Steinberg, A. D. 1994. MRL-lpr/lpr disease: theories meet Fas. Semin Immunol 6:55-69.
83. Furukawa, F., and T. Yoshimasu. 2005. Animal models of spontaneous and drug-induced cutaneous lupus erythematosus. Autoimmun Rev 4:345-350.
84. Hayashi, Y., N. Haneji, and H. Hamano. 1994. Pathogenesis of Sjogren's syndrome-like autoimmune lesions in MRL/lpr mice. Pathol Int 44:559-568.
85. Hang, L. M., S. Izui, and F. J. Dixon. 1981. (NZW x BXSB)F1 hybrid. A model of acute lupus and coronary vascular disease with myocardial infarction. J Exp Med 154:216-221.
86. Pisitkun, P., J. A. Deane, M. J. Difilippantonio, T. Tarasenko, A. B. Satterthwaite, and S. Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312:1669-1672.
87. Satoh, M., and W. H. Reeves. 1994. Induction of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J Exp Med 180:2341-2346.
88. Isaacs, A., and J. Lindenmann. 1957. Virus interference. I. The interferon. Proc R Soc Lond B Biol Sci 147:258-267.
89. Isaacs, A., J. Lindenmann, and R. C. Valentine. 1957. Virus interference. II. Some properties of interferon. Proc R Soc Lond B Biol Sci 147:268-273.
90. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol 23:307-336.
91. Uze, G., G. Lutfalla, and I. Gresser. 1990. Genetic transfer of a functional human interferon alpha receptor into mouse cells: cloning and expression of its cDNA. Cell 60:225-234.
92. Novick, D., B. Cohen, and M. Rubinstein. 1994. The human interferon alpha/beta receptor: characterization and molecular cloning. Cell 77:391-400.
93. Su, L., and M. David. 2000. Distinct mechanisms of STAT phosphorylation via the interferon-alpha/beta receptor. Selective inhibition of STAT3 and STAT5 by piceatannol. J Biol Chem 275:12661-12666.
94. Samuel, C. E. 2001. Antiviral Actions of Interferons. Clin. Microbiol. Rev. 14:778-809.
95. de Veer, M. J., M. Holko, M. Frevel, E. Walker, S. Der, J. M. Paranjape, R. H. Silverman, and B. R. Williams. 2001. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol 69:912-920.
112
96. Kochs, G., and O. Haller. 1999. Interferon-induced human MxA GTPase blocks nuclear import of Thogoto virus nucleocapsids. Proc Natl Acad Sci U S A 96:2082-2086.
97. Towbin, H., A. Schmitz, D. Jakschies, P. Von Wussow, and M. A. Horisberger. 1992. A whole blood immunoassay for the interferon-inducible human Mx protein. J Interferon Res 12:67-74.
98. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, and A. N. Theofilopoulos. 2007. TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 13:543-551.
99. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat Immunol 7:131-137.
100. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu Rev Immunol 21:335-376.
101. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat Immunol 5:987-995.
102. Akira, S. 2003. Toll-like receptor signaling. J Biol Chem 278:38105-38108.
103. Liu, Y. J. 2005. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol 23:275-306.
104. Lund, J., A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki. 2003. Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. J Exp Med 198:513-520.
105. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:1529-1531.
106. Barton, G. M., and R. Medzhitov. 2004. Toll signaling: RIPping off the TNF pathway. Nat Immunol 5:472-474.
107. Akira, S., M. Yamamoto, and K. Takeda. 2003. Role of adapters in Toll-like receptor signalling. Biochem Soc Trans 31:637-642.
108. Sato, S., M. Sugiyama, M. Yamamoto, Y. Watanabe, T. Kawai, K. Takeda, and S. Akira. 2003. Toll/IL-1 receptor domain-containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulatory factor-3, in the Toll-like receptor signaling. J Immunol 171:4304-4310.
109. Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, and D. T. Golenbock. 2003. LPS-TLR4 Signaling to IRF-3/7 and NF-{kappa}B Involves the Toll Adapters TRAM and TRIF. J. Exp. Med. 198:1043-1055.
113
110. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737.
111. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ 13:816-825.
112. Meylan, E., and J. Tschopp. 2006. Toll-like receptors and RNA helicases: two parallel ways to trigger antiviral responses. Mol Cell 22:561-569.
113. Vitour, D., and E. F. Meurs. 2007. Regulation of interferon production by RIG-I and LGP2: a lesson in self-control. Sci STKE 2007:pe20.
114. Saito, T., R. Hirai, Y. M. Loo, D. Owen, C. L. Johnson, S. C. Sinha, S. Akira, T. Fujita, and M. Gale, Jr. 2007. Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proc Natl Acad Sci U S A 104:582-587.
115. Kang, D. C., R. V. Gopalkrishnan, Q. Wu, E. Jankowsky, A. M. Pyle, and P. B. Fisher. 2002. mda-5: An interferon-inducible putative RNA helicase with double-stranded RNA-dependent ATPase activity and melanoma growth-suppressive properties. Proc Natl Acad Sci U S A 99:637-642.
