Upload
doantuong
View
220
Download
0
Embed Size (px)
Citation preview
University of Groningen
Growth factors, Cytokines and VEGF in human neoplastic and inflammatory pathologiesArtico, Marco
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2016
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Artico, M. (2016). Growth factors, Cytokines and VEGF in human neoplastic and inflammatory pathologies:Immunohistochemical basis for nuclear medicine studies. [Groningen]: University of Groningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 16-02-2019
1
Growth factors, Cytokines and VEGF in
human neoplastic and inflammatory
pathologies
Immunohistochemical basis for Nuclear Medicine studies
2
ISBN: 978-90-367-9114-4
Copyright © 2016 Marco Artico. All rights are reserved. No part of
this publication may be reproduced or translated in any form or by
any mean without permission from the author.
The work presented in this thesis has started at the University of
Rome “Sapienza”, where the majority of work has been performed.
Some articles have been made in cooperation with the University
Medical Center Groningen, NL .
Cover picture: VEGF molecule; IHC analysis: Expression of VEGFR1
in mouse subcutaneous tissue implanted and colonized by human
HT 29 colon carcinoma cells; tumour blush
3
RIJKSUNIVERSITEIT GRONINGEN
Proefschrift
ter verkrijging van het doctoraat in de
Medische Wetenschappen
aan de Rijkuniversiteit Groningen
op gezag van de
Rector Magnificus, Prof. E. Sterken,
in het openbaar te verdedigen op
Maandag 31-10-2016
om 16:15 uur
door
Marco Artico
geboren op 24 februari 1962
te Roma, Italië
4
Promotores:
Prof. Dr. A. Signore
Prof. Dr. R.A. Dierckx
Beoordelingscommissie:
Prof. Dr. R. Slart
Prof. Dr. C. van de Wiele
Prof. Dr. L. Zamai
5
Index of chapters
1 Introduction (partially published in: Int J Oncol, 49: 437-447, 2016).
2 Artico, M., Bronzetti, E., Pompili, E., Ionta, B., Alicino, V., D'Ambrosio,
A., Santoro, A., Pastore, FS, Elenkov I, Fumagalli L. Immunohistochemical
profile of neurotrophins in human cranial dura mater and meningiomas (2009)
Oncology Reports, 21 (6), pp. 1373-80.
3 Artico, M., Bianchi, E., Magliulo, G., De Vincentiis, M., De Santis, E.,
Orlandi, A., Santoro, A., Pastore, F.S., Giangaspero, F., Caruso, R., Re, M.,
Fumagalli, L. Neurotrophins, their receptors and Ki-67 in human GH-secreting
pituitary adenomas: An immunohistochemical analysis (2012) International
Journal of Immunopathology and Pharmacology, 25 (1), pp. 117-25.
4 Bianchi, E., Scarinci, F., Grande, C., Plateroti, R., Plateroti, R., Plateroti,
A.M., Fumagalli, L., Capozzi, P., Feher, J., Artico, M. Immunohistochemical
profile of vegf, tgf-ß and pge2in human pterygium and normal conjunctiva:
Experimental study and review of the literature (2012) International Journal of
Immunopathology and Pharmacology, 25 (3), pp. 607-15.
5 Bianchi E*, Artico M*, Di Cristofano C, Leopizzi M, Taurone S, Pucci M,
Gobbi P, Mignini F, Petrozza V, Pindinello I, Conconi MT, Della Rocca C. Growth
factors, their receptor expression and markers for proliferation of endothelial
and neoplastic cells in human osteosarcoma (2013) International Journal of
Immunopathology and Pharmacology, 26 (3), pp. 621-32. (*Authors equally
contributed).
6
6 Taurone S, Bianchi E, Attanasio G, Gioia CD, Ierinó R, Carubbi C, Galli D,
Pastore FS, Giangaspero F, Filipo R, Zanza C, Artico M. Immunohistochemical
profile of cytokines and growth factors expressed in vestibular schwannoma
and in normal vestibular nerve tissue (2015) Molecular Medicine Reports, 12
(1), pp. 737-45.
7 Bianchi E, Taurone S, Bardella L, Signore A, Pompili E, Sessa V,
Chiappetta C, Fumagalli L, Di Gioia C, Pastore FS, Scarpa S, Artico M.
Involvement of pro-inflammatory cytokines and growth factors in the
pathogenesis of the Dupuytren’s contracture. (2015) Clinical Science 129 (8).
pp 711-20.
8 Filippo Galli*, Marco Artico*, Samanta Taurone, Isabella Manni, Enrica
Bianchi, Giulia Piaggio, Bruce D. Weintraub, Mariusz W. Szkudlinski, Enzo
Agostinelli, Rudi A.J.O. Dierckx, Alberto Signore. Radiolabeling of VEGF165 with
99mTc to evaluate VEGFR expression in tumor angiogenesis (2016) submitted on
August 2016 to International Journal of Oncology. (*Authors equally
contributed)
9 Conclusions and future perspectives
10 English summary
11 Dutch summary
12 Curriculum vitae et studiorum
13 Acknowledgements
7
Chapter 1
Introduction
VEGF in Nuclear Medicine: Clinical
Applications, Future Perspectives and
Review of the Literature
1S. Taurone*, 2F. Galli*. 2,3A. Signore, 4E. Agostinelli,
3R.A.J.O. Dierckx, 5A. Minni, 5M. Pucci and 5M. Artico
1G.B. Bietti Eye Foundation-IRCCS, Rome, Italy.
2Nuclear Medicine Unit, Department of Medical-Surgical Sciences and of
Translational Medicine, Fac. of Medicine and Psychology, “Sapienza” University,
Rome, Italy.
3Department of Nuclear Medicine and Molecular Imaging, University of
Groningen, University Medical Center Groningen, Groningen, The Netherlands.
4Department of Biochemistry, “Sapienza” University, Rome, Italy.
5Department of Sensory Organs, “Sapienza” University, Rome, Italy
*Samanta Taurone and Filippo Galli contributed equally to this publication
Partially published in:
International Journal of Oncology 49 (29), 437-447, 2016
Key words: VEGF – VEGFR – IHC – PET – SPECT – Nuclear medicine
8
Introduction
The clinical study of human inflammatory and neoplastic pathologies requires
an accurate evaluation of tissues microenvironment to better understand the
complex mechanisms which may represent the cause of the physiopathological
evolution of these diseases. In this perspective immunohistochemistry (IHC)
potentially represents an ideal investigative tool which may be very useful in
the preliminary approach addressed to the preparation of innovative
radiolabeled drug used in nuclear medicine diagnosis and therapy of the above
mentioned pathologies. Potential new antigens and/or receptors involved in the
progression of tumors or inflammatory conditions, and discovered in sick
tissues by IHC, may lead to an interesting selective determination of novel
radiolabeled ligands or anti-targets antibodies. For these reasons in this Ph.D.
thesis we have tried to establish some intriguing and possibly important
correlations between growth factors and/or inflammatory cytokines
“immunolabeling” granted by IHC and their potential application in nuclear
medicine. The majority of humans neoplasms demonstrates a concrete
correlation between factors stimulating vessels’ growth (especially VEGF) and
progression of the tumor.
Clinical trials with antiangiogenic drugs revealed their potential against cancer.
However, a large percentage of patients still does not benefit from this
therapeutic approach highlighting the need of diagnostic tools to non-invasively
evaluate and monitor response to therapy. In this perspective the role of
Nuclear Medicine remains pivotal, being the discipline that allows the more
effective approach to non-invasive lesion detection, especially neoplastic ones,
with encouraging results even in advances diseases. It would also allow to
predict which patient will likely benefit from antiangiogenic therapy. Reasons
for treatment failure may be that low expression of drug’s targets or prevalence
of other pathways, therefore, molecular imaging has been explored as a
9
diagnostic technique of choice. Since the VEGF/VEGFR pathway is the main
responsible of tumor angiogenesis, many new drugs target either the soluble
ligand or its receptor to inhibit signaling leading to tumor regression. It is
currently impossible to evaluate local VEGF or VEGFR levels and their non-
invasive measurement in tumors might give insight to the available target for
VEGF/VEGFR-dependent antiangiogenic therapies allowing therapy decision
making and monitoring of response. Angiogenesis is the process that leads to
the formation of new blood vessels, and, if induced by tumors, can also
contribute to the growth of the disorganized vasculature able to sustain cancer
progression over 2-3 mm and metastasization (1). The events that trigger
tumor angiogenesis derive from the interaction between cancer cells and host
microenvironment that includes immune cells, connective tissue and soluble
factors. Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) are
the main contributors to proliferation of endothelial cells, thus representing
suitable targets for antiangiogenic therapies (2).
