University of Groningen Cell wall deformation and ... · Table of Contents Chapter 1.1 Chemical signals and mechanosensing in bacterial responses to their environment (PLOS Pathogens

University of Groningen

Cell wall deformation and Staphylococcus aureus surface sensingHarapanahalli, Akshay

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Harapanahalli, A. (2015). Cell wall deformation and Staphylococcus aureus surface sensing. University ofGroningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 29-11-2020

https://www.rug.nl/research/portal/en/publications/cell-wall-deformation-and-staphylococcus-aureus-surface-sensing(d98eb12f-df83-4001-87e8-77599156decc).html

Cell Wall Deformation and

Staphylococcus aureus Surface

Sensing

Akshay Kumar Harapanahalli

-Cover story-

The story of growth and success...

A respectable distance from a big tree is the small seed’s greatest chance to grow big and

strong someday by getting its own sunlight. Similarly, in the field of science, starting a PhD

was like sowing a seed of knowledge, a beginning. And, the process of finishing it was like

growing stonger in all aspects of scientific research with a hope to deliver greater good to the

society.

Cell Wall Deformation and Staphylococcus aureus Surface Sensing

By Akshay Kumar Harapanahalli

University Medical Center Groningen, University of Groningen

Groningen, The Netherlands

Copyright © 2015 by Akshay Kumar Harapanahalli

Printed by CPI Whormann Print Service B.V., ZUTPHEN

ISBN (printed version): 978-90-367-8422-1

ISBN (electronic version): 978-90-367-8421-4

Financial support for thesis printing was provided by W.J.Kolff Institute and University of

Groningen

Cover design by Rene Dijkstra

Page layout by Akshay kumar Harapanahalli

Cell Wall Deformation and Staphylococcus aureus Surface Sensing

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the

Rector Magnificus Prof. E. Sterken and in accordance with

the decision by the College of Deans.

This thesis will be defended in public on

Wednesday 16 December 2015 at 09.00 hours

by

Akshay Kumar Harapanahalli

born on 7 May 1982 in Adoni, India

Supervisors

Prof. H.C. van der Mei

Prof. H.J. Busscher

Assessment Committee

Prof. J.M. van Dijl

Prof. J. Kok

Prof. Y. Dufrene

Paranymphs:

Dhr. Willem Woudstra

Dr. Deepak.H.Veeregowda

“To my parents, wife and Grandfather to who I shall be indebted for being a great support

in my life and imbibing me with good morals and values”

Table of Contents

Chapter 1.1 Chemical signals and mechanosensing in bacterial responses to their

environment (PLOS Pathogens 11 (2015) e1005057) 09

Chapter 1.2 General aim of this thesis 16

Chapter 2 Nanoscale cell wall deformation impacts long-range bacterial

adhesion forces on surfaces (Applied and Environmental Microbiology

80 (2014) 637-643) 21

Chapter 3 Residence-time dependent cell wall deformation of different

Staphylococcus aureus strains on gold measured using

Surface enhanced fluorescence (Soft Matter 10 (2014) 7638-7646) 51

Chapter 4 Influence of adhesion force on icaA and cidA gene expression

and production of matrix components in Staphylococcus aureus

biofilms (Applied and Environmental Microbiology 81 (2015) 3369-3378) 81

Chapter 5 Expression of NsaRS two-component system in Staphylococcus aureus

under mechanical and chemical stress

(to be submitted to Environmental Microbiology Reports) 109

Chapter 6 General discussion 127

Summary 133

Nederlandse samenvatting 139

Acknowledgements 145

8

9

Chapter 1

General Introduction and Aim

(Reproduced with permission of PLOS from Akshay K. Harapanahalli.; Jessica A.

Younes.; Elaine Allan.; Henny C. van der Mei.; Henk J. Busscher. Chemical Signals and

Mechanosensing in Bacterial Responses to their Environment, PLoS Pathogen, 2015, 11:

e1005057)

Chapter 1.1

10

Bacteria encounter different environmental conditions during the course of their growth and

have developed various mechanisms to sense their environment and facilitate survival.

Bacteria are known to communicate with their environment through sensing of chemical

signals such as pH, ionic strength or sensing of biological molecules, such as utilized in

quorum sensing [1]. However, bacteria do not solely respond to their environment by means

of chemical sensing, but also respond through physical-sensing mechanisms. For instance,

upon adhesion to a surface, bacteria may respond by excretion of extracellular-polymeric-

substances (EPS) through a mechanism called mechanosensing, allowing them to grow in

their preferred, matrix protected biofilm mode of growth [2]. Chemical sensing of

antimicrobials may further enhance EPS excretion [3]. We will now first discuss the

distinction between chemical- and mechanosensing mechanisms and subsequently elaborate

further on mechanosensing.

What Distinguishes Chemical Sensing from Mechanosensing?

Chemical sensing relies on the presence of specific molecules such as H+ ions, antimicrobials

or on the presence of excreted biological signaling molecules that need to diffuse toward

neighbouring organisms to enable communication and response. In general, Gram-negative

bacteria use homoserine lactones as signaling molecules [4], while peptides are

predominantly used by Gram-positive bacteria [5]. When signaling molecules have reached a

threshold concentration, they activate a receptor which induces expression of target genes to

control the response.

In mechanosensing, bacteria are required to come into physical contact with their

environment, for instance by adhering to a substratum surface or the surfaces of

neighbouring bacteria. This can either be through non-specific or highly specific ligand-

receptor interactions (see also below). Some bacterial cells have special surface appendages,

like flagella or pili that can come in direct, physical contact with another surface. In Vibrio

parahaemolyticus for instance, physical contact can act as a signal, to switch the population

from a planktonic to a sessile, surface-adhering phenotype [6]. Vibrio cholerae can use its

flagellum as a mechanosensor and upon contact with a hard surface, the flagellar motor

Chemical and Mechanosensing in Bacteria

11

stops and ion flow through the motor ceases, which increases the membrane potential and

initiates biofilm formation [7].

Not all bacterial strains possess surface appendages to probe a surface, yet upon

adhesion to a surface they respond by producing EPS and adapting a biofilm mode of

growth. Another form of mechanosensing of a surface is based on adhesion force induced

deformation of the bacterial cell wall. In S. aureus, adhesion forces to substratum surfaces

have been found to modulate icaA expression and associated EPS production. [8]. Moreover,

adhesion force modulated icaA expression was disturbed in mutants lacking a rigid, cross-

linked peptidoglycan layer, suggesting that this form of mechanosensing depends on an

intricate balance between rigidity of the bacterial cell wall and prevailing adhesion forces.

The lipid membrane subsequently follows the deformation of the more rigid peptidoglycan

layer in the cell wall.

How does Cell Wall Deformation yield Surface Sensing?

When a bacterial cell wall deforms either under the influence of adhesion forces arising from

a substratum surface or due to other external forces, the intra-bilayer pressure profile across

the lipid membrane changes as a result of bilayer deformation [9]. Pressure profile changes

can be sensed by bacteria in two different ways: one is through a physical approach (gating of

the mechanosensitive channel, see Figure 1A) and the other through responses generated by

stress sensitive proteins on the cell surface (Figure 1B). Cell wall deformation occurs at the

expense of energy, provided by the adhesion forces arising from the substratum surface to

which bacteria adhere. This energy is required to compensate for the energetically

unfavorable contact between hydrophobic membrane lipids and water (“hydrophobic

mismatch”) and the geometric consequences (thinning of the lipid membrane and wider

spacing between lipid molecules) of the lipid bilayer intrinsic curvature (Figure 1A) [9].

Membrane intrinsic curvature changes in Escherichia coli were found to trap membrane

channels in a fully open state, while hydrophobic mismatch alone was unable to open

channels. Accordingly, mechanosensitive channels must be considered as interpreters of

membrane tension [10] through which mechanical stimuli can be translated into a biological

response. Similarly, stress sensitive proteins present on the cell surface can become activated

upon cell wall deformation. In the Cpx two-component system in E. coli for example [11], the

Chapter 1.1

12

stress sensitive protein CpxA protein can autophosphorylate and transfer phosphate groups

to the response regulator protein CpxR in the cytoplasm. Subsequently, the phosphorylated

CpxR binds to multiple regulatory sites of the DNA to increase transcription of target genes.

Figure 1. Bacterial cell wall deformation, mechanosensing and the measurement of cell

wall deformation using surface enhanced fluorescence. A) Left: Intact lipid membrane at

equilibrium of an undeformed bacterium, with a closed mechanosensitive channel (MSC). Right:

Bacterium adhering to a substratum surface, deformed under the influence of adhesion forces arising

from the substratum, yielding hydrophobic mismatch over the thickness of the membrane (water

molecules adjacent to hydrophobic lipid tails) and altered lipid bilayer tension in the lipid membrane.

Hydrophobic mismatch and pressure profile changes lead to the opening of MSCs. B) Left: A non-


13

activated stress sensitive protein (SS) on the bacterial cell surface of an undeformed bacterium and a

response regulator protein (RR) suspended freely in the cytoplasm. Right: A SS protein senses cell

wall deformation due to adhesion, changes its conformation and phosphorylates a RR protein which

regulates the expression of SS regulated genes. C) Left: Lifshitz-Van der Waals forces operate between

all molecular pairs in a bacterium and a substratum, decreasing with distance between the molecules

(decreasing thickness of the arrows). Right: Adhering bacterium, deformed due to attractive Lifshitz-

Van der Waals forces, with more molecules in the bacterium closer to the substratum, yielding stronger

adhesion and more deformation. Deformation stops once the counter-forces arising from the

deformation of the rigid peptidoglycan layer match those of the adhesion forces. D) Left: Only a small

number of fluorophores inside an undeformed bacterium are sufficiently close to a metal substratum

surface to experience surface-enhanced-fluorsecence (brighter dots). Right: In a deformed, adhering

bacterium, the volume of the bacterium close to the surface increases and the number of fluorophores

subject to surface-enhanced-fluoresecence becomes higher. Thus quantitative analysis of fluorescence

arising from fluorescent bacteria adhering to a metal surface provides a ways to determine cell wall

deformation.

How can we Experimentally Demonstrate and Quantify Bacterial Cell Wall

Deformation upon Adhesion to Surfaces?

Bacterial adhesion to surfaces is mediated by adhesion forces arising from the substratum

surface to which they adhere. From a physico-chemical perspective, there are only a limited

number of different adhesion forces:

Lifshitz-Van der Waals forces, generally attractive and operative over a relatively

long distance range;

electrostatic forces that can either be attractive or repulsive depending on their

magnitude and distance range, as determined by ionic strength and pH;

acid-base interactions between hydrogen-donating and hydrogen-accepting groups

that can also be attractive or repulsive.

When these adhesion forces arise from spatially localized and stereo-chemical groups, they

are sometimes called “specific”, or ligand-receptor interactions [12].

Due to the long-range nature of Lifshitz-Van der Waals forces, contributions to the

total Lifshitz-Van der Waals force arise from all molecular pairs in a bacterium and a

substratum, which of course decrease in magnitude with increasing distance (Figure 1C) [13].

Chapter 1.1

14

It has been argued that, since the overall molecular composition of different bacterial strains

is highly similar, differences in Lifshitz-Van der Waals forces between adhering bacteria on

different substratum surfaces reflect varying degrees of cell wall deformation. The rationale

for this is simple: deformation brings more molecules in the close vicinity of a substratum,

average distance will decrease and adhesion forces increase, yielding more extensive

deformation until impeded by counter-forces arising from the rigidity of the peptidoglycan

layer. It is uncertain whether also ligand-receptor interactions can mediate cell wall

deformation to the extent as non-specific Lifshitz-Van der Waals forces have been

demonstrated to do [14]. Since ligand-receptor interactions only arise from molecules

present at the surface, their number is small relative to compared to the number of

molecules participating in Lifshitz-Van der Waals forces (see Figure 1C). However, their

strength of interaction may be quite strong.

Adhesion induced cell wall deformation has been directly demonstrated through

atomic-force-microscopy measurements of the height and base width of bacteria adhering to

substratum surfaces, but atomic force microscopy data have to be obtained for individual

bacteria, which is a tedious procedure with high variability [14]. As an alternative method to

quantify bacterial cell wall deformation, surface enhanced fluorescence has been proposed.

Surface enhanced fluorescence is based on recent observations that fluorescence is enhanced

on reflecting surfaces once the fluorophores are within the range of 20-30 nm from the

surface [15]. Similarly, upon adhesion of fluorescent bacteria to a reflecting surface, cell wall

deformation will occur that brings a larger volume of the bacterium and therewith more

fluorophores closer to a surface, yielding stronger surface enhanced fluorescence (Figure

1D). Surface enhanced fluorescence of adhering bacteria can be measured using macroscopic

bio-optical imaging that allows observation over substratum areas of several tens of cm2,

therewith encompassing numbers of adhering bacteria that approximate a bacterial

monolayer (around 108 bacteria/cm2). Accordingly, surface enhanced fluorescence has been

proposed as an ideal method to study adhesion induced cell wall deformation in a rapid and

statistically reliable manner under naturally occurring adhesion forces, the only drawback

being the need to use a reflecting surface and fluorescent bacterial strains.


15

Does Physical Contact between Bacteria Modulate Quorum Sensing?

Physical contact is not only established between bacteria adhering to substratum surfaces

but also between individual bacteria in a biofilm, which raises a number of interesting

questions. First of all, biofilms produce different amounts of EPS depending on the nature of

the substratum [3], but only the initially adhering bacteria have contact with the substratum

surface itself [16]. Clearly, the effective range of all attractive or repulsive forces arising from

a substratum surface is limited to tens of nanometres, making it impossible for bacterial cells

other than the initial colonisers to directly sense a surface. Moreover, they will experience

adhesion forces from neighboring organisms with whom they co-adhere. This implies that

there must be a communication means available within a biofilm through which substratum

information is passed to bacteria that are not in direct contact with the substratum enabling

them to indirectly sense the surface. Quorum sensing likely is the prevailing mechanism for

the indirect passing of this information to later colonizers in a biofilm, although physical

contact between coadhering bacteria may play a role here too. For instance, Myxococcus

xanthus, E. coli, Bacillus subtilis and lactobacilli use contact-dependent signaling for

communication [17] in addition to quorum sensing, suggesting that physical contact not only

provides a direct way of communication between bacteria within their environment,

moreover it may also constitute a mechanism by which bacteria can optimise the use of

quorum sensing molecules. For example, lactobacilli adhere more strongly to staphylococci

than staphylococci to each other, giving lactobacilli the opportunity to penetrate and colonise

regions of vaginal biofilms where staphylococci predominate, resulting in the quorum

sensing mediated quenching of staphylococcal toxic shock syndrome toxin secretion [18, 19].

This form of quorum quenching only occurs however, when there is a sufficiently high

concentration of quorum quenching dipeptides in the close neighborhood of toxic shock

syndrome toxin secreting staphylococci, which occurs more readily when staphylococci and

lactobacilli are in direct contact with each other [18]. Thus physical contact, as established

through adhesion forces between bacteria and biochemical signaling, may be considered as

intrinsically linked mechanisms in a biofilm.

Chapter 1.1

16

Perspective: Cell Wall Deformation and Adhesion Induced Antibiotic

Resistance of Biofilms

Eighty percent of all human infections are caused by biofilms adhering to soft tissue surfaces

in the human body, the surfaces of biomaterial implants or coadhering to other bacteria. The

antibiotic resistance of biofilms exceeds that of planktonic bacteria [20] due to phenotypic

changes induced by adhesion of the bacteria involved and their production of an EPS matrix

which hampers antimicrobial penetration [21]. Cell wall deformation induced by adhesion

forces plays a pivotal role in this transition from antibiotic susceptible planktonic growth to a

more antibiotic resistant biofilm mode of growth and production of a protective EPS matrix

has been found absent for bacteria adhering to surfaces exerting weak adhesion forces [22].

However, this implies only indirect evidence for the involvement of mechanosensitive

channels or stress sensitive proteins in bacterial biofilm formation. Therefore, control of the

forces experienced by bacteria in a biofilm may provide a relatively unexplored pathway to

control resistance associated with implant associated infections and perhaps the

pathogenicity of biofilms.

1.2 AIM OF THIS THESIS

The preceding chapter (1.1) on bacterial interactions with environment suggests a crucial

role for adhesion forces between bacteria and the surface to which they adhere.

In this respect, the aim of this thesis was to evaluate the role of adhesion forces in

the response of bacteria to their adhering state. To this end, we used a model pathogen

Staphylococcus aureus, common in biomaterial associated infections and several of its

isogenic mutants and applied atomic force microscopy and surface enhanced fluorescence to

quantify adhesion forces and cell wall deformation, respectively. Bacterial response was

evaluated in terms of gene expression on different biomaterials commonly used in

orthopedic implants.


17

References

1. Miller MB, Bassler BL (2001) Quorum sensing in bacteria. Annu Rev Microbiol 55: 165-169.

2. Decho AW (2013) The EPS matrix as an adaptive bastion for biofilms: introduction to special

issue. Int J Mol Sci 14: 23297–23300.

3. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC (2011) Ica-expression and

gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant

biomaterials. J Biomed Mater Res Part A 96: 365–371.

4. Gambello MJ, Kaye S, Iglewski BH (1993) LasR of Pseudomonas aeruginosa is a

transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A

expression. Infect Immun 61: 1180–1184.

5. Novick RP, Muir TW (1999) Virulence gene regulation by peptides in staphylococci and other

Gram-positive bacteria. Curr Opin Microbiol 2: 40–45.

6. Gode-Potratz CJ, Kustusch RJ, Breheny PJ, Weiss DS, McCarter LL (2011) Surface sensing in

Vibrio parahaemolyticus triggers a programme of gene expression that promotes colonization

and virulence. Mol Microbiol 79: 240–263.

7. Van Dellen KL, Houot L, Watnick PI (2008) Genetic analysis of Vibrio cholerae monolayer

formation reveals a key role for ΔΨ in the transition to permanent attachment. J Bacteriol

190: 8185–8196.

8. Harapanahalli AK, Chen Y, Jiuyi Li, Busscher HJ, Van der Mei HC (2015) Influence of

adhesion force on icaA and cidA gene expression and production of matrix components in

Staphylococcus aureus biofilms. Appl Environ Microbiol 81: 3369-3378.

9. Perozo E, Kloda A, Cortes DM, Martinac B (2002) Physical principles underlying the

transduction of bilayer deformation forces during mechanosensitive channel gating. Nat

Struct Biol 9: 696–703.

10. Haswell ES, Phillips R, Rees DC (2011) Mechanosensitive channels: what can they do and how

do they do it? Structure 19: 1356–1369.

11. Otto K, Silhavy TJ (2002) Surface sensing and adhesion of Escherichia coli controlled by the

Cpx-signalling pathway. Proc Natl Acad Sci U S A 99: 2287-2292.

12. Van Oss CJ, Good RJ, Chaudhury MK (1986) The role of Van der Waals forces and hydrogen

bonds in “hydrophobic interactions” between biopolymers and low energy surfaces. J Colloid

Interface Sci 111: 378–390.

13. Rijnaarts HHM, Norde W, Lyklema J, Zehnder AJB (1999) DLVO and steric contributions to

bacterial deposition in media of different ionic strengths. Colloids Surf B Biointerf 14: 179–

195.

Chapter 1.1

18

14. Chen Y, Harapanahalli AK, Busscher HJ, Norde W, Van der Mei HC (2014) Nanoscale cell

wall deformation impacts long-range bacterial adhesion forces on surfaces. Appl Environ

Microbiol 80: 637–643.

15. Li J, Busscher HJ, Swartjes J, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema

J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus

strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.

16. Busscher HJ, Bos R, Van der Mei HC (1995) Initial microbial adhesion is a determinant for

the strength of biofilm adhesion. FEMS Microbiol. Lett 128: 229-234.

17. Blango MG, Mulvey MA (2009) Bacterial landlines: contact-dependent signaling in bacterial

populations. Curr Opin Microbiol 12: 177–181.

18. Younes JA, Van der Mei HC, Van den Heuvel E, Busscher HJ, Reid G (2012) Adhesion forces

and coaggregation between vaginal staphylococci and lactobacilli. PLoS One 7: e36917.

19. Li J, Wang W, Xu SX, Magarvey NA, Mccormick JK (2011) Lactobacillus reuteri -produced

cyclic dipeptides quench agr -mediated expression of toxic shock syndrome toxin-1 in

staphylococci. Proc Natl Acad Sci USA 108: 3360–3365.

20. John AK, Schmaler M, Khanna N, Landmann R (2011) Reversible daptomycin tolerance of

adherent staphylococci in an implant infection model. Antimicrob Agents Chemother 55:

3510–3516.

21. He Y, Peterson BW, Jongsma MA, Ren Y, Sharma PK, et al. (2013) Stress relaxation analysis

facilitates a quantitative approach towards antimicrobial penetration into biofilms. PLoS One

8: e63750.

22. Muszanska AK, Nejadnik MR, Chen Y, Van den Heuvel ER, Busscher HJ, et al. (2012)

Bacterial adhesion forces with substratum surfaces and the susceptibility of biofilms to

antibiotics. Antimicrob Agents Chemother 56: 4961-4964.

19

20

21

Chapter 2

Nano-scale Cell Wall Deformation Impacts Long-range

Bacterial Adhesion Forces to Surfaces

(Reproduced with permission of American Society for Microbiology from Yun Chen, Akshay

K. Harapanahalli, Henk J. Busscher, Willem Norde, and Henny C. van der Mei. Nano-scale

Cell Wall Deformation Impacts Long-range Bacterial Adhesion Forces to Surfaces. Appl.

Environ. Microbiol. 2014, 2, 637-643)

Chapter 2

22

ABSTRACT

Adhesion of bacteria occurs on virtually all natural and synthetic surfaces, and is crucial for

their survival. Once adhering, bacteria start growing and form a biofilm, in which they are

protected against environmental attacks. Bacterial adhesion to surfaces is mediated by a

combination of different short- and long-range forces. Here we present a new, Atomic Force

Microscopy (AFM)-based method to derive long-range bacterial adhesion forces from the

dependence of bacterial adhesion forces on the loading force, as applied during using AFM.

Long-range adhesion forces of wild-type Staphylococcus aureus parent strains (0.5 and 0.8

nN) amounted to only one third of these forces measured for their, more deformable

isogenic Δpbp4 mutants that are deficient in peptidoglycan cross-linking. Measured long-

range Lifshitz-Van der Waals adhesion forces matched those calculated from published

Hamaker constants, provided a 40% ellipsoidal deformation of the bacterial cell wall was

assumed for the Δpbp4 mutants. Direct imaging of adhering staphylococci using the AFM

PeakForce-QNM mode confirmed height reduction due to deformation in the Δpbp4

mutants by 100 – 200 nm. Across naturally occurring bacterial strains, long-range forces do

not vary to the extent as observed here for the Δpbp4 mutants. Importantly however,

extrapolating from the results of this study it can be concluded that long-range bacterial

adhesion forces are not only determined by the composition and structure of the bacterial

cell surface, but also by a hitherto neglected, small deformation of the bacterial cell wall,

facilitating an increase in contact area and therewith in adhesion force.

Cell Wall Deformation and Long-range Adhesion Forces

23

INTRODUCTION

Bacteria adhere to virtually all natural and synthetic surfaces (1, 2), as adhesion is crucial for

their survival. Bacterial adhesion to surfaces is followed by their growth and constitutes the

first step in the formation of a biofilm, in which organisms are protected against

antimicrobial treatment and environmental attacks. Accordingly, the biofilm mode of growth

is highly persistent and biofilms are notoriously hard to remove, causing major problems in

many industrial and bio-medical applications with high associated costs. On the other hand,

biofilms can be beneficial too, as in bio-remediation of soil, for instance. Surface

thermodynamics and (extended) DLVO approaches have been amply applied in current

microbiology to outline that bacterial adhesion to surfaces is mediated by an interplay of

different fundamental physico-chemical interactions, including Lifshitz-Van der Waals,

electric double layer, and acid-base forces (3–5). Assorted according to their different

"effective" ranges, these different fundamental interactions can be alternatively categorized

into two groups: short-range and long-range forces (6) that act over distances of a few nm up

to tens of nm, respectively.

Long-range adhesion forces are generally associated with Lifshitz-Van der Waals

forces and can be theoretically calculated (7) for the configuration of a sphere with radius R0

versus a flat surface (Figure 1) using

02

0 3

0

)(

)2(

6)(

Rz

zdz

zD

zzRA

DDF (1)

in which A is the Hamaker constant (8), z is distance and D indicates the separation distance

between the sphere and the substratum surface. The Hamaker constant in equation 1

accounts for the materials properties of the interacting surfaces and the medium across

which the force is operative. Since long-range adhesion forces result from the summation of

all pair-wise molecular interaction forces in the interacting volumes, any deformation that

brings a bacterial cell surface closer to a substratum surface and extending over a larger

contact area, will increase the long-range adhesion force (see Figure 1).

Chapter 2

24

Figure 1. Pair-wise summation of long-range, Lifshitz-Van der Waals molecular interaction forces in

the bacterial cell and substratum yields the long-range adhesion force between the interacting surfaces.

Deformation of the bacterial cell wall brings more molecules in the bacterium in the close vicinity of the

substratum, which increases the adhesion force. In this schematics, the undeformed bacterial cell is

taken as a sphere with radius R0, deforming under the influence of the adhesion forces into an oblate

spheroid with a polar radius r and an equatorial radius R. D indicates the separation distance.

So far, this aspect of long-range adhesion forces between bacteria and substratum surfaces

has been largely neglected, because deformation due to adhesion forces is small for naturally

occurring bacteria, possessing a rigid, well-structured peptidoglycan layer. Nevertheless, it

has recently been pointed out, that even small deformations can have a considerable impact

on the metabolic activity of adhering bacteria, a phenomenon for which the term “stress de-

activation” has been coined (9). Thus, despite their small numerical values, minor variation

in long-range adhesion forces may still strongly affect the behavior of bacterial cells at

substratum surfaces.