116. Kovacsovics, M., F. Martinon, O. Micheau, J. L. Bodmer, K. Hofmann, and J. Tschopp. 2002. Overexpression of Helicard, a CARD-containing helicase cleaved during apoptosis, accelerates DNA degradation. Curr Biol 12:838-843.
117. Yang, Y., C. T. Huang, X. Huang, and D. M. Pardoll. 2004. Persistent Toll-like receptor signals are required for reversal of regulatory T cell-mediated CD8 tolerance. Nat Immunol 5:508-515.
118. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101-105.
119. Ishii, K. J., C. Coban, H. Kato, K. Takahashi, Y. Torii, F. Takeshita, H. Ludwig, G. Sutter, K. Suzuki, H. Hemmi, S. Sato, M. Yamamoto, S. Uematsu, T. Kawai, O. Takeuchi, and S. Akira. 2006. A Toll-like receptor-independent antiviral response induced by double-stranded B-form DNA. Nat Immunol 7:40-48.
120. Eisenacher, K., C. Steinberg, W. Reindl, and A. Krug. 2007. The role of viral nucleic acid recognition in dendritic cells for innate and adaptive antiviral immunity. Immunobiology 212:701-714.
121. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr., S. Akira, S. Yonehara, A. Kato, and T. Fujita. 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175:2851-2858.
114
122. Brinkmann, V., T. Geiger, S. Alkan, and C. H. Heusser. 1993. Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J Exp Med 178:1655-1663.
123. Ousman, S. S., J. Wang, and I. L. Campbell. 2005. Differential regulation of interferon regulatory factor (IRF)-7 and IRF-9 gene expression in the central nervous system during viral infection. J Virol 79:7514-7527.
124. Taniguchi, T., and A. Takaoka. 2001. A weak signal for strong responses: interferon-alpha/beta revisited. Nat Rev Mol Cell Biol 2:378-386.
125. Kessler, D. S., S. A. Veals, X. Y. Fu, and D. E. Levy. 1990. Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev 4:1753-1765.
126. Tassiulas, I., X. Hu, H. Ho, Y. Kashyap, P. Paik, Y. Hu, C. A. Lowell, and L. B. Ivashkiv. 2004. Amplification of IFN-alpha-induced STAT1 activation and inflammatory function by Syk and ITAM-containing adaptors. Nat Immunol 5:1181-1189.
127. Luft, T., P. Luetjens, H. Hochrein, T. Toy, K. A. Masterman, M. Rizkalla, C. Maliszewski, K. Shortman, J. Cebon, and E. Maraskovsky. 2002. IFN-alpha enhances CD40 ligand-mediated activation of immature monocyte-derived dendritic cells. Int Immunol 14:367-380.
128. Sonmez, M., B. Sonmez, N. Eren, M. Yilmaz, S. S. Karti, and E. Ovali. 2004. Effects of interferon-alpha-2a on Th3 cytokine response in multiple myeloma patients. Tumori 90:387-389.
129. Reznikov, L. L., A. J. Puren, G. Fantuzzi, H. Muhl, L. Shapiro, D. Y. Yoon, D. L. Cutler, and C. A. Dinarello. 1998. Spontaneous and inducible cytokine responses in healthy humans receiving a single dose of IFN-alpha2b: increased production of interleukin-1 receptor antagonist and suppression of IL-1-induced IL-8. J Interferon Cytokine Res 18:897-903.
130. Song, M. M., and K. Shuai. 1998. The suppressor of cytokine signaling (SOCS) 1 and SOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral and antiproliferative activities. J Biol Chem 273:35056-35062.
131. Biron, C. A. 2001. Interferons alpha and beta as immune regulators--a new look. Immunity 14:661-664.
132. Ito, S., P. Ansari, M. Sakatsume, H. Dickensheets, N. Vazquez, R. P. Donnelly, A. C. Larner, and D. S. Finbloom. 1999. Interleukin-10 inhibits expression of both interferon alpha- and interferon gamma- induced genes by suppressing tyrosine phosphorylation of STAT1. Blood 93:1456-1463.
115
133. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005. Cross-regulation of TNF and IFN-alpha in autoimmune diseases. Proc Natl Acad Sci U S A 102:3372-3377.
134. Kang, M. J., Y. H. Lee, and J. Lee. 2006. Etanercept-induced systemic lupus erythematosus in a patient with rheumatoid arthritis. J Korean Med Sci 21:946-949.
135. Eriksson, C., S. Engstrand, K. G. Sundqvist, and S. Rantapaa-Dahlqvist. 2005. Autoantibody formation in patients with rheumatoid arthritis treated with anti-TNF alpha. Ann Rheum Dis 64:403-407.
136. Lamprecht, P. 2005. TNF-alpha inhibitors in systemic vasculitides and connective tissue diseases. Autoimmun Rev 4:28-34.