VEGF
Vascular endothelial growth factor (VEGF) is the most important mediator of
angiogenesis. It is overexpressed in various tumors, stimulating endothelial cell
proliferation and migration, and leading to the formation of new blood vessels
from preexisting ones (8). The VEGF family is composed of five glycoproteins
(VEGF-A, VEGF-B, VEGF-C, VEGF-D and VEGF-E). VEGF-A is a homodimeric,
disulfide-bound glycoprotein, which exists in several isoforms with different
numbers of amino acid residues, such as VEGF121, VEGF165, VEGF189 and
VEGF206. Different VEGF-A isoforms exhibit varying biological properties, such as
the ability to bind to cell surface heparin sulfate proteoglycans. VEGF121,
commonly existing as a homodimer, is freely diffusible without heparin binding.
The angiogenic actions of VEGF are mediated primarily via two closely related
endothelium-specific receptor tyrosine kinases, Flt-1 (VEGFR1) and Flk-1/KDR
10
(VEGFR2) (9). Both are largely restricted to vascular endothelial cells and are
overexpressed on the endothelium of tumor vasculature, yet they are almost
undetectable in the vascular endothelium of adjacent normal tissues (10). All of
the VEGF-A isoforms bind to both VEGFR1 and VEGFR2. VEGF and its receptors
are overexpressed in a variety of solid tumor biopsy specimens, and over-
expression of VEGFR2 or VEGF-A has been considered as a poor prognostic
marker in various clinical studies (11-13). Indeed, new vasculature allows
tumor cells to grow by supplying nutrients and oxygen, enabling disposal of
metabolic waste products and providing a route for metastatic spreading. VEGF
production by tumor cells is thought to be regulated by hypoxemia, growth
factors signaling, cytokines, and cell differentiation (8).
Given the role of VEGF and VEGFR in several oncological and non oncological
diseases, pharmaceutical companies and researchers are deeply involved in
developing agents potentially useful in the prevention of VEGF-A binding to its
receptors (14), or antibodies blocking VEGFR2 (11) or small molecules that
inhibit the kinase activity of VEGFR2 (15, 16) and thereby block growth factor
signaling.
Indeed, VEGF/VEGFR targeting has already been proved successful in many
cancer types (17).
The VEGF/VEGFR pathway
The VEGF-VEGFR system is unique in that it consists of a very limited number
of molecules that play a central role in angiogenesis. The likely mechanism is
that bevacizumab binds to VEGF both soluble and bound to the extracellular
matrix and thereby prevents VEGF binding to its receptors, blocking the biologic
pathways induced after VEGF binding. Bevacizumab is approved both by the
United States Food and Drug Administration (FDA) and the European Medicines
Agency (EMA) for the treatment of metastatic colorectal cancer, non small cell
11
lung cancer, breast cancer and glioblastoma multiforme in combination with
chemotherapy.
VEGF-A and its receptors are the best-characterized signaling pathway in
developmental angiogenesis as well as tumor angiogenesis (10). VEGFR2
appears to be the most important receptor in VEGF-induced mitogenesis,
angiogenesis, and permeability increase, whereas the role of VEGFR1 in
endothelial cell function is less clear (18). During the exponential growth stage,
VEGFR expression is highly up-regulated on the newly developed tumor
vasculature. Being the naturally existing VEGFR ligand, VEGF121 offers several
advantages over the synthetic small-molecule VEGFR ligands or anti-VEGFR
antibodies, especially as a tracer. It has much higher binding affinity to VEGFR
(nanomolar range) than reported peptidic VEGFR inhibitors (submicromolar to
micromolar range) (19, 20). If Compared to antibody-based
radiopharmaceuticals, VEGF121 clears much faster from the blood pool and the
non-targeting organs because of its smaller size. Regulation of inflammatory
cell recruitment by VEGFR1 appears to be exerted mainly through placental
growth factor (PGF). Notably, the expression of PGF is very low under
physiological conditions, but it may be strongly upregulated in various cell types
by different pathological stimuli such as hypoxia, inflammatory cytokines, or
oncogenes (21-23). PGF has recently been regarded as an attractive candidate
for anti-angiogenic therapy. Indeed, it has been shown that PGF plays a key
role in promoting pathological angiogenesis associated with tumor progression
(24) and overexpression of PGF in a mouse melanoma model resulted in
increased tumor growth and metastasis (25). Tumor cells may also express
VEGFR2, although epithelial and mesenchymal tumor cells typically express
VEGFR1 rather than VEGFR2 (26, 27). Nevertheless, increased expression of
VEGFR2 on tumor cells has been described for melanoma and hematological
malignancies (28). It has been shown that VEGFR2-mediated signaling allowed
survival of cancer cells under chronic hypoxic conditions and might contribute
to a more aggressive phenotype (29). VEGF-C, VEGFR3 and its involvement in
lymphatic endothelial cell proliferation should also be considered for their
12
potential important role in the pathogenesis of reticulo-endothelial diseases. A
soluble form of the VEGFR2 (sVEGFR2) has been also described and it may
have important biological roles. sVEGFR2 binds VEGFC and prevents activation
of VEGFR3, consequently inhibiting lymphatic endothelial cell proliferation (31).
Notably, regulation of sVEGFR2 in advanced metastatic neuroblastoma may
promote lymphogenic spread of metastases (32). The expression of VEGFR3 in
tumor cells is still controversial (33); however, it has been ascertained that
inhibition of VEGFR3 activity arrests tumor vascularization, leading to decreased
vascular density in several tumor models (34). The axis VEGF-C/VEGFR3 plays
a fundamental role in the tumor microenvironment by promoting the formation
of new lymphatic vessels from preexisting ones (35). VEGF-C, produced by
neoplastic cells, induces lymphatic endothelial destabilization, resulting in
endothelial sprouting as well as leakage and enlargement of the vessels. These
modifications induce entry of tumor cells into the lymphatics vessels and further
dissemination of metastasis to sentinel lymph nodes (36, 37).
VEGF and cancer-related inflammation
Growing evidence supports an important link between chronic inflammation and
tumor development. Induction of VEGFR2 expression in tumor cells, and also in
intestinal epithelium during colitis, is mediated by the pro-inflammatory
cytokine interleukin-6, which is a strong promoter of tumor growth in
experimental colitis-associated colon cancer (30). High expression of VEGFs
and/or VEGFRs in various tumor biopsy specimens is indicative of poor
prognosis for cancer patients (2, 38, 39). Therefore, non-invasive imaging and
quantification of VEGFR expression is of relevant importance in cancer patient
management. Many strategies have been adopted to block the VEGF/VEGFR
signaling pathway for cancer treatment, such as agents that can bind to VEGF-
A to prevent its interaction with VEGFRs (bevacizumab, VEGF-trap, etc.) (40,
13
41) antibodies/antibody fragments that target VEGFR-2 (ramucirumab, CDP791,
etc.) (42, 43) and small molecule inhibitors that interrupt the downstream
signaling of VEGFR-2 (axitinib, sunitinib, sorafenib, etc.) (44–45). Many of
these agents have been approved by the Food and Drug Administration (FDA)
for various medical indications in cancer therapy (2, 46).
VEGFR-2 mediates the majority of VEGF-A signaling in the tumor
microenvironment including microvascular permeability and endothelial cell
proliferation (8, 10). Several agents, including anti- bodies and soluble receptor
constructs, have been developed to target the VEGF system. The drug that is
currently most widely used in the clinical practice to modulate VEGF-A is the
humanized monoclonal antibody. It blocks VEGF-induced endothelial cell
proliferation, permeability, and survival, and it inhibits human tumor cell line
growth. One of the greatest challenges in bevacizumab therapy is the lack of
predictive biomarkers and tools that can predict the efficacy of anti-VEGF
therapy (48).
Anti-VEGF drugs
Development of anti-angiogenic therapy including anti-VEGF antibodies and
VEGF-tyrosine kinase receptors has been a major landmark in cancer therapy
leading improvement in survival in several cancers.
The pharmacologic inhibition of angiogenesis via the VEGF pathway is an
important therapeutic approach that prevents cancer growth and metastasis
formation. In addition to anti-VEGF antibodies, other strategies have been
explored and include the blocking of its signaling receptor, receptor tyrosine
kinase inhibitors (49-52), and gene therapy approaches, in which the vector
produces an antisense molecule or a soluble receptor that acts in a dominant
negative manner (53).
Several studies have shown that anti-VEGF treatment, in association with
chemotherapy (54) or radiation therapy (55, 56), results in greater anti-tumor
14
effects than either treatment alone. An issue that is now being debated is the
mechanism of such potentiation, and a variety of hypotheses, which are not
mutually exclusive, have been put forward. Klement et al. proposed that
chemotherapy, especially when delivered at low dose, preferentially damages
endothelial cells and the blockade of VEGF blunts a key survival signal for
endothelial cells, thereby amplifying the antitumor-cell effects of chemotherapy
(54). Jain et al. proposed that antiangiogenic therapy ‘normalizes’ the tumor
vasculature, leading to pruning of excessive endothelial cells and perivascular
cells, reduction in vessel tortuosity and drop in interstitial pressure and
consequent improved oxygenation and delivery of chemotherapy to tumor cells
(57). These effects are accompanied by a reduction in permeability of
macromolecules (58, 59). Most recently, Willett et al. have shown that VEGF
blockade by bevacizumab decreases tumor perfusion, vascular volume,
microvascular density, interstitial fluid pressure and the number of viable
circulating endothelial and progenitor cells in colorectal cancer patients (60).