25

In this paper we propose a method to derive long-range adhesion forces between

bacteria and substratum surfaces, based on a previously published elastic deformation model

(10). Through the use of two isogenic Δpbp4 mutants and their wild-type, parent strains

(Staphylococcus aureus NCTC 8325-4 and ATCC 12600), long-range adhesion forces could

be related with the nano-scale deformability of the cell wall. Note that so-called Δpbp4

mutants are deficient in penicillin-binding-proteins that play an important role in cross-

linking peptidoglycan strands and are therefore more susceptible to deformation than their

parent strains (11), for which reason they are ideal to demonstrate the role of deformation in

long-range adhesion forces between bacteria and substratum surfaces.

MATERIALS AND METHODS

Bacterial strains and culture conditions

Two pairs of staphylococcal strains were included in this study. Each pair comprised a wild-

type, parent strain and a so-called Δpbp4 mutant, deficient in penicillin-binding-proteins

that play an important role in cross-linking peptidoglycan strands in the cell wall. The Δpbp4

mutant of S. aureus NCTC 8325-4 was kindly provided by Dr. Mariana G. Pinho

(Universidade Nova de Lisboa), while the Δpbp4 mutant of S. aureus ATCC 12600 was an

own construct, prepared as described by Atilano et al. (12). Briefly, the strain was inoculated

with the pMAD-pbp4 plasmid by electroporation and grown on Tryptone Soya Agar (TSA,

OXOID, Basingstoke, England) plates containing erythromycin (SIGMA-ALDRICH, St.

Louis, Missouri, USA) and X-Gal (SIGMA-ALDRICH) for 48 h at 30°C. To obtain bacteria

with a chromosomally integrated copy of pMAD-pbp4, blue colonies were used to inoculate

overnight cultures in Tryptone Soya Broth (TSB, OXOID) medium. Next, 10 ml TSB was

inoculated with 100 μl of an overnight culture, grown for 1 h at 30°C, and then transferred to

42°C for 6 h. To select bacteria with a chromosomally integrated copy of pMAD-pbp4,

dilutions (1000×) of the culture were plated on TSA plates with erythromycin and X-Gal and

incubated for 48 h at 42°C. To subsequently obtain bacteria that had excised pMAD-pbp4

from the chromosome, blue colonies with integrated pMAD-pbp4 were used to inoculate

overnight cultures in TSB medium at 42°C. Next, 10 ml TSB was inoculated with 10 μl of the

overnight culture and growth was continued for 6 h at 30°C. Dilutions (1000×) of the

Chapter 2

26

cultures were plated on TSA plates with X-Gal and incubated at 42°C for 48 h. White

colonies were tested for erythromycin sensitivity and checked for the presence or absence of

pbp4 by colony PCR.

Staphylococci were pre-cultured from blood agar plates in 10 ml TSB. Pre-cultures

were grown for 24 h at 37°C. After 24 h, 0.5 ml of a pre-culture was transferred into 10 ml

fresh medium and a main culture was grown for 16 h at 37°C. Bacteria were harvested by

centrifugation at 5000 × g for 5 min, washed twice with 10 mM potassium phosphate buffer,

pH 7.0 and finally suspended in the same buffer. When bacterial aggregates were observed

microscopically, 10 s sonication at 30 W (Vibra Cell model 375, Sonics and Materials Inc.,

Danbury, Connecticut, USA) was carried out intermittently for three times, while cooling the

suspension in a water/ice bath. Note that staphylococci are coccal organisms, possessing a

nearly perfect spherical shape (13–15).

Dynamic light scattering (DLS)

In order to account for possible differences in the size of the Δpbp4 mutants with respect to

their wild-type, parent strains, hydrodynamic radii R0 of the staphylococci were determined

using DLS (Zetasizer Nano ZS, Malvern Instruments Ltd., United Kingdom) in 10 mM

potassium phosphate buffer. For each strain, three separate cultures were included, and the

measurements were repeated on three different aliquots from one culture.

AFM force spectroscopy

Glass slides (Gerhard Menzel GmbH, Braunschweig, Germany) were sonicated for 3 min in

2% RBS35 (Omnilabo International BV, The Netherlands), and sequentially rinsed with tap

water, demineralized water, methanol, tap water, and demineralized water.

Bacterial probes were prepared by immobilizing a bacterium to a NP-O10 tipless

cantilever (Bruker, Camarillo, California, USA). Cantilevers were first calibrated by the

thermal tuning method and spring constants were always within the range given by the

manufacturer (0.03 – 0.12 N/m). Next, a cantilever was mounted to the end of a

micromanipulator and under microscopic observation, the tip of the cantilever was dipped


27

into a droplet of 0.01% α-poly-L-lysine with MW 70,000-150,000 (SIGMA-ALDRICH) for 1

min to create a positively charged layer. After 2 min of air-drying, the tip of the cantilever

was carefully dipped into a staphylococcal suspension droplet for 1 min to allow bacterial

attachment through electrostatic attraction and dried in air for 2 min. Successful attachment

of a staphylococcus on the cantilever follows directly from a comparison of the force-distance

curves of a staphylococcal probe versus the one of a poly-L-lysine coated cantilever (see

Figure A1, Supplementary materials). Although this attachment protocol is standard in the

measurement of adhesion forces using AFM (16), it is possible that the attachment

procedure disturbs the structure of the weakened mutant strains and therewith affects the

results. However, bacterial probes produce similar force-distance curves, regardless of the

different drying times for the wild-type, parent strains and the Δpbp4 mutants (see Figure

A2, Supplementary materials). Thus it can be ruled out that the attachment protocol disturbs

the structure of the Δpbp4 mutants, with their weakened cell walls. Bacterial probes were

always used immediately after preparation.

All force measurements were performed in 10 mM potassium phosphate buffer (pH

7.0) at room temperature on a BioScope Catalyst Atomic Force Microscope (AFM) (Bruker).

In order to verify that a bacterial probe had a single contact with the substratum surface, a

scanned image in the AFM contact mode with a loading force of 1 - 2 nN was made at the

onset of each experiment and examined for double contour lines. Double contour lines

indicate that the AFM image is not prepared from the contact of a single bacterium with the

surface, but that multiple bacteria on the probe are in simultaneous contact with the

substratum. Any probe exhibiting double contour lines was discarded. At this point it must

be noted however, that images containing double contour lines seldom or never occurred,

since it represents the unlikely situation that bacteria on the cantilever are equidistant to the

substratum surface within the small range of the interaction forces. This is unlikely because

the cantilever is contacting the substratum under an angle of 15 degrees.

Adhesion forces between the bacterial cell and glass surface were measured at

multiple, randomly chosen spots. Before actual measurements, five force-distance curves of

a bacterial probe toward a clean glass surface were measured at a loading force of 3 nN and

the maximal adhesion force upon retract recorded. Next, the maximal adhesion forces were

measured at loading forces of 1, 3, 5, 7, and 9 nN, separately. For each loading force, at least

20 force-distance curves were recorded (Figure A3, Supplementary materials for replicate

Chapter 2

28

measurements with one probe) and, after this series, the maximal adhesion force under the

loading force of 3 nN was always measured again. Whenever this force differed more than 1

nN from the initially measured value, the bacterial probe was regarded damaged and

replaced by a new one. Measurements for each strain at a single loading force typically

include six bacteria and two probes, with bacteria taken out of three separate cultures.

Derivation of the long-range contribution to the total adhesion force

The long-range force FLR between a bacterium and the substratum arises from pair-wise

attractive Lifshitz-Van der Waals forces between all molecules in the interacting bodies (see

Figure 1), and decays slowly with increasing distance between a bacterium and substratum

surface. Therefore, as long as the bacterial cell surface is in contact with the substratum

surface, FLR can be approximated as a constant, while the short-range force FSR can be

assumed to be proportional to the contact area S. Hence,

SfFFFF SRLRSRLRadh (2)

where fSR is the short-range force per unit contact area. Based on a previously proposed

elastic deformation model (10), Fadh can be expressed as

LR0SRld*

SRadh FSfF

E

fF (3)

Equation 3 indicates a linear relationship between Fadh and the loading force Fld (Figure 2),

while fSR, the reduced Young's modulus E* and the initial contact area S0 are readily

determined from our elastic deformation model (10). By fitting Fadh versus Fld according to

equation 3, the value of FLR can be resolved immediately from the intercept F0 by

0SR0LR SfFF (4)


29

Theoretical evaluation of the cell wall deformation from a comparison of

Lifshitz-Van der Waals forces between a sphere and an ellipsoid

The Lifshitz-Van der Waals force s

LWF between a sphere and a substratum surface can be

expressed as

20s

LW 6D

ARF (5)

Figure 2. The adhesion force Fadh as a function of the loading force Fld applied during AFM

measurements for two wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and their isogenic

Chapter 2

30

Δpbp4 mutants. Error bars denote the standard deviations over at least 100 force curves (six bacteria

divided over two different probes and taken from three separate cultures).

where 0R is the radius of the undeformed sphere and D the separation distance between the

sphere and the substratum surface (see also Figure 1) (7, 17). Assuming that adhering coccal

bacteria deform to an ellipsoid, with a shorter polar axis, and a circular equatorial plane, its

Lifshitz-Van der Waals force e

LWF can be calculated from

22

2e

LW )2(3

2

rDD

rARF

(6)

where R and r represent the lengths of the equatorial and polar radii, respectively. When the

bacterial cell volume remains constant during the deformation,

3

0

2 RrR (7)

Insertion of equation 7 into equation 6 leads to

22

3

0e

LW )2(3

2

rDD

ARF

(8)

The Hamaker constant of isogenic mutants can be considered similar to the one of their

parent strains, and, possibly, invariant with bacterial strains involved (18, 19). Hence,

dividing equation 8 as applied to the Δpbp4 mutant by equation 5, as applied to the parent


31

strain, yields the ratio k of the Lifshitz-Van der Waals forces between an ellipsoidally

deformed Δpbp4 bacterium and a undeformed, spherical bacterium of the parent strain:

3

P

0

M

0

2

2P

0

s

LW

e

LW )()2(

)2(

R

R

Dr

DR

F

Fk

(9)

where P

0R and M

0R represent the hydrodynamic radii of the undeformed bacteria for the

parent strain and its isogenic Δpbp4 mutant strain, respectively. Equation 9, at close

approach (20) (D « P

0R , r), simplifies into

2P

0

3M

0 )(

rR

Rk (10)

The ratio k can be readily determined from the Lifshitz-Van der Waals adhesion forces of the

parent strains and their isogenic Δpbp4 mutants, as summarized in Table 1.

Subsequently, r can be calculated by

5.0P

0

M

0M

0 )(kR

RRr (11)

and substitution in equation 7 yields

Chapter 2

32

25.0M

0

P

0M

0 )(R

kRRR (12)


33

Table 1. Pairwise comparison of the hydrodynamic radii R0 of planktonic staphylococci, the long-range

adhesion forces FLR, and the dimensions of the ellipsoidally deformed bacterial cells from matching

experimental and theoretically calculated Lifshitz-Van der Waals forces (rLW and RLW), for the two

wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and their isogenic Δpbp4 mutants (for

explanation of the dimensional parameters, see also Figure 1). The deformation of the bacterial cell is

expressed in terms of the difference between the hydrodynamic radius and the polar radius, i.e., (R0 -

rLW) and (R0 - rHeight Image), in which rHeight Image is obtained from AFM imaging. Shaded blocks could not

be calculated due to the assumption of undeformable wild-type strains.

Strain

S. aureus NCTC 8325-4 S. aureus ATCC 12600

Parent

strain Δpbp4

Parent

strain Δpbp4

R0 (nm)a 618 ± 35 570 ± 38 678 ± 38 620 ± 33

FLR (nN)b -0.8 ± 0.2 -2.7 ± 0.3 -0.5 ± 0.1 -1.6 ± 0.4

kb 3 ± 1 3 ± 1

rLW (nm)b 304 ± 97 327 ± 99

RLW (nm)b 780 ± 202 854 ± 197

R0 - rLW (nm)b 266 ± 135 293 ± 132

rHeight Image

nm)c

638 ± 44 508 ± 40† 690 ± 31 583 ± 27†

R0 – rHeight

Image (nm)b 82 ± 78 49 ± 60

a ± signs indicate standard deviations in hydrodynamic radii over nine aliquots taken from three

separate bacterial cultures of each strain.

b ± signs indicate standard deviations calculated by error propagation.

Chapter 2

34

c ± signs indicate standard deviations in the height of bacterial cells over at least 60 staphylococci taken

from three different cultures of each strain.

† The polar radius rHeight Image determined in AFM PeakForce-QNM mode is significantly smaller than

the hydrodynamic radius R0 measured by DLS, according to a one-sided Student's t-test (p < 0.05).

Imaging of bacterial cell deformation using AFM in the PeakForce-QNM mode

In order to directly image possible deformation of staphylococci adhering to a surface, AFM

was applied in the so-called PeakForce-QNM mode, providing the possibility to obtain

images while applying a minimal imaging force through the precise control of the force

response. SCNASYST-FLUID tips (Bruker) for use in the PeakForce-QNM mode were

calibrated as described above for NP-O10 tipless cantilevers. The tip radius was estimated by

scanning the calibration surface provided by the manufacturer and image-analysis with the

NanoScope Analysis software (Bruker). First a droplet of 0.01% α-poly-L-lysine was spread

on a clean glass slide and air-dried to create a positively charged surface (21). Next, a 200 µl

droplet of a staphylococcal suspension was put on the slide. After 30 min, the suspension

was washed off and immobilized bacteria within an area of 25 μm2 were scanned in 10 mM

potassium phosphate buffer (pH 7.0) using a previously calibrated tip in the PeakForce-

QNM mode on the BioScope Catalyst AFM, at a scan rate of 0.5 Hz and PeakForce set-point

of 1 nN. The images were analyzed using Gwyddion v2.30 (22). The height of each individual

bacterial cell was determined from the extracted height profile (see Figure 3). For each

strain, images were taken of at least 60 different staphylococci, representing three separate

cultures.


35

RESULTS

Hydrodynamic radii of planktonic staphylococci

Hydrodynamic radii R0 of planktonic staphylococci are presented in Table 1. According to a

one-sided Student’s t-test performed at a significance level of p < 0.05, Δpbp4 mutants are

slightly, but significantly smaller than their wild-type parent strains. Importantly,

hydrodynamic radii of the strains were not affected by harvesting procedures, as

demonstrated in Figure S5a (Supplemental Material).

Long-range contributions to bacterial adhesion forces and bacterial cell

deformation

In Figure 2, the adhesion force Fadh is plotted versus the loading force Fld applied during

AFM measurements, as derived from force-distance curves under different applied loading

forces (see Figure S4, Supplemental Material). Three out of four strains show good linear

relationships (R2 > 0.9) despite variations in slope and intercept. However, for S. aureus

NCTC 8325-4Δpbp4, the adhesion force appears to be independent of the loading force.

Table 1 also summarizes the long-range contribution FLR to the adhesion force for the two

parent strains and their isogenic Δpbp4 mutants. All strains show attractive long-range

forces. Interestingly, the ratios k of these two forces for the parent strains and their

respective isogenic mutant are very similar around 3 for both S. aureus NCTC 8325-4 and

ATCC 12600. Since the space separating the bacterial cell from the glass substratum is filled

with potassium phosphate buffer of relatively high ionic strength (10 mM), electric double

layer interactions may be considered negligible,23,24 and the ratio k between the long-range

forces for parent and mutant strain can be considered as the ratio between their Lifshitz-Van

der Waals forces. This consideration allows for calculating the change in the dimensions of

the Δpbp4 staphylococcal mutants under the influence of attractive Lifshitz-Van der Waals

forces. Measured long-range Lifshitz-Van der Waals adhesion forces matched those

calculated from published Hamaker constants,18,19 provided an ellipsoidal deformation of the

bacterial wall was assumed for the Δpbp4 mutants from its original undeformed, spherical

shape with a radius R0 (for details see equations 11 and 12). Accordingly, it can be calculated

that the deformation of the Δpbp4 mutants R0 – rLW amounts to 266 nm and 293 nm for S.

Chapter 2

36

aureus NCTC 8325-4 and ATCC 12600, respectively (see also Table 1) due to the built-in

deficiency in their cell wall rigidity.

Direct measurement of staphylococcal cell deformation

Comparative, quantitative data do not exist for the deformation of Δpbp4 mutants as

compared to their parent strains. Although the above results from our elastic deformation

model are intuitively reasonable, we also measured the deformation directly using the AFM

in the PeakForce-QNM mode (Figure 3). Importantly, the polar radii of the strains were not

affected by harvesting procedures, as demonstrated in Figure S5b (Supplemental Material).

The height images and profiles of the respective wild-type, parent and mutant strains were

expressed in terms of the polar radii rHeight Image and are also presented in Table 1. According

to a two-sided Student's t-test performed at a significance level of p < 0.05, the rHeight Image

values of the wild-type, parent strains are not significantly different from their

hydrodynamic radii R0 values.


37

Figure 3. Height images and profiles of individual staphylococci immobilized on a glass surface in the

AFM PeakForce-QNM mode for two wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and

their isogenic Δpbp4 mutants. Five examples of height profiles are presented for each strain. The

profiles plotted as solid lines are derived along the directions indicated by the dashed lines in the

height images presented.

Chapter 2

38

However, according to a one-sided Student's t-test performed at a significant level of p <

0.05, the rHeight Image values of both Δpbp4 mutants are significantly smaller than their

hydrodynamic radii R0 values determined using DLS. These direct measurements confirm

strong deformation of Δpbp4 mutants during adhesion to glass, although not to the extent as

derived from our elastic deformation model.

DISCUSSION

Long-range, Lifshitz-Van der Waals adhesion forces between bacteria and substratum

surfaces are of ubiquitous importance in facilitating adhesion of bacteria, since they cause

attraction of bacteria from a large distance to a substratum surface while, they operate

regardless of the details of the bacterial cell surface structure and composition. Moreover, in

a long-range approach, surface appendages may be less important, as the concept of distance

between bacteria and substratum surfaces is lost upon close approach. Long-range, Lifshitz-

Van der Waals adhesion forces can be derived from contact angles with liquids on the

interacting surfaces and surface thermodynamic modeling25,26 or decoupling of AFM

adhesion force measurements using Poisson analysis.27–30 However, long-range adhesion

forces vary considerably less among different strains than short-range forces.27–30 Similarity

in long-range adhesion forces is to be expected, because these forces arise from the entire

bacterial cell, i.e. its DNA content, cytoplasm, cell membrane, peptidoglycan layer and

outermost cell wall structures (see Figure 1). Whereas the outermost cell wall structures may

vary most across different strains, yet the overall composition of different bacterial strains is

rather similar, which suggests that the variations observed hitherto in long-range adhesion

forces may have other sources than differences in chemical composition. This is the first

study to derive quantitative data on the nano-scale deformation of deformable Δpbp4

mutants and its relation with long-range adhesion forces between these staphylococci and

substratum surfaces. Long-range adhesion forces of the deformable mutants are three-fold

stronger than of their rigid parent strains, which suggests that long-range, Lifshitz-Van der

Waals forces between bacteria and substratum surfaces are strongly affected by the

deformability of the bacterial cell wall. In this study, Staphylococcus aureus was used, since

the undeformed bacterium is spherical and can be attached to the AFM cantilever without

orientational preference. Evaluation of cell wall deformation based on the comparison of the


39

Lifshitz-Van der Waals forces for other cell types, like rod-shaped organisms is possible, but

this requires different equations to derive the theoretical values of the Lifshitz-Van der

Waals force and moreover, precise control of the orientation of the organisms on the AFM

cantilever.

An impact of bacterial cell wall deformation on long-range adhesion forces is new, as

it is extremely difficult to reveal by other methods. Contact angle measurements with liquids

on bacterial lawns for instance, most likely yield information on undeformed cell wall of the

bacteria with the outer surface structures collapsed in a partly dehydrated state. Force values

derived from combining contact angles on solid substrata and bacterial lawns using

thermodynamic modeling therefore do not include an influence of deformation as a result of

adhesion to a substratum surface. This implies that studies aimed to reveal an impact of

deformation on long-range adhesion forces should one way or another include cell wall

deformation combined with an appropriate method. At this point it should be admitted, that

even in the current study using our previously published elastic deformation model,10 we

conclude that bacteria slightly deform under the influence of adhesion forces from an

extrapolation of results obtained for highly deformable Δpbp4 staphylococcal mutants to the

situation as valid for rigid organisms.

Deformation of Δpbp4 staphylococcal mutants has never been quantified before, and

hence we have no independent comparative data. Based on the ellipsoidal deformation (see

Figure 1), over forty percent deformation along the polar axis occurred for the Δpbp4

mutants under a loading as high as 9 nN, using the assumption that the wild-type parent

strains remained spherical under the same load. When directly imaging bacteria

immobilized at the poly-L-lysine-coated glass slide, as mediated by attractive electrostatic

interactions,16 the polar radii rHeight Image of the Δpbp4 mutants are smaller than their

hydrodynamic radii R0, but the differences appeared much smaller compared to the

deformation obtained from our elastic deformation model (compare R0 – rHeight Image with R0

– rLW in Table 1). However, in AFM force spectroscopy the loading force also contributes to

the deformation of the bacterial cell wall. In the AFM PeakForce-QNM mode, the loading

force hardly deforms immobilized bacteria and the cell wall deforms only under the

influence of the adhesion force between the bacterium and the substratum surface. This

difference in origin of external loads likely explains why the deformation calculated from

matching measured and theoretically calculated Lifshitz-Van der Waals forces is larger than

Chapter 2

40

directly measured using the AFM in the PeakForce-QNM mode. Although quantitatively

deviating, results from our elastic deformation model and AFM, support that Δpbp4 mutants

are mechanically "softer" than their parent strains and deform significantly under loading,

which is consistent with the lack of cross-linked peptidoglycan strands in their cell wall.11,12

At a first glance, from the independence of the adhesion force Fadh on the applied loading Fld,

this may not seem true for S. aureus NCTC 8325-4Δpbp4 (Figure 2). However, this

particular mutant readily reaches a strong adhesion force at low loading forces, which may

be indicative of deformation over the entire range of loading forces applied, i.e. it may

possess an extremely soft peptidoglycan layer.

Due to the lack of sufficiently sensitive techniques, like the AFM PeakForce-QNM, it

has hitherto been assumed that naturally occurring bacterial strains, including the parent

strains of our isogenic mutants, do not deform during adhesion. Recent observations

emphasize that de-activation of bacterial metabolism differs when bacteria adhere to

different substrata.9,31 Assuming stress-deactivation is related to cell deformation, it is

inferred that naturally occurring bacteria suffer small, nano-scale deformation upon

adhesion, causing stress-deactivation9,32 and cell death as a fatal result when adhesion forces

and accompanying deformation become too large.33–35 Yet, these studies do not provide

direct evidence of bacterial cell wall deformation upon adhesion. Based on the results of this

study, it can be concluded that minor differences in long-range Lifshitz-Van der Waals forces

may be considered indicative of potential bacterial cell wall deformation.

Summarizing, differences in long-range Lifshitz-Van der Waals forces between

adhering bacteria and substratum surfaces need not only be due to variation in composition

and structure of the bacterial cell surface, but can also be caused by nano-scale deformation

of the bacterial cell wall, facilitating an increase in contact area and therewith in adhesion

force. Bacterial cell wall deformation has never been accounted for in bacterial adhesion

studies and therewith the current paper paves the way for a better understanding of poorly

understood phenomena like bacterial “stress-deactivation” upon strong adhesion of micron-

sized bacteria to a substratum surface.


41

ACKNOWLEDGMENTS

The authors are grateful to Dr. Mariana G. Pinho, Laboratory of Bacterial Cell Biology, and

Dr. Sergio R. Filipe, Laboratory of Bacterial Cell Surfaces and Pathogenesis, Instituto de

Tecnologia Quimica e Biológica, Universidade Nova de Lisboa, for providing S. aureus NCTC

8325-4 Δpbp4 and the pMAD-pbp4 plasmid.

REFERENCES

1. Fletcher M. 1994. Bacterial biofilms and biofouling. Curr. Opin. Biotechnol. 5:302–306.

2. Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2:95–108.

3. Bos R, Van der Mei HC, Busscher HJ. 1999. Physico-chemistry of initial microbial adhesive interactions – its mechanisms and methods for study. FEMS Microbiol. Rev. 23:179–230.

4. Hermansson M. 1999. The DLVO theory in microbial adhesion. Colloids Surf. B Biointerfaces 14:105–119.

5. Van Oss CJ. 1994. Interfacial forces in aqueous media. Marcel Dekker.

6. Van Oss CJ. 2003. Long-range and short-range mechanisms of hydrophobic attraction and hydrophilic repulsion in specific and aspecific interactions. J. Mol. Recognit. 16:177–190.

7. Israelachvili JN. 1992. Intermolecular and surface forces, 2nd ed. Academic Press.

8. Hamaker HC. 1937. The London—van der Waals attraction between spherical particles. Physica 4:1058–1072.

9. Liu Y, Strauss J, Camesano TA. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.

10. Chen Y, Norde W, Van der Mei HC, Busscher HJ. 2013. Bacterial cell surface deformation under external loading. mBio 3:e00378–12.

11. Wyke AW, Ward JB, Hayes MV, Curtis NA. 1981. A role in vivo for penicillin-binding protein-4 of Staphylococcus aureus. Eur. J. Biochem. FEBS 119:389–393.

Chapter 2

42

12. Atilano ML, Pereira PM, Yates J, Reed P, Veiga H, Pinho MG, Filipe SR. 2010. Teichoic acids are temporal and spatial regulators of peptidoglycan cross-linking in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 107:18991–18996.

13. Lee JC, Betley MJ, Hopkins CA, Perez NE, Pier GB. 1987. Virulence studies, in mice, of transposon-induced mutants of Staphylococcus aureus differing in capsule size. J. Infect. Dis. 156:741–750.

14. Touhami A, Jericho MH, Beveridge TJ. 2004. Atomic force microscopy of cell growth and division in Staphylococcus aureus. J. Bacteriol. 186:3286–3295.

15. Madigan MT, Martinko JM, Stahl DA, Clark DP. 2011. Brock biology of microorganisms. Pearson Education, Limited.

16. Vadillo-Rodríguez V, Busscher HJ, Norde W, De Vries J, Dijkstra RJB, Stokroos I, Van der Mei HC. 2004. Comparison of atomic force microscopy interaction forces between bacteria and silicon nitride substrata for three commonly used immobilization methods. Appl. Environ. Microbiol. 70:5441–5446.