137. Wilson, L. E., D. Widman, S. H. Dikman, and P. D. Gorevic. 2002. Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum 32:163-173.
138. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1990. Possible induction of systemic lupus erythematosus by interferon-alpha treatment in a patient with a malignant carcinoid tumour. J Intern Med 227:207-210.
139. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1991. Autoimmunity after alpha-interferon therapy for malignant carcinoid tumors. Ann Intern Med 115:178-183.
140. Vallin, H., A. Perers, G. V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313.
141. Bennett, L., A. K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, and V. Pascual. 2003. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med 197:711-723.
142. Baechler, E. C., F. M. Batliwalla, G. Karypis, P. M. Gaffney, W. A. Ortmann, K. J. Espe, K. B. Shark, W. J. Grande, K. M. Hughes, V. Kapur, P. K. Gregersen, and T. W. Behrens. 2003. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. PNAS 100:2610-2615.
143. Hertz, C. J., S. M. Kiertscher, P. J. Godowski, D. A. Bouis, M. V. Norgard, M. D. Roth, and R. L. Modlin. 2001. Microbial lipopeptides stimulate dendritic cell maturation via Toll-like receptor 2. J Immunol 166:2444-2450.
144. Munz, C., R. M. Steinman, and S. Fujii. 2005. Dendritic cell maturation by innate lymphocytes: coordinated stimulation of innate and adaptive immunity. J Exp Med 202:203-207.
145. Blander, J. M. 2007. Coupling Toll-like receptor signaling with phagocytosis: potentiation of antigen presentation. Trends Immunol 28:19-25.
116
146. Hornell, T. M., T. Burster, F. L. Jahnsen, A. Pashine, M. T. Ochoa, J. J. Harding, C. Macaubas, A. W. Lee, R. L. Modlin, and E. D. Mellins. 2006. Human dendritic cell expression of HLA-DO is subset specific and regulated by maturation. J Immunol 176:3536-3547.
147. Shortman, K., and Y. J. Liu. 2002. Mouse and human dendritic cell subtypes. Nat Rev Immunol 2:151-161.
148. Caux, C., S. Ait-Yahia, K. Chemin, O. de Bouteiller, M. C. Dieu-Nosjean, B. Homey, C. Massacrier, B. Vanbervliet, A. Zlotnik, and A. Vicari. 2000. Dendritic cell biology and regulation of dendritic cell trafficking by chemokines. Springer Semin Immunopathol 22:345-369.
149. Pickl, W. F., O. Majdic, P. Kohl, J. Stockl, E. Riedl, C. Scheinecker, C. Bello-Fernandez, and W. Knapp. 1996. Molecular and functional characteristics of dendritic cells generated from highly purified CD14+ peripheral blood monocytes. J Immunol 157:3850-3859.
150. Blanco, P., A. K. Palucka, M. Gill, V. Pascual, and J. Banchereau. 2001. Induction of dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science 294:1540-1543.
151. Jefford, M., M. Schnurr, T. Toy, K. A. Masterman, A. Shin, T. Beecroft, T. Y. Tai, K. Shortman, M. Shackleton, I. D. Davis, P. Parente, T. Luft, W. Chen, J. Cebon, and E. Maraskovsky. 2003. Functional comparison of DCs generated in vivo with Flt3 ligand or in vitro from blood monocytes: differential regulation of function by specific classes of physiologic stimuli. Blood 102:1753-1763.
152. Facchetti, F., C. de Wolf-Peeters, D. Y. Mason, K. Pulford, J. J. van den Oord, and V. J. Desmet. 1988. Plasmacytoid T cells. Immunohistochemical evidence for their monocyte/macrophage origin. Am J Pathol 133:15-21.
153. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835-1837.
154. Diebold, S. S., M. Montoya, H. Unger, L. Alexopoulou, P. Roy, L. E. Haswell, A. Al-Shamkhani, R. Flavell, P. Borrow, and C. Reis e Sousa. 2003. Viral infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 424:324-328.
155. Hochrein, H., B. Schlatter, M. O'Keeffe, C. Wagner, F. Schmitz, M. Schiemann, S. Bauer, M. Suter, and H. Wagner. 2004. Herpes simplex virus type-1 induces IFN-{alpha} production via Toll-like receptor 9-dependent and -independent pathways. PNAS 101:11416-11421.
156. Ryman, K. D., K. C. Meier, E. M. Nangle, S. L. Ragsdale, N. L. Korneeva, R. E. Rhoads, M. R. MacDonald, and W. B. Klimstra. 2005. Sindbis virus translation is inhibited by a PKR/RNase L-independent effector induced by alpha/beta interferon priming of dendritic cells. J Virol 79:1487-1499.
117
157. Izaguirre, A., B. J. Barnes, S. Amrute, W. S. Yeow, N. Megjugorac, J. Dai, D. Feng, E. Chung, P. M. Pitha, and P. Fitzgerald-Bocarsly. 2003. Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J Leukoc Biol 74:1125-1138.