Surprisingly, these studies have also shown that permeability to small
molecules actually increases following VEGF blockade (60).
Bevacizumab has been initially approved for the treatment of metastatic
colorectal cancer in combination with intravenous 5-fluorouracil-based
chemotherapy (61). Subsequently, bevacizumab has been approved for various
indications in nonsquamous cell lung carcinoma (NSCLC), metastatic renal cell
carcinoma, and glioblastoma multiforme (62-66). The antitumor activity of
bevacizumab is primarily manifested in combination with chemotherapy, except
for renal cell carcinoma, where it has shown efficacy as a single agent (67).
Presently, bevacizumab is being used in nearly 1000 clinical trials, and despite
promising results, its effects in many types of cancer are modest or even
irrelevant (68). Furthermore, recent studies have raised the possibility that
treatment with bevacizumab may be associated with a more aggressive
invasive tumor phenotype, particularly in glioblastoma (69), which is often a
greatly vascularized brain tumor. Although the clinical impact of these results is
far from clear, it is obvious that antiangiogenic therapy will have to be closely
15
evaluated depending on disease stage and molecular profile of different
patients and tumours.
Preclinical data with anti-VEGFR2 antibodies have demonstrated a reduction in
VEGF-induced signaling as well as angiogenesis and primary or metastatic
growth in a variety of different tumor models (70 - 73); therefore, the specific,
antibody-based blockade of VEGFR2 has also received special attention in
clinical trials. Ramucirumab (IMC-1121B; Imclone Systems) is currently being
tested in several clinical trials, including breast cancer, gastric cancer, and HCC
(74). Basing on preliminary results, this antibody has shown activity in patients
previously treated with other antiangiogenic agents, suggesting a more efficient
antitumor response by direct targeting of VEGFR2.
Small molecule inhibitors of VEGFR tyrosine kinase activity represent another
major approach to blocking VEGF-mediated angiogenesis. Several tyrosine
kinase inhibitors have been developed to selectively inhibit VEGFR2, but they
have also activity on other VEGFRs and tyrosine kinase receptors, including
basic fibroblast growth factor (FGF) receptor, EGFR family members, PDGFR-a,
PDGFR-b, c-kit, and Flt3. Sunitinib was approved in 2006 for its clinical use in
imatinib-resistant gastrointestinal stromal tumors and advanced metastatic
renal cell carcinoma (75, 76), whereas sorafenib received FDA approval for the
treatment of metastatic renal cell carcinoma (77) and HCC (78). Sunitinib and
sorafenib have shown clinical efficacy as single agents, possibly due to their
ability to inhibit multiple RTKs and in particular those regulating tumor
angiogenesis. Additional clinical trials aimed to evaluate combinations of
sorafenib and sunitinib with different chemotherapeutic agents and other
antiangiogenic agents are under evaluation
There has been a worldwide research program to develop antiangiogenic
agents for the treatment of cancer. Many families of antiangiogenic drugs now
exist, but their clinical development has been hampered by scarce data
concerning the optimal biologically active dose. In addition, although the
classical phase I study design focuses on toxicity as an endpoint to establish
the maximum tolerated dose, many humanized monoclonal antibodies have no
16
clinically significant toxicity, which precludes identification of the maximum
tolerated dose. Furthermore, biologic dose–response relationships may follow a
bell-shaped curve (79) and therefore the maximum tolerated dose may not
even be the best dose for clinical applications. To overcome these issues,
biologic pharmacodynamic investigations (80) have entered phase I clinical trial
design with the goal of establishing the optimum biologically active dose.
Efficacy of anti-VEGF therapy
Antiangiogenic therapies are promising approaches for cancer treatment.
However, their systematic application remains problematic because of poor
understanding of mechanisms of action and occurrence of resistance (81).
Indeed, a significant fraction of patients do not respond to antiangiogenic drugs
(82), whereas those who respond have relatively modest benefits, mostly in
progression-free survival rather than in overall survival. In addition, a number
of significant toxicities have been observed in patients treated with
antiangiogenic agents, emphasizing that a careful assessment of the risk-
benefit ratio needs to be conducted in individual patients. Despite disease
stabilization and increase in the proportion of patients with progression-free
survival, tumors eventually become resistant to antiangiogenic agents and
relapse (83 - 86).
Antiangiogenic therapy depends on several factors, including the tumor stage,
the nature of the tumor vascular bed and the origin and genotype of the
neoplastic cells. Tumorigenesis (87), and progression (88) are often associated
with a modified expression of different angiogenic factors (88). Advanced
human breast cancers may express different pro-angiogenic factors, including
VEGF, acidic and basic fibroblast growth factors (aFGF and bFGF), transforming
growth factor β1 (TGFβ1), platelet-derived growth factor (PDGF), placental
growth factor (PGF) and pleiotrophin (88). The mechanism of action of certain
drugs is also different at various stages of tumorigenesis. For example, the
17
release of VEGF, following the remodelling of the extracellular matrix by matrix
metalloproteinase 9 (MMP9), is reported to be a component of the RIP1–Tag2
angiogenic switch (89, 90-93). Inhibition of VEGF is not effective against
established β-cell islet tumors (90, 94), and this finding may led to hypothesize
that the vasculature matures with increased pericyte coverage, thereby
reducing dependence on VEGFR2. The success of targeted therapies, such as
trastuzumab (Genentech), is often dependent on the expression of the drug’s
target by the tumor (95). Given that bevacizumab is a monoclonal antibody
with a well-defined target, it is logical that VEGF expression might predict
benefit. However, in retrospective subset analyses, VEGF expression by primary
tumors of metastatic, treatment-refractory breast cancers (96) or metastatic
colorectal cancers did not predict benefit from the addition of bevacizumab
(97). The reasons responsible for this behaviour are not entirely clear. Perhaps
VEGF expression by primary tumors is not representative of metastatic disease,
but detailed research indicates that they are equivalent (98).
Imaging of tumor angiogenesis
Positron emission tomography (PET), very sensitive technique (down to 10-12
molar) and quantitative with superb tissue penetration, has been widely used in
clinical oncology for tumor staging and treatment monitoring, where 18F-FDG (
fluorodeoxyglucose) was used as the tracer for measuring tumor glucose
metabolism (107, 108). High-resolution PET scanners continue to be developed
and made available for imaging small animals, improving the capacity for in
vivo studies in mice, primates, and humans (Fig. 1 and 2).
As already discussed, anti-angiogenic targeted therapies are a promising
approach for the treatment of cancer. However, clinical trials showed variable
response due to intra- and inter-tumor heterogeneity and non-invasive tools to
monitor treatment response and drug efficacy are needed.
18
Several methods have been developed to image tumor angiogenesis, but there
is no general agreement as to which strategy is the most suitable for
monitoring anti-angiogenic therapy in single-center and multicenter trials.
There is also evidence that angiogenic imaging data may be a useful predictor
of response to chemo-radiotherapy, the success of which depends on good
perfusion of the tumor (Fig. 3).
Personalized medicine allows to identify the right patient population for the
right therapy at the right time, as well as to provide quantitative, non-invasive,
and accurate information about the therapeutic responses in real-time. In this
scenario nuclear medicine offers several radiopharmaceuticals for “in vivo”
imaging of angiogenic markers, but to date, none emerged as a gold standard.
As an example, radiolabeled bevacizumab is one of the most studied
radiopharmaceuticals since it is able to bind VEGF with high affinity. Indeed,
development of a bevacizumab-based imaging agent can play important roles
in these aspects, as well as elucidating the function and modulation of
VEGF/VEGFR signaling during cancer development/intervention.
Targeting vascular endothelial growth factor
Being the most important angiogenic effector and already established
therapeutic target, many VEGF-targeting radiopharmaceuticals were developed
and studied in vitro and in vivo. In particular, the mAb bevacizumab is one of
the most studied radiolabelled anti-VEGF drugs and, to date, it has been
labeled with a number of PET isotopes such 89Zr (109, 110), 124In (111), 86Y
(112), and 64Cu (113). In addition, it has also been investigated with various
other imaging techniques such as single photon emission computed
tomography (SPECT) (114, 115), ultrasound (116), and optical imaging (117,
118). Studies with radiolabeled bevacizumab for imaging tumor angiogenesis
were performed in preclinical models proposing that its accumulation in the
tumor was due to interactions with the VEGF-A-165 and -189 isoforms,
19
associated with the tumor cell surface and/or the extracellular matrix (137-
139). However, in a clinical study with 111In-bevacizumab in patients affected
by colorectal cancer liver metastases, there was a lack of correlation between
radiolabelled bevacizumab uptake and VEGF-A expression in the lesions (140).