17. Parsegian VA. 2006. Van der Waals forces. Cambridge University Press.

18. Rijnaarts HHM, Norde W, Bouwer EJ, Lyklema J, Zehnder AJB. 1993. Bacterial adhesion under static and dynamic conditions. Appl. Environ. Microbiol. 59:3255–3265.

19. Rijnaarts HHM, Norde W, Lyklema J, Zehnder AJB. 1999. DLVO and steric contributions to bacterial deposition in media of different ionic strengths. Colloids Surf. B Biointerfaces 14:179–195.

20. Van Kampen NG, Nijboer BRA, Schram K. 1968. On the macroscopic theory of Van der Waals forces. Phys. Lett. 26:307–308.

21. Camesano TA, Natan MJ, Logan BE. 2000. Observation of changes in bacterial cell morphology using tapping mode atomic force microscopy. Langmuir 16:4563–4572.

22. Nečas D, Klapetek P. 2012. Gwyddion: an open-source software for SPM data analysis. Cent. Eur. J. Phys. 10:181–188.

23. Verwey EJW. 1947. Theory of the stability of lyophobic colloids. J. Phys. Colloid Chem. 51:631–636.

24. Butt H-J, Graf K, Kappl M. 2006. Physics and chemistry of interfaces. John Wiley & Sons.

25. Absolom DR, Lamberti FV, Policova Z, Zingg W, Van Oss CJ, Neumann AW. 1983. Surface thermodynamics of bacterial adhesion. Appl. Environ. Microbiol. 46:90–97.

26. Van Oss CJ. 1989. Energetics of cell-cell and cell-biopolymer interactions. Cell Biophys. 14:1–16.


43

27. Han T, Williams J, Beebe T. 1995. Chemical-bonds studied with functionalized atomic-force microscopy tips. Anal. Chim. Acta 307:365–376.

28. Williams J, Han T, Beebe T. 1996. Determination of single-bond forces from contact force variances in atomic force microscopy. Langmuir 12:1291–1295.

29. Stevens F, Lo Y, Harris JM, Beebe TP. 1999. Computer modeling of atomic force microscopy force measurements: comparisons of Poisson, histogram, and continuum methods. Langmuir 15:207–213.

30. Chen Y, Busscher HJ, Van der Mei HC, Norde W. 2011. Statistical analysis of long- and short-range forces involved in bacterial adhesion to substratum surfaces as measured using atomic force microscopy. Appl. Environ. Microbiol. 77:5065–5070.

31. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state? PLoS Pathog. 8:e1002440.

32. Rizzello L, Galeone A, Vecchio G, Brunetti V, Sabella S, Pompa PP. 2012. Molecular response of Escherichia coli adhering onto nanoscale topography. Nanoscale Res. Lett. 7:575.

33. Lewis K, Klibanov AM. 2005. Surpassing nature: rational design of sterile-surface materials. Trends Biotechnol. 23:343–348.

34. Tiller JC. 2011. Antimicrobial Surfaces. Bioact. Surfaces 240:193–217.

35. Schaer TP, Stewart S, Hsu BB, Klibanov AM. 2012. Hydrophobic polycationic coatings that inhibit biofilms and support bone healing during infection. Biomaterials 33:1245–1254.

Chapter 2

44

SUPPLEMENTAL MATERIAL

Control experiments to demonstrate effective bacterial probe preparation

Effective attachment of a staphylococcus on a poly-L-lysine coated cantilever was

demonstrated by comparing force-distance curves between a staphylococcal probe and a

poly-L-lysine coated cantilever versus a glass surface (see Figure S1).

Figure S1. Examples of force-distance curves recorded for a poly-L-lysine coated cantilever (a) and a

staphylococcal probe (S. aureus NCTC 8325-4) (b) on a glass surface taken in 10 mM potassium

phosphate buffer (pH 7.0) under a maximal loading force of 3 nN. Note that the X-axes have different

scales.

The poly-L-lysine coated cantilever adheres weakly to the glass surface with a single, narrow,

adhesion force in the retract curve, while the staphylococcal probe shows a stronger

adhesion force with multiple peaks upon retract.

A second control involves the possible disturbance of the bacterial cell wall upon air-

drying the staphylococci to the cantilever, which might be especially important for the Δpbp4

mutants with their weakened cell wall. In Figure S2, it can be seen that drying times up to 3

min do not systematically affect the force-distance curves, neither of the wild-type, parent

strains nor of the Δpbp4 mutants within the reproducibility of the experiments. In neither

case do the force-distance curves resemble those of a cantilever without bacteria.


45

Figure S2. Retract force-distance curves for staphylococcal probes prepared of S. aureus NCTC 8325-

4 (a), S. aureus NCTC 8325-4 Δpbp4 (b), S. aureus ATCC 12600 (c) and S. aureus ATCC 12600Δpbp4

(d) after different drying times. Note that panel b has a different X-axis scale than the other three

panels.

Chapter 2

46

Replicate force-distance curves for a staphylococcal probe and influence of the

loading force

Force-distance curves between staphylococci and glass surfaces were generally reproducible

(see Figure S3), showing clear effects of the loading force (see Figure S4).

Figure S3. Five replicates of retract force-distance curves recorded for a bacterial probe of S. aureus

NCTC 8325-4 under a loading force of 3 nN at a same spot on a glass surface in 10 mM potassium

phosphate buffer (pH 7.0). Different symbols represent five different replicates.


47

Figure S4. Retract force-distance curves for a bacterial probe of S. aureus NCTC 8325-4 on a glass

surface under loading forces Fld of 1, 3, 5, 7 and 9 nN in 10 mM potassium phosphate buffer (pH 7.0).

Chapter 2

48

Influence of centrifugation and sonication on the hydrodynamic radii of

planktonic staphylococci

In order to verify whether centrifugation and sonication affected the hydrodynamic radii of

the staphylococci in their planktonic state, three additional harvesting protocols were

applied other than the standard protocol described in the Materials and Methods section.

Their hydrodynamic radii R0 and polar radii rHeight Image were determined using DLS and AFM

PeakForce-QNM mode, respectively:

PROTOCOL 1: staphylococci were harvested by a single centrifugation at 5000 × g for 5

min and directly suspended in 10 mM potassium phosphate buffer.

PROTOCOL 2: 10 s sonication at 30 W was carried out intermittently for three times for

bacteria harvested using Protocol 1, while cooling the suspension in a water/ice bath.

PROTOCOL 3: the bacteria were harvested and suspended as described in the standard

protocol, but no sonication was conducted afterwards.

Figure S5 summarizes the hydrodynamic radii R0 (Figure S5a) the polar radii rHeight Image

(Figure S5b) of bacterial cells prepared by different protocols. Two-sided, one-way ANOVA

indicated no significant differences in polar radii of staphylococci harvested according to

different protocols (p > 0.05).


49

Figure S5. Hydrodynamic radii R0 measured by DLS (a) and polar radii rHeight Image determined using

AFM imaging (b) for staphylococci harvested according to different protocols. Error bars in panel a

denote the standard deviations over nine aliquots taken from three separate bacterial cultures of each

strain, and error bars in panel b denote the standard deviations over at least 60 staphylococci taken

from three separate bacterial cultures of each strain.

Chapter 2

50

51

Chapter 3

Residence-time Dependent Cell Wall Deformation of

Different Staphylococcus aureus Strains on Gold

measured using Surface-Enhanced-Fluorescence

(Reproduced with permission of Royal Society of Chemistry from Jiuyi Li, Henk J. Busscher,

Jan J. T. M. Swartjes, Yun Chen, Akshay K. Harapanahalli, Willem Norde, Henny C. van der

Mei, Jelmer Sjollema. Residence-time Dependent Cell Wall Deformation of Different

Staphylococcus aureus Strains on Gold measured using Surface-Enhanced-Fluorescence.

Soft Matter 2014, 38, 7638-7646)

Chapter 3

52

ABSTRACT

Bacterial adhesion to surfaces is accompanied by cell wall deformation that may extend to

the lipid membrane with an impact on the antimicrobial susceptibility of the organisms.

Nanoscale cell wall deformation upon adhesion is difficult to measure, except for Δpbp4

mutants, deficient in peptidoglycan cross-linking. This work explores surface enhanced

fluorescence to measure cell wall deformation of staphylococci adhering on gold surfaces.

Adhesion-related fluorescence enhancement depends on the distance of the bacteria to the

surface and the residence-time of the adhering bacteria. A model is forwarded based on the

adhesion-related fluorescence enhancement of green-fluorescent microspheres, through

which the distance to the surface and cell wall deformation of adhering bacteria can be

calculated from their residence-time dependent adhesion-related fluorescence enhancement.

The distances between adhering bacteria and a surface, including compression of their

extracellular polymeric substance (EPS)-layer, decrease up to 60 min after adhesion,

followed by cell wall deformation. Cell wall deformation is independent on the integrity of

the EPS-layer and proceeds fastest for a Δpbp4 strain.

Cell Wall Deformation on Gold Surfaces using SEF

53

INTRODUCTION

Bacterial adhesion to substratum surfaces constitutes the first step in the formation of a

biofilm. Biofilms can pose considerable problems in many industrial and environmental

applications and over 60% of all human bacterial infections are due to biofilms (1, 2). On the

other hand, there are applications where the development of biofilms is beneficiary to

processes like bioremediation of soil, or to support host-protection against invading

pathogens (3, 4). The bacterial cell wall consists of a relatively soft outermost layer, crucial

for adhesion and biofilm formation, and a more rigid, hard core enveloped by a cross-linked

peptidoglycan layer. The peptidoglycan layer is relatively thick in Gram-positive bacteria as

compared to Gram-negative ones. The outermost bacterial cell layer can be composed of a

variety of different surface appendages and a matrix of “extracellular polymeric substances”

(EPS) containing amongst others, polysaccharides, lipids, proteins and eDNA (2, 5, 6). eDNA

is pivotal for the integrity of the EPS-layer around a bacterium and serves as a glue holding

its various components together (7-9).

The outermost surface of bacteria behaves differently upon adhesion to a substratum

surface than the one of inert, non-biological particles, although similarities exist too. Both

adhering bacteria as well as inert particles show initial maturation of the adhesive bond by

progressive removal of interfacial water, re-arrangement of surface structures to increase the

number of contact points and structural adaptation of surface-associated macromolecules.

Residence-time dependent desorption phenomena in a parallel plate flow chamber, time

dependent adhesion force measurements using atomic force microscopy (AFM) and

experiments with a quartz-crystal microbalance with dissipation (QCM-D) have all indicated

that this type of physico-chemical bond-maturation proceeds on a time-scale of up to several

minutes (10). The forces involved in bacterial adhesion to a substratum surface not only

affect this initial bond-maturation, but moreover dictate the amount of EPS produced (11)

and, when exceeding a threshold force, lead to so-called “stress de-activation” of an adhering

bacterium (12). Stress de-activation can become so severe as to cause cell death. Nanoscale

cell wall deformation upon bacterial adhesion to a substratum surface has been suggested to

trigger the bacterial response to an adhering state (13, 14). Nanoscale bacterial cell wall

deformation is extremely difficult to measure due to the rigidity of the peptidoglycan layer.

The little evidence available for bacterial cell wall deformation as a result of adhesion to a

surface, stems from work with so-called Δpbp4 isogenic mutants. Staphylococcus aureus

Δpbp4 mutants lack chemical cross-linking in their peptidoglycan layers (3), and accordingly

Chapter 3

54

relatively large deformations of up to 100-300 nm have been reported, depending upon the

method applied (15). Thus by extrapolation, it can be expected that wild-type strains with

cross-linked peptidoglycan also deform as a result of their adhesion to a surface, but less

than their Δpbp4 isogenic mutants.

Surface enhanced fluorescence (SEF) is a relatively newly discovered phenomenon

that was first described for fluorescent proteins and later also for fluorescently-engineered

bacteria. It involves enhanced emission of fluorescent light when fluorophores come close to

a reflecting metal surface, a mechanism which has been widely investigated during the last

10 years (16-19). SEF on average extends over a distance of around 30 nm and decreases

exponentially with separation distance between the fluorophore and the reflecting surface, as

demonstrated by measuring SEF of proteins adsorbed to reflecting surfaces with polymeric

spacers of different lengths in between (20, 21). In principle, bacterial cell wall deformation

brings the intracellular content closer to a substratum surface, and hence it can be expected

that SEF will enable quantitative evaluation of cell wall deformation of fluorescent bacteria

upon their adhesion to a reflecting substratum.

The aim of this study is to measure SEF of three green-fluorescent S. aureus strains

upon adhesion to gold surfaces as a function of their residence-time. Secondly, a model is

proposed to describe the decrease of SEF with distance between green-fluorescent

microspheres and a reflecting gold surface, based on the measurement of SEF of green-

fluorescent microspheres adhering to gold-coated quartz surfaces with adsorbed

poly(ethylene glycol) methyl ether thiol (PEG-thiols) layers of different thickness. Further

elaboration of the model enables to quantitatively evaluate bacterial cell wall deformation

from SEF. Two S. aureus strains with different expression of EPS were employed, as well as

a Δpbp4 mutant, expected to yield more extensive cell wall deformation than its parent

strain. All strains were evaluated prior to and after treatment with DNase I to disrupt the

integrity of their EPS (22), therewith enabling to distinguish between effects of initial

deposition, compression of EPS, and cell wall deformation. S. aureus was chosen as it

represents a major pathogen in human health and disease, with especially pathogenic traits

when involved in biomaterial-associated infections.


55


Bacterial strains and cultures

Three different S. aureus strains were involved in this study, i.e. S. aureus RN4220, S.

aureus ATCC 12600 and its isogenic pbp4 mutant differing in the degree of cross-linking of

their peptidoglycan layer (3). To generate GFP expressing bacteria, the plasmid pMV158 GFP

containing optimized GFP under control of the constitutively expressed MalP promoter (23),

was introduced into these S. aureus strains by electroporation (24). Bacteria were routinely

cultured aerobically at 37°C on a Tryptone Soya Broth (TSB; OXOID, Basingstoke, England)

agar plate supplemented with 10 g mL-1 tetracycline. One colony was used to inoculate 10

ml TSB also supplemented with 10 g ml-1 tetracycline and this pre-culture was grown for 24

h at 37°C. The pre-culture was diluted 1:20 in 200 ml TSB and grown for 16 h at 37°C.

Cultures were harvested by centrifugation (Beckman J2-MC centrifuge, Beckman Coulter,

Inc., CA, USA) for 5 min at 4000 g, and washed twice with 10 ml phosphate buffered saline

(PBS: 5 mM K2HPO4, 5 mM KH2PO4, 0.15 M NaCl, pH 7.0). To break staphylococcal

aggregates, sonication at 30 W (Vibra Cell Model 375, Sonics and Materials Inc., Danbury,

CT, USA) was applied (3 times 10 s), while cooling in an ice/water bath. Finally, bacteria

were resuspended in PBS to a concentration of 3 108 ml-1 as determined in a Bürker-Türk

counting chamber. The hydrodynamic diameter of these staphylococci amounted 1.2 µm on

average, as determined using dynamic light scattering.

DNase I treatment

All three S. aureus strains produced EPS, as they grew black colonies on Congo Red agar

plates (data not shown). To address the contribution of the EPS-matrix on cell wall

deformation, bacterial pellets harvested from 200 ml TSB culture were suspended in 10 ml

PBS solution with 100 g ml-1 DNase I (Fermentas Life Sciences, Roosendaal, The

Netherlands) for 1 h at 37C, after which sonication at 30 W was applied (3 times 10 s) to

remove naturally present endogenous eDNA and therewith disrupting the EPS-matrix on the

bacterial cell surfaces and slightly reducing the staphylococcal diameter to 1.1 µm.

Subsequently, bacteria were harvested, washed and sonicated to break staphylococcal

aggregates, as described above. Finally, bacteria were resuspended in PBS to a concentration

of 3 108 ml-1, also as described above.

Chapter 3

56

Fluorescent microspheres

Green-fluorescent polystyrene microspheres with a size similar to the one of staphylococci,

i.e. with a similar diameter as the staphylococci of 1.1 m (Molecular Probes,

Invitrogen Life Technology, Grand Island, NY, USA), were used to represent

undeformable fluorescent particles. Although polystyrene particles deposited from

suspension can deform and coalesce upon drying to form latex films due to forces associated

with the evaporation of the suspension liquid (25), polystyrene particles kept in a liquid

phase will not experience such forces and can be considered undeformable. As received

microsphere suspensions were diluted in PBS to a concentration of 1 107 ml-1 as determined

in a Bürker-Türk counting chamber.

Gold-coated surfaces, coupling of PEG-thiols and their layer thickness using

QCM-D

Gold-coated quartz-crystal sensors (Jiaxing JingKong Electonic Co. Ltd., Jiaxing, China)

were used as a reflecting substratum for staphylococcal adhesion and adhesion of green-

fluorescent microspheres. Before each experiment, gold-coatings were cleaned by immersion

in a 3:1:1 mixture of water, 25% NH3H2O and 20% H2O2 (Merck, Darmstadt, Germany) at

70C for 10 min. After cleaning, gold-coated crystals were mounted in the chamber of a

QCM-D (Q-Sense AB, Gothenburg, Sweden) to allow deposition of staphylococci and

microspheres. The QCM-D chamber is disc-shaped with a diameter of 14 mm, and a height

of 0.66 mm.

In order to establish a relation between SEF and the separation distance of

fluorescent microspheres and the gold surface, gold surfaces were coated with a self-

assembled monolayer of variable thickness. To this end, the gold-coated crystals were placed

in the QCM-D chamber and the system was perfused with water at a flow rate of 0.144 ml

min-1 until stable baseline values were obtained. Subsequently, the chamber was filled with a

0.2 mM PEG-thiol (molecular weight of 2000, 5000, and 10000; Sigma-Aldrich, St. Louis,

MO, USA) solution in water for 30 min at room temperature after which the chamber was

perfused again with water and the resulting changes in frequency and dissipation were used


57

to calculate the adsorbed layer thickness of the PEG-thiols with the QCM-D accompanying

software package (Q-Sense, Sweden) (26).

Deposition of staphylococci and microspheres and fluorescence imaging

Next, a suspension of fluorescent staphylococci or microspheres was flown into the QCM-D

chamber and flow was arrested to allow measurement of deposition using a metallurgical

microscope. Since staphylococci and microspheres were suspended in relatively high ionic

strength PBS, there will be no electrostatic energy barrier for deposition and deposition

occurs solely under the influence of diffusion and sedimentation (27). For deposition

measurements, the microscope was equipped with a 40 objective (ULWD, CDPlan, 40PL,

Olympus Co, Tokyo, Japan), connected to a CCD camera (Basler A101F, Basler AG,

Germany). Staphylococci or microspheres were allowed to sediment under the influence of

gravity and the number of bacteria or particles adhering per unit area was expressed as a

fraction of the number of bacteria or particles adhering to the coatings in a stationary phase,

i.e. when all staphylococci present in the chamber had deposited.

For fluorescence imaging, the entire QCM-D chamber was placed on a sample stage

inside a bio-optical imaging system (IVIS Lumina II, PerkinElmer, Inc., Hopkinton, MA,

USA), and the above described deposition experiments repeated. The IVIS was kept at 20C

and provided a field of view of 7.5 x 7.5 cm, to encompass the diameter of the crystal

surfaces. Excitation and emission wavelengths for detection of both GFP staphylococci and

microspheres were 465 nm and 515-575 nm, respectively. An exposure time of 5 s was

employed and images were taken every 10 min over the entire period of 3 h. Average

fluorescence radiances, R (photons s-1 cm-2 sr-1) over a 1 cm2 user-defined region of interest

were determined for each image with the Living Image software package 3.1 (PerkinElmer

Inc., USA) which transforms electron counts on the CCD camera to an average fluorescence

radiance, taking into account the current optical parameters (area of the region of interest,

magnification, binning, diaphragm, exposure time and light collecting ability of the camera

as calibrated with standard light sources). The total number of staphylococci or

microspheres, ntot, contributing to the fluorescent radiance captured within the region of

interest was around 2.0 107 and 6.6 105, respectively. Fluorescence radiance R(t) was

monitored as a function of time during deposition.

Chapter 3

58

Calculation of residence-time dependent, adhesion-related fluorescence

enhancement

The increase of the fluorescence radiance due to adhesion of fluorescent staphylococci or

microspheres was measured relative to the fluorescence of suspended ones and expressed as

a total fluorescence enhancement, TFE(t), according to

(1)

in which R(t) denotes the fluorescence radiance at time t, while R0 and R(0) indicate the

fluorescence radiance before and after the introduction of staphylococci or microsphere

suspension into the flow chamber, respectively. TFE(t) comprises the fluorescence

contribution from adhering bacteria or microspheres and those still in the suspension.

Fluorescence enhancement was not corrected for photobleaching, because photobleaching

was found to be negligible over the time scale of the experiments (see Supporting

Information, Figure S1). Note that for staphylococci, demonstrating a residence-time

dependent fluorescent enhancement, TFE(t) comprises the fluorescence contribution from

adhering bacteria with various residence-times and the ones still in the suspension.

Accordingly,

(2)

in which 0 is the fluorescence from staphylococci in suspension, () is the adhesion-related

residence-time dependent fluorescence enhancement, τ is the residence-time of adhering

staphylococci, j(t) is the deposition rate at time t and ntot is the total number of bacteria or

microspheres, both in suspension and attached, contributing to the fluorescent radiance

captured within the region of interest.

In order to assess (), eqn (2) has been transformed to a finite summation according to

0

0

(0)

)()(

RR

RtRtTFE

tot0

t

0

tot

t

0

0

n

j(t)dtnτ)dτα(τ)j(t

TFE(t)


59

(3)

in which is the deposition rate at time i x Δt divided by ntot. Subsequently 1, the

adhesion-related fluorescence enhancement for the shortest residence-time Δt, is obtained

from the first measurement after the start of an experiment at t = Δt

(4)

In line, m, the adhesion-related fluorescence enhancement for residence-time m x Δt, can

be calculated after m consecutive steps according to

(for m>=2) (5)

STATISTICS

Data were statistically analysed using paired, two tailed Student t-tests. Significance was

established at p< 0.05.

11)(αjΔtTFEm

1i

i1mim

ij

1jΔt

1TFEα

1

11

1

m

1i

1m

1i

1iimim

mjΔt

1jαjΔtTFE

α

Chapter 3

60

RESULTS

Fluorescence enhancement during deposition of staphylococci and

microspheres

Figure 1. Total fluorescence enhancement, TFE(t), and percentage staphylococci and

microspheres deposited to a gold-coated surface as a function of deposition time for three,

green-fluorescent S .aureus strains. (a) S. aureus ATCC 12600GFP, (b) S. aureus RN4220GFP, (c)

S. aureus ATCC 12600 pbp4GFP and (d) green-fluorescent microspheres (note the different

time axis). TFE is due to planktonic and adhering bacteria and microspheres, while deposition

is expressed as a percentage of the number of adhering bacteria or microspheres, na with

respect to their total numbers in the system, ntot. Error bars represent standard errors over four

separate experiments with different bacterial cultures and microsphere suspensions. Open

symbols represent data for staphylococci treated with DNase I.


61

Adhesion-related fluorescence enhancement as a function of residence-time

Fluorescent enhancement will increase over time due to increasing numbers of adhering

staphylococci or microspheres on the gold surface and time dependent deformation of the

bacterial cell wall. Using a finite summation procedure, we were able to calculate the

adhesion-related fluorescence enhancement, (), as a function of residence-times, , of

adhering fluorescent bacteria and microspheres. Both bacteria as well as inert particles

showed an initially high adhesion-related fluorescence enhancement (Figure 2), followed by

a continuous increase for adhering staphylococci over a time period of at least 3 h (Figure

2a-2c) that levelled off after 1 h for S. aureus RN4220GFP and S. aureus ATCC 12600GFP but

not for its isogenic mutant S. aureus ATCC 12600 Δpbp4GFP, suggesting ongoing

deformation. For adhering fluorescent microspheres, however, a stationary level was

obtained within 10 min (Figure 2d), confirming their undeformable nature under the current

experimental conditions. These observations suggest that the rapid, initial increase bacterial

fluorescence enhancement is due to adhesion of the staphylococci at the surface and EPS-

compression, while the slower, continued increase results from cell wall deformation.

Importantly, the rate of continued increase is slightly higher for the Δpbp4GFP mutant (0.11 h-

1) than for its parent strain (0.08 h-1). Treatment of the EPS-matrix of the staphylococcal

strains with DNase I consistently resulted in an increased adhesion-related fluorescence

enhancement (Figure 2a-2c).

Chapter 3

62

Figure 2. Adhesion-related fluorescence enhancement, (), as a function of residence-time, ,

for three, green-fluorescent S. aureus strains and microspheres adhering to a gold-coated

surface. (a) S. aureus ATCC 12600GFP, (b) S. aureus RN4220GFP, (c) S. aureus ATCC 12600

pbp4GFP and (d) green-fluorescent microspheres. Error bars represent standard errors over

four separate experiments with different bacterial cultures and microsphere suspensions. Open

symbols represent staphylococci treated with DNase I.

Modelling the distance-dependence of adhesion-related fluorescence

enhancement of fluorescent microspheres on PEG-thiol layers

SEF of fluorescent proteins as a function of distance has been determined on reflecting

surfaces with polymeric spacers of different lengths in between.20,21 The task at hand in this

manuscript however, is more difficult and challenging, as we want to determine not only the

effects of bringing an undeformed, fluorescent bacterium closer to a reflecting substratum

surface as a result of deposition and EPS-compression under the influence of the adhesion

forces, but we also want to quantify further deformation of the bacterial cell wall. Therefore,

we first studied the time-dependence of the total fluorescence enhancement of

undeformable, fluorescent microspheres adhering on gold surfaces with polymeric spacers of

different molecular weights, yielding different separation distances between the

microspheres and the reflecting gold surface (Figure 3a). The thickness of the polymer layer

was determined using QCM-D.


63

Figure 3. Analysis of the fluorescence enhancement of green-fluorescent microspheres

adhering to a gold-coated surface. (a) Total fluorescence enhancement, TFE(t) as a function of

time to gold-coated surfaces with adsorbed PEG-thiol layers of different molecular weight, (b)

Adhesion-related fluorescence enhancement, (δ), for green-fluorescent microspheres

adhering to a gold-coated surface as a function of the adsorbed layer thickness of PEG-thiols.