158. Tucci, M., N. Calvani, H. B. Richards, C. Quatraro, and F. Silvestris. 2005. The interplay of chemokines and dendritic cells in the pathogenesis of lupus nephritis. Ann N Y Acad Sci 1051:421-432.
159. W.H. Reeves, M. S. a. D. P. M. 2002. Autoantibody testing by non-FITC methods. Manual of Clinical Laboratory Immunology:pp. 933–950.
160. Ronnblom, L., and G. V. Alm. 2001. An etiopathogenic role for the type I IFN system in SLE. Trends Immunol 22:427-431.
161. Arnett, F. C., R. G. Hamilton, M. G. Roebber, J. B. Harley, and M. Reichlin. 1988. Increased frequencies of Sm and nRNP autoantibodies in American blacks compared to whites with systemic lupus erythematosus. J Rheumatol 15:1773-1776.
162. Craft, J. 1992. Antibodies to snRNPs in systemic lupus erythematosus. Rheum Dis Clin North Am 18:311-335.
163. Kelly, K. M., H. Zhuang, D. C. Nacionales, P. O. Scumpia, R. Lyons, J. Akaogi, P. Lee, B. Williams, M. Yamamoto, S. Akira, M. Satoh, and W. H. Reeves. 2006. "Endogenous adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60. Arthritis Rheum 54:1557-1567.
164. Le Bon, A., G. Schiavoni, G. D'Agostino, I. Gresser, F. Belardelli, and D. F. Tough. 2001. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14:461-470.
165. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, and Y.-J. Liu. 1999. The Nature of the Principal Type 1 Interferon-Producing Cells in Human Blood. Science 284:1835-1837.
166. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:919-923.
167. Grouard, G., M. C. Rissoan, L. Filgueira, I. Durand, J. Banchereau, and Y. J. Liu. 1997. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med 185:1101-1111.
168. Gill, M. A., P. Blanco, E. Arce, V. Pascual, J. Banchereau, and A. K. Palucka. 2002. Blood dendritic cells and DC-poietins in systemic lupus erythematosus. Hum Immunol 63:1172-1180.
118
169. Radvanyi, L. G., A. Banerjee, M. Weir, and H. Messner. 1999. Low levels of interferon-alpha induce CD86 (B7.2) expression and accelerates dendritic cell maturation from human peripheral blood mononuclear cells. Scand J Immunol 50:499-509.
170. Tough, D. F. 2004. Type I interferon as a link between innate and adaptive immunity through dendritic cell stimulation. Leuk Lymphoma 45:257-264.
171. Steinman, R. M., D. Hawiger, and M. C. Nussenzweig. 2003. Tolerogenic dendritic cells. Annu Rev Immunol 21:685-711.
172. Doyle, S., S. Vaidya, R. O'Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin, and G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17:251-263.
173. Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, and S. Bauer. 2004. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303:1526-1529.
174. Hartmann, G., G. J. Weiner, and A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S A 96:9305-9310.
175. Hornung, V., J. Schlender, M. Guenthner-Biller, S. Rothenfusser, S. Endres, K. K. Conzelmann, and G. Hartmann. 2004. Replication-dependent potent IFN-alpha induction in human plasmacytoid dendritic cells by a single-stranded RNA virus. J Immunol 173:5935-5943.
176. Gilli, F., A. Sala, C. Bancone, P. Salacone, M. Gallo, E. Gaia, and A. Bertolotto. 2002. Evaluation of IFNalpha bioavailability by MxA mRNA in HCV patients. J Immunol Methods 262:187-190.
177. Scheinman, R. I., P. C. Cogswell, A. K. Lofquist, and A. S. Baldwin, Jr. 1995. Role of transcriptional activation of I kappa B alpha in mediation of immunosuppression by glucocorticoids. Science 270:283-286.
178. Hardin, J. A., and T. Mimori. 1985. Autoantibodies to ribonucleoproteins. Clin Rheum Dis 11:485-505.
179. Pisetsky, D. S. 1992. Anti-DNA antibodies in systemic lupus erythematosus. Rheum Dis Clin North Am 18:437-454.
180. Maddison, P. J., and M. Reichlin. 1977. Quantitation of precipitating antibodies to certain soluble nuclear antigens in SLE. Arthritis Rheum 20:819-824.
181. Leadbetter, E. A., I. R. Rifkin, A. M. Hohlbaum, B. C. Beaudette, M. J. Shlomchik, and A. Marshak-Rothstein. 2002. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416:603-607.
119
182. Wagner, H. 2004. The immunobiology of the TLR9 subfamily. Trends Immunol 25:381-386.
183. Kirou, K. A., C. Lee, S. George, K. Louca, I. G. Papagiannis, M. G. Peterson, N. Ly, R. N. Woodward, K. E. Fry, A. Y. Lau, J. G. Prentice, J. G. Wohlgemuth, and M. K. Crow. 2004. Coordinate overexpression of interferon-alpha-induced genes in systemic lupus erythematosus. Arthritis Rheum 50:3958-3967.