Authors speculated that the accumulation of the mAb was due to enhanced
vascular permeability leading to unspecific uptake in the tumor. This could limit
the usefulness of radiolabeled bevacizumab in imaging tumor angiogenesis.
However, this radiopharmaceutical showed promising results in many other
cancers like breast cancer. Various studies have reported overexpression of
VEGF-A in the breast cancer microenvironment, compared with normal breast
tissue (142-145). All VEGF-A splice variants are bound by the clinically used
monoclonal antibody bevacizumab. When labeled with the PET isotope 89Zr, it
preserves its VEGF-A–binding properties. Thus, tracer dosages of radiolabeled
bevacizumab can be used for tumor-specific, whole-body imaging of VEGF-A. In
preclinical studies (146, 147) and in a study in renal cell cancer patients (148),
we have already shown an excellent tumor-to-background ratio with an
optimum at 4 d after tracer injection when using 89Zr-bevacizumab. 89Zr-
bevacizumab might be potentially valuable for biologic characterization of
tumors and for prediction and evaluation of the effect of VEGF-A–targeting
therapeutics. VEGF-A is reported in several studies to be over expressed in
malignant breast tumors and in ductal carcinoma in situ (145,149), thus
covering the full spectrum from early-stage breast cancer to more advanced
stages. More frequent VEGF-A staining was found to be related to
aggressiveness as assessed by VEGF-A staining in a study with 1,788 breast
tumors (145). 89Zr-bevacizumab PET proved to be able to detect a broad range
of VEGF-A expression levels. Quantitative tumor analyses showed a more than
10-fold difference between individual SUV(standardized uptake value)max
measurements, suggesting large differences in VEGF-A tumor levels between
patients, 89Zr-bevacizumab might be potentially valuable for biologic
characterization of tumors and for prediction and evaluation of the effect of
VEGF-A–targeting therapeutics.
20
Because of better and more accurate scatter and attenuation corrections
associated with PET, 86Y-labeled bevacizumab was developed for imaging
VEGF-A tumor angiogenesis and as a surrogate marker for 90Y-based RIT
(Radioimmunotherapy Trial). The 111In and 89Zr-labeled probes have been
proposed as surrogate imaging markers for 90Y therapy, however, deviations
were observed due to subtle differences in the metalchelate complexes and
metabolism (150, 151) highlighting the need for the development of isotopically
matched 86Y-labeled probes for 90Y.
However, 86Y possesses its own set of challenges, in particular, its high positron
energy (Emax 1⁄4 3.1 MeV) and emission of 1.08 MeV (83% abundance),
which can significantly affect the image quality and recovery coefficients due to
spurious coincidences. When appropriate corrections are performed, the image
quality is greatly improved and is quantifiable (152 – 154).
PET imaging with 86Y-CHX-A00-DTPA-bevacizumab may have a useful role in
patient selection for bevacizumab-related therapy as it would indicate
accessibility of the antibody to VEGF-A target sites. However, 86Y-CHX-A00-
DTPA-bevacizumab imaging by itself may not predict the response to therapy
as it is only indicative of how much bevacizumab reaches the tumor and not
the overall tumor microenvironment and the biomolecular characteristics. The
primary use of 86Y-CHX-A00- DTPA-bevacizumab will be for the selection of
patients for 90Y-CHX-A00-DTPA-bevacizumab RIT, monitoring of those patients
during therapy as well as to provide information for dosimetry calculations
(150, 155) To achieve the long-term goal of clinical translation of 86Y-CHX-A00-
DTPA-bevacizumab, PET/CT and MRI studies are currently being performed
with mice bearing orthotopic and disseminated ascites forming colorectal and
ovarian tumors.
In conclusion, the utility of 86Y-CHX-A00-DTPA-bevacizmab for noninvasive PET
imaging of VEGF-A secreting tumors in preclinical models has been
demonstrated (156) 86Y-CHX-A00-DTPA-bevacizumab may be useful for the
assessment of bevacizumab uptake and localization, which may be important
for risk stratification, patient screening and appropriate dosage selection.
21
Ultimately, 86Y-CHX-A00- DTPA-bevacizumab would serve as a surrogate PET
marker for dosimetry and selection of subjects for 90Y CHX-A00-DTPA-
bevacizumab RIT of VEGF-A–secreting cancers (156).
The limiting factor for more general application of imaging with radionuclides is
the radiation burden. In a study comparing the risks of radiation-induced
cancer from mammography, molecular breast imaging, and positron emitting
mammography, the cumulative cancer incidence is 15–30 times higher for
positron emission mammography and molecular breast imaging than for
mammography (157). The estimated radiation burden of 89Zr-bevacizumab-PET
is 19 mSv per tracer injection, on the basis of extrapolation from 111In-
bevacizumab data and a dosimetry study on 89Zr-U36, compared with 5.3 mSv
for 18F-FDG PET (158-161).
Besides bevacizumab, other radiolabeled anti-VEGF antibodies such as I-labeled
VG76e (121) and HuMV833 (122) have been reported. Phase I trials of the
latter revealed that antibody distribution and clearance was quite
heterogeneous, not only between and within patients but also between and
within individual tumors, which underscored the importance of patient selection
to achieve maximum therapeutic effect.
Targeting VEGF receptor
In addition to VEGF, VEGFR is another important target for cancer diagnosis
and monitoring the therapeutic efficacy of anti-angiogenic therapies. Over the
last decade, imaging of VEGFR expression has gained enormous interest not
only in cancer but also in many other angiogenesis-related diseases (119, 120).
Examination of the tumor in the same animals or cancer patients with both
VEGF- and VEGFR-targeted radiopharmaceuticals or fluorescent probes in
comparison to IHC expression of VEGFR1 and VEGFR2 in tissue animals (Fig. 4
and 5) or in human neoplastic tissues (Fig. 6 and 7) may give important
insights about distribution and expression kinetics of VEGF and VEGFRs during
22
cancer development and cancer therapy. Substantial effort has been devoted to
non-invasive imaging of VEGFR expression in cancer over the last two decades
and various agents have been developed for SPECT (125–128), PET (126, 129–
133), optical imaging, magnetic resonance imaging (MRI) (134) and ultrasound
(US) (135). Because of the high affinity to VEGFRs, VEGF121 has emerged as a
particularly desirable candidate for tracer development in the literature (123).
To avoid significant interference with VEGFR binding, site-specific labeling of
VEGF-based proteins has been adopted in many literature reports which
typically utilizes a cysteine residue for radiolabeling (126, 136). However, in
many of the reported studies, liver and kidney uptake of the tracer was very
high (in some cases > 100 percentage of injected dose per gram of tissue
[%ID/g]) which significantly hampered the clinical translation/applications of
these tracers. The aim is to develop a PET tracer for the imaging of VEGFR
expression using lysine tagged recombinant human VEGF121 (denoted as K3-
VEGF121). The three lysine residues at the N-terminus, far from the VEGFR
binding sites, can facilitate radiolabeling without affecting the biological activity
and receptor binding. In the design of novel radiotracers, it is important to
minimize the radiation dose to normal organs without compromising the
imaging characteristics. VEGF121 and its derivatives have been labeled with
many PET/SPECT isotopes.
Considered these premises about the importance of IHC in the detection of new
potential targets in nuclear medicine management of neoplastic and
inflammatory conditions in the 2nd chapter of this thesis are reported the results
of a previously published study which correlates the immunohistochemical
expression of neutotrophins between meningiomas and normal dura mater. In
the 3rd chapter are presented the results of a study performed on human GH-
secreting pituitary adenomas to investigate the IHC expression of
neurotrophins, their receptors and Ki-67. In the 4th chapter I report the results
of an experimental study which investigates the IHC expression of VEGF, TGF-
and PGE2 in human pterygium and normal conjunctiva. In the 5th chapter are
presented the experimental evidences of IHC expression of some growth
23
factors, their receptors and markers of proliferation of human osteosarcomas.
In the 6th chapter are illustrated the experimental results of a study performed
on IHC expression cytokines and growth factors in vestibular schwannomas and
normal vestibular nerve. In the 7th chapter are discussed the experimental
results of an IHC study on the involvement and the expression of some pro-
inflammatory cytokines and growth factors in the pathogenesis of Dupuytren’s
contracture. In the 8th chapter are discussed the results of a study (submitted
for publication) concerning the tumor uptake of 99mTc-HINIC-VEGF165 which
correlates with VEGF production and not with VEGFR expression. In the chapter
9th are finally discussed the conclusions and the future perspectives deriving
from the analysis of the obtained results and from possible applications in the
field of the nuclear medicine.
24
REFERENCES
1. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med.
1971;285:1182–1186
2. Folkman J. Angiogenesis: an organizing principle for drug discovery? Nat
Rev Drug Discov. 2007;6:273–286.