Fluorescent enhancement values are taken in the stationary phase of the deposition process

(see Figure 3a) and are independent of residence-time (see also Figure 2d). Bars represent

standard errors over four separate experiments with different suspensions of microspheres.

The solid line represents calculated adhesion-related fluorescence enhancement as a function

of distance according to the model presented for undeformed green-fluorescent microspheres

on a reflecting metal surface, using literature values for the decay rates in the absence of a

metal, the enhancement factors N0nr and N0

r and the characteristic distances dn and dr (20).

Chapter 3

64

The enhancement factor N0ex and characteristic distance de were used as parameters in a least-

square fitting procedure yielding values of 68 and 387 Å, respectively.

Figure 3b presents the adhesion-related fluorescence enhancement of green-fluorescent

microspheres (similarly sized as our staphylococci) on gold surfaces, coated with PEG-thiol

layers as a function of the coating thickness. Adhesion-related fluorescence enhancement for

microspheres decreased with increasing thickness, i.e., the separation distance between the

microspheres and the reflecting gold surface. Since adhesion-related fluorescence

enhancement of microspheres was immediate and not increasing over time (see Figure 2d),

it can be assumed that the surfaces of the microspheres were in direct contact with the PEG-

thiol coating within the 10 min time-resolution of our measurements. SEF of single

fluorophores can be described (20, 28, 29) as the combined result of metal-induced

increases in the rate of (1) fluorescence quenching or non-radiative decay (knr) by a factor

Nnr, (2) fluorescence emission or radiative decay (Γ) by a factor Nr and (3) excitation of

fluorophores by a factor Nex. The distance-dependent adhesion-related fluorescence

enhancement of a single fluorophore, α(d), on a reflecting metal surface can be described by

the relative increase of the quantum yield Q(d) as related to the quantum yield far away from

the substratum, Q , multiplied by the increase in the excitation rate

(6)

The quantum yield, Q(d), can be expressed as the ratio of radiative decay relative to the total

decay,20 i.e., the sum of the radiative and non-radiative decays

(7)

The rates of non-radiative and radiative decay and the excitation rates occurring in eqn (6)

and (7) decrease exponentially as a function of the distance to the reflecting metal surface

according to

)()(

)( dNQ

dQd ex

nrnrr

r

kdNdN

dNdQ

)()(

)()(


65

(8)

where dn, dr, and de are the characteristic distances over which these effects decrease and

N0nr, N0

r and N0ex are the non-radiative, radiative and excitation rates of single fluorophores

at the surface. The distance-dependent adhesion-related fluorescence enhancement, α(d), of

Cy3-labeled oligonucleotides on silver particles rapidly increases with their distance from the

reflecting surface and amounts to around 80 at a distance of 10 nm, after which an

exponential decrease sets in ranging over approximately 30 nm (20).

In order to calculate the distance-dependent adhesion-related fluorescence

enhancement, α(δ) of green-fluorescent microspheres as a function of the distance, δ,

between the surface of a microsphere and a reflecting gold surface, it is assumed that

fluorophores distribute homogeneously within the microspheres, while we describe their

volume as a stack of 100 cylindrical disks. Eqn (6) to (8) subsequently allow calculation of

the fluorescent enhancement by each disk at various distances and summation values can be

compared with experimental data (Figure 3b) using a least-square fitting procedure. Note

that the adhesion-related fluorescence enhancement of microspheres is maximally 1.65 at

contact, which is about 50 times smaller than of fluorescent molecules. This is because for

fluorescent microspheres, there is only a fraction of all fluorophores present in the region

close to the reflecting surface where fluorescence enhancement is largest. In Figure 3b it can

be seen that unlike for single fluorophores, the near-linear data variation does not allow

derivation of all eight model parameters occurring in eqn (6) to (8). Therefore values for the

decay rates in the absence of a metal Γ (109 s-1) and knr (4 x 108 s-1), the enhancement factors

N0nr (38000) and N0

r (186) and characteristic distances dn (8.5 Å) and dr (119 Å) were

taken from surface enhanced fluorescence of Cy3-labeled oligonucleotides on silver particles

(20), and only values of N0ex and de were obtained from least-square fitting, which are the

main model parameters accounting for the distance dependence of SEF. Accordingly, a high

quality of the fit (R2 = 0.99; see Figure 3b) could be obtained, yielding a relation between

1)/exp()(

1)/exp()(

1)/exp()(

0

0

0

dedNdN

drdNdN

dndNdN

exex

rr

nrnr

Chapter 3

66

adhesion-related fluorescence enhancement of fluorescent microspheres and their distance

from a reflecting surface.

Residence-time dependent adhesion-related fluorescence enhancement and

staphylococcal cell wall deformation

Adhesion-related fluorescence enhancement of undeformable fluorescent microspheres on a

bare gold surface immediately reached a stationary value of around 1.6, within the time-

resolution of our fluorescence measurements. Adhering staphylococci however, did not reach

that level of fluorescence enhancement, which indicates that they kept a larger separation

distance between the cell wall and the gold surface through the presence of the EPS-layer

around them. Assuming that the GFP molecules are homogeneously distributed throughout

the entire volume of the bacterial cytoplasm as enclosed by the bacterial cell wall, the

separation distance can be calculated using the model for the distance-dependence of

adhesion-related fluorescence enhancement forwarded above. If we assume that cell wall

deformation only occurs when a bacterium has approached the gold surface to the closest

possible distance, we can first derive the residence-time dependent distance between the

staphylococci and the surface. The initial distance varied between 25 and 45 nm, depending

on the strain considered and the distance decreased within an hour (Figure 4). Interestingly,

DNase I treated staphylococci with a disrupted EPS-layer approached the surface faster than

strains with an intact EPS-layer to a distance of around 18 nm, which we consider as the

limiting distance for EPS compression. Adapting 18 nm as the closest possible distance to

which bacteria can approach the substratum surface, further interpretation of adhesion-

related fluorescence enhancement was done in analogy to the model outlined above for

fluorescent microspheres, but now allowing cell wall deformation. Cell wall deformation

brings a larger fluorescent volume of an adhering staphylococcus closer to the surface and

accordingly adhering staphylococci were assumed to deform from an initial sphere with

radius R0 to an oblate ellipsoid, with a short, polar radius, b and a circular equatorial plane

with radius, a. Assuming constant volume

V= (9) 3

0

2

3

4

3

4Rba


67

The ellipsoids could also be divided in stacks of discs and using the model proposed

above and the parameters presented in Figure 3, cell wall deformation could be evaluated

and expressed as the difference between the radius of the undeformed staphylococcus, R0

and the short, polar radius of the ellipsoidally deformed bacterium. All three staphylococcal

strains deformed between 1 and 3 h after deposition on the gold surface. It should be noted

that deformation was calculated up to 3 h for demonstration of the principle, while under

more physiologically relevant conditions adhering bacteria may well have divided by then. S.

aureus ATCC 12600 deformed more extensively than S. aureus RN4220, but both strains

with cross-linked peptidoglycan layers demonstrated similar cell wall deformations

irrespective of DNase I treatment. S. aureus ATCC 12600 Δpbp4GFP, deficient in

peptidoglycan cross-linking showed the most extensive deformation of its cell wall (Figure

4), that initially seemed dampened by the presence of an intact EPS-layer compared to the

deformation observed for the DNase I treated Δpbp4GFP mutant.

DISCUSSION

The biofilm-mode of growth is a ubiquitously occurring form of bacterial growth during

which the organisms experience adhesion forces from the surfaces to which they adhere, i.e.

either substratum surfaces or surfaces of neighbouring bacteria. This is unlike the situation

during planktonic growth, where they are freely suspended in an aqueous phase. The forces

experienced by bacteria in a biofilm-mode of growth have been demonstrated to have severe

impact on their susceptibility to antimicrobials and general viability (11, 12). The response of

bacteria to these adhesion forces has been suggested to be due to cell wall deformation,

causing altered membrane stresses (12), and re-arrangement of membrane lipids (30). AFM

has demonstrated that the bacterial cell wall can indeed be deformed up to the level of its

rigid peptidoglycan layer, but these experiments have all been carried out by wrenching

bacteria between a substratum surface and an AFM-cantilever15 or tip (31, 32) under the

influence of an externally applied loading force, rather than under the influence of the

naturally-occurring adhesion force arising from a substratum surface. Besides AFM-imaging

of bacteria artificially immobilized on positively charged surfaces, bacterial cell wall

deformation under the influence of naturally-occurring adhesion forces has never been

demonstrated nor reliably quantified. In this study, we used recently described surface

enhanced fluorescence of adhering bacteria (17, 24) to assess bond-maturation processes

and cell wall deformation of staphylococci adhering to gold surfaces.

Chapter 3

68

To this end, we have developed a new model to describe the distance dependence of

SEF for undeformable fluorescent microspheres and bacteria, from which we extrapolate to

deformation of the rigid core of adhering bacteria containing the fluorophores. As a first step

in bacterial interaction with a substratum surface (see Figure 5 for a schematic summary),

bacteria approach the surface and jump into contact. Jump into contact is facilitated by a low

energy barrier as a result of the absence of strong electrostatic repulsion in PBS (27), similar

to the coalescence of two liquid layers after approach.33 Next bond-maturation processes

occur, including removal of interfacial water that has been described to occur within several

minutes (10). These initial bond-maturation processes cannot be separated from effects of

EPS-compression, by consequence of the 10 min time-resolution of our experiments. In

initial bond-maturation, significant effects of DNase I treatment of staphylococci are seen for

S. aureus ATCC 12600GFP and S. aureus RN4220GFP. Although initial bond-maturation is

more extensive for S. aureus ATCC 12600GFP than for its isogenic mutant S. aureus ATCC

12600 Δpbp4GFP (Figure 4), this difference disappears after DNase I treatment. S. aureus

RN4220GFP differs from S. aureus ATCC 12600GFP in the sense that DNase I treatment of S.

aureus ATCC 12600GFP removes virtually all stainable EPS, while stainable EPS clearly

remains behind after DNase I treatment in case of S. aureus RN4220GFP (Supplementary

Figure S2). Thus, whereas DNase I treated S. aureus ATCC 12600GFP immediately reaches

the distance of closest possible approach to the gold surface, this requires more time for S.

aureus RN4220GFP (see Figure 4). This distance of closest approach between the

staphylococci adhering on a gold surface may be compared with the height of an assumed,

cylindrical contact volume that can be obtained using a newly proposed elastic deformation

model,15 based on the relation between adhesion forces and externally applied, loading forces

in AFM. Importantly, the elastic deformation model self-defines the height of the contact

volume between adhering bacteria and substratum surfaces. In order to find confirmation

for the separation of adhesion-related fluorescence enhancement into a component due to

the distance between adhering bacteria and a reflecting surface and cell wall deformation, we

performed AFM adhesion force measurements as a function of the external loading force and

applied the above mentioned elastic deformation model (see Supplementary Figure S3).

Interestingly, regardless of the strain involved, the height of the contact cylinder was found

to be around 20 nm, confirming the validity of our analysis of adhesion-related fluorescence

enhancement for our strains, yielding a distance of closest approach of 18 nm.


69

The bacterial core of adhering staphylococci enveloped by peptidoglycan, deforms

more readily in case of S. aureus ATCC 12600 Δpbp4GFP, deficient in peptidoglycan cross-

linking than observed for both wild-type strains, which supports the validity of our model.

Nevertheless, also the staphylococcal cores enveloped by cross-linked peptidoglycan deform.

DNase I treatment to disrupt the integrity of the EPS-layer, destabilizes the cell wall of the

Δpbp4GFP mutant, resulting in an almost instantaneous cell wall deformation right after

adhesion. This confirms a recently proposed new role for EPS as a stress-absorber (34),

hampering cell wall deformation and the associated development of membrane stresses that

may increase bacterial susceptibility to antimicrobials (30). Cell wall deformation for S.

aureus ATCC 12600 Δpbp4 immobilized on a positively charged, α-poly-L-lysine coated

surface, obtained using AFM-imaging and measured within approximately 1 h of contact,

amounts to 49 ± 60 nm (15), which is comparable to the deformation observed here for

staphylococci after 1 h of adhesion on a negatively charged gold surface (see Figure 4). Note

that deformation observed from AFM-imaging possesses a much larger standard deviation

than obtained using SEF, as SEF in essence is a macroscopic technique encompassing

numbers of bacteria that exceed the numbers of bacteria involved in microscopic AFM-

imaging by orders of magnitude.

The adhesion forces between the staphylococci involved in this study and the gold surfaces

and responsible for the deformations as presented in Figure 4, have been measured using

AFM force measurements between staphylococci attached to a tipless cantilever and the gold

coatings (see Supplementary Figure S4). These forces initially amount around 1 nN and

increase to between 2 and 3 nN after 30 s of bond-maturation under an externally applied

loading force of 1 nN, regardless of the strain considered. An estimate of the deformations

that might arise from these forces can be calculated using a Hertz model (15) that considers a

bacterium as a homogeneous elastic mass. Taking a Young’s modulus of whole bacteria in

the order of 1000 kPa (15), it can be calculated that an adhesion force of 3 nN yields a cell

wall deformation in the order of 20 - 25 nm, which is in the same range as reported here for

a residence-time of adhering staphylococci of 1 h.

Chapter 3

70

Figure. 4 Bacterium-substratum distance, δ, and bacterial cell wall deformation, (R0-b), as a

function of the residence-time of staphylococci adhering to gold surfaces. Error bars represent

standard errors calculated from adhesion-related fluorescence enhancement data from four

different bacterial cultures.

Wrenched between V-shaped and colloidal-probe AFM tips, deformations of Gram-

negative Pseudomonas aeruginosa PAO1 under an externally applied force of 10 nN, exerted

during a time-period of 10 s, amounted to 200 nm, while similar conditions for Gram-

positive Bacillus subtilis 168 strain yielded 80 nm deformation (32-35). Considering the

generally short time-periods involved in these studies while yielding cell deformations in the

same range as obtained here after 1 – 3 h (compare Figure 4), it can be concluded that

experiments in which bacteria are wrenched between a substratum and an AFM cantilever

overestimate initial bacterial cell wall deformation. This can either be due to the fact that the

externally applied forces by the AFM probe always yield a high local stress or due to the fact

that it is difficult to match the externally applied force to the naturally occurring forces

involved in bacterial adhesion to surfaces. Both these aspects are avoided through the use of

SEF.


71

Figure. 5 Schematic presentation of the different steps in bacterial interaction with a surface and SEF

events.(a) Approach of a bacterium towards the substratum surface. (b) Bacteria jump into

contact and SEF occurs from the fluorophores within the cytoplasm of the bacterium,

sufficiently close to the reflecting metal surface. (c) EPS is compressed under the influence of

the adhesion forces between the bacterium and the substratum surfaces, bringing more

fluorophores sufficiently close to the surface for SEF, up to a minimum separation distance of

around 18 nm. (d) When EPS is compressed to its limiting thickness, the cell wall deforms,

further increasing the number of fluorophores within the reach of SEF

CONCLUSION

Summarizing, we have forwarded a new method to determine residence-time dependent

adhesion-related fluorescence enhancement, and developed a model through which bond-

maturation of bacteria adhering on reflective metal surfaces can be analyzed in terms of the

distance between an adhering bacterium and the substratum, including EPS compression

and cell wall deformation. Cell wall deformations arising from the measurement of adhesion-

related fluorescence enhancement could be validated with AFM measurements of cell wall

deformation, provided care was taken to carefully match the conditions under which the

AFM experiments are carried out with the naturally occurring adhesion forces. As an

important advantage of using SEF, the number of bacteria involved in a single analysis is

much larger than can be obtained using more microscopic methods, like AFM.

Cell wall deformation plays an important role in understanding bacterial

susceptibility to antimicrobials as it extends to the lipid membrane and affects the lipid

density in the membrane. Deformations of the bacterial cell wall as demonstrated here, are

accompanied by an increase in the surface area of the lipid membrane from around 3 μm2 to

4.5 μm2. Therewith the distance between lipid molecules in the membrane increases, making

Chapter 3

72

it more susceptible for antimicrobials to penetrate. With the era of current antimicrobials

approaching its end (36), accurate measurement of cell wall deformation as a result of

bacterial adhesion to surfaces, irrespective of whether of synthetic or biological origin, is

thus highly important to develop alternatives for current antimicrobials.


73

REFERENCES

1. Busscher HJ, Van der Mei HC, Subbiahdoss G, Jutte PC, Van den Dungen JJAM, Zaat SAJ, Schultz MJ, Grainger DW. 2012. Biomaterial-Associated Infection: Locating the Finish Line in the Race for the Surface. Sci. Transl. Med. 4:153rv10–153rv10.

2. Flemming H-C, Wingender J. 2010. The biofilm matrix. Nat. Rev. Microbiol. 8:623–633.

3. Atilano ML, Pereira PM, Yates J, Reed P, Veiga H, Pinho MG, Filipe SR. 2010. Teichoic acids are temporal and spatial regulators of peptidoglycan cross-linking in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 107:18991–6.

4. Reid G, Younes JA, Van der Mei HC, Gloor GB, Knight R, Busscher HJ. 2011. Microbiota restoration: natural and supplemented recovery of human microbial communities. Nat. Rev. Microbiol. 9:27–38.

5. Sheng G-P, Yu H-Q, Li X-Y. 2010. Extracellular polymeric substances (EPS) of microbial aggregates in biological wastewater treatment systems: A review. Biotechnol. Adv. 28:882–894.

6. Koo H, Xiao J, Klein MI, Jeon JG. 2010. Exopolysaccharides produced by Streptococcus mutans glucosyltransferases modulate the establishment of microcolonies within multispecies biofilms. J. Bacteriol. 192:3024–3032.

7. Whitchurch CB, Tolker-Nielsen T, Ragas PC, Mattick JS. 2002. Extracellular DNA required for bacterial biofilm formation. Science 295:1487.

8. Huseby MJ, Kruse AC, Digre J, Kohler PL, Vocke JA, Mann EE, Bayles KW, Bohach GA, Schlievert PM, Ohlendorf DH, Earhart CA. 2010. Beta toxin catalyzes formation of nucleoprotein matrix in staphylococcal biofilms. Proc. Natl. Acad. Sci. U. S. A. 107:14407–14412.

9. Das T, Sehar S, Manefield M. 2013. The roles of extracellular DNA in the structural integrity of extracellular polymeric substance and bacterial biofilm development. Environ. Microbiol. Rep. 5:778–786.

10. Busscher HJ, Norde W, Sharma PK, Van der Mei HC. 2010. Interfacial re-arrangement in initial microbial adhesion to surfaces. Curr. Opin. Colloid Interface Sci.

11. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state?. PLoS Pathog. 8:e1002440.

12. Liu Y, Strauss J, Camesano T a. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.

13. Ruiz N, Silhavy TJ. 2005. Sensing external stress: Watchdogs of the Escherichia coli cell envelope. Curr. Opin. Microbiol. 8:122–126.

Chapter 3

74

14. Otto K, Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 99:2287–2292.

15. Chen Y, Norde W, Mei HC Van Der, Busscher HJ. 2012. Bacterial Cell Surface Deformation under External Loading. MBio 3:e00378–12.

16. Lakowicz JR. 2001. Radiative decay engineering: biophysical and biomedical applications. Anal. Biochem. 298:1–24.

17. Lee K, Hahn LD, Yuen WW, Vlamakis H, Kolter R, Mooney DJ. 2011. Metal-Enhanced Fluorescence to Quantify Bacterial Adhesion. Adv. Mater. 23:H101–H104.

18. Moal E Le, Fort E, Lévêque-Fort S, Cordelières FP, Fontaine-Aupart M-P, Ricolleau C. 2007. Enhanced fluorescence cell imaging with metal-coated slides. Biophys. J. 92:2150–2161.

19. Dragan AI, Bishop ES, Casas-Finet JR, Strouse RJ, McGivney J, Schenerman M a., Geddes CD. 2012. Distance Dependence of Metal-Enhanced Fluorescence. Plasmonics 7:739–744.

20. Malicka J, Gryczynski I, Gryczynski Z, Lakowicz JR. 2003. Effects of fluorophore-to-silver distance on the emission of cyanine-dye-labeled oligonucleotides. Anal. Biochem. 315:57–66.

21. Fu Y, Lakowicz JR. 2006. Enhanced fluorescence of Cy5-labeled oligonucleotides near silver island films: A distance effect study using single molecule spectroscopy. J. Phys. Chem. B 110:22557–22562.

22. Harmsen M, Lappann M, Knøchel S, Molin S. 2010. Role of extracellular DNA during biofilm formation by listeria monocytogenes. Appl. Environ. Microbiol. 76:2271–2279.

23. Nieto C, Espinosa M. 2003. Construction of the mobilizable plasmid pMV158GFP, a derivative of pMV158 that carries the gene encoding the green fluorescent protein. Plasmid 49:281–285.

24. Li J, Busscher HJ, Van der Mei HC, Sjollema J. 2012. Surface enhanced bacterial fluorescence and enumeration of bacterial adhesion. Biofouling. 29:11–19.

25. Sperry PR, Snyder BS, O’Dowd ML, Lesko PM. 1994. Role of Water in Particle Deformation and Compaction in Latex Film Formation. Langmuir 10:2619–2628.

26. Voinova M V., Jonson M, Kasemo B. 2002. “Missing mass” effect in biosensor’s QCM applications. Biosens. Bioelectron. 17:835–841.

27. Wilson WW, Wade MM, Holman SC, Champlin FR. 2001. Status of methods for assessing bacterial cell surface charge properties based on zeta potential measurements. J. Microbiol. Methods 43:153–164.

28. Anger P, Bharadwaj P, Novotny L. 2006. Enhancement and quenching of single-molecule fluorescence. Phys. Rev. Lett. 96:3–6.


75

29. Chris D. Geddes, Joseph R. Lakowicz. 2002. Metal-Enhanced Fluorescence. J. Fluoresc. 12:121–129.

30. Isabel Perez M, Rodriguez N, Ocampo J, Chavez J, Fernanda Contreras M, Arevalo C, Feussner I, Trier S, Leidy C. 2013. Bacterial Biofilm Formation Induces Strong Shifts in Lipid Composition Resulting in Increased Resistance Towards Antimicrobial Peptide Activity. Biophys. J. 104:20A.

31. Vadillo-Rodriguez V, Schooling SR, Dutcher JR. 2009. In situ characterization of differences in the viscoelastic response of individual gram-negative and gram-positive bacterial cells. J. Bacteriol. 191:5518–5525.

32. Bolshakova A V, Kiselyova OI, Yaminsky I V. 2004. Microbial surfaces investigated using atomic force microscopy. Biotechnol. Prog. 20:1615–1622.

33. Chen N, Kuhl T, Tadmor R, Lin Q, Israelachvili J. 2004. Large deformations during the coalescence of fluid interfaces. Phys. Rev. Lett. 92:024501.

34. Crismaru M, Asri L a TW, Loontjens TJ a, Krom BP, De Vries J, Van der Mei HC, Busscher HJ. 2011. Survival of adhering staphylococci during exposure to a quaternary ammonium compound evaluated by using atomic force microscopy imaging. Antimicrob. Agents Chemother. 55:5010–5017.

35. Vadillo-Rodriguez V, Beveridge TJ, Dutcher JR. 2008. Surface viscoelasticity of individual gram-negative bacterial cells measured using atomic force microscopy. J. Bacteriol. 190:4225–4232.

36. Woodford N, Livermore DM. 2009. Infections caused by Gram-positive bacteria: a review of the global challenge. J. Infect. 59 Suppl 1:S4–16.

Chapter 3

76

SUPPLEMENTAL MATERIAL

Figure S1 Fluorescence radiance, R(t), normalized against the radiance at t=0, R(0), arising

from green-fluorescence staphylococci adhering to a glass surface as a function of time for three

different strains involved in this study. Fluorescence is constant over a time period of at least 5

h, demonstrating the absence of significant photo-bleaching upon repetitive excitation.


77

Figure S2 Stainable EPS expression in planktonic cultures of S. aureus ATCC12600 and S.

aureus RN4220. Staphylococci, grown and harvested as described in the main text, were

suspended in 10 ml PBS to an optical density at 578 nm of 1. Subsequently, 1.5 ml suspension

was pelleted at 5000 g for 5 min at 10°C, after which EPS was extracted by re-suspending the

pellet in 50 μL of 0.5 M EDTA (pH 8.0) for 5 min at 100°C. Concentrated EPS was incubated at

37°C with 10 μl of 20 μg/ml proteinase K for 30 min and diluted 1:100 in water and 40 µL was

blotted on a nitrocellulose membrane. The membrane was then blocked using 1% bovine serum

albumin-Tris buffered saline (20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.05% Tween20) for 1 h

under mild shaking at room temperature. The membrane was subsequently incubated with a 1:

10,000 dilution of Wheat Germ Agglutinin (Sigma-Aldrich, St. Louis, USA) for 1.5 h under mild

shaking at room temperature. Wheat Germ Agglutinin is a biotin labelled antibody specific for

poly-n-acetylglucosamine, a major constituent of staphylococcal EPS. Finally, Streptavidin

IRDye (LI-COR Biosciences, Lincoln, USA) was added in 1: 10,000 dilution for 30 min under

similar conditions and the membrane was washed 3 times, for 10 min each, with Tween20-Tris

buffered saline. The membrane was imaged using an Odyssey Infrared Imaging System (LI-

COR Biosciences, Lincoln, USA), yielding dark spots on the blot indicative of the amount of

PNAG.

Chapter 3

78

Figure S3 Height of the contact cilinder of untreated and DNase I treated S. aureus adhering

on gold-coated quartz surfaces, as derived from AFM adhesion force measurements under

different loading forces. Staphylococci were grown, harvested and DNase I treated as described

in the main text. Bacterial probes were prepared by immobilizing a bacterium to an α-poly-L-

lysine coated tipless cantilever (Bruker, Camarillo, CA). Deformation was measured at different

loading forces as exerted by the AFM cantilever up to 1 nN and applied in a recently published 15

elastic deformation model, that self-defines the dimensions of an assumed cylindrical, contact

volume between adhering bacteria and substratum surfaces based on the relation between

deformation and the loading force applied. Error bars represent standard deviations of 90

force-distance measurements on 30 randomly chosen spots, equally divided over the surfaces

of three different bacteria.