184. Preble, O. T., R. J. Black, R. M. Friedman, J. H. Klippel, and J. Vilcek. 1982. Systemic lupus erythematosus: presence in human serum of an unusual acid-labile leukocyte interferon. Science 216:429-431.
185. Kim, T., Y. Kanayama, N. Negoro, M. Okamura, T. Takeda, and T. Inoue. 1987. Serum levels of interferons in patients with systemic lupus erythematosus. Clin Exp Immunol 70:562-569.
186. Bengtsson, A. A., G. Sturfelt, L. Truedsson, J. Blomberg, G. Alm, H. Vallin, and L. Ronnblom. 2000. Activation of type I interferon system in systemic lupus erythematosus correlates with disease activity but not with antiretroviral antibodies. Lupus 9:664-671.
187. Diaz, M. O., H. M. Pomykala, S. K. Bohlander, E. Maltepe, K. Malik, B. Brownstein, and O. I. Olopade. 1994. Structure of the human type-I interferon gene cluster determined from a YAC clone contig. Genomics 22:540-552.
188. de la Rosa, G., N. Longo, J. L. Rodriguez-Fernandez, A. Puig-Kroger, A. Pineda, A. L. Corbi, and P. Sanchez-Mateos. 2003. Migration of human blood dendritic cells across endothelial cell monolayers: adhesion molecules and chemokines involved in subset-specific transmigration. J Leukoc Biol 73:639-649.
189. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, and M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23-33.
190. Fonteneau, J. F., M. Larsson, A. S. Beignon, K. McKenna, I. Dasilva, A. Amara, Y. J. Liu, J. D. Lifson, D. R. Littman, and N. Bhardwaj. 2004. Human immunodeficiency virus type 1 activates plasmacytoid dendritic cells and concomitantly induces the bystander maturation of myeloid dendritic cells. J Virol 78:5223-5232.
191. Shodell, M., K. Shah, and F. P. Siegal. 2003. Circulating human plasmacytoid dendritic cells are highly sensitive to corticosteroid administration. Lupus 12:222-230.
192. Shodell, M., and F. P. Siegal. 2001. Corticosteroids depress IFN-alpha-producing plasmacytoid dendritic cells in human blood. J Allergy Clin Immunol 108:446-448.
193. Pulendran, B., J. Banchereau, S. Burkeholder, E. Kraus, E. Guinet, C. Chalouni, D. Caron, C. Maliszewski, J. Davoust, J. Fay, and K. Palucka. 2000. Flt3-ligand and granulocyte colony-stimulating factor mobilize distinct human dendritic cell subsets in vivo. J Immunol 165:566-572.
120
194. Ioannou, Y., and D. A. Isenberg. 2000. Current evidence for the induction of autoimmune rheumatic manifestations by cytokine therapy. Arthritis Rheum 43:1431-1442.
195. Casciola-Rosen, L. A., G. Anhalt, and A. Rosen. 1994. Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J Exp Med 179:1317-1330.
196. Ahonen, C. L., C. L. Doxsee, S. M. McGurran, T. R. Riter, W. F. Wade, R. J. Barth, J. P. Vasilakos, R. J. Noelle, and R. M. Kedl. 2004. Combined TLR and CD40 Triggering Induces Potent CD8+ T Cell Expansion with Variable Dependence on Type I IFN. J Exp Med 199:775-784.
197. Zhuang, H., S. Narain, E. Sobel, P. Y. Lee, D. C. Nacionales, K. M. Kelly, H. B. Richards, M. Segal, C. Stewart, M. Satoh, and W. H. Reeves. 2005. Association of anti-nucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin Immunol 117:238-250.
198. Zhuang, H., M. Kosboth, P. Lee, A. Rice, D. J. Driscoll, R. Zori, S. Narain, R. Lyons, M. Satoh, E. Sobel, and W. H. Reeves. 2006. Lupus-like disease and high interferon levels corresponding to trisomy of the type I interferon cluster on chromosome 9p. Arthritis Rheum 54:1573-1579.
199. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. Weinstein, R. Lyons, E. Sobel, M. Satoh, and W. H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783.
200. Lee, P. Y., J. S. Weinstein, D. C. Nacionales, P. O. Scumpia, Y. Li, E. Butfiloski, N. van Rooijen, L. Moldawer, M. Satoh, and W. H. Reeves. 2008. A Novel Type I IFN-Producing Cell Subset in Murine Lupus. J Immunol 180:5101-5108.
201. Herrmann, M., R. E. Voll, O. M. Zoller, M. Hagenhofer, B. B. Ponner, and J. R. Kalden. 1998. Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41:1241-1250.
202. Wen, L., S. A. Shinton, R. R. Hardy, and K. Hayakawa. 2005. Association of B-1 B cells with follicular dendritic cells in spleen. J Immunol 174:6918-6926.