3. Ellis, L. M., Liu, W., and Wilson, M. (1996). Down-regulation of vascular
endothelial growth factor in human colon carcinoma cell lines by antisense
transfection decreases endothelial cell proliferation.Surgery120,871–878.
4. Gerber, H. P., Kowalski, J., Sherman, D., Eberhard, D. A., and Ferrara,
N. (2000). Complete
inhibition of rhabdomyosarcoma xenograft growth and neovascularization
requires blockade of both tumor and host vascular endothelial growth factor.
Cancer Res.60, 6253–6258
5. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and
Ferrara, N. (1993).
Inhibition of vascular endothelial growth factor-induced angiogenesis
suppresses tumour growth in vivo.Nature362,841–844
6. Klohs, W. D., and Hamby, J. M. (1999). Antiangiogenic agents.Curr.
Opin. Biotechnol.10,
544–549.
7. Prewett, M., Huber, J., Li, Y., Santiago, A., O’Connor, W., King, K.,
Overholser, J., Hooper, A., Pytowski, B., Witte, L., Bohlen, P., and Hicklin, D. J.
(1999). Antivascular endothelial growth factor receptor (fetal liver kinase 1)
monoclonal antibody inhibits tumor angiogenesis and growth of several mouse
and human tumors.Cancer Res.59,5209–5218.
8. Ferrara N, Davis-Smyth T . The biology of vascular endothelial growth
factor. Endocr Rev. 1997;18:4–25.
9. Sato Y, Kanno S, Oda N, et al. Properties of two VEGF receptors, Flt-1
and KDR, in signal transduction. Ann N Y Acad Sci. 2000;902:201–205.
25
10. Ferrara N. The role of VEGF in the regulation of physiological and
pathological angiogenesis. EXS. 2005;94:209–231.
11. Tang RF, Itakura J, Aikawa T, et al. Overexpression of lymphangiogenic
growth factor VEGF-C in human pancreatic cancer. Pancreas. 2001;22:285–292
12. Ryden L, Linderholm B, Nielsen NH, Emdin S, Jonsson PE, Landberg G.
Tumor specific VEGF-A and VEGFR2/KDR protein are co-expressed in breast
cancer. Breast Cancer Res Treat. 2003;82:147–154.
13. Decaussin M, Sartelet H, Robert C, et al. Expression of vascular
endothelial growth factor (VEGF) and its two receptors (VEGF-R1-Flt1 and
VEGF-R2-Flk1/KDR) in non-small cell lung carcinomas (NSCLCs): correlation
with angiogenesis and survival. J Pathol. 1999;188:369–377.
14. Sun J, Wang DA, Jain RK, et al. Inhibiting angiogenesis and
tumorigenesis by a synthetic molecule that blocks binding of both VEGF and
PDGF to their receptors. Oncogene. 2005;24:4701–4709.
15. Prewett M, Huber J, Li Y, et al. Antivascular endothelial growth factor
receptor (fetal liver kinase 1) monoclonal antibody inhibits tumor angiogenesis
and growth of several mouse and human tumors. Cancer Res. 1999;59:5209–
5218.
16. Wood JM, Bold G, Buchdunger E, et al. PTK787/ZK 222584, a novel and
potent inhibitor of vascular endothelial growth factor receptor tyrosine kinases,
impairs vascular endothelial growth factor-induced responses and tumor growth
after oral administration.
17. Wedge SR, Ogilvie DJ, Dukes M, et al. ZD4190: an orally active inhibitor
of vascular endothelial growth factor signaling with broad-spectrum antitumor
efficacy. Cancer Res. 2000;60:970–975.
18. Ferrara N. Vascular endothelial growth factor: basic science and clinical
progress. Endocr Rev. 2004;25:581–611.
19. El-Mousawi M, Tchistiakova L, Yurchenko L, et al. A vascular endothelial
growth factor high affinity receptor 1-specific peptide with antiangiogenic
activity identified using a phage display peptide library. J Biol
Chem.2003;278:46681–46691.
26
20. Goncalves M, Estieu-Gionnet K, Berthelot T, et al. Design, synthesis, and
evaluation of original carriers for targeting vascular endothelial growth factor
receptor interactions. Pharm Res. 2005;22:1411–1421
21. Failla, C. M., Odorisio, T., Cianfarani, F., Schietroma, C., Puddu, P., and
Zambruno, G. (2000).Placenta growth factor is induced in human keratinocytes
during wound healing.J. Invest.Dermatol.115,388–395
22. Green, C. J., Lichtlen, P., Huynh, N. T., Yanovsky, M., Laderoute, K. R.,
Schaffner, W., and Murphy, B. J. (2001). Placenta growth factor gene
expression is induced by hypoxia in fibroblasts: a central role for metal
transcription factor-1.Cancer Res.61,2696–2703
23. Larcher, F., Franco, M., Bolontrade, M., Rodriguez-Puebla, M., Casanova,
L., Navarro, M., Yancopoulos, G., Jorcano, J. L., and Conti, C. J. (2003).
Modulation of the angiogenesis response through Ha-ras control, placenta
growth factor, and angiopoietin expression in mouse skin carcinogenesis.Mol.
Carcinog.37,83–90.
24. Carmeliet, P., De Smet, F., Loges, S., and Mazzone, M. (2009).
Branching morphogenesis and antiangiogenesis candidates: tip cells lead the
way.Nat. Rev. Clin. Oncol.6,315–326
25. Li, B., Sharpe, E. E., Maupin, A. B., Teleron, A. A., Pyle, A. L., Carmeliet,
P., and Young, P. P. (2006). VEGF and PlGF promote adult vasculogenesis by
enhancing EPC recruitment and vessel formation at the site of tumor
neovascularization.FASEB J.20,1495–1497.
26. Hicklin, D. J., and Ellis, L. M. (2005). Role of the vascular endothelial
growth factor pathway in tumor growth and angiogenesis.J. Clin.
Oncol.23,1011–1027
27. Podar, K., and Anderson, K. C. (2005). The pathophysiologic role of
VEGF in hematologic malignancies: therapeutic implications.Blood105,1383–
1395.
28. Youssoufian, H., Hicklin, D. J., and Rowinsky, E. K. (2007). Review:
monoclonal antibodies to the vascular endothelial growth factor receptor-2 in
cancer therapy. Clin. Cancer Res.13, 5544s–5548s.
27
29. Calvani, M., Rapisarda, A., Uranchimeg, B., Shoemaker, R. H., and
Melillo, G. (2006). Hypoxic induction of an HIF-1alpha-dependent bFGF
autocrine loop drives angiogenesis in human endothelial cells.Blood107,2705–
2712.
30. Waldner,M.J.,Wirtz,S.,Jefremow,A.,Warntjen,M.,Neufert,C.,Atreya,R.,Bec
ker,C., Weigmann, B., Vieth, M., Rose-John, S., and Neurath, M. F. (2010).
VEGF receptor signaling links inflammation and tumorigenesis in colitis-
associated cancer.J. Exp. Med.207,2855–2868
31. Albuquerque, R. J. C., Hayashi, T., Cho, W. G., Kleinman, M. E., Dridi, S.,
Takeda, A., Baffi, J. Z., Yamada, K., Kaneko, H., Green, M. G., Chappell, J.,
Wilting, J.,et al. (2009). Alternatively spliced vascular endothelial growth factor
receptor-2 is an essential endogenous inhibitor of lymphatic vessel growth.Nat.
Med.15,1023–1030
32. Becker, J., Pavlakovic, H., Ludewig, F., Wilting, F., Weich, H. A.,
Albuquerque, R., Ambati, J., and Wilting, J. (2010). Neuroblastoma progression
correlates with downregulation of the lymphangiogenesis inhibitor sVEGFR-
2.Clin. Cancer Res.16,1431–1441
33. Petrova, T. V., Bono, P., Holnthoner, W., Chesnes, J., Pytowski, B.,
Sihto, H., Laakkonen, P., Heikkila, P., Joensuu, H., and Alitalo, K. (2008).
VEGFR-3 expression is restricted to blood and lymphatic vessels in solid
tumors.Cancer Cell13,554–556
34. Laakkonen, P., Waltari, M., Holopainen, T., Takahashi, T., Pytowski, B.,
Steiner, P., Hicklin, D., Persaud, K., Tonra, J. R., Witte, L., and Alitalo, K.
(2007). Vascular endothelial growth factor receptor 3 is involved in tumor
angiogenesis and growth.Cancer Res.67,593–599
35. He, Y., Rajantie, I., Ilmonen, M., Makinen, T., Karkkainen, M. J., Haiko,
P., Salven, P., and Alitalo, K. (2004). Preexisting lymphatic endothelium but not
endothelial progenitor cells are essential for tumor lymphangiogenesis and
lymphatic metastasis. Cancer Res. 64, 3737–3740.
36. Achen, M. G., and Stacker, S. A. (2008). Targeting tumor stroma.Curr.
Cancer Drug Targets8, 446
28
37. He, Y., Rajantie, I., Pajusola, K., Jeltsch, M., Holopainen, T., Yla-
Herttuala, S., Harding, T., Jooss, K., Takahashi, T., and Alitalo, K. (2005).