79

Figure S4 Residence-time dependent adhesion forces for untreated and DNase I-treated S.

aureus adhering on gold-coated quartz surfaces from AFM force measurements. Staphylococci

were grown, harvested and DNase I treated as described in the main text and immobilized to an

α-poly-L-lysine coated tipless cantilever (Bruker, Camarillo, CA) for residence-time dependent

AFM adhesion force measurements in 10 mM potassium phosphate buffer (pH 7.0) at room

temperature using a BioScope Catalyst AFM (Bruker) under a loading force of 1 nN. For each

bacterial probe, force-distance curves were measured upon initial contact (0 s) and after 30 s

bond-maturation. Error bars represent standard deviations of 90 force-distance measurements

on 30 randomly chosen spots, equally divided over the surfaces of three different bacteria.

80

81

Chapter 4

Influence of Adhesion Force on icaA and cidA Gene

Expression and Production of Matrix Components in

Staphylococcus aureus Biofilms

(Reproduced with permission of American Society for Microbiology from Akshay K.

Harapanahalli, Yun Chen, Jiuyi Li, Henk J. Busscher and Henny C. van der Mei. Influence of

Adhesion Force on icaA and cidA Gene Expression and Production of Matrix Components in

Staphylococcus aureus Biofilms. Appl. Environ. Microbiol. 2015, 12, 3369-3378)

Chapter 4

82

ABSTRACT

The majority of human infections are caused by biofilms. The biofilm mode of growth

enhances the pathogenicity of Staphylococcus spp. considerably, because once adhering

staphylococci embed themselves in a protective, self-produced matrix of extracellular-

polymeric-substances (EPS). The aim of this study is to investigate the influence of

staphylococcal adhesion forces to different biomaterials on icaA (regulating production of

EPS matrix components) and cidA (associated with cell lysis and eDNA release) gene

expression in Staphylococcus aureus biofilms. Experiments were performed with S. aureus

ATCC12600 and its isogenic mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan

cross-linking. Deletion of pbp4 was associated with greater cell-wall deformability, while not

affecting planktonic growth rate, biofilm formation or cell-surface-hydrophobicity or zeta-

potential of the strains. Adhesion forces of S. aureus ATCC12600 were strongest on

polyethylene (4.9 ± 0.5 nN), intermediate on polymethylmethacrylate (3.1 ± 0.7 nN) and

weakest on stainless steel (1.3 ± 0.2 nN). Production of poly-N-acetylglucosamine, eDNA

presence and expression of icaA genes decreased with increasing adhesion forces. However,

no relation between adhesion forces and cidA expression was observed. Adhesion forces of

the isogenic mutant S. aureus ATCC12600Δpbp4 (deficient in peptidoglycan cross-linking)

were much weaker than of the parent strain and did not show any correlation with the

production of poly-N-acetylglucosamine, eDNA nor the expression of icaA and cidA genes.

This suggests that adhesion forces modulate the production of matrix molecules poly-N-

acetylglucosamine, eDNA and icaA gene expression by inducing nanoscale cell-wall

deformation with a pivotal role of cross-linked peptidoglycan layers in this adhesion force

sensing.

Influence of Adhesion Force on Gene Expression

83

INTRODUCTION

Staphylococcus spp. present an important group of potentially pathogenic strains and

species. According to estimates by The National Institutes of Health, about 80% of all human

infections are caused by biofilms (1). The biofilm mode of growth enhances the pathogenicity

of Staphylococcus spp. considerably when formed on the surfaces of biomaterial implants

and devices, such as total knee or hip arthroplasties or pacemakers (2). Biofilm formation

starts with the adhesion of individual organisms to a substratum surface. Initially, adhesion

is reversible but the bond between an adhering organism and a substratum surface rapidly

matures over time to become stronger and eventually adhesion is irreversible (3). Adhesion

is further enforced through the production of a matrix consisting of Extracellular Polymeric

Substances (EPS) by the adhering organisms in which they grow and find shelter against the

host immune system and antibiotic treatment. EPS composition largely depends on bacterial

strains and environmental conditions, but major components of EPS across different species

are polysaccharides, proteins and extracellular DNA (4).

It is difficult to envision how adhering bacteria regulate EPS production in response

to their adhesion to different surfaces. Recently, we have proposed that the bacterial

response to adhesion is dictated by the magnitude of the force by which a bacterium adheres

to a surface (5) and distinguished three regimes of adhesion forces (Figure 1). In the

planktonic regime, bacteria adhere weakly and accordingly cannot realize that they are on a

surface and retain their planktonic phenotype. The opposite regime is called the lethal

regime, where strong adhesion forces lead to high cell-wall stresses, retarded growth and

finally cell death. Both the planktonic regime as well as the lethal regime occur mostly after

application of coatings, like highly hydrated and hydrophilic polymer brush coatings or

positively charged quaternary ammonium coatings exerting strong, attractive electrostatic

forces on adhering bacteria, which are usually negatively charged under physiological

conditions (6). Most biomaterials used for implants and devices however, exert intermediate

adhesion forces on adhering bacteria and this regime is called the interaction regime. In the

interaction regime, bacteria were hypothesized to respond to the adhesion forces exerted by

a surface through production of various matrix components. Clinically indeed, biofilms of

the same strain can have different pathogenicity when formed on different biomaterials (7).

For example in abdominal wall surgery, hydrophobic surgical meshes made of

polytetrafluoroethylene are more susceptible to infection than meshes of less hydrophobic

polypropylene (8). On orthopedic biomaterials, icaA expression by Staphylococcus

Chapter 4

84

epidermidis and EPS production were higher on polyethylene than on

polymethylmethacrylate. Moreover, biofilms on polyethylene showed lower susceptibility to

gentamicin relative to biofilms on polymethylmethacrylate (9).

Figure 1 Regimented scheme for the interaction of bacteria with substratum surfaces. Weakly

adhering bacteria remain to have a planktonic phenotype, while strongly adhering ones die upon

contact. In the interaction regime bacteria are hypothesized to respond to their adhering state with

differential gene expression according to the adhesion force value they experience (5).

Little is known however, on the exact role of adhesion forces on the complex

response of adhering bacteria in the interaction regime. A likely hypothesis is that the

adhesion forces cause nanoscale cell-wall deformations and membrane stresses that act as a

signaling mechanism for an organism to its adhering state. Therefore, the response of

bacteria to their adhering state will not only differ on different biomaterials but will also

depend on the rigidity of the cell-wall itself as maintained in Gram-positive strains by a

relatively thick layer of cross-linked peptidoglycan. Measuring nanoscale cell wall

deformation upon bacterial adhesion to a surface is extremely difficult. Recently a new,

highly sensitive method has been proposed based on surface enhanced fluorescence that

measures cell-wall deformation over a large number of adhering bacteria under the influence

of the naturally occurring adhesion forces arising from a substratum surface (10). Surface

enhanced fluorescence is the phenomenon of increased fluorescence when fluorophores

come closer to a reflecting metal surface. It was first described for fluorescent proteins (11)

and ranges over a distance of 30 nm beyond which it decreases exponentially with separation

distance between the fluorophore and the reflecting surface. This relationship between


85

surface enhanced fluorescence and separation distance was validated using fluorescent

proteins attached to polymeric spacers of varying lengths (12) and forms the basis for the

interpretation of surface enhanced fluorescence of adhering fluorescent bacteria in terms of

deformation of their cell wall. This method has a drawback that it can only be applied on

reflecting metal surfaces, but bears as advantages with respect to atomic force microscopy

e.g., that there are no external forces applied on an adhering bacterium, while it also

measures a large number of adhering bacteria simultaneously.

The aim of this study is to investigate the influence of adhesion to different common

biomaterials on icaA and cidA gene expression in Staphylococcus aureus biofilms. To this

end, we first measure staphylococcal adhesion forces to different biomaterials and relate

these adhesion forces with the expression of icaA and cidA genes. The ica operon is present

in S. aureus and is mainly involved in production of capsular polysaccharides upon

activation (13). Recently, it has also been reported that the ica locus is also required for

colonization and immunoprotection during colonizing the host (13, 14). IcaA and icaD

synthesize poly-N-acetylglucosamine (PNAG) which supports cell-cell and cell-surface

interactions (15). cidA expression is associated with cell lysis and the release of eDNA during

planktonic growth to facilitate adhesion and biofilm formation (16). Therefore, eDNA is

known to act as an essential glue to maintain the integrity of both the EPS matrix and

biofilms as a whole (16, 17). All experiments were performed with S. aureus ATCC12600 and

its isogenic mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan cross-linking.

Higher deformability of the S. aureus ATCC12600Δpbp4 cell-wall with respect to the wild-

type strain was demonstrated using surface enhanced fluorescence.

Chapter 4

86



Bacterial strains S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were used

throughout this study. All the strains were stored at -80°C in Tryptone Soya Broth (TSB,

OXOID, Basingstoke, UK) containing 15% glycerol. Bacteria were cultured aerobically at

37°C on blood agar or TSB-agar plates with 10 μg ml-1 tetracycline. One colony was

inoculated in 10 ml TSB and grown for 24 h at 37°C. The pre-culture was then inoculated in

10 ml fresh TSB (1:100) and cultured for 16 h. The main culture (1:100) was used for 24 h

biofilm growth, while for other experiments staphylococci were suspended in TSB or

phosphate-buffered saline (PBS; 10 mM potassium phosphate, 0.15 M NaCl, pH 7.0) to the

desired density, as determined either by OD578 nm (Genesys™ 20 visible spectrophotometer,

Beun de Ronde, Abcoude, The Netherlands) or enumeration of the number of bacteria per

ml using a Bürker-Türk counting chamber. A stable chromosomal mutation in S. aureus

ATCC12600Δpbp4 was obtained by transfecting the temperature sensitive pMAD-pbp4

plasmid, as previously described (18). pMAD-pbp4 plasmid was obtained from Dr. M. G.

Pinho, Laboratory of Bacterial Cell Biology, and Dr. S. R. Filipe, Laboratory of Bacterial Cell

Surfaces and Pathogenesis, Instituto de Tecnologia Quimica e Biológica, Universidade Nova

de Lisboa.

To confirm that pbp4 deletion had an influence on cell-wall deformation using

surface enhanced fluorescence, GFP expressing variants (S. aureus ATCC12600-GFP and S.

aureus ATCC12600Δpbp4-GFP) were made by introducing the plasmid PMV158 into the

staphylococci, as controlled by the MalP promoter using electroporation and selected on 10

μg ml-1 tetracycline TSB-agar plates.

Cell-wall deformation

pbp4 deletion was confirmed by PCR and its expression was quantified in both the

staphylococcal strains using primer sets listed in Table 1. Main cultures were diluted 1:100 in

10 ml TSB and grown for 24 h under static conditions. Next, 1 ml of the resulting suspension

was subjected to RNA isolation and cDNA synthesis procedures, as described below for icaA

and cidA gene expression. To confirm that pbp4 deletion had an influence on cell-wall

deformation of the staphylococci, we applied a novel, highly sensitive method to

demonstrate cell-wall deformation of bacteria adhering on reflecting metal surfaces based on


87

surface enhanced fluorescence (19). Briefly, staphylococci suspended in PBS (3 x 108 cells ml-

1) were allowed to sediment from a 0.075 cm high suspension volume above a stainless steel

316L (SS) substratum surface (7.6 x 1.6 cm) and the fluorescence radiance was measured as a

function of time using a bio-optical imaging system (IVIS Lumina II, PerkinElmer, Inc.,

Hopkinton, MA, USA) at an excitation wavelength of 465 nm and emission wavelength

between 515-575 nm. The IVIS was kept at 20°C with an exposure time of 5 s and images

were taken from the entire SS substratum surface every 5 min over a period of 3 h. From

three user defined regions of interest (1 cm2) the average fluorescent radiance was

determined with Living Image software package 3.1 (PerkinElmer Inc., USA). It was not

necessary to correct the fluorescence enhancement for photobleaching because previously

reported control experiments on glass showed negligible bleaching up to 5 h (19).

Staphylococcal sedimentation was monitored by direct observation and images of adhering

bacteria were taken using a metallurgical microscope equipped with 40x objective (ULWD,

CDPlan, 40PL, Olympus Co, Tokyo, Japan) connected to a CCD camera (Basler A101F,

Basler AG, Germany). The images were analysed using an in-house developed software

based on MATLAB to count the number of adhering bacteria in each image. Numbers of

adhering bacteria over the entire substratum surface were subsequently expressed as a

percentage with respect to the total number of bacteria present in the suspension volume

(0.912 ml) above the substratum.

The increase of the fluorescence radiance due to sedimentation and adhesion of

fluorescent staphylococci was measured relative to the fluorescence of suspended ones and

expressed as a total fluorescence enhancement, TFE(t), according to

(1)

in which R(t) denotes the fluorescence radiance at time t, while R0 and R(0) indicate the

fluorescence radiance of a suspension in the absence of staphylococci and immediately prior

to their sedimentation from suspension, respectively. Whereas total fluorescence

enhancement is due to a combination of increasing numbers of sedimented staphylococci

and their cell-wall deformation, increases in total fluorescence enhancement extending

0

0

(0)

)()(

RR

RtRtTFE

Chapter 4

88

beyond the time at which sedimentation is complete, are due to cell-wall deformation (19).

Cell-wall deformation brings a larger volume of the bacterial cytoplasm closer to the surface

and therewith more fluorophores inside the bacterium become subject to fluorescence

enhancement, yielding a higher fluorescence signal. Fluorescence enhancement only occurs

on reflecting substrata and accordingly effects of pbp4 deletion on cell-wall deformation

were only examined on SS.

Staphylococcal characteristics not-related to cell-wall deformation

In order to verify that other characteristics relevant for the current study were not affected

by pbp4 deletion, planktonic growth curves, biofilm formation, cell surface hydrophobicity

and zeta potential of the bacterial cell surfaces were determined.

Planktonic growth curves

Planktonic growth curves of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were

compared. Staphylococci were suspended in 10 ml TSB to an optical density OD578 nm of 0.05

and grown at 37°C under static conditions. Optical densities were subsequently measured as

a function of time.

Biofilm formation and quantitation

Biofilms on SS, polymethylmethacrylate (PMMA) and polyethylene (PE) coupons were

grown in triplicate in a 12-wells plate. After incubation for 6, 12 and 24 h at 37°C, the

coupons with biofilms were carefully removed and placed into a new 12-wells plate and

gently washed. The biofilms from three coupons of the same material were then suspended

by repeated pipetting and pooled in 1 ml PBS. To measure the biofilm biomass, 1:10 dilutions

of the pooled bacterial suspensions were prepared and optical densities OD578nm were

measured.

Microbial Adhesion To Hydrocarbons (MATH)

MATH was carried out in its kinetic mode (20) to reveal possible differences in adhesive cell

surface properties between S. aureus ATCC12600 and its isogenic Δpbp4 mutant. To this

end, staphylococci were suspended in phosphate buffer (10 mM potassium phosphate buffer,

pH 7.0) to an optical density OD578nm of 0.45-0.50 (Ao) and 150 μl hexadecane was added to


89

3 ml bacterial suspension, and the two phase system was vortexed for 10 s (0.17 min) and

allowed to settle for 10 min. The optical density (At) was measured and this procedure was

repeated 5 more times (increasing vortexing times) and results were plotted as log (At / Ao ×

100) against the vortexing time (t) to determine the rate of initial bacterial removal R0 (min-

1) from the aqueous phase, i.e. their hydrophobicity as by the kinetic MATH assay, according

to

Zeta potential Bacterial suspensions of the wild-type and mutant strain were prepared as

mentioned above. Main cultures were centrifuged at 4000 g for 10 min and washed 2 times

in 10 ml PBS, pH 7.0. The washed pellets were resuspended in 10 ml PBS, pH 7.0 and zeta

potentials were determined by particulate microelectrophoresis (Zetasizer nano-ZS; Malvern

Instruments, Worcestershire, UK) at 25°C. The experiments were repeated three times and

the data are presented as averages ± standard error of the mean.

Preparation of bacterial AFM probes and adhesion force measurements In order

to measure adhesion forces between the S. aureus strains and different biomaterials,

staphylococci were immobilized on a cantilever for atomic force microscopy (AFM), as

described before (21). Bacteria were cultured as described above, with the difference that

they were washed and suspended in demineralized water. Adhesion force measurements

were performed at room temperature in PBS using a Dimension 3100 system (Nanoscope V,

Digital Instruments, Woodbury, NY, USA). For each bacterial probe, force-distance curves

were measured with no surface delay at a 2 nN trigger threshold. Using the same bacterial

probe, fifteen force measurements were recorded and three different probes were used on

three random locations on each material surface. Adhesion forces were determined from the

cantilever deflection data which were converted to force values (nN) by multiplication with

the cantilevers spring constant according to Hooke’s law

F= Ksp × D ` (3)

where Ksp is the spring constant of the cantilever and D is the deflection of the cantilever.

The spring constant of each cantilever was determined using the thermal method (22). The

integrity of a bacterial probe was monitored before and after the onset of each adhesion cycle

Chapter 4

90

by comparing adhesion forces measured on a clean glass surface. Whenever this adhesion

force differed more than 0.5 nN, data obtained last with that probe were discarded and a new

bacterial probe was made.

icaA and cidA gene expression

Gene expression analysis was performed on 1 h, 3 h and 24 h old biofilms. Biofilms were

grown by adding 2 ml of 1:100 diluted main culture with growth medium to each sample.

Total RNA from the biofilms was isolated using RiboPureTM-Bacteria Kit (Ambion,

Invitrogen) according to the manufacturer’s instructions. Traces of genomic DNA was

removed using DNAfreeTM kit (Ambion, Applied biosystems, Foster City, CA) and absence of

genomic DNA contamination was verified by real-time PCR prior to cDNA synthesis. cDNA

synthesis was carried out using 200 ng of RNA, 4 μl 5x iScript Reaction Mix, 1 μl iScript

Reverse Transcriptase, in a total volume of 20 μl (Iscript, Biorad, Hercules, CA) according to

manufacturer’s instructions. Real time RT-qPCR was performed in triplicates in a 96-well

plate AB0900 (Thermo Scientific, UK) with the primer sets for gyrB, icaA and cidA (Table

1). The following thermal conditions were used for all qPCR reactions: 95°C for 15 min and

40 cycles of 95°C for 15 s and 60°C for 20 s. The mRNA levels were quantified in relation to

endogenous control gene gyrB. Expression levels of icaA and cidA in all biofilms were

expressed relative to biofilms grown on PE.


91

TABLE 1 Primer sequences for qRT-PCR used in this study.

Primer Sequence (5’- 3’) icaA-forward GGAAGTTCTGATAATACTGCTG icaA-reverse GATGCTTGTTTGATTCCCTC cidA-forward AGCGTAATTTCGGAAGCAACATCCA cidA-reverse CCCTTAGCCGGCAGTATTGTTGGTC pbp4 -forward GTTTGCCGGGTACAGATGGT pbp4-reverse CTCTTGGATAGTCCGCGTGT gyrB-forward GGAGGTAAATTCGGAGGT gyrB-reverse CTTGATGATAAATCGTGCCA

Production of matrix components in staphylococcal biofilms.

PNAG extraction and quantitation

Extraction of PNAG from S. aureus was performed as previously described (13). Briefly, 24 h

staphylococcal biofilms grown on SS, PMMA and PE coupons as described above were

suspended in 1 ml PBS for normalization, and diluted to an OD578nm of 0.75 for slime

extraction. The bacterial suspension was pelleted at 4000 g for 15 min, the supernatant was

aspirated and the pellet was re-suspended in 50 μl 0.5 M EDTA (pH 8) and incubated 5 min

at 100°C on a hot plate. Cell debris was pelleted at 8500 g for 5 min and 30 μl of the EPS

containing supernatant was pipetted into fresh tubes. The samples were treated with 10 μl

proteinase K (20 μg ml-1) for 30 min at 37°C before quantitation. The concentrated EPS was

diluted 1:100 with ultrapure water and 20 μl was blotted on nitrocellulose membrane using

Bio-Dot® apparatus (Biorad, Hercules, CA). The nitrocellulose membrane was then blocked

using 1% bovine serum albumin-Tris buffered saline (20 mM Tris-HCl pH 7.5, 500 mM

NaCl, 0.05% Tween20) for 1 h under mild shaking at room temperature. The membrane was

subsequently incubated with the lectin (wheat germ agglutinin, Sigma-Aldrich, Saint Louis,

USA) isolated from Triticum vulgaris that detects 1,4 β-N-acetyl-D-glucosamine, labeled

with biotin as a primary antibody in a 1:1000 dilution for 1.5 h under mild shaking at room

temperature. Finally, Streptavidin-Infra Red Dye® (LI-COR Biosciences, Leusden, The

Netherlands) was added as a secondary antibody in 1:10,000 dilution for 30 min under mild

shaking at room temperature. The membrane was washed 3 times, for 10 min each, with

Tween20-Tris buffered saline and the amount of PNAG measured using an Odyssey Infrared

Imaging System (LI-COR Biosciences).

eDNA extraction and quantitation. Extraction of eDNA was performed, as previously

described (14), but with some minor modifications. Briefly, biofilms grown for 24 h on SS,

Chapter 4

92

PMMA and PE coupons as described above were suspended in 1 ml 500 mM NaCl containing

10 mM EDTA and 50 mM Tris.HCl, pH 7.5 and transferred into chilled tubes. OD578nm of the

suspensions were measured for normalization and staphylococci were centrifuged at 4000 g

for 15 min to separate bacteria and eDNA. The supernatant was collected and subjected to

DNA extraction twice with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1)

and precipitated using 1/10 (v/v) of 3 M sodium acetate and 2/3 (v/v) of ice cold

isopropanol. After centrifugation (15 min, 4°C, 8500 g), the pellet was washed with 100%

ethanol and air dried. The dried DNA pellet was dissolved in 50 μl TE buffer (10 mM Tris-

HCl, 1 mM EDTA, pH 7.5). The amount of eDNA was quantified using CyQuant cell

proliferation assay kit (Invitrogen, molecular probes, Eugene, Oregon, USA) based on a

calibration curve of λDNA from 0 to 1000 ng ml-1. The eDNA samples were processed

according to the manufacturer’s instructions and measured by a fluorescence plate reader at

an excitation wavelength of 485 nm and emission wavelength of 520 nm.

Substratum surfaces, contact angle and surface roughness measurements

Substratum surfaces used in this study were SS, PMMA and PE. All substratum surfaces

were prepared to possess a comparable surface roughness in the micron-range, 1-2 μm in

order to rule out possible effects of surface roughness. SS was polished using 1200 grid SiC

paper followed by MetaDi 3 μm diamond suspension (Buehler, Lake bluff, IL, USA) on a

polishing mat for 20 min, while PMMA and PE surfaces were used as received. Circular

coupons of 0.5 mm thickness with a surface area of 3.1 cm2 were made to fit into a 12-wells

plate, sterilized with methanol, washed with sterile PBS and stored in sterile demineralized

water until use. Water contact angles were measured on all materials at 25°C using the

sessile drop technique in combination with a home-made contour monitor. Surface

roughness of the biomaterials was determined by AFM (Nanoscope IV DimensionTM 3100)

using a silicon nitride tip (Mountain View, CA, USA; probe curvature radius of 18 nm).


93

RESULTS

Physico-chemical surface properties of biomaterials

Hydrophobicities of the biomaterials were evaluated using water contact angles. Water

contact angles varied considerably over the three materials included in this study. SS was the

least hydrophobic material with an average water contact angle of 33 ± 9 degrees, followed

by PMMA 69 ± 6 degrees and PE 84 ± 1. Surface roughnesses measured with AFM of the

materials were all in the micron-range and amounted 1.8 ± 0.2 µm, 2.0 ± 0.4 µm and 1.0 ±

0.2 µm for SS, PMMA and PE, respectively.

Effects of pbp4 deletion on S. aureus

Peptidoglycan cross-links provide cell-wall rigidity, therefore effects on cell-wall deformation

were determined from total fluorescence enhancement of S. aureus sedimenting and

adhering to SS. The initial linear increase (1–2 h) in total fluorescence enhancement for S.

aureus ATCC12600-GFP and S. aureus ATCC12600Δpbp4-GFP is due in part to an increase

in the number of sedimented bacteria (compare Figure 2a and Fig 2b), but the slow increase

in total fluorescence enhancement after 3 h once all staphylococci from the suspension have

sedimented on the surface, is fully due to cell-wall deformation. Accordingly, it can be seen

that S. aureus ATCC12600Δpbp4-GFP deforms to a greater extent than does S. aureus

ATCC12600-GFP due to the absence of pbp4 crosslinking.

Chapter 4

94

Figure 2 Effects of pbp4 deletion on cell-wall deformation.(a) Cell-wall deformation of S. aureus

ATCC12600-GFP and S. aureus ATCC12600∆pbp4-GFP upon adhesion to SS, as measured using

surface enhanced fluorescence. As an adhering bacterium deforms, its fluorescent intracellular content

gets closer to the reflecting metal surface yielding a surface enhanced fluorescence that increases with

increasing deformation. Each point represents an average ± standard error of the mean over three

individual experiments. All differences between S. aureus ATCC12600 and S. aureus

ATCC12600Δpbp4 are statistically significant (p < 0.05).(b) The number of adhering S. aureus

ATCC12600-GFP and S. aureus ATCC12600∆pbp4-GFP on SS surfaces as a function of sedimentation

time, expressed as a percentage of bacteria adhering (na) with respect to the total number of bacteria

(ntot) in the suspension volume above the substratum surface. Each point represents an average ±

standard error of the mean over three individual experiments. All differences between S. aureus

ATCC12600 and S. aureus ATCC12600Δpbp4 are statistically significant (p < 0.05).

In order to establish that pbp4 deletion solely affected the cell-wall deformability of S.

aureus ATCC12600 and no other properties, planktonic growth (Figure 3a), biofilm

formation (Figure 3d and 3e), cell surface hydrophobicities (Figure 3B) using the MATH-test

in its kinetic mode (20) and zeta potentials (Figure 3c) were compared with the ones of S.

aureus ATCC12600Δpbp4. Growth curves, zeta potentials and cell surface hydrophobicities

(initial removal coefficients R0 of 0.0002 min-1) of both strains were identical. Generally, S.

aureus ATCC12600Δpbp4 formed less biofilm than S. aureus ATCC12600. For both strains

on SS, more biofilm is formed than on PMMA and PE for all time points measured (Figure

3d, 3e), although no statistically significant differences could be established in amount of

biofilm on the three substratum surfaces after 24 h of growth.