203. Gaipl, U. S., L. E. Munoz, G. Grossmayer, K. Lauber, S. Franz, K. Sarter, R. E. Voll, T. Winkler, A. Kuhn, J. Kalden, P. Kern, and M. Herrmann. 2007. Clearance deficiency and systemic lupus erythematosus (SLE). J Autoimmun 28:114-121.
204. Ren, Y., J. Tang, M. Y. Mok, A. W. Chan, A. Wu, and C. S. Lau. 2003. Increased apoptotic neutrophils and macrophages and impaired macrophage phagocytic clearance of apoptotic neutrophils in systemic lupus erythematosus. Arthritis Rheum 48:2888-2897.
121
205. Steinbach, F., F. Henke, B. Krause, B. Thiele, G. R. Burmester, and F. Hiepe. 2000. Monocytes from systemic lupus erythematous patients are severely altered in phenotype and lineage flexibility. Ann Rheum Dis 59:283-288.
206. Qian, Z. M., H. Li, H. Sun, and K. Ho. 2002. Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway. Pharmacol Rev 54:561-587.
207. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cells in immunity. Nat Immunol 5:1219-1226.
208. Cederblad, B., S. Blomberg, H. Vallin, A. Perers, G. V. Alm, and L. Ronnblom. 1998. Patients with systemic lupus erythematosus have reduced numbers of circulating natural interferon-alpha- producing cells. J Autoimmun 11:465-470.
209. Farkas, L., K. Beiske, F. Lund-Johansen, P. Brandtzaeg, and F. L. Jahnsen. 2001. Plasmacytoid dendritic cells (natural interferon- alpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol 159:237-243.
210. Blomberg, S., M. L. Eloranta, B. Cederblad, K. Nordlin, G. V. Alm, and L. Ronnblom. 2001. Presence of cutaneous interferon-alpha producing cells in patients with systemic lupus erythematosus. Lupus 10:484-490.
211. Hume, D. A. 2006. The mononuclear phagocyte system. Curr Opin Immunol 18:49-53.
212. Leon, B., M. Lopez-Bravo, and C. Ardavin. 2005. Monocyte-derived dendritic cells. Semin Immunol 17:313-318.
213. Ronnblom, L., and G. V. Alm. 2001. A pivotal role for the natural interferon alpha-producing cells (plasmacytoid dendritic cells) in the pathogenesis of lupus. J Exp Med 194:F59-63.
214. Mohty, M., A. Vialle-Castellano, J. A. Nunes, D. Isnardon, D. Olive, and B. Gaugler. 2003. IFN-{alpha} Skews Monocyte Differentiation into Toll-Like Receptor 7-Expressing Dendritic Cells with Potent Functional Activities. J Immunol 171:3385-3393.
215. Subramanian, S., K. Tus, Q. Z. Li, A. Wang, X. H. Tian, J. Zhou, C. Liang, G. Bartov, L. D. McDaniel, X. J. Zhou, R. A. Schultz, and E. K. Wakeland. 2006. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci U S A 103:9970-9975.
216. Lau, C. M., C. Broughton, A. S. Tabor, S. Akira, R. A. Flavell, M. J. Mamula, S. R. Christensen, M. J. Shlomchik, G. A. Viglianti, I. R. Rifkin, and A. Marshak-Rothstein. 2005. RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J Exp Med 202:1171-1177.
122
217. Lovgren, T., M. L. Eloranta, U. Bave, G. V. Alm, and L. Ronnblom. 2004. Induction of interferon-alpha production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG. Arthritis Rheum 50:1861-1872.
218. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, and T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 434:1035-1040.
219. Honda, K., and T. Taniguchi. 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 6:644-658.
220. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol 34:796-805.
221. Barnes, B. J., J. Richards, M. Mancl, S. Hanash, L. Beretta, and P. M. Pitha. 2004. Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection. J Biol Chem 279:45194-45207.
222. Lu, R., and P. M. Pitha. 2001. Monocyte differentiation to macrophage requires interferon regulatory factor 7. J Biol Chem 276:45491-45496.
223. Sykes, D. B., J. Scheele, M. Pasillas, and M. P. Kamps. 2003. Transcriptional profiling during the early differentiation of granulocyte and monocyte progenitors controlled by conditional versions of the E2a-Pbx1 oncoprotein. Leuk Lymphoma 44:1187-1199.
224. Guiducci, C., G. Ott, J. H. Chan, E. Damon, C. Calacsan, T. Matray, K. D. Lee, R. L. Coffman, and F. J. Barrat. 2006. Properties regulating the nature of the plasmacytoid dendritic cell response to Toll-like receptor 9 activation. J Exp Med 203:1999-2008.
225. Koffler, D., V. Agnello, R. Thoburn, and H. G. Kunkel. 1971. Systemic lupus erythematosus: prototype of immune complex nephritis in man. J Exp Med 134:169s-179s.