Vascular endothelial cell growth factor receptor 3-mediated activation of
lymphatic endothelium is crucial for tumor cell entry and spread via lymphatic
vessels.Cancer Res.65,4739–4746
38. Gerber HP, Ferrara N. Pharmacology and pharmacodynamics of
bevacizumab as monotherapy or in combination with cytotoxic therapy in
preclinical studies. Cancer Res. 2005;65:671–680.
39. Sandler A, Gray R, Perry MC, Brahmer J, Schiller JH, Dowlati A,
Lilenbaum R, Johnson DH. Paclitaxel-carboplatin alone or with bevacizumab for
non-small-cell lung cancer. N Engl J Med. 2006;355:2542–2550.
40. Miles DW, Chan A, Dirix LY, Cortes J, Pivot X, Tomczak P, Delozier T,
Sohn JH, Provencher L, Puglisi F, Harbeck N, Steger GG, Schneeweiss A,
Wardley AM, Chlistalla A, Romieu G. Phase III study of bevacizumab plus
docetaxel compared with placebo plus docetaxel for the first-line treatment of
human epidermal growth factor receptor 2-negative metastatic breast cancer.
J. Clin. Oncol. 2010;28:3239–3247.
41. Robert NJ, Dieras V, Glaspy J, Brufsky AM, Bondarenko I, Lipatov ON,
Perez EA, Yardley DA, Chan SY, Zhou X, Phan SC, O'Shaughnessy J. RIBBON-1:
randomized, double-blind, placebo-controlled, phase III trial of chemotherapy
with or without bevacizumab for first-line treatment of human epidermal
growth factor receptor 2-negative, locally recurrent or metastatic breast cancer.
J. Clin. Oncol. 2011;29:1252–1260.
42. Miller K, Wang M, Gralow J, Dickler M, Cobleigh M, Perez EA, Shenkier T,
Cella D, Davidson NE. Paclitaxel plus bevacizumab versus paclitaxel alone for
metastatic breast cancer. N Engl J Med. 2007;357:2666–2676.
43. Valachis A, Polyzos NP, Patsopoulos NA, Georgoulias V, Mavroudis D,
Mauri D. Bevacizumab in metastatic breast cancer: a meta-analysis of
randomized controlled trials. Breast Cancer Res Treat. 2010;122:1–7.
44. Pivot X, Schneeweiss A, Verma S, Thomssen C, Passos-Coelho JL,
Benedetti G, Ciruelos E, von Moos R, Chang HT, Duenne AA, Miles DW. Efficacy
29
and safety of bevacizumab in combination with docetaxel for the first-line
treatment of elderly patients with locally recurrent or metastatic breast cancer:
Results from AVADO. Eur J Cancer. 2011;47:2387–2395.
45. Vach W, Høilund-Carlsen PF, Fischer BM, Gerke O, Weber W. How to
study optimal timing of PET/CT for monitoring of cancer treatment. Am J Nucl
Med Mol Imaging. 2011;1:54–62.
46. Rakheja R, Ciarallo A, Alabed YZ, Hickeson M. Intravenous
administration of diazepam significantly reduces brown fat activity on 18F-FDG
PET/CT. Am J Nucl Med Mol Imaging. 2011;1:29–35.
47. Eary JF, Hawkins DS, Rodler ET, Conrad EUI. 18F-FDG PET in sarcoma
treatment response imaging. Am J Nucl Med Mol Imaging. 2011;1:47–53.
48. Iagaru A. 18F-FDG PET/CT: timing for evaluation of response to therapy
remains a clinical challenge. Am J Nucl Med Mol Imaging. 2011;1:63–64.
49. Mendel DB, Schreck RE, West DC, Li G, Strawn LM, Tanciongco SS, et al.
The angiogenesis inhibitor SU5416 has long-lasting effects on vascular
endothelial growth factor receptor phosphorylation and function. Clin Cancer
Res2000;6:4848–58.
50. Laird AD, Vajkoczy P, Shawver LK, Thurnher A, Liang C, Mohammadi M,
et al. SU6668 is a potent antiangiogenic and antitumor agent that induces
regression of established tumors. Cancer Res 2000;60:4152–60.
51. Wedge SR, Ogilvie DJ, Dukes M, Kendrew J, Curwen JO, Hennequin LF,
et al. ZD4190: an orally active inhibitor of vascular endothelial growth factor
signaling with broad-spectrum antitumor efficacy. Cancer Res 2000;60:970–5.
52. Drevs J, Hofmann I, Hugenschmidt H, Wittig C, Madjar H, Muller M, et
al. Effects of PTK787/ZK 222584, a specific inhibitor of vascular endothelial
growth factor receptor tyrosine kinases, on primary tumor, metastasis, vessel
density, and blood flow in a murine renal cell carcinoma model. Cancer
Res2000;60:4819–24.
53. Davidoff AM, Leary MA, Ng CY, Vanin EF. Gene therapy-mediated
expression by tumor cells of the angiogenesis inhibitor flk-1 results in inhibition
of neuroblastoma growth in vivo. J Pediatr Surg 2001;36:30–6.
30
54. Klement, G. et al. Continuous low-dose therapy with vinblastine and
VEGF receptor-2 antibody induces sustained tumor regression without overt
toxicity. J. Clin. Invest. 105, R15–R24 (2000).
55. Lee, C. G. et al. Anti-vascular endothelial growth factor treatment
augments tumor radiation response under normoxic or hypoxic conditions.
Cancer Res. 60, 5565–5570 (2000)
56. Kozin, S. V. et al. Vascular endothelial growth factor receptor-2-blocking
antibody potentiates radiation-induced long-term control of human tumor
xenografts. Cancer Res. 61, 39–44 (2001).
57. Jain, R. K. Normalizing tumor vasculature with antiangiogenic therapy: a
new paradigm for combination therapy. Nature Med. 7, 987–989 (2001)
58. Yuan, F. et al. Time-dependent vascular regression and permeability
changes in established human tumor xenografts induced by an anti-vascular
endothelial growth factor/vascular permeability factor antibody. Proc. Natl
Acad. Sci. USA 93, 14765–14770 (1996)
59. Pham, C. D. et al. Magnetic resonance imaging detects suppression of
tumor vascular permeability after administration of antibody to vascular
endothelial growth factor. Cancer Invest. 16, 225–230 (1998)
60. Willett, C. G. et al. Direct evidence that the VEGF-specific antibody
bevacizumab has antivascular effects in human rectal cancer. Nature Med. 10,
145–147 (2004).
61. Hurwitz, H., Fehrenbacher, L., Novotny, W., Cartwright, T., Hainsworth,
J., Heim, W., Berlin, J., Baron, A., Griffing, S., Holmgren, E., Ferrara, N., Fyfe,
G.,et al. (2004). Bevacizumab plus irinotecan, fluorouracil, and leucovorin for
metastatic colorectal cancer.N. Engl. J. Med.350,2335–2342
62. Escudier, B., Bellmunt, J., Negrier, S., Bajetta, E., Melichar, B., Bracarda,
S., Ravaud, A., Golding, S., Jethwa, S., and Sneller, V. (2010). Phase III trial of
bevacizumab plus interferon alfa-2a in patients with metastatic renal cell
carcinoma (AVOREN): final analysis of overall survival.J. Clin. Oncol.28,2144–
2150
31
63. Friedman, H. S., Prados, M. D., Wen, P. Y., Mikkelsen, T., Schiff, D.,
Abrey, L. E., Yung, W. K. A., Paleologos, N., Nicholas, M. K., Jensen, R.,
Vredenburgh, J., Huang, J., et al. (2009). Bevacizumab alone and in
combination with irinotecan in recurrent glioblastoma.J. Clin. Oncol.27,4733–
4740.
64. Kreisl, T. N., Kim, L., Moore, K., Duic, P., Royce, C., Stroud, I., Garren,
N., Mackey, M., Butman, J. A., Camphausen, K., Park, J., Albert, P. S.,et al.
(2009). Phase II trial of singleagent bevacizumab followed by bevacizumab plus
irinotecan at tumor progression in recurrent glioblastoma.J. Clin. Oncol.27,740–
745
65. Rini, B. I., Halabi, S., Rosenberg, J. E., Stadler, W. M., Vaena, D. A., Ou,
S. S., Archer, L., Atkins, J. N., Picus, J., Czaykowski, P., Dutcher, J., and Small,
E. J. (2008). Bevacizumab plus interferon alfa compared with interferon alfa
monotherapy in patients with metastatic renal cell carcinoma: CALGB 90206. J.
Clin. Oncol.26,5422–5428.