95

S. aureus adhesion forces to different biomaterials

The adhesion forces of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were

measured using AFM, equipped with a bacterial probe as recently advocated by Alsteens et

al. (23). For S. aureus ATCC12600 (Figure 4a), strongest adhesion forces were observed on

the PE surface (4.9 ± 0.5 nN) that decreased in a statistically significant manner (p < 0.05)

toward more hydrophilic PMMA (3.1 ± 0.7 nN) and SS (1.3 ± 0.2 nN) surfaces. Adhesion

forces of the Δpbp4 mutant were significantly smaller (p < 0.05) than of S. aureus

ATCC12600 (Figure 4b).

Figure 3 Effects of expression of pbp4 in S. aureus ATCC12600 on strain characteristics not-related to

cell-wall deformation. (a) Planktonic growth curves of S. aureus ATCC12600 and S. aureus

ATCC12600Δpbp4 at 37°C (fully overlapping). (b) The optical density log (At/A0 × 100) as a function of

the vortexing time for the removal of S. aureus ATCC12600 and its isogenic mutant S. aureus

Chapter 4

96

ATCC12600Δpbp4 from an aqueous phase (10 mM potassium phosphate buffer, pH 7.0) by

hexadecane. Absence of removal indicates a hydrophilic cell surface.Each point represents an average ±

standard error of the mean over three individual experiments with separately grown staphylococcal

cultures. None of the differences between S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 are

statistically significant. (c) Zeta potentials of S. aureus ATCC12600 and S. aureus ATCC12600∆pbp4 in

PBS, pH 7.0. Each point represents an average ± standard error of the mean over three individual

experiments with separately grown staphylococcal cultures. None of the differences between S. aureus

ATCC12600 and S. aureus ATCC12600Δpbp4 are statistically significant. (d) and (e) Biofilm formation

of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 expressed as OD578 nm after 6, 12 and 24 h of

growth on SS, PMMA and PE.

Figure 4 S. aureus adhesion forces to different biomaterials. (a) Adhesion forces of S. aureus

ATCC12600 to SS, PMMA and PE. (b) Similar as in (a), for S. aureus ATCC12600Δpbp4. Each bar

represents an average of 135 adhesion force curves measured with 9 different bacterial probes taken

from three separately grown staphylococcal cultures. Error bars represent the standard errors of the

mean. * indicates significant differences (p < 0.05) in staphylococcal adhesion forces to different

biomaterials (two tailed, two-sample equal variance Student’s t-test).


97

Production of matrix components and gene expression in relation with

staphylococcal adhesion forces in 24 h old biofilms.

PNAG production normalized with respect to the amount of biofilm formed decreased with

increasing adhesion force towards the more hydrophobic PE surface in a significant manner

(p < 0.05) (Figure 5a). Normalized amounts of eDNA in 24 h S. aureus ATCC12600 biofilms

decreased as well with increasing adhesion force (p < 0.05) (Figure 5b). However for 24 h S.

aureus ATCC12600Δpbp4 biofilms, neither PNAG production nor eDNA presence relates in

a significant way with its adhesion forces to different biomaterials (Figure 5c and 5d).

Figure 5 S. aureus PNAG production and eDNA presence versus adhesion forces. (a)

Normalized PNAG production in 24 h S. aureus ATCC12600 biofilms as a function of the

adhesion force. (b) Normalized eDNA presence in 24 h S. aureus ATCC12600 biofilms as a

function of the adhesion force.(c) Similar as in (a) for S. aureus ATCC12600Δpbp4. (d)

Chapter 4

98

Similar as in (b) for S. aureus ATCC12600Δpbp4. Linear regression analysis was performed

in all graphs to analyse the correlation between PNAG production, eDNA presence and

adhesion force. The drawn line represents the best fit to a linear function, while r2 values

represent the correlation coefficients. The dotted lines enclose the 95% confidence intervals.

PNAG and eDNA were normalized to the amount of biofilm formed on each substratum and

each point represents an average ± standard error of the mean over three individual

experiments with separately grown staphylococcal cultures.

In Figure 6 we have plotted the staphylococcal adhesion forces on the different biomaterials

versus their icaA and cidA gene expression in 24 h old biofilms, as responsible for the

production of PNAG and eDNA respectively. In S. aureus ATCC12600, icaA gene expression

decreased as adhesion forces increased (Figure 6a) in line with PNAG production. cidA gene

expression did not follow a similar trend as that of icaA expression in 24 h old biofilms, but

was equally expressed on all the biomaterials irrespective of the adhesion forces experienced

over different biomaterials (Figure 6b). In S. aureus ATCC12600Δpbp4, lacking

peptidoglycan cross-linking, neither expression of icaA nor of cidA relates with its adhesion

force to the different biomaterials (Figs. 6c and 6d).


99

Figure 6 S. aureus icaA and cidA gene expressions versus adhesion forces in 24 h old biofilms. (a)

Normalized icaA expression in 24 h S. aureus ATCC12600 biofilms as a function of the adhesion force.

(b) Normalized cidA expressions in 24 h S. aureus ATCC12600 biofilms as a function of the adhesion

force.(c) Similar as in (a) for S. aureus ATCC12600Δpbp4. (d) Similar as in (b) for S. aureus

ATCC12600Δpbp4. Linear regression analysis was performed in all graphs to analyse the correlation

between gene expression and adhesion force. The drawn line represents the best fit to a linear function,

while r2 values represent the correlation coefficients. The dotted lines enclose the 95% confidence

intervals. IcaA and cidA expression were normalized to gyrB and presented as normalized fold

expression with respect to PE. Each point represents an average ± standard error of the mean over

three individual experiments with separately grown staphylococcal cultures.

Chapter 4

100

icaA gene expression in relation with staphylococcal adhesion forces in 1 and 3

h old biofilms of S. aureus ATCC12600

In order to assess the speed at which gene expression is regulated by the adhesion forces an

adhering bacterium experiences, icaA gene expression was also assessed in 1 h and 3 h old

biofilms of S. aureus ATCC12600 and plotted against adhesion forces (Figure 7). In 1 h old

biofilms, icaA gene expression did not show any relation with adhesion force (Figure 7a), but

in 3 h old biofilms (Figure 7b) a similar relation with adhesion force was observed as in 24 h

old biofilms (compare Figure 7b and Figure 6a).

Figure 7 icaA gene expression versus adhesion forces in 1 h and 3 h old biofilms of S. aureus

ATCC12600.(a) Normalized icaA expression in 1 h old S. aureus biofilms as a function of the adhesion

force. (b) Similar as in (a) in 3 h old S. aureus biofilms. Linear regression analysis was performed to

analyse the correlation between icaA gene expression and adhesion force. The drawn line represents

the best fit to a linear function, while r2 values represent the correlation coefficients. The dotted lines

enclose the 95% confidence intervals. IcaA expression was normalized to gyrB and presented as

normalized fold expression with respect to PE. Each point represents an average ± standard error of

the mean over three individual experiments with separately grown staphylococcal cultures.


101

DISCUSSION

In this study, we hypothesized that adhesion forces sensed by S. aureus upon adhesion to

different biomaterials regulate the expression of two important genes icaA and cidA, known

to contribute in the formation of their self-produced EPS matrix. Over the range of adhesion

forces between 1 and 5 nN, icaA gene expression decreased with increasing adhesion forces

in 3 h and 24 h old biofilms but not in 1 h old ones, while for cidA gene expression no

influence of adhesion forces was found. Moreover, production of the EPS matrix components

PNAG and eDNA decreased with increasing adhesion forces experienced by S. aureus

ATCC12600 on different biomaterials, making it unlikely that cidA expression solely

regulates eDNA release. The differences in eDNA presence in biofilms grown on SS, PMMA

and PE can be caused by autolysin atl gene. This gene produces two functional proteins

responsible for regulating growth, cell lysis and biofilm formation (24). The expression of the

alt gene occurs under several external stress conditions (25) including adhesion as a

potential trigger for DNA release. Since matrix components (PNAG and eDNA) provide an

important means through which bacteria can evade the host immune response and antibiotic

attack, we can speculate from the results in this study that pathogenicity of S. aureus

biofilms is regulated in part by the adhesion forces arising from the substratum to which

they adhere.

Bacterial behavior has been found to be extremely sensitive to minor differences in

adhesion forces. In S. aureus, invasive isolates exhibited higher mean adhesion forces to a

fibronectin-coated substratum by 0.28 nN than non-invasive control isolates (26). Moreover,

strains of Listeria monocytogenes with adhesion forces to the silicon nitride tip of an AFM

cantilever stronger than 0.38 nN were found more pathogenic than strains with smaller

adhesion forces (27), coinciding with our conclusion on the impact of adhesion forces on S.

aureus gene expression and associated pathogenicity. In the current study, we measured

adhesion forces between S. aureus and different biomaterial surfaces with bacterial probe

AFM. This method has been applied more often, but raises concerns as to whether contact is

established by a single organism or multiple ones. In the past (28), we have noticed that

multiple contacts seldom or never happen because bacteria attached to the cantilever are

unlikely to be equidistant to the substratum surface within the small distance range of

interaction forces. In addition, the bacterial probe is contacting the surface at an angle of 15

degrees which makes it less probable for multiple contacts. Multiple contact points however,

would become evident from double contour lines when a bacterial probe is used for imaging.

Chapter 4

102

Routine checks on probes have never yielded double contour lines and hence it is safe to

assume that our bacterial probes do not yield multiple contact points.

Biofilm formation starts with adhesion of so-called “linking film” bacteria, which

provide the groundwork for further biofilm growth. In essence, only these linking film

bacteria are capable of sensing a substratum surface, since all organisms later appearing in a

biofilm adhere to neighboring organisms. Yet we found that a similar relation between icaA

gene expression in 3 h old biofilms of S. aureus ATCC12600 (see Figure 7b) as in 24 h old

ones (compare Figure 7b and 6a), while in 1 h old biofilm this relation was still lacking (see

Figure 7a) as bacteria may not have adapted within 1 h to the substratum to which they

adhere. This shows that gene expression is a time-dependent process and stable expression

only occurs after 3 h and lasts minimally during 24 h of biofilm growth. This raises the

important question how organisms appearing later in a biofilm, either due to growth or

progressive co-adhesion, sense the adhesion forces arising from a substratum. Clearly, the

range of all attractive or repulsive forces arising from a substratum surface is limited to few

tens of nm, making it impossible for later organisms to directly sense a surface. Much more,

they will experience adhesion forces from neighboring organisms with which they co-adhere

(29). This implies that there must be a communication means available within a biofilm

through which substratum information is passed to bacteria in a biofilm that are not in

direct contact with the substratum.

Expression of icaA, but not of cidA genes decreased with increasing adhesion forces

experienced by adhering staphylococci. Adhesion forces arising from substratum surfaces

have recently been demonstrated to induce nanoscopic cell-wall deformation, yielding

membrane stresses (21). Deformation of lipid bilayers has been shown to result in opening of

mechanosensitive channels involved in adhesion force sensing, as they transduce a

mechanical force into chemical signals (30). Note that also for Pseudomonas aeruginosa,

surface-associated organisms have been found to produce more pili than their planktonic

counterparts, suggesting that a localized mechanical signal, i.e. cell-wall stress arising from

surface-association, plays a pivotal role in regulating genes associated with surface adhesion

(31). Cell-wall stress and resulting deformation are extremely difficult to measure due to the

rigidity of the peptidoglycan layer and therefore we employed an isogenic mutant S. aureus

ATCC12600Δpbp4-GFP lacking peptidoglycan cross-linking and confirmed the greater

deformability of the isogenic mutant (Figure 2) using surface enhanced fluorescence (32).

Surface enhanced fluorescence can only be measured on reflecting surfaces and was thus


103

only performed on SS. Importantly, due to the extreme sensitivity of surface enhanced

fluorescence measurements, also other wild-type strains have been shown to deform upon

adhesion to a surface (19). As important aspects of surface enhanced fluorescence, the

number of bacteria involved in a single analysis is much larger than can be obtained using

more microscopic methods, like AFM, while secondly it measures deformation under the

naturally occurring adhesion forces that is, not under an applied force as in AFM (21).

Therefore, it can be anticipated that differences in adhesion forces between S. aureus and

various substratum surfaces may actually induce different degrees of cell-wall deformation

which supports our hypothesis that adhesion forces cause nanoscale cell-wall deformations

and membrane stresses that act as a signaling mechanism for an organism to its adhering

state.

cidA expression did not relate with adhesion forces, possibly because cidA

membrane proteins program cell death based on the oxidation and reduction state of the cell

membrane (33) rather than its deformation suggesting that other environmental conditions

like pH, nutrient availability, biofilm age or antimicrobial stress influencing DNA release

(34). The peptidoglycan layer, ensuring rigidity to the bacterial cell-wall, appears of pivotal

importance in adhesion force sensing, as its deformation is directly transmitted to the

membrane. In the isogenic mutant S. aureus ATCC12600Δpbp4, lacking cross-linked

peptidoglycan and therewith possessing a softer cell-wall, adhesion force sensing appears to

be ineffective as no relation was found between adhesion forces and gene expression.

Deletion of pbp4 from S. aureus ATCC12600 neither had an effect on planktonic

growth, cell surface hydrophobicity or zeta potential, and had only a small effect on biofilm

formation (see Figure 3). However, it may be considered strange, that the amount of biofilm

of both strains formed on different materials bears no significant relation with the forces

experienced by these linking film organisms. This can be explained by the fact that that

bacteria will only adhere once they experience attractive forces that exceed the prevailing

detachment forces in a given environment. The current experiments were carried out under

static conditions rather than under flow, which implies a virtually zero detachment force

operating during adhesion and making any adhesion force large enough for a bacterium to

remain adhering. In this respect, it is not surprising that S. aureus ATCC12600Δpbp4 had a

similar ability to form biofilm than its parent strains as both its cell surface hydrophobicity

as well as its zeta potential are similar to the ones of the parent strain (see Figure 3).

Importantly for the development of biofilms in the presence of weak adhesion forces,

biofilms even form on highly hydrated, polymer-brush coatings, exerting very small

Chapter 4

104

adhesion forces in the sub-nN range that were found insufficient for adhering bacteria to

even realize they were in an adhering state (35).

Concluding, S. aureus reacts to its adhering state based on the magnitude of the

adhesion forces it experiences as arising from the substratum surface to which it adheres.

This response predominantly involves icaA gene expression and the production of EPS

matrix components (PNAG and eDNA) that both decrease with increasing adhesion forces.

Increasing adhesion forces bring an adhering organism closer to the “lethal” regime which

might be a reason as to why less EPS is produced by organisms experiencing stronger

adhesion forces. In addition, our data also suggest that mechanical properties of the cell-wall

as provided by the peptidoglycan layer surrounding the cell membrane, serve as an

important tool for the adhesion force sensing capacity in S. aureus.

ACKNOWLEDGEMENTS

The authors are grateful to Dr. Mariana G. Pinho, Laboratory of Bacterial Cell Biology, and

Dr. Sergio R. Filipe, Laboratory of Bacterial Cell Surfaces and Pathogenesis, Instituto de

Tecnologia Quimica e Biológica, Universidade Nova de Lisboa, for providing pMADΔpbp4

plasmid.


105

REFERENCES

1. The national institutes of health. 1999. The national institutes of health. SBIR/STTR Study Control Microb. biofilms.

2. Darouiche RO. 2004. Treatment of infections associated with surgical implants. N. Engl. J. Med. 350:1422–1429.

3. Monroe D. 2007. Looking for chinks in the armor of bacterial biofilms. PLoS Biol. 5:e307.


5. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state? PLoS Pathog. 8:e1002440.

6. Kügler R, Bouloussa O, Rondelez F. 2005. Evidence of a charge-density threshold for optimum efficiency of biocidal cationic surfaces. Microbiology. 151:1341–1348.

7. Tiller JC, Liao CJ, Lewis K, Klibanov AM. 2001. Designing surfaces that kill bacteria on contact. Proc. Natl. Acad. Sci. U. S. A. 98:5981–5985.

8. Engelsman AF, Van Dam GM, Van der Mei HC, Busscher HJ, Ploeg RJ. 2010. In vivo evaluation of bacterial infection involving morphologically different surgical meshes. Ann. Surg. 251:133–137.

9. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC. 2011. Ica-expression and gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant biomaterials. J. Biomed. Mater. Res. Part A. 96:365–371.

10. Li J, Busscher HJ, Swartjes J, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.

11. Lakowicz JR, Geddes CD, Gryczynski I, Malicka J, Gryczynski Z, Aslan K, Lukomska J, Matveeva E, Zhang J, Badugu R, Huang J. 2004. Advances in surface-enhanced fluorescence. J. Fluoresc. 14:425–441.

12. Fu Y, Lakowicz JR. 2006. Enhanced fluorescence of Cy5-labeled oligonucleotides near silver island films: A distance effect study using single molecule spectroscopy. J. Phys. Chem. B 110:22557–22562.

13. Cramton SE, Gerke C, Schnell NF, Nichols WW, Götz F. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67:5427–5433.

14. Begun J, Gaiani JM, Rohde H, Mack D, Calderwood SB, Ausubel FM, Sifri CD. 2007. Staphylococcal biofilm exopolysaccharide protects against Caenorhabditis elegans immune defenses. PLoS Pathog. 3:e57.

Chapter 4

106

15. Arciola CR, Baldassarri L, Montanaro L. 2001. Presence of icaA and icaD genes and slime production in a collection of Staphylococcal strains from catheter-associated infections. J. Clin. Microbiol. 39:2151–2156.

16. Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS, Bayles KW. 2007. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 104:8113–8118.

17. Dominiak DM, Nielsen JL, Nielsen PH. 2011. Extracellular DNA is abundant and important for microcolony strength in mixed microbial biofilms. Environ. Microbiol. 13:710–721.

18. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–6891.

19. Li J, Busscher HJ, Van der Mei HC, Sjollema J. 2012. Surface enhanced bacterial fluorescence and enumeration of bacterial adhesion. Biofouling. 29:11–19.

20. Lichtenberg D, Rosenberg M, Sharfman N, Ofek I. 1985. A kinetic approach to bacterial adherence to hydrocarbon. J. Microbiol. Methods. 4:141–146.

21. Chen Y, Harapanahalli AK, Busscher HJ, Norde W, Van der Mei HC. 2014. Nanoscale cell wall deformation impacts long-range bacterial adhesion forces on surfaces. Appl. Environ. Microbiol. 80:637–643.

22. Burnham NA, Chen X, Hodges CS, Matei GA, Thoreson EJ, Roberts CJ, Davies MC, Tendler SJB. 2002. Comparison of calibration methods for atomic-force microscopy cantilevers. Nanotechnology. 14:1–6.

23. Alsteens D, Beaussart A, El-Kirat-Chatel S, Sullan RMA, Dufrêne YF. 2013. Atomic force microscopy: a new look at pathogens. PLoS Pathog. 9:e1003516.

24. Singh VK. 2014. High level expression and purification of Atl, the major autolytic protein of Staphylococcus aureus. Int. J. Microbiol. 2014:615965.

25. Vollmer W, Joris B, Charlier P, Foster S. 2008. Bacterial peptidoglycan (murein) hydrolases. FEMS Microbiol. Rev. 32:259–86.

26. Yongsunthon R, Fowler jr VG, Lower BH, Vellano III FP, Alexander E, Reller LB, Corey GR, Lower SK. 2007. Correlation between fundamental binding forces and clinical prognosis of Staphylococcus aureus infections of medical implants. Langmuir. 23:2289–2292.

27. Park B-J, Haines T, Abu-Lail NI. 2009. A correlation between the virulence and the adhesion of Listeria monocytogenes to silicon nitride: An atomic force microscopy study. Colloids Surf B Biointerf. 73:237–243.

28. Younes JA, Van der Mei HC, Van den Heuvel E, Busscher HJ, Reid G. 2012. Adhesion forces and coaggregation between vaginal staphylococci and lactobacilli. PLoS One 7:e36917.


107

29. Mayer C, Moritz R, Kirschner C, Borchard W, Maibaum R, Wingender J, Flemming H-C. 1999. The role of intermolecular interactions: studies on model systems for bacterial biofilms. Int. J. Biol. Macromol. 26:3–16.

30. Kumamoto CA. 2008. Molecular mechanisms of mechanosensing and their roles in fungal contact sensing. Nat. Rev. Microbiol. 6:667–673.

31. Cowles KN, Gitai Z. 2010. Surface association and the MreB cytoskeleton regulate pilus production, localization and function in Pseudomonas aeruginosa. Mol. Microbiol. 76:1411–1426.

32. Hao Q, Qiu T, Chu PK. 2012. Surfaced-enhanced cellular fluorescence imaging. Prog. Surf. Sci. 87:23–45.

33. Ranjit DK, Endres JL, Bayles KW. 2011. Staphylococcus aureus CidA and LrgA proteins exhibit holin-like properties. J. Bacteriol. 193:2468–2476.

34. Kaplan JB, Izano EA, Gopal P, Karwacki MT, Kim S, Bose JL, Bayles KW, Horswill AR. 2012. Low levels of β-lactam antibiotics induce extracellular DNA release and biofilm formation in Staphylococcus aureus. mBio. 3:e00198–12.

35. Dong B, Jiang H, Manolache S, Wong ACL, Denes FS. 2007. Plasma-mediated grafting of poly(ethylene glycol) on polyamide and polyester surfaces and evaluation of antifouling ability of modified substrates. Langmuir. 23:7306–7313.

108

109

Chapter 5

Expression of the NsaRS Two-Component System in

Staphylococcus aureus under Mechanical and Chemical

Stresses

(Submitted to Environmental Microbiology Reports. Akshay K. Harapanahalli, Henk J.

Busscher and Henny C. van der Mei. Expression of the NsaRS Two-Component-System in

Staphylococcus aureus under Mechanical and Chemical Stresses)

Chapter 5

110

ABSTRACT

Nisin-associated-sensitivity-response-regulator (NsaRS) is important for surface adhesion,

biofilm formation and bacterial resistance against chemical stresses in S. aureus. It consists

of an intra-membrane located sensor NasS and a cytoplasmatically located response

regulator NsaR, which becomes activated upon receiving phosphate groups from the NsaS

sensor. The intra-membrane location of the NsaS sensor leads us to hypothesize that the

NsaRS system can sense not only chemical but also mechanical stresses to modulate

antibiotic resistance via the NsaAB efflux pump. To verify this hypothesis, we compared

expressions of the NsaS sensor and NsaA efflux pump in S. aureus SH1000 in their adhering

(“mechanical stress”) and planktonic state, while the presence of nisin constitutes a chemical

stress. NsaS and NsaA gene expressions by S. aureus SH1000 were higher in a mechanically

stressed, adhering state than in a planktonic one. Chemical stress enhanced NsaS and NsaR

gene expressions. Gene expression became largest, when the organisms experienced a

chemical stress in combination with a strong mechanical stress, in the current study

quantitated as the adhesion force arising from a substratum surface measured using

bacterial probe atomic force microscopy. This confirms our hypothesis that the NsaRS

system can sense both chemical and mechanical stresses.

Expression of NsaRS under Mechanical and Chemical Stress

111

INTRODUCTION

Staphylococcus aureus possesses an extensive infection capacity in a plethora of ecological

niches within the host, including the surfaces of biomaterial implants and devices. An

infection related to the presence of a biomaterial implant surface starts with the reversible

adhesion of bacteria to the implant surface, after which adhering bacteria embed themselves

in a matrix of extracellular polymeric substances (EPS) to yield a transition to irreversible

adhesion and biofilm growth commences. The EPS matrix protects biofilm inhabitants

against biological, mechanical and chemical stresses, such as the host immune response,

fluid shear and antibiotic treatment (1). Different biomaterials used in the clinical practice

have different tendencies to become colonized and cause infection (2). Moreover, antibiotic

resistance of biofilms seems to be related to the biomaterial used (3). This indicates that

adhering bacteria can sense the type of biomaterial they adhere to and regulate gene

expression for optimal adaptation and survival.

S. aureus interacts with its surroundings through a wide range of sensing systems to

regulate gene expression in response to environmental stresses. Bacteria, including

Staphylococcus aureus, can either use one- (4) or two-component systems (5,6) to process

environmental stimuli. Nisin associated sensitivity response regulator (NsaRS) is a recently

discovered two-component system in S. aureus, consisting of an intra-membrane bound

histidine kinase and a cytoplasmatically located response regulator NsaR, that becomes

activated upon receiving phosphate groups from the NsaS sensor. Intra-membrane bound

histidine kinase senses environmental changes and reprograms bacterial gene expression to

reduce stress (see Figure 1). Depending on the type of external stress, the response regulator

activates or represses the target gene expression (7). The NsaRS two-component system has

been shown to be important for surface adhesion, biofilm formation (8) and bacterial

resistance against chemical stresses, exerted by antimicrobial peptides including nisin (9),

bacitracin and cell wall perturbing antibiotics such as phosphomycin and ampicillin (8).

NsaRS mediates resistance by upregulating the NsaAB efflux pump (Figure1) which

detoxifies the cell to promote survival (8).

Chapter 5

112

Figure 1. Schematic presentation of the NsaRS two-component system and upregulation of

downstream transporter NsaAB. The NsaS intra-membrane histidine kinase (IM-HK) rearranges upon

sensing an external chemical stress and autophosphorylates to transfer phosphate to the NsaR

response regulator. The NsaR activates or represses target gene expression. Upon activation of the

target genes, NsaAB is activated to pump chemicals out of the cell.

Mechanical stresses exerted by adhesion forces between a substratum surface and

adhering staphylococci have been shown to impact ica expression and associated production

of the extracellular matrix component poly-N-acetylglycosamine (10), resulting in

differential sensitivities of adhering staphylococci against chemical stresses (3). Although

NsaRS activation is clearly associated with chemical stress (8, 9) the intra-membrane

location of the NsaS sensor suggests its possible activation by membrane deformation as a

result of mechanical stress (11), as seen in ica expression by adhering staphylococci (10). Few


113

other examples are known where mechanical stress, such as fluid shear forces (12, 13) or

adhesion to a surface lead to surface sensing and cause gene activation. In Escherichia coli

initial surface adhesion causes physical stress to the cell envelop and activates the Cpx

pathway for biofilm formation (6). Similarly, Vibrio parahaemoliticus uses the ScrABC

pathway (14) for surface sensing and biofilm formation. Considering the intra-membrane

location of the NsaS sensor and the involvement of the NsaRS two-component system in

both biofilm formation and antibiotic resistance, we here hypothesize that the NsaRS system

can sense both chemical and mechanical stresses and therewith plays an important role in

biomaterial induced modulation of antiobiotic resistance via the NsaAB efflux pump.