226. Morel, L., U. H. Rudofsky, J. A. Longmate, J. Schiffenbauer, and E. K. Wakeland. 1994. Polygenic control of susceptibility to murine systemic lupus erythematosus. Immunity 1:219-229.
227. Hess, E. V., and Y. Farhey. 1994. Epidemiology, genetics, etiology, and environment relationships of systemic lupus erythematosus. Curr Opin Rheumatol 6:474-480.
228. Boackle, S. A., V. M. Holers, X. Chen, G. Szakonyi, D. R. Karp, E. K. Wakeland, and L. Morel. 2001. Cr2, a candidate gene in the murine Sle1c lupus susceptibility locus, encodes a dysfunctional protein. Immunity 15:775-785.
123
229. Salmon, J. E., S. Millard, L. A. Schachter, F. C. Arnett, E. M. Ginzler, M. F. Gourley, R. Ramsey-Goldman, M. G. Peterson, and R. P. Kimberly. 1996. Fc gamma RIIA alleles are heritable risk factors for lupus nephritis in African Americans. J Clin Invest 97:1348-1354.
230. Sen, G. C., and R. M. Ransohoff. 1993. Interferon-induced antiviral actions and their regulation. Adv Virus Res 42:57-102.
231. Dalod, M., T. Hamilton, R. Salomon, T. P. Salazar-Mather, S. C. Henry, J. D. Hamilton, and C. A. Biron. 2003. Dendritic cell responses to early murine cytomegalovirus infection: subset functional specialization and differential regulation by interferon alpha/beta. J Exp Med 197:885-898.
232. Fountain, J. W., M. Karayiorgou, D. Taruscio, S. L. Graw, A. J. Buckler, D. C. Ward, N. C. Dracopoli, and D. E. Housman. 1992. Genetic and physical map of the interferon region on chromosome 9p. Genomics 14:105-112.
233. Humphray, S. J., K. Oliver, A. R. Hunt, R. W. Plumb, J. E. Loveland, K. L. Howe, T. D. Andrews, S. Searle, S. E. Hunt, C. E. Scott, M. C. Jones, R. Ainscough, J. P. Almeida, K. D. Ambrose, R. I. Ashwell, A. K. Babbage, S. Babbage, C. L. Bagguley, J. Bailey, R. Banerjee, D. J. Barker, K. F. Barlow, K. Bates, H. Beasley, O. Beasley, C. P. Bird, S. Bray-Allen, A. J. Brown, J. Y. Brown, D. Burford, W. Burrill, J. Burton, C. Carder, N. P. Carter, J. C. Chapman, Y. Chen, G. Clarke, S. Y. Clark, C. M. Clee, S. Clegg, R. E. Collier, N. Corby, M. Crosier, A. T. Cummings, J. Davies, P. Dhami, M. Dunn, I. Dutta, L. W. Dyer, M. E. Earthrowl, L. Faulkner, C. J. Fleming, A. Frankish, J. A. Frankland, L. French, D. G. Fricker, P. Garner, J. Garnett, J. Ghori, J. G. Gilbert, C. Glison, D. V. Grafham, S. Gribble, C. Griffiths, S. Griffiths-Jones, R. Grocock, J. Guy, R. E. Hall, S. Hammond, J. L. Harley, E. S. Harrison, E. A. Hart, P. D. Heath, C. D. Henderson, B. L. Hopkins, P. J. Howard, P. J. Howden, E. Huckle, C. Johnson, D. Johnson, A. A. Joy, M. Kay, S. Keenan, J. K. Kershaw, A. M. Kimberley, A. King, A. Knights, G. K. Laird, C. Langford, S. Lawlor, D. A. Leongamornlert, M. Leversha, C. Lloyd, D. M. Lloyd, J. Lovell, S. Martin, M. Mashreghi-Mohammadi, L. Matthews, S. McLaren, K. E. McLay, A. McMurray, S. Milne, T. Nickerson, J. Nisbett, G. Nordsiek, A. V. Pearce, A. I. Peck, K. M. Porter, R. Pandian, S. Pelan, B. Phillimore, S. Povey, Y. Ramsey, V. Rand, M. Scharfe, H. K. Sehra, R. Shownkeen, S. K. Sims, C. D. Skuce, M. Smith, C. A. Steward, D. Swarbreck, N. Sycamore, J. Tester, A. Thorpe, A. Tracey, A. Tromans, D. W. Thomas, M. Wall, J. M. Wallis, A. P. West, S. L. Whitehead, D. L. Willey, S. A. Williams, L. Wilming, P. W. Wray, L. Young, J. L. Ashurst, A. Coulson, H. Blocker, R. Durbin, J. E. Sulston, T. Hubbard, M. J. Jackson, D. R. Bentley, S. Beck, J. Rogers, and I. Dunham. 2004. DNA sequence and analysis of human chromosome 9. Nature 429:369-374.