66. Sandler, A., Gray, R., Perry, M. C., Brahmer, J., Schiller, J. H., Dowlati,
A., Lilenbaum, R., and Johnson, D. H. (2006). Paclitaxel-carboplatin alone or
with bevacizumab for non-small-cell lung cancer.N. Engl. J. Med.355,2542–
2550
67. Yang, J. C., Haworth, L., Sherry, R. M., Hwu, P., Schwartzentruber, D. J.,
Topalian, S. L., Steinberg, S. M., Chen, H. X., and Rosenberg, S. A. (2003). A
randomized trial of bevacizumab, an anti-vascular endothelial growth factor
antibody, for metastatic renal cancer. N. Engl. J. Med.349,427–434
68. Van Meter, M. E., and Kim, E. S. (2010). Bevacizumab: current updates
in treatment.Curr. Opin. Oncol.22,586–591.
69. Keunen, O., Johansson, M., Oudin, A., Sanzey, M., Rahim, S. A., Fack,
F., Thorsen, F., Taxt, T., Bartos, M., Jirik, R., Miletic, H., Wang, J.,et al. (2011).
Anti-VEGF treatment reduces blood supply and increases tumor cell invasion in
glioblastoma.Proc. Natl. Acad. Sci. USA108, 3749–3754.
70. Bruns, C. J., Shrader, M., Harbison, M. T., Portera, C., Solorzano, C. C.,
Jauch, K. W., Hicklin, D. J., Radinsky, R., and Ellis, L. M. (2002). Effect of the
32
vascular endothelial growth factor receptor-2 antibody DC101 plus gemcitabine
on growth, metastasis and angiogenesis of human pancreatic cancer growing
orthotopically in nude mice.Int. J. Cancer 102, 101–108.
71. Prewett, M., Huber, J., Li, Y., Santiago, A., O’Connor, W., King, K.,
Overholser, J., Hooper, A., Pytowski, B., Witte, L., Bohlen, P., and Hicklin, D. J.
(1999). Antivascular endothelial growth factor receptor (fetal liver kinase 1)
monoclonal antibody inhibits tumor angiogenesis and growth of several mouse
and human tumors.Cancer Res.59,5209–5218.
72. Shaheen, R. M., Tseng, W. W., Vellagas, R., Liu, W., Ahmad, S. A., Jung,
Y. D., Reinmuth, N., Drazan, K. E., Bucana, C. D., Hicklin, D. J., and Ellis, L. M.
(2001). Effects of an antibody to vascular endothelial growth factor receptor-2
on survival, tumor vascularity, and apoptosis in a murine model of colon
carcinomatosis.Int. J. Oncol.18,221–226
73. Zhu, Z., Lu, D., Kotanides, H., Santiago, A., Jimenez, X., Simcox, T.,
Hicklin, D. J., Bohlen, P., and Witte, L. (1999). Inhibition of vascular endothelial
growth factor induced mitogenesis of human endothelial cells by a chimeric
anti-kinase insert domain-containing receptor antibody.Cancer Lett.136,203–
213.
74. Spratlin, J. (2011). Ramucirumab (IMC-1121B): monoclonal antibody
inhibition of vascular endothelial growth factor receptor-2.Curr. Oncol.
Rep.13,97–102
75. Demetri, G. D., van Oosterom, A. T., Garrett, C. R., Blackstein, M. E.,
Shah, M. H., Verweij, J., McArthur, G., Judson, I. R., Heinrich, M. C., Morgan, J.
A., Desai, J., Fletcher, C. D.,et al. (2006). Efficacy and safety of sunitinib in
patients with advanced gastrointestinal stromal tumour after failure of imatinib:
a randomised controlled trial.Lancet368,1329–1338
76. Motzer, R. J., Michaelson, M. D., Rosenberg, J., Bukowski, R. M., Curti,
B. D., George, D. J., Hudes, G. R., Redman, B. G., Margolin, K. A., and Wilding,
G. (2007). Sunitinib efficacy against advanced renal cell carcinoma.J.
Urol.178,1883–1887.
33
77. Escudier, B., Eisen, T., Stadler, W. M., Szczylik, C., Oudard, S.p., Siebels,
M., Negrier, S., Chevreau, C., Solska, E., Desai, A. A., Rolland, F.d.r., Demkow,
T.,et al. (2007). Sorafenib in advanced clear-cell renal-cell carcinoma.N. Engl. J.
Med.356,125–134.
78. Llovet, J. M., Ricci, S., Mazzaferro, V., Hilgard, P., Gane, E., Blanc, J. F.,
de Oliveira, A. C., Santoro, A., Raoul, J. L., Forner, A., Schwartz, M., Porta,
C.,et al. (2008). Sorafenib in advanced hepatocellular carcinoma.N. Engl. J.
Med.359,378–390
79. Gruber BL, Marchese MJ, Kew R. Angiogenic factors stimulate mast-cell
migration. Blood 1995;86:2488–93.
80. Thomas A, Morgan B, Drevs J, Jivan A, Buchert M, Horsfield M, et al.
Pharmacodynamic results using dynamic contrast enhanced magnetic
resonance imaging of 2 Phase 1 studies of the VEGF inhibitor PTK787/ZK
222584 in patients with liver metastases from colorectal cancer. Proc ASCO
2001;20.
81. Jain, R. K., Duda, D. G., Clark, J. W., and Loeffler, J. S. (2006). Lessons
from phase III clinical trials on anti-VEGF therapy for cancer.Nat. Clin. Pract.
Oncol.3,24–40
82. Burris, H., III, and Rocha-Lima, C. (2008). New therapeutic directions for
advanced pancreatic cancer: targeting the epidermal growth factor and
vascular endothelial growth factor pathways.Oncologist13,289–298.
83. Bergers, G., and Hanahan, D. (2008). Modes of resistance to anti-
angiogenic therapy.Nat. Rev. Cancer8,592–603
84. Ellis, L. M., and Hicklin, D. J. (2008a). Pathways mediating resistance to
vascular endothelial growth factor-targeted therapy.Clin. Cancer Res.14,6371–
6375
85. Kerbel, R. S. (2008). Tumor angiogenesis.N. Engl. J. Med.358,2039–
2049.
86. Shojaei, F., and Ferrara, N. (2008b). Role of the microenvironment in
tumor growth and in refractoriness/resistance to anti-angiogenic therapies.Drug
Resist. Updat.11,219–230.
34
87. Ferrara, N. Vascular endothelial growth factor: basic science and clinical
progress. Endocr. Rev. 25, 581–611 (2004)
88. Relf, M. et al. Expression of the angiogenic factors vascular endothelial
cell growth factor, acidic and basic fibroblast growth factor, tumor growth
factor β-1, platelet-derived endothelial cell growth factor, placenta growth
factor, and pleiotrophin in human primary breast cancer and its relation to
angiogenesis. Cancer Res. 57, 963–969 (1997)
89. Christofori, G., Naik, P. & Hanahan, D. Vascular endothelial growth factor
and its receptors, flt-1 and flk-1, are expressed in normal pancreatic islets and
throughout islet cell tumorigenesis. Mol. Endocrinol. 9, 1760–1770 (1995).
90. Inoue, M., Hager, J. H., Ferrara, N., Gerber, H. P. & Hanahan, D. VEGF-A
has a critical, nonredundant role in angiogenic switching and pancreatic βcell
carcinogenesis. Cancer Cell 1, 193–202 (2002).
91. Joyce, J. A. et al. Stage-specific vascular markers revealed by phage
display in a mouse model of pancreatic islet tumorigenesis. Cancer Cell 4, 393–
403 (2003).
92. Bergers, G., Javaherian, K., Lo, K. M., Folkman, J. & Hanahan, D. Effects
of angiogenesis inhibitors on multistage carcinogenesis in mice. Science 284,
808–812 (1999).
93. Bergers, G. et al. Matrix metalloproteinase-9 triggers the angiogenic
switch during carcinogenesis. Nature Cell Biol. 2, 737–744 (2000).
94. Bergers, G., Song, S., Meyer-Morse, N., Bergsland, E. & Hanahan, D.
Benefits of targeting both pericytes and endothelial cells in the tumor
vasculature with kinase inhibitors. J. Clin. Invest. 111, 1287–1295 (2003)
95. Slamon, D. J. et al. Use of chemotherapy plus a monoclonal antibody
against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J.
Med. 344, 783–792 (2001).
96. Hillan, K. J. et al. The role of VEGF expression in response to
bevacizumab plus capcitabine in metastatic breast cancer (MBC). J. Clin. Oncol.
21, 284S–284S (2003).
35
97. Jubb, A. M. et al. Impact of vascular endothelial growth factor-A
expression, thrombospondin-2 expression, and microvessel density on the
treatment effect of bevacizumab in metastatic colorectal cancer. J. Clin. Oncol.