The aim of this study was to verify the above hypothesis by investigating differences

in expression of the NsaS sensor and NsaA efflux pump during early S. aureus biofilm

formation in presence and absence of nisin on two common biomaterials (stainless steel (SS)

and polyethylene (PE)) exerting different adhesion forces on S. aureus. Bacterial adhesion

forces on the two biomaterials will be measured using bacterial probe atomic force

microscopy as an indicator of mechanical stress, while the presence of nisin constitutes a

chemical stress. Experiments will be conducted with S. aureus SH1000 and S. aureus

SH1000∆NsaS, a mutant lacking the intra-membrane kinase sensor, NsaS.



The bacterial strains S. aureus SH1000 and S. aureus SH1000ΔNsaS, a mutant lacking the

kinase sensor, were used in this study and kindly provided by Dr. Lindey N. Shaw,

Department of Cell Biology, Microbiology and Molecular Biology, University of South

Florida, Tamps, FL. USA. The strains were cultured aerobically at 37°C on blood agar. One

colony was inoculated in 10 ml Tryptone Soya Broth (TSB, OXOID, Basingstoke, UK) and

grown for 24 h at 37°C. The pre-culture was used to inoculate the main culture, 10 ml TSB

(1:100) and cultured for 16 h. The main culture was diluted (1:5) and 3 ml was used to grow 3

and 6 h biofilms on coupons made of SS and PE at 37°C in presence and absence of 2 µg ml-1

nisin, a sub-minimal inhibitory concentration (MIC for S. aureus SH1000 is 4 µg ml-1; (9) in

a 6 wells plate. Biofilms were harvested by transferring the coupons with biofilms to a new 6

wells plate, washing the coupons twice with phosphate-buffered saline (PBS; 10 mM

potassium phosphate, 0.15 M NaCl, pH 7.0) and resuspended in 1 ml PBS by repeated

Chapter 5

114

pipetting. The suspended biofilm was centrifuged at 4000 x g for 10 min, the supernatant

was removed and the pellets were stored at -20 ºC until RNA isolation.

Materials and preparation

SS and PE were prepared to possess a comparable surface roughness in the micron-range. SS

was polished using 1200 grid SiC paper followed by MetaDi 3 μm diamond suspension

(Buehler, Lake bluff, IL, USA) on a polishing mat for 15 min, using a mechanical polisher

Phoenix Beta, fitted with VectorTM power head (Buehler, Dusseldorf, Germany). PE was used

as received from the manufacturer (Goodfellow Cambridge Ltd, Huntingdon, England).

Coupons were made to fit into a 6-wells plate with a total surface area of 7.5 cm2, sterilized

with ethanol (96%), washed with sterile PBS and stored in sterile demineralized water until

use.

Water contact angles measurements

Water contact angles were measured on SS and PE surfaces at 25°C using the sessile drop

technique with a home-made contour monitor.

Adhesion force measurements

In order to measure adhesion forces between the S. aureus strains and SS and PE surfaces,

staphylococci were immobilized on a tipless cantilever for the atomic force microscope

(AFM), as described before (15) Adhesion force measurements were performed at room

temperature in PBS using a Dimension 3100 system (Nanoscope V, Digital Instruments,

Woodbury, NY, USA). For each bacterial probe, force-distance curves were measured

without surface delay at a 2 nN trigger threshold. Bacterial probes were prepared out of three

different cultures. For each bacterial probe, ten force measurements were recorded and three

different probes were used on three random locations on each material surface. The spring

constant of each cantilever was determined using the thermal method (16). The integrity of a

bacterial probe was monitored before and after the onset of each ten adhesion force

measurements by comparing adhesion forces measured on a clean glass surface. Whenever

this adhesion force had a difference > 0.5 nN, data obtained last with that probe were

discarded and a new bacterial probe was made.


115

NsaS and NsaA gene expression

Total RNA from 3 and 6 h biofilms grown on SS and PE surfaces, was isolated using

RiboPureTM-Bacteria Kit (Ambion, Invitrogen) according to the manufacturer’s instructions.

Traces of genomic DNA were removed using DNAfreeTM kit (Ambion, Applied biosystems,

Foster City, CA) and absence of genomic DNA contamination was verified by real-time PCR

prior to cDNA synthesis. 200 ng of RNA was used for cDNA synthesis, 4 μl 5x iScript

Reaction Mix, 1 μl iScript Reverse Transcriptase, in a total volume of 20 μl (Iscript, Biorad,

Hercules, CA) according to manufacturer’s instructions. Real time RT-qPCR was performed

in triplicates in a 384-well plate HSP-3905 (Bio-RAD, Laboratories, Foster city, CA, USA)

with the primer sets for 16s, NsaS and NsaA (Table 1). The following thermal conditions

were used for all qPCR reactions: 95°C for 15 min and 40 cycles of 95°C for 15 s and 59°C for

20 s. The mRNA levels were quantified in relation to endogenous control gene 16s. NsaS and

NsaA expression levels in the biofilms were normalized to S. aureus SH1000 planktonic

culture.

TABLE 1 Primer sequences for qRT-PCR used in this study

Primer Sequence (5’- 3’) NsaS-forward GCAACATGGCATGCACCTC NsaS-reverse AGGTTATAATGGCCAGCGCC NsaA-forward TGCATGCCATGTTGCT NsaA-reverse TTCACCAGCTTCAACT 16s -forward TACGGGAGGCAGCAG 16s-reverse ATTACCGCGGCTGCTGG

Chapter 5

116

RESULTS AND DISCUSSION

Staphylococcal adhesion forces to SS and PE biomaterial surfaces

Figure 2. Adhesion forces of S. aureus strains on SS and PE measured by bacterial probe AFM. Each

bar represents an average of 90 adhesion force curves measured with 9 different bacterial probes taken

from three separately grown staphylococcal cultures. Error bars represent the standard errors of the

mean. *indicates significant differences (p < 0.05) in staphylococcal adhesion forces (two tailed, two-

sample equal variance Student’s t-test).

Adhesion forces were measured using bacterial probe atomic force microscopy (17) for the

wild-type S. aureus SH1000 and the ΔNsaS mutant strain. The wild-type strain SH1000 and

the ΔNsaS mutant showed similar adhesion forces on SS surfaces, but on PE surfaces

adhesion forces for the wild-type strain were significantly stronger than for the mutant strain

(Figure 2). Whereas the wild-type strain adhered more strongly to PE than to SS surfaces,

the mutant strain adhered strongest to SS surfaces. Such differences in adhesion forces can

arise from several environmental factors, including the physico-chemical properties of the SS


117

and PE surfaces or the bacterial surface properties. Bacteria experience in general stronger

adhesion forces on hydrophobic surfaces than on hydrophilic surfaces. (18) Thewes et al.

(2014) have shown that Staphylococcus carnosus adheres two times more strongly to

hydrophobic silicon wafers than to hydrophilic ones, suggesting that short-range, non-

specific hydrophobic interactions present between bacterial cell wall proteins and

substratum surfaces enhance the adhesion forces. Our results show a similar trend with

stronger adhesion forces of staphylococci to hydrophobic PE (water contact angle 85 ± 2

degrees) compared to hydrophilic SS (water contact angle 35 ± 3 degrees) for the wild-type

staphylococcal strain, but not for the mutant strain. This suggests a potential change in cell

surface hydrophobicity or charge upon deletion of the NsaS sensor from its membrane

position in the ΔNsaS mutant strain.

NsaS and NsaA gene expression under mechanical stress

NsaS and NsaA gene expressions of wild-type S. aureus SH1000 and the ΔNsaS mutant

strain upon mechanical stress, i.e. adhesion to SS and PE surfaces, were measured by

isolating total RNA from 3 h and 6 h biofilms grown on SS and PE surfaces, using

RiboPureTM-Bacteria Kit. In the wild-type strain, NsaS and NsaA expressions were always

trended higher for staphylococci in their adhering state than in their planktonic state

(compare Figs. 3a and 3b and Figs. 3c and 3d). However, no such consistent pattern in NsaS

and NsaA expressions were observed in the ΔNsaS mutant strain, probably due to the loss of

the intra-membrane NsaS sensor, implying the inability of the strain to perceive its adhering

state. Previously, it has been suggested that loss of intra-membrane NsaS impedes surface

sensing capacity of S. aureus, but not necessarily affects the expression of the downstream

drug transporter NsaA (8).

Surface sensing under mechanical stress occurs through deformation of the bacterial

cell wall and adhesion forces in the order of magnitude of 0.5 - 1 nN have been shown, using

surface fluorescence enhancement, to yield substantial cell wall deformation in staphylococci

(10). Whereas in S. aureus ATCC12600, expression of icaA and poly-N-acetylglucosamine

upon adhesion to different biomaterial surfaces decreased with increasing adhesion forces

(10), expressions of NsaS and NsaA genes do not necessarily increase with increasing

adhesion forces over the range of force values observed here, but mainly seem to respond to

the absence (planktonic state) or presence of adhesion forces (biofilm mode of growth).

Chapter 5

118

Figure 3. NsaS and NsaA expression in S. aureus in a planktonic state and under mechanical stress in

an early biofilm mode of growth. (a) Normalized NsaS gene expression in a planktonic state and after 3

h biofilm formation to SS and PE of the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS.(b)

Normalized NsaA gene expression in a planktonic state and after 3 h biofilm formation to SS and PE of

the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS (c) Normalized NsaS gene expression

in a planktonic state and after 6 h biofilm formation to SS and PE of the wild-type S. aureus SH1000

and the mutant SH1000ΔNsaS (d) Normalized NsaA gene expression in a planktonic state and after 6

h biofilm formation to SS and PE of the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS

The mRNA levels were quantified in relation to the endogenous control gene 16s with respect to wild-

type SH1000 cells in planktonic cultures. Each point represents an average ± standard error of the

mean over three individual experiments with separately grown staphylococcal cultures.


119

NsaS and NsaA gene expression under chemical and mechanical Stresses

Figure 4. NsaS and NsaA expression in S. aureus SH1000 in a planktonic state and under mechanical

and chemical stresses in an early biofilm mode of growth. (a) Normalized NsaS gene expression in a

planktonic state and in early, 3 h biofilms on SS and PE in the presence of nisin (2 µg/ml). (b)

Normalized NsaA gene expression in a planktonic state and in early, 3 h biofilms in the presence of

Chapter 5

120

nisin (2 µg/ml).The mRNA levels were quantified in relation to endogenous control gene 16s with

respect to wild-type SH1000 in planktonic cultures. Each point represents an average ± standard error

of the mean over three individual experiments with separately grown staphylococcal cultures.

In order to study the combination of a chemical and mechanical stress, NsaS and NsaA gene

expression in the presence of nisin was measured for planktonic S. aureus SH1000 and

staphylococci in a biofilm mode of growth. No experiments were done with the ΔNsaS

mutant strain because the mutant strain was killed upon exposure to nisin at the

concentration of 2 µg/ml applied, likely because 2 µg/ml is above the minimal inhibitory

concentration of S. aureus ΔNsaS (8). In planktonic S. aureus SH1000, expressions of both

NsaS (Figure 4a) and NsaA (Figure 4b) were significantly higher in presence of nisin than in

its absence. NsaS and NsaA gene expressions in presence of nisin were highest on PE, likely

due to the fact that PE exerted the strongest adhesion forces (6.2 ± 0.2 nN) on adhering S.

aureus SH1000. Gene expression in presence of nisin for staphylococci adhering to SS was

similar as in a planktonic state, but significantly different from that of SS because adhesion

forces on SS (3.5 ± 0.2 nN) are significantly weaker than on more hydrophobic PE.

In general, it can be concluded that NsaS and NsaA gene expressions by S. aureus

SH1000 are higher when the organism is mechanically stressed in an adhering state than

when in a planktonic one (see Figure 5), which we attribute to cell wall deformation under

the influence of the adhesion forces arising from a substratum surface. Furthermore,

chemical stress enhances NsaS and NsaA gene expression (see also Figure 5), and gene

expression clearly becomes largest, when the organisms experiences a strong mechanical

stress in combination with a chemical one. This confirms our hypothesis that the NsaRS

system can sense both chemical and mechanical stresses and therewith plays an important

role in biomaterial induced modulation of antiobiotic resistance via the NsaAB efflux pump.


121

Figure 5. Expression of NsaA versus NsaS in wild-type S. aureus SH1000 in a planktonic state and

after 3 h biofilm formation in the presence and absence of nisin. The solid lines represent the best fit to

a linear function (correlation coefficient r2 equals 0.683), while the dotted lines enclose the 95%

confidence interval.

Chapter 5

122

ACKNOWLEDGEMENTS

The authors are grateful to Dr. Lindsey N. Shaw, Department of Cell Biology, Microbiology

and Molecular Biology, University of South Florida, Tampa, FL, USA, for providing S. aureus

SH1000 and S. aureus SH1000ΔNsaS strains.


123

REFERENCES


2. An YH, Friedman RJ. 1998. Concise review of mechanisms of bacterial adhesion to biomaterial surfaces. J. Biomed. Mater. Res. 43:338–348.


4. Ulrich LE, Koonin E V., Zhulin IB. 2005. One-component systems dominate signal transduction in prokaryotes. Trends Microbiol. 13:52–56.

5. Kawada-Matsuo M, Yoshida Y, Nakamura N, Komatsuzawa H. 2011. Role of two-component systems in the resistance of Staphylococcus aureus to antibacterial agents. Virulence 2:427–430.

6. Otto K, Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 99:2287–92.

7. Lejeune P. 2003. Contamination of abiotic surfaces: what a colonizing bacterium sees and how to blur it. Trends Microbiol. 11:179–184.

8. Kolar SL, Nagarajan V, Oszmiana A, Rivera FE, Miller HK, Davenport JE, Riordan JT, Potempa J, Barber DS, Koziel J, Elasri MO, Shaw LN. 2011. NsaRS is a cell-envelope-stress-sensing two-component system of Staphylococcus aureus. Microbiology 157:2206–2219.

9. Blake KL, Randall CP, O’Neill AJ. 2011. In vitro studies indicate a high resistance potential for the lantibiotic nisin in Staphylococcus aureus and define a genetic basis for nisin resistance. Antimicrob. Agents Chemother. 55:2362–2368.

10. Harapanahalli AK, Chen Y, Li J, Busscher HJ, Van der Mei HC. 2015. Influence of Adhesion Force on icaA and cidA Gene Expression and Production of Matrix Components in Staphylococcus aureus Biofilms. Appl. Environ. Microbiol. 81:3369–3378.

11. Harapanahalli AK, Younes JA, Allan E, Van der Mei HC, Busscher HJ. 2015. Chemical Signals and Mechanosensing in Bacterial Responses to Their Environment. PLoS Pathog. 11:e1005057.

12. Stoodley P, Jacobsen A, Dunsmore BC, Purevdorj B, Wilson S, Lappin-Scott HM, Costerton JW. 2001. The influence of fluid shear and AICI3 on the material properties of Pseudomonas aeruginosa PAO1 and Desulfovibrio sp. EX265 biofilms. Water Sci. Technol. 43:113–120.

13. Stoodley P, Cargo R, Rupp CJ, Wilson S, Klapper I. 2002. Biofilm material properties as related to shear-induced deformation and detachment phenomena. J. Ind. Microbiol. Biotechnol. 29:361–367.

Chapter 5

124

14. Ferreira RBR, Antunes LCM, Greenberg EP, McCarter LL. 2008. Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression relevant to growth on surfaces. J. Bacteriol. 190:851–860.

15. Beaussart A, El-Kirat-Chatel S. 2014. Quantifying the forces guiding microbial cell adhesion using single-cell force spectroscopy. Nat. Protoc. 9:1049–55.

16. Burnham NA, Chen X, Hodges CS, Matei GA, Thoreson EJ, Roberts CJ, Davies MC, Tendler SJB. 2002. Comparison of calibration methods for atomic-force microscopy cantilevers. Nanotechnology. 14:1–6.

17. Liu Y, Strauss J, Camesano T a. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.

18. Thewes N, Loskill P, Jung P, Peisker H, Bischoff M, Herrmann M, Jacobs K. 2014. Hydrophobic interaction governs unspecific adhesion of staphylococci: a single cell force spectroscopy study. Beilstein J. Nanotechnol. 5:1501–1512.

125

126

127

Chapter 6

General Discussion

General discussion

128

Bacterial communication with their environment takes place in two different systems: 1)

Quorum Sensing (QS) and 2) mechanosensing (1, 2). The mechanism of QS is described in

literature (1) for many bacteria, including Staphylococcus aureus. However, very little is

known about the mechanism of mechanosensing which contributes to sensing of the

environment when it is in contact with surfaces. Therefore, in this thesis we have studied the

adhesion of S. aureus to biomaterials in terms of 1) Physical characteristics to the bacterial

cell wall that contribute to surface sensing and 2) Gene specific responses of bacteria

adhering to different biomaterials. To study physical characteristics (adhesion forces and cell

wall deformation), we have used advanced state of the art techniques, like Atomic Force

Microscopy (AFM) and Surface Enhanced Fluorescence (SEF). Molecular changes at the

gene level due to external stress were studied using quantitative real time polymerase chain

reactions.

Cell wall deformation determined by atomic force microscopy and surface

enhanced fluorescence

In the field of microbiology, AFM is widely used to measure nanomechanical properties of

the living cell. Properties such as visco-elasticity, single protein functionality, cell wall

deformation and adhesion forces can be measured to understand nano-scale organization,

dynamics of cell membranes and cell walls (1-3). Adhesion forces and cell wall deformations

between the cell and the substratum can be quantified in the range of piconewtons (~ 10-12

N) and nanometers, respectively (3). In chapter 2 we have directly determined the cell wall

deformation by measuring the polar radii (height images) of two S. aureus strains and their

isogenic Δpbp4 mutants (strains with a softer cell wall) to demonstrate that, Δpbp4 mutants

are 40% more deformable than their parent strains. In chapter 4 we have measured adhesion

forces of the same wild-type and mutant strains on three different biomaterials (stainless

steel, poly-methyl methacrylate and polyethylene) and have shown that, adhesion forces are

substratum specific and stronger for the wild-type S. aureus than the Δpbp mutant strains.

Although, the wild-type S. aureus strains have more rigid and less deformable cell walls, we

can anticipate that differences in adhesion forces between the wild-type cells and the

biomaterials can induce, adhesion force dependent substratum specific deformation.

Adhesion forces and cell-wall deformations measured using AFM give considerable

understanding about cell–substratum interactions, but there are a few critical drawbacks

General Discussion

129

using AFM. Firstly, AFM requires an external load, which is required to image the cell

surface, which is used to calculate the cell wall deformation and its rigidity. Secondly,

bacteria are immobilized (using α-poly-L-lysine or dopamine) to the AFM cantilever or the

surface through chemical treatment (4). Application of an external load and chemical

treatment can potentially introduce artifacts during studying bacterial adhesion forces when

compared to the bacterial adhesion force to surfaces under natural conditions as in a flow

chamber. For instance, cell wall deformations obtained using AFM imaging for S. aureus

Δpbp4 mutants attached to α-poly-L-lysine coated surface, showed deformations between 49

– 82 nm (chapter 2) that were more or less similar than deformations measured by SEF (20

– 25 nm) (chapter 3). With SEF deformation of bacterial cell walls can be determined under

natural conditions and at a macroscopic level (3 x 108 cells cm-3), while the AFM can only be

applied to a single bacterial cell and requires many experiments in order to get similar

statistics as SEF. Therefore, application of new methods like SEF are a more appropriate and

accurate method to evaluate cell–substratum interactions than AFM.

SEF as applied in this thesis is a very reliable and powerful method to measure the

cell wall deformation. However, SEF also has a few drawbacks. Firstly, SEF (also known as

metal enhanced fluorescence) can only be applied on metal surfaces due to the nature of the

method. Secondly, we assumed that distribution of the fluorophores in the bacterial cell is

homogeneous. To validate this assumption, other microscopical methods, like the super-

resolution microscopy can be applied (5). With this method single molecule localization

within a spatial resolution of 1 nm can be determined. Therefore, in order to determine cell-

wall deformation SEF is the preferred technique but has the limitation that it can only be

used on metal surfaces, therefore the AFM method is a good alternative. Moreover, the best

way to overcome these limitations would be to apply both methods wherever possible to

compliment the findings of one another.

General discussion

130

Gene specific responses to biomaterials and mechanosensing in bacteria

Sensing environmental stresses is an important part of bacterial survival. For

mechanosensing, some bacteria have developed extracellular appendages like flagella, pili or

curli to respond to adhesion or physical stress (6). Interestingly, S. aureus does not possess

any extracellular appendages, yet it can respond to physical contact, suggesting that a

generalized surface sensing approach must exist for all microorganisms and cells to respond

to localized surface stresses upon adhesion. Eukaryotic cells have several points of contact

between the cell and the surface, these points of contact are called focal adhesion points,

which connect the extracellular membrane to the transmembrane linkers through an actin-

myosin networks (7). In Pseudomonas aeruginosa, transmembrane links are established

through MreB cytoskeleton, which has a similar function as the actin-myosin network and

also regulate the type IV pili of P. aeruginosa to sense adhesion forces to surfaces and

transmit regulatory signals for biofilm formation (8). The surface sensing of S. aureus

possibly takes places through adhesion force induced cell wall deformation. In chapter 4, we

show that cell wall deformation of S. aureus strains is due to adhesion forces caused by

different biomaterials. Although, this is not a direct quantification of the cell wall

deformation, we determined molecular changes that took place upon adhesion to three

different biomaterials, stainless steel, poly-methyl-methacrylate and polyethylene. Matrix

associated poly-N-acetylglucosamine and its corresponding icaA gene expression showed a

remarkable correlation with adhesion forces measured on the three surfaces, confirming the

effects of adhesion force induced cell wall deformation. Studies also show that icaA

expression in Staphylococcus epidermidis is substratum specific in presence of gentamicin

(9).

Bacterial cell wall deformation in its natural surface adhesive state can be quantified

using SEF. The molecular effects of nanoscale cell wall deformations can be linked to

adhesion forces arising from the substratum surfaces. Furthermore, investigating molecular

links between mechanosensitive channels and cell surface proteins can reveal more insights

into mechano-transduction, bacterial sensing of substratum surfaces and adaptability.

General Discussion

131

Future perspectives

Bacteria can sense and interact with the substratum and gain resistance. In this thesis, we

have shown that membrane proteins can detect and respond to adhesion forces experienced

by the cell wall to up-regulate antibacterial resistance. Mechanisms such as two-component

systems serve as key models in understanding surface sensing and regulation of antibacterial

resistance. However bacteria regulate antibacterial resistance through more than one

mechanism, and at an alarming rate. Infection causing strains detected in 2013 were

resistant to four classes of antibiotics, which were still effective treatments in 2009 (10).

Therefore, identifying alternative targets and mechanisms are very important in order to

keep pace with growing antibacterial resistance. Mechanosensitive channels are ideal

candidates for surface sensing and perhaps in regulating antibacterial resistance upon

surface adhesion via opening and closing of the channels. Therefore, it would be worthwhile

to investigate the impact of adhesion forces on channel opening and regulation of

antibacterial susceptibility in the wild-type strains and compare it with mutants lacking

mechanosensitive channels in biomaterial associated infections.

General discussion

132

REFERENCES

1. Miller MB, Bassler BL. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165–169.

2. Dorel C. 2010. Manipulating bacterial cell fate: key role of surface-sensing and signal transduction. Appl. Microbiol. Microb. Biotechnol. 791–800.

3. Heinisch JJ, Lipke PN, Beaussart A, Chatel SEK, Dupres V, Alsteens D, Dufrene YF. 2012. Atomic force microscopy - looking at mechanosensors on the cell surface. J. Cell Sci. 125:4189–4195.

4. Li J, Busscher HJ, Swartjes JJTM, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.

5. Betzig E, Patterson GH, Sougrat R, Lindwasser OW, Olenych S, Bonifacino JS, Davidson MW, Lippincott-Schwartz J, Hess HF. 2006. Imaging intracellular fluorescent proteins at nanometer resolution. Science 313:1642–1645.

6. Jarrell KF, McBride MJ. 2008. The surprisingly diverse ways that prokaryotes move. Nat. Rev. Microbiol. 6:466–476.

7. Kumamoto CA. 2008. Molecular mechanisms of mechanosensing and their roles in fungal contact sensing. Nat. Rev. Microbiol. 6:667–673.

8. Cowles KN, Gitai Z. 2010. Surface association and the MreB cytoskeleton regulate pilus production, localization and function in Pseudomonas aeruginosa. Mol. Microbiol. 76:1411–1426.


10. Centers for disease control and prevention. (2013) http://www.cdc.gov/narms/pdf/2013-annual-report-narms-508c.pdf

Summary

133

Summary

Summary

134

Staphylococcus aureus is one of the major causative bacteria of implant associated

infections. Biomaterial associated infections start with the reversible adhesion of bacteria to

the implant surface, after which adhering bacteria embed themselves in a matrix of

extracellular polymeric substances (EPS) to yield a transition to irreversible adhesion and

biofilm growth commences. The EPS matrix protects biofilm inhabitants against biological,

mechanical and chemical stresses, such as the host immune response, fluid shear and

antibiotic treatment. All these phenomenal changes in S. aureus physiology occurs due to

adhesion and biofilm formation, therefore a sense of touch or mechanical sensitivity towards

surface adhesion is an important characteristic for adaptation and survival. However, very

less is understood about mechanical sensitivity of S. aureus during adhesion to a surface.