234. Einhorn, S., D. Grander, O. Bjork, K. Brondum-Nielsen, and S. Soderhall. 1990. Deletion of alpha-, beta-, and omega-interferon genes in malignant cells from children with acute lymphocytic leukemia. Cancer Res 50:7781-7785.
235. Young, R. S., T. Reed, M. E. Hodes, and C. G. Palmer. 1982. The dermatoglyphic and clinical features of the 9p trisomy and partial 9p monosomy syndromes. Hum Genet 62:31-39.
124
236. Wilson, G. N., A. Raj, and D. Baker. 1985. The phenotypic and cytogenetic spectrum of partial trisomy 9. Am J Med Genet 20:277-282.
237. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN-{alpha} Induces Early Lethal Lupus in Preautoimmune (New Zealand Black x New Zealand White)F1 but Not in BALB/c Mice. J Immunol 174:2499-2506.
238. Dupont, S. A., S. Goelz, J. Goyal, and M. Green. 2002. Mechanisms for regulation of cellular responsiveness to human IFN-beta1a. J Interferon Cytokine Res 22:491-501.
239. Gigli, G. L., A. Scalise, F. Pauri, G. Silvestri, M. Diomedi, F. Placidi, M. Grazia Pomponi, and C. Masala. 1996. Valproate-induced systemic lupus erythematosus in a patient with partial trisomy of chromosome 9 and epilepsy. Epilepsia 37:587-588.
240. Gigli, G. L., A. Scalise, G. Silvestri, M. Diomedi, F. Placidi, M. G. Pomponi, and C. Masala. 1996. Clinical case report: multiple idiosyncratic adverse effects of antiepileptic drugs in trisomy 9p. Int J Neurosci 87:181-189.
241. Bleck, T. P., and M. C. Smith. 1990. Possible induction of systemic lupus erythematosus by valproate. Epilepsia 31:343-345.
242. Asconape, J. J., K. R. Manning, and M. E. Lancman. 1994. Systemic lupus erythematosus associated with use of valproate. Epilepsia 35:162-163.
243. Bonnet, F., P. Morlat, S. De Witte, C. Combe, and J. Beylot. 2003. Lupus-like syndrome and vasculitis induced by valpromide. J Rheumatol 30:208-209.
244. Boon, D. M., J. A. van Parys, and A. J. Swaak. 1992. [Disseminated lupus erythematosus induced by carbamazepine (Tegretol)]. Ned Tijdschr Geneeskd 136:2085-2087.
245. Lyle, R., C. Gehrig, C. Neergaard-Henrichsen, S. Deutsch, and S. E. Antonarakis. 2004. Gene expression from the aneuploid chromosome in a trisomy mouse model of down syndrome. Genome Res 14:1268-1274.
246. Doyle, S. E., R. O'Connell, S. A. Vaidya, E. K. Chow, K. Yee, and G. Cheng. 2003. Toll-like receptor 3 mediates a more potent antiviral response than Toll-like receptor 4. J Immunol 170:3565-3571.
247. MacKay, V. L., X. Li, M. R. Flory, E. Turcott, G. L. Law, K. A. Serikawa, X. L. Xu, H. Lee, D. R. Goodlett, R. Aebersold, L. P. Zhao, and D. R. Morris. 2004. Gene expression analyzed by high-resolution state array analysis and quantitative proteomics: response of yeast to mating pheromone. Mol Cell Proteomics 3:478-489.
248. Iafrate, A. J., L. Feuk, M. N. Rivera, M. L. Listewnik, P. K. Donahoe, Y. Qi, S. W. Scherer, and C. Lee. 2004. Detection of large-scale variation in the human genome. Nat Genet 36:949-951.
125
249. Faham, M., J. Zheng, M. Moorhead, H. Fakhrai-Rad, E. Namsaraev, K. Wong, Z. Wang, S. G. Chow, L. Lee, K. Suyenaga, J. Reichert, A. Boudreau, J. Eberle, C. Bruckner, M. Jain, G. Karlin-Neumann, H. B. Jones, T. D. Willis, J. D. Buxbaum, and R. W. Davis. 2005. Multiplexed variation scanning for 1,000 amplicons in hundreds of patients using mismatch repair detection (MRD) on tag arrays. Proc Natl Acad Sci U S A 102:14717-14722.
126
BIOGRAPHICAL SKETCH
Haoyang Zhuang was born in Tianjin, China. She received her bachelor’s degree in
microbiology from Nankai Unversity, Tianjin, China in 1998. She then worked as a sales
manager in the Department of Import and Export at Shenzhen Agriculture Product Co., Ltd,
Guangdong, China. In 2000, she started work as a research assistant in the Institute of
Microbiology, Chinese Academy of Science, Beijing, China, under the supervision of Dr. Yanhe
Ma. She was admitted to the Interdisciplinary Program in Biomedical Sciences at the University of
Florida in 2002. She did her dissertation research under the supervision of Dr. Westley H.
Reeves in the Division of Rheumatology and Clinical Immunology and was awarded the Doctor
of Philosophy in 2008.