Chapter 1. gives an overview of the differences between two major sensory

strategies used by bacteria to sense the external environment, the chemical and

mechanosensing. Bacteria encounter different environmental conditions during the course

of their growth and have developed various mechanisms to sense their environment and

facilitate survival. Bacteria communicate with their environment through sensing of

chemical signals such as pH, ionic strength or sensing of biological molecules, such as

utilized in quorum sensing. However, bacteria do not solely respond to their environment by

means of chemical sensing, but also respond through physical-sensing mechanisms. For

instance, upon adhesion to a surface, bacteria may respond by excretion of EPS through a

mechanism called mechanosensing, allowing them to grow in their preferred, matrix

protected biofilm mode of growth. Therefore, the aim of this thesis was to evaluate the role of

adhesion forces in the response of bacteria to their adhering state. We have used a model

pathogen S. aureus, common in biomaterial associated infections and several of its isogenic

mutants and applied atomic force microscopy (AFM) and surface enhanced fluorescence

(SEF) to quantify adhesion forces and cell wall deformation, respectively. Bacterial response

was evaluated in terms of gene expression on different biomaterials commonly used in

orthopedic implants.

Bacterial adhesion to surfaces is mediated by a combination of different short- and

long-range forces. In Chapter 2, we present a new AFM based method to derive long-range

bacterial adhesion forces from the dependence of bacterial adhesion forces on the loading

force, as applied during the use of AFM. We have used two S. aureus strains, (S. aureus

ATCC12600 and S. aureus NCTC 8325-4) and their isogenic Δpbp4 mutants. The long-range

Summary

135

adhesion forces of wild-type S. aureus parent strains (0.5 and 0.8 nN) amounted to only one

third of these forces measured for their more deformable isogenic Δpbp4 mutants (2.7 and

1.6 nN) that were deficient in peptidoglycan cross-linking. The measured long-range

Lifshitz-Van der Waals adhesion forces matched those calculated from published Hamaker

constants, provided that a 40% ellipsoidal deformation of the bacterial cell wall was assumed

for the Δpbp4 mutants. Direct imaging of adhering staphylococci using the AFM peak force-

quantitative nanomechanical property mapping imaging mode confirmed a height reduction

due to deformation in the Δpbp4 mutants of 100 – 200 nm. Across naturally occurring

bacterial strains, long-range forces do not vary to the extent as observed here for the Δpbp4

mutants. Importantly however, extrapolating from the results of this study it can be

concluded that long-range bacterial adhesion forces are not only determined by the

composition and structure of the bacterial cell surface, but also by a hitherto neglected, small

deformation of the bacterial cell wall, facilitating an increase in contact area and therewith in

adhesion force.

Nanoscale cell wall deformation upon adhesion is difficult to measure, except

for Δpbp4 mutants, deficient in peptidoglycan cross-linking. Chapter 3 discusses a

more advanced technique to quantify cell wall deformation based on surface

enhanced fluorescence in staphylococci adhering on gold surfaces. Adhesion related

fluorescence enhancement depends on the distance of the bacteria from the surface

and the residence-time of the adhering bacteria. In this chapter, a model was

forwarded based on the adhesion related fluorescence enhancement of green-

fluorescent microspheres, through which the distance to the surface and cell wall

deformation of adhering bacteria can be calculated from their residence-time

dependent adhesion related fluorescence enhancement. The distances between

adhering bacteria and a surface, including compression of their EPS-layer, decreased

up to 60 min after adhesion, followed by cell wall deformation. Cell wall deformation

is independent on the integrity of the EPS-layer and proceeds fastest for a Δpbp4

strain.

Based on the results from chapter 2 and 3, it can be concluded that cell wall

deformation of both the parent and the Δpbp4 mutant strains occurred upon surface

adhesion. However, what these deformations mean to bacteria in terms of molecular

response in modulating their phenotypes from free floating to surface growing biofilms is

Summary

136

unknown. In Chapter 4, we have investigated the influence of staphylococcal adhesion

forces to different biomaterials on icaA (regulating production of EPS matrix components)

and cidA (associated with cell lysis and extracellular DNA release) gene expression in S.

aureus biofilms. Experiments were performed with S. aureus ATCC12600 and its isogenic

mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan cross-linking. Deletion of

pbp4 was associated with greater cell-wall deformability, while it did not affect the

planktonic growth rate, biofilm formation, cell surface hydrophobicity or zeta potential of the

strains. The adhesion forces of S. aureus ATCC12600 were strongest on polyethylene (4.9 ±

0.5 nN), intermediate on polymethylmethacrylate (3.1 ± 0.7 nN) and the weakest on

stainless steel (1.3 ± 0.2 nN). The production of poly-N-acetylglucosamine, eDNA presence

and expression of icaA genes decreased with increasing adhesion forces. However, no

relation between adhesion forces and cidA expression was observed. The adhesion forces of

the isogenic mutant S. aureus ATCC12600Δpbp4 were much weaker than those of the parent

strain and did not show any correlation with the production of poly-N-acetylglucosamine,

eDNA presence, or expression of the icaA and cidA genes. This suggests that adhesion forces

modulate the production of matrix molecules poly-N-acetylglucosamine, eDNA presence and

icaA gene expression by inducing nanoscale cell wall deformation, with cross-linked

peptidoglycan layers playing a pivotal role in this adhesion force sensing.

Bacterial adhesion to biomaterial surfaces and associated susceptibility to

antimicrobials is an important threat faced by the medical community. Bacteria not only

form biofilms, but may also gain up to 1000 times more resistance to antibiotics when in a

biofilm than in a planktonic mode of growth. To reveal mechanisms that induce such strong

resistance, in Chapter 5, we investigated the regulation of one of the newly discovered two-

component system nisin-associated-sensitivity-response-regulator (NsaRS) and its

downstream drug transporter NsaAB in S. aureus cells, in presence of chemical stress and

mechanical stress. NsaRS is important for surface adhesion, biofilm formation and bacterial

resistance against chemical stresses in S. aureus. It consists of an intra-membrane located

sensor NasS and a cytoplasmatically located response regulator NsaR, which becomes

activated upon receiving phosphate groups from the NsaS sensor. The intra-membrane

location of the NsaS sensor leads us to hypothesize that the NsaRS system can sense not only

chemical but also mechanical stresses to modulate antibiotic resistance via the NsaAB efflux

pump. To verify this hypothesis, we compared expressions of the NsaS sensor and NsaA

efflux pump in S. aureus SH1000 in their adhering (“mechanical stress”) and planktonic

Summary

137

state, while the presence of nisin constitutes a chemical stress. NsaS and NsaA gene

expressions by S. aureus SH1000 were higher in a mechanically stressed, adhering state

than in a planktonic one. Chemical stress enhanced NsaS and NsaR gene expressions. Gene

expression became largest, when the organisms experienced a chemical stress in

combination with a strong mechanical stress, in the current study quantitated as the

adhesion force arising from a substratum surface measured using bacterial probe AFM. This

confirms our hypothesis that the NsaRS system can sense both chemical and mechanical

stresses.

In Chapter 6 we have discussed the differences in using AFM and SEM in

quantifying cell wall deformation. Furthermore, we discuss the molecular basis for surface

sensing in S. aureus in comparison with other bacteria and eukaryotic cells. Finally, from the

results obtained in this thesis, we suggested future studies on the role of mechanosensitive

channels in antimicrobial susceptibility.

138

139

Nederlandse Samenvatting


140

Staphylococcus aureus is één van de belangrijkste bacteriën verantwoordelijk voor

implantaat gerelateerde infecties. Biomateriaal gerelateerde infecties beginnen met

reversibele hechting van bacteriën aan een implantaat, waarna de gehechte bacteriën

beginnen met de productie van een matrix van extracellulaire polymere substanties (EPS)

om over te gaan tot irreversibele hechting, gevolgd door biofilm groei. De EPS matrix

beschermd de bacteriën in een biofilm tegen biologische, mechanische en chemische stress,

zoals de immuun respons, vloeistof gerelateerde schuifkrachten en behandeling met

antibiotica. Al deze grootse veranderingen in S. aureus fysiologie vinden plaats vanwege

hechting en biofilm formatie, vandaar dat mechanische waarneming van oppervlakte

hechting een belangrijke eigenschap is voor aanpassing en overleving. Echter, er is slechts

weinig bekend over de mechanische sensitiviteit van S. aureus gedurende hechting aan

oppervlakken.

Hoofdstuk 1 geeft een overzicht van de verschillen tussen twee belangrijke

sensorische strategieën die bacteriën gebruiken om de omgeving waar te nemen, chemische

en mechanisch sensorische perceptie. Bacteriën worden aan verschillende

omgevingscondities blootgesteld tijdens hun groei en hebben verschillende mechanismes

ontwikkeld om hun omgeving waar te nemen en overleving te vergemakkelijken. Bacteriën

communiceren met hun omgeving door het waarnemen van chemische signalen zoals pH,

ionische sterkte of het waarnemen van biologische moleculen, zoals door quorum sensing.

Bacteriën reageren echter niet alleen op hun omgeving door chemische waarnemingen, maar

ook door fysieke waarnemingsmechanismen. Bij hechting aan een oppervlak bijvoorbeeld,

kunnen bacteriën reageren door de excretie van EPS door een mechanisme dat

mechanosensing wordt genoemd. Dit stelt ze in staat om te groeien in de door hun

geprefereerde matrix beschermde biofilm.

Vandaar dat het doel van dit proefschrift was om de rol van hechtingskrachten in de

respons van bacteriën op hechting te onderzoeken. We hebben S. aureus gebruikt als model

pathogeen dat veelvuldig voorkomt bij biomateriaal gerelateerde infecties en vervolgens deze

stam en een aantal isogene mutanten onderzocht met behulp van atomische kracht

microscopie (AFM) en oppervlakte versterkte fluorescentie (SEF), om de hechtingskrachten

en celwand vervorming te bepalen. De bacteriële respons werd geëvalueerd in termen van

gen expressie en getest op verschillende biomaterialen die veelvuldig gebruikt worden in

orthopedische implantaten.


141

Bacteriële hechting op oppervlakken wordt beheerst door een combinatie van

verschillende korte- en langeafstandskrachten. In Hoofdstuk 2 presenteren we een nieuwe

methode gebaseerd op AFM om de bacteriële hechtingskrachten die over lange afstand

werken te bepalen, aan de hand van de toegepaste kracht tijden het gebruik van AFM. We

hebben twee S. aureus stammen (S. aureus ATCC12600 en S. aureus NCTC 8325-4) en hun

isogene Δpbp4 mutanten gebruikt. De lange afstand hechtingskrachten van de S. aureus

stammen (0.5 en 0.8 nN) waren slechts een derde van de krachten die gemeten werden voor

de meer vervormbare Δpbp4 mutanten (2.7 en 1.6 nN), die niet in staat zijn om

peptidoglycan te crosslinken. De gemeten Lifshitz-Van der Waals hechtingskrachten die over

lange afstand domineren, gaven de aanleiding om een 40% elliptische vervorming van de

bacteriële celwand aan te nemen voor de Δpbp4 mutanten. Directe metingen van hechtende

stafylokokken gemaakt met behulp van AFM in de PeakForce-QNM mode bevestigden een

hoogte reductie door vervorming in de Δpbp4 mutanten van 100 – 200 nm. Onder natuurlijk

voorkomende bacteriële stammen variëren de langeafstandskrachten niet in dezelfde mate

als hier is waargenomen voor de Δpbp4 mutanten. Door deze resultaten te extrapoleren

kunnen we echter concluderen dat de langeafstandskrachten in bacteriële hechting niet

alleen bepaald worden door de samenstelling en de structuur van het bacteriële cel

oppervlak, maar ook door tot nu toe genegeerde kleine vervormingen van de bacteriële

celwand, die het contactoppervlak vergroten en daarmee ook de hechtingskrachten.

Celwand vervorming op de nanoschaal die plaats vindt tijdens de hechting van

bacteriën is moeilijk te meten, behalve bij Δpbp4 mutanten die niet in staat zijn om

peptidoglycan te cross linken. Hoofdstuk 3 behandelt een meer geavanceerde techniek om

celwand vervorming te kwantificeren gebaseerd op oppervlakte versterkte fluorescentie in

stafylokokken hechtend op goud oppervlakken. Hechting gerelateerde versterking van

fluorescentie hangt af van de afstand van de bacteriën tot het oppervlak en de hechtingstijd.

In dit hoofdstuk wordt een model aangedragen gebaseerd op de hechting gerelateerde

versterking van fluorescentie van groen-fluorescente microspheres, waarmee de afstand tot

het oppervlak en de celwand vervorming van gehechte bacteriën berekend kan worden,

gebaseerd op hun hechtingstijd afhankelijke versterking van fluorescentie. De afstanden

tussen hechtende bacteriën en een oppervlak, inclusief compressie van de EPS-laag, daalde

tot 60 min na hechting, gevolgd door vervorming van de celwand. Vervorming van de

celwand is onafhankelijk van de integriteit van de EPS-laag en verloopt het snelst voor een

Δpbp4 stam.


142

Gebaseerd op de resultaten van hoofdstuk 2 en 3 kan er geconcludeerd worden dat

de celwand vervorming van zowel de moeder stam als de Δpbp4 mutanten optreedt na

hechting aan een oppervlak. Echter, wat de vervorming betekent voor de bacteriën in termen

van moleculaire respons in het moduleren van het fenotype van vrij bewegend naar het

groeien in een biofilm is niet bekend. In Hoofdstuk 4 hebben we onderzocht wat de invloed

is van hechtingskrachten met verschillende biomaterialen op icaA (reguleert productie van

EPS matrix componenten) en cidA (geassocieerd met cel lyse en extracellulair DNA

productie) gen expressie in S. aureus biofilms. Experimenten werden uitgevoerd met S.

aureus ATCC12600 en zijn isogene mutant S. aureus ATCC12600Δpbp4, die niet in staat is

om peptidoglycan te crosslinken. Het verwijderen van pbp4 leidde tot meer vervorming van

de celwand, terwijl groei, biofilm formatie, hydrofobiciteit van het cel oppervlak en zeta

potentialen van de stammen onveranderd bleven. De hechtingskrachten van S. aureus

ATCC12600 waren het sterkst op polyethyleen (4.9 ± 0.5 nN), het zwakst op roestvrij staal

(1.3 ± 0.2 nN) en hechtingskrachten op polymethylmethacrylaat (3.1 ± 0.7 nN) lagen tussen

die waarden in. De productie van poly-N-acetylglucosamine, aanwezigheid van eDNA en

expressie van icaA genen daalde met toenemende hechtingskrachten. Er werd echter geen

relatie gevonden tussen hechtingskrachten en cidA expressie. De hechtingskrachten van de

isogene mutant S. aureus ATCC12600Δpbp4 waren veel zwakker dan die van de

moederstam en toonden geen correlatie met de productie van poly-N-acetylglucosamine,

aanwezigheid van eDNA of expressie van de icaA en cidA genen. Dit suggereert dat

hechtingskrachten de productie van matrix moleculen, poly-N-acetylglucosamine,

aanwezigheid van eDNA en icaA gen expressie moduleren door het induceren van

vervorming van de celwand, waarbij waarneming van de hechtingskrachten door

gecrosslinkte peptidoglycan lagen een grote rol speelt.

Hechting van bacteriën aan biomaterialen en de daarmee geassocieerde gevoeligheid

voor antibiotica is een belangrijke bedreiging voor de medische gemeenschap. Bacteriën

vormen niet alleen biofilms, maar ze worden ook tot 1000 keer meer resistent voor

antibiotica wanneer ze als biofilm groeien. Om het mechanisme dat deze sterke resistentie

veroorzaakt te onthullen, hebben we in Hoofdstuk 5 de regulatie van een recent ontdekt 2-

componenten systeem bestaande uit een met nisine geassocieerde gevoeligheidsrespons

regulator (NsaRS) en de bijbehorende transporter NsaAB in S. aureus onderzocht in de

aanwezigheid van chemische en mechanische stress. NsaRS is belangrijk voor hechting,

biofilm formatie en resistentie tegen chemische factoren in S. aureus. Het bestaat uit een in


143

het membraam gelegen sensor NasS en een in het cytoplasma voorkomende respons

regulator NsaR, welke geactiveerd wordt wanneer het een fosfaat groep ontvangt van de

NsaS sensor. De aanwezigheid van de NsaS sensor in het membraam leidt tot onze

hypothese die stelt dat het NsaRS systeem niet alleen chemische, maar ook mechanische

stress kan waarnemen om zo de antibiotica resistentie via de NsaAB efflux pomp te

moduleren. Om deze hypothese te verifiëren vergeleken we de expressie van de NsaS sensor

en de NsaA efflux pomp in S. aureus SH1000 in de hechtende (“mechanische stress”) en de

planktonische toestand, terwijl de aanwezigheid van nisine werd gebruikt als chemische

stress. NsaS en NsaA expressie door S. aureus SH1000 was verhoogd onder mechanische

stress, in de gehechte toestand. Chemische stress verhoogde de gen expressie van NsaS en

NsaR ook. Gen expressie was het hoogst wanneer de bacteriën een combinatie van

chemische stress en een sterke mechanische stress ondergingen, in de huidige studie

gekwantificeerd als de hechtingskrachten die ontstaan door een substraat oppervlak en

gemeten met behulp van AFM. Dit bevestigd onze hypothese dat het NsaRS systeem zowel

chemische als mechanische stress kan waarnemen.

In Hoofdstuk 6 hebben we de verschillen besproken tussen het gebruik van AFM

en SEF in het kwantificeren van celwand vervorming. Daarnaast bespreken we ook de

moleculaire basis voor het waarnemen van oppervlakken in S. aureus in vergelijking met

andere bacteriën en eukaryote cellen. Tenslotte, met de resultaten van dit proefschrift,

bevelen we toekomstige studies aan om de rol van mechanische sensoren bij antibiotica

gevoeligheid te onderzoeken.

144

145

Acknowledgements

Acknowledgements

146

I feel really lucky and happy to have done my PhD in a diversified group like Biomedical

Engineering. In the last 4-5 years of my stay at BME, I also had the opportunity to meet

people from different countries, cultures and backgrounds which have broadened my

thinking and understanding of the world. Not only did I get to know you all, it was also very

interesting to discussed science. Some of them are engineers, chemists and life-science

scientists, there was always something interesting to learn from each other and do better as a

scientist. Now the time has come for me to say good bye to all of you. Although we will not

see eachother on a day-to-day basis, I believe we may cross into eachother someday. During

this fascinating journey, I have had help from many people in doing science and arranging

administrative things, without which completing my thesis was not possible. Therefore I

would like to convay my sincere thanks to you all and share my experiences with each of you.

Dear Henk and Henny, You both are like two strong and great pillers of the department

overseeing all the PhDs. I have always wondered, how you managed so many projects, wrote

grants, assisted PhDs and make successful collaborations across the world. I admire you for

this and have learned a lot. Also, I enjoyed the scientific independence to design and execute

projects duing my PhD and I appreciate your support in every aspect to bring these projects

to a conclusion. Thank you for sharing your expertise and enthusiasm for science and

constructive discussions in guiding me in the right direction.

Prof. Jan Maarten van Dijl, Prof. Jan Kok and Prof. Yves Durene, thank you for

agreeing to be the reading committee for my thesis and suggesting valuable inputs.

Bastiaan, thank you for recognizing my research skills and hiring me for the PhD position.

Although you moved to Amsterdam after few months I joined, you had already laid the

foundation required for my project, and your feedfack during the initial days was very

helpful and allowed me to settle down quickly and do the right things required for the

project.

Prashant, thank you for informing me about the vacancy at BME and forwarding my CV, I

will always remember your help which has given me the opportunity to achieve my goal.

Also, thank you for interesting discussions during the coffee breaks and for hosting all the

BBQ parties during summer. Also, Spoorthi and I really enjoyed the Biryani party during the

last New Year’s Eve. Thanks you for inviting.

Acknowledgements

147

Jelmer, our discussions regarding two different projects were very interesting. I am also

happy that, of those two projects one is accepted and published, in which I am a co-author.

Thank you for giving me the opportunity to collaborate.

Wya, Ina and Willy, Thank you all for all the help with respect to paper work, financial

matters and arranging important things when I joined the department

Ed the IT guru of BME, thank you for all the technical support and for arranging a wonderful

PC which never gave any problems in the last 5 years.

Yun, Juiyi, Deepak and Jessica, thank you all for you collaboration in my PhD.

Importantly, I believe each of us have unique expertise which has helped to solve bio-

physical aspects of Implant-infection relationships in this thesis. Katya and Moijtaba,

thank you for giving me the opportunity to contribute to your work and at the same time

broaden the understanding of bacterial interactions with its environment. It was great

knowing you all and working with.

Joop, Willy and Rene, It goes without saying that all you three were very helpful in

introducing me to AFM/ DNA lab/ IVIS. Thank you for always being there to help whenever

I ran into trouble during the experiments. Joop, thanks for organizing the virtual Word CUP

football competition, it was really fun and of course I was more happy when I won. Rene,

I appreciate your simplicity and willingness to help all PhD students, thank you for

desigining a wonderful cover page for my thesis. Also, discussions during the coffee breaks,

lunch breaks or in the corridor were always great. It was good to know you.

Present fellows of room number 1265 and former occupants of brain center Deepak,

Agnieszka, Otto, Gene, Meyul and Willem, it was great sharing office space with you all,

lot of fun and memories. Deepak and Agnieszka, thank you for being such a nice host, we

have had many parties and “n” number of dinners (never had Polish dinner though) at your

place. Otto, Gene and Willem, thank you for being a good company at office. Willem and

Deepak, special thanks to you both for being my support as paranimphs and for taking

responsibility of arranging important things on my defense.

Jan, Barbra, Phillip and Jessica, It was fun knowing you guys and thank you for inviting

me and Spoorthi to all the birthday parties and house warming parties, it was a nice way to

Acknowledgements

148

catch up outside work. Most of you are not at BME anymore or will finish very soon; I wish

you all the success in your careers and life.

I also would like to acknowledge all other colleagues Theo, Roel, Danialle, Arina, Stefan,

Steven, Vera, Helen, Anna, Song, Joana, Sara, Rebecca, Hilde, Edward, Brian,

Brandon, Katya, Rene, Adhi, Das, Marja, Mini, Marianne, Betsy, Chris, Niar,

Jelly, Gesinda and Victor, thank you for a pleasant and memorable time at BME.

Fortunately, I also have a lot of friends outside BME to balance my work and personal life.

My neighbours Rajender and Shilpa, you are almost like a family to us, never needed an

appointment to meet up and in numerable dinners, parties and vacations together. We truly

enjoyed your company and thank you for being there for us all the time. Shilpa, good luck

for your new job and I hope you both will find a balance between work and personal life.

Raja babu and Saisri, although you live far away from Groningen (in your village

Hoornsemeer) you made it to a point to visit us often for most of the get togethers. Thanks

for being there for us and for your kind help to drop us home after late night parties. Apart

from general stuff, I found that our discussions were intense and most of the time head on to

prove eachother wrong, but I think that’s a best way to debate facts. Saisri, when I met you

for the first time you were very shy and reserved, but after seeing you at Saritha’s party I

know you can burn the dance floor, very significant improvement after coming to Europe.

Good luck for your new job and I hope you both will find a balance between work and

personal life, because travelling is always tyring and time consuming.

Shiva and Ananya, Shiva you are the most funny and witty person I have ever met, your

presence itself makes me laugh. Thanks for all the fun during our parties and get togethers.

Good luck with your PostDoc in Norway. Hope to see you in Netherlands soon.

Gopi and Saritha, you both are good friends since long, but I never had a clue that you both

were together. I am happy for you both; your couple is unique in our friends circle because

you’re the first, and may the only doctor couple. My best wishes for your wedding and all the

best in life.

Kabir Hussain and Julian, we have known each other for not so long but you are very

friendly and helping, it was good to know you. Thank you for inviting us to visit your place at

Acknowledgements

149

Stadskanaal, we enjoyed the stay and the tasty food that Julian made. I wish you both and to

be born baby all the success and happiness in life.

Kiran and Shruthi, Ganesh and Subha, Vikram and Oksana, Eshwar and Mounika

Sridhar and Richa, It was very good to meet you all at some point of time in Groningen,

thank you all for making my stay in Groningen a memorable one. I am sure we will keep in

contact where ever we are and share our experiences in life.

Goutam, Pranav, Praneeth, Suresh Vijay, Khayum, Sai Krishna, Arun, Sodhan,

Chaitnaya, Shanti, Sunil and Smitha, Tushar, Jasmin, Neha, Pallavi, Amol,

Sneha, Abhishek, Veena, Arun Patil and Suchita, It was fun to enjoy Diwali, holi,

Bolluwood nights and GISA events with you all. I will always cherish those Groningen

moments. All the best in your future endeavors.

Meena aunty and Vinod uncle, you both are like guardian angels, always ready to help

and take care like a family, very kind and down to earth. I admire you both for your qualities

and values. Thank you for all the help Uncle and Aunty. Vinesh, Vinay and Nawina, it was

good to know you guys, enjoyed the movie nights and dinners we had to gether, success to

you all in your endeavors.

Bhaskar Reddy uncle, thank you for helping me during difficult times, it is because of you

I was able to pursue my Masters in The Netherlands. I wish you and you family all the

success and happiness.

Niveditha (Sister) and Kalyan bava (Brother-in-law), thank you so much for your

immense support and advice at the end of my PhD days. It is always fun to catch up with you

guys, we should meet more frequently. I will miss you both on my defense and party. Love

you both.

Sahitya / Sali, you’r my darling, fun loving and a lovely girl. Very happy to have you as my

Sali, but you should keep our secrets a secret and not tell them to your sister. Good luck

with your Masters in Belgium.

Janardhan Mamayya (Father-in-law) and Bramara attamma (Mother-in-law), your

support and encouragement has always helped me during my PhD. Thank you for your love

and care.

Acknowledgements

150

Amma (Mother) and Nana (Father), I do not know how to say thank you for all the things

you have done for me. It is because of your teachings and values imbibed in me; I have

reached this happy day in my life. Nana, thank you for all your efforts and hardships to

provide me with good education. This is the biggest asset that you can ever give me. I will

miss you on my defense. I wish you all the happiness in life.

Last but not the least; Dear wife Spoorthi, thank you for being my greatest support during

good and bad times; your words always filled confidence in me. I am very happy to have you

in my life.

Documents

University of Groningen Cell wall deformation and ... · Table of Contents Chapter 1.1 Chemical signals and mechanosensing in bacterial responses to their environment (PLOS Pathogens