24, 217–227 (2006)
98. Kuramochi, H. et al. Vascular endothelial growth factor messenger RNA
expression level is preserved in liver metastases compared with corresponding
primary colorectal cancer. Clin. Cancer Res. 12, 29–33 (2006)
99. Miller, J. C., Pien, H. H., Sahani, D., Sorensen, A. G. & Thrall, J. H.
Imaging angiogenesis: applications and potential for drug development. J. Natl
Cancer Inst.97, 172–187 (2005)
100. Jain RK, Munn LL, Fukumura D. Dissecting tumour pathophysiology
using intravital microscopy. Nat Rev Cancer 2002;2:266–76
101. Bergers G, Benjamin L. Tumorigenesis and the angiogenic switch. Nat
Rev Cancer 2003;3:401–10
102. McDonald D, Choyke P. Imaging of angiogenesis: from microscope to
clinic. Nat Med 2003;9:713–25
103. Rosen L. Antiangiogenic strategies and agents in clinical trials.
Oncologist 2000;5 Suppl 1:20–7
104. Davis DW, McConkey DJ, Abbruzzese JL, Herbst RS. Surrogate markers
in antiangiogenesis clinical trials. Br J Cancer 2003;89:8–14
105. Anderson H, Price P, Blomley M, Leach MO, Workman P. Measuring
changes in human tumour vasculature in response to therapy using functional
imaging techniques. Br J Cancer 2001;85:1085–93
106. Miles KA. Functional computed tomography in oncology. Eur J Cancer
2002;38:2079–84
107. Vach W, Høilund-Carlsen PF, Fischer BM, Gerke O, Weber W. How to
study optimal timing of PET/CT for monitoring of cancer treatment. Am J Nucl
Med Mol Imaging. 2011;1:54–62
108. Iagaru A. 18F-FDG PET/CT: timing for evaluation of response to therapy
remains a clinical challenge. Am J Nucl Med Mol Imaging. 2011;1:63–64
36
109. Nagengast WB, de Vries EG, Hospers GA, Mulder NH, de Jong JR,
Hollema H, Brouwers AH, van Dongen GA, Perk LR, Lub-de Hooge MN. In vivo
VEGF imaging with radiolabeled bevacizumab in a human ovarian tumor
xenograft. J Nucl Med. 2007;48:1313–1319
110. Nagengast WB, de Korte MA, Oude Munnink TH, Timmer-Bosscha H, den
Dunnen WF, Hollema H, de Jong JR, Jensen MR, Quadt C, Garcia-Echeverria C,
van Dongen GA, Lub-de Hooge MN, Schroder CP, de Vries EG. 89Zr-
bevacizumab PET of early antiangiogenic tumor response to treatment with
HSP90 inhibitor NVP-AUY922. J Nucl Med. 2010;51:761–767.
111. Christoforidis JB, Carlton MM, Knopp MV, Hinkle GH. PET/CT imaging of
I-124-radiolabeled bevacizumab and ranibizumab after intravitreal injection in a
rabbit model. Invest Ophthalmol Vis Sci. 2011;52:5899–5903
112. Nayak TK, Garmestani K, Baidoo KE, Milenic DE, Brechbiel MW. PET
imaging of tumor angiogenesis in mice with VEGF-A-targeted 86Y-CHX-A''-
DTPA-bevacizumab. Int J Cancer. 2011;128:920–926
113. Paudyal B, Paudyal P, Oriuchi N, Hanaoka H, Tominaga H, Endo K.
Positron emission tomography imaging and biodistribution of vascular
endothelial growth factor with 64Cu-labeled bevacizumab in colorectal cancer
xenografts. Cancer Sci.2011;102:117–121.
114. Stollman TH, Scheer MG, Leenders WP, Verrijp KC, Soede AC, Oyen WJ,
Ruers TJ, Boerman OC. Specific imaging of VEGF-A expression with
radiolabeled anti-VEGF monoclonal antibody. Int J Cancer. 2008;122:2310–
2314
115. Nagengast WB, Hooge MN, van Straten EM, Kruijff S, Brouwers AH, den
Dunnen WF, de Jong JR, Hollema H, Dierckx RA, Mulder NH, de Vries EG,
Hoekstra HJ, Hospers GA. VEGF-SPECT with 111In-bevacizumab in stage III/IV
melanoma patients.Eur J Cancer. 2011;47:1595–1602
116. Zhang L, Xu JS, Sanders VM, Letson AD, Roberts CJ, Xu RX.
Multifunctional microbubbles for image-guided antivascular endothelial growth
factor therapy. J Biomed Opt. 2010;15:030515
37
117. Withrow KP, Newman JR, Skipper JB, Gleysteen JP, Magnuson JS, Zinn
K, Rosenthal EL. Assessment of bevacizumab conjugated to Cy5.5 for detection
of head and neck cancer xenografts. Technol Cancer Res Treat. 2008;7:61–66
118. Terwisscha van Scheltinga AG, van Dam GM, Nagengast WB,
Ntziachristos V, Hollema H, Herek JL, Schroder CP, Kosterink JG, Lub-de Hoog
MN, de Vries EG. Intraoperative near-infrared fluorescence tumor imaging with
vascular endothelial growth factor and human epidermal growth factor receptor
2 targeting antibodies. J Nucl Med. 2011;52:1778–1785.
119. Chan C, Sandhu J, Guha A, Scollard DA, Wang J, Chen P, Bai K, Lee L,
Reilly RM. A human transferrin-vascular endothelial growth factor (hnTf-VEGF)
fusion protein containing an integrated binding site for 111In for imaging tumor
angiogenesis. J Nucl Med. 2005;46:1745–1752
120. Hao G, Hajibeigi A, De León-Rodríguez LM, Öz OK, Sun X. Peptoid-
based PET imaging of vascular endothelial growth factor receptor (VEGFR)
expression. Am J Nucl Med Mol Imaging. 2011;1:65–75
121. Collingridge DR, Carroll VA, Glaser M, Aboagye EO, Osman S, Hutchinson
OC, Barthel H, Luthra SK, Brady F, Bicknell R, Price P, Harris AL. The
development of [124I] iodinated-VG76e: a novel tracer for imaging vascular
endothelial growth factor in vivo using positron emission tomography. Cancer
Res. 2002;62:5912–5919
122. Jayson GC, Zweit J, Jackson A, Mulatero C, Julyan P, Ranson M,
Broughton L, Wagstaff J, Hakannson L, Groenewegen G, Bailey J, Smith N,
Hastings D, Lawrance J, Haroon H, Ward T, McGown AT, Tang M, Levitt D,
Marreaud S, Lehmann FF, Herold M, Zwierzina H. Molecular imaging and
biological evaluation of HuMV833 anti-VEGF antibody: implications for trial
design of antiangiogenic antibodies. J Natl Cancer Inst. 2002;94:1484–1493
123. Cai W, Chen X. Multimodality imaging of vascular endothelial growth
factor and vascular endothelial growth factor receptor expression. Front Biosci.
2007;12:4267–79.
124. Cai W, Hong H. Peptoid and positron emission tomography: an appealing
combination. Am J Nucl Med Mol Imaging. 2011;1:76–79.
38
125. Chan C, Sandhu J, Guha A, Scollard DA, Wang J, Chen P, Bai K, Lee L,
Reilly RM. A human transferrin-vascular endothelial growth factor (hnTf-VEGF)
fusion protein containing an integrated binding site for 111In for imaging tumor
angiogenesis. J Nucl Med. 2005;46:1745–52.
126. Backer MV, Levashova Z, Patel V, Jehning BT, Claffey K, Blankenberg FG,
Backer JM. Molecular imaging of VEGF receptors in angiogenic vasculature with
single-chain VEGF-based probes. Nat Med. 2007;13:504–9.
127. Blankenberg FG, Backer MV, Levashova Z, Patel V, Backer JM. In vivo
tumor angiogenesis imaging with site-specific labeled 99mTc-HYNIC-VEGF. Eur J
Nucl Med Mol Imaging. 2006;33:841–8.
128. Li S, Peck-Radosavljevic M, Kienast O, Preitfellner J, Havlik E, Schima W,
Traub-Weidinger T, Graf S, Beheshti M, Schmid M, Angelberger P, Dudczak R.
Iodine-123-vascular endothelial growth factor-165 (123I-VEGF165).
Biodistribution, safety and radiation dosimetry in patients with pancreatic
carcinoma. Q J Nucl Med Mol Imaging.2004;48:198–206.
129. Cai W, Chen K, Mohamedali KA, Cao Q, Gambhir SS, Rosenblum MG,
Chen X. PET of vascular endothelial growth factor receptor expression. J Nucl
Med.2006;47:2048–56.
130. Wang H, Cai W, Chen K, Li ZB, Kashefi A, He L, Chen X. A new PET
tracer specific for vascular endothelial growth factor receptor 2. Eur J Nucl Med
Mol Imaging.2007;34:2001–10.
131. Hsu AR, Cai W, Veeravagu A, Mohamedali KA, Chen K, Kim S, Vogel H,
Hou LC, Tse V, Rosenblum MG, Chen X. Multimodality molecular imaging of
glioblastoma growth inhibition with vasculature-targeting fusion toxin
VEGF121/rGel. J Nucl Med.2007;48:445–54.
132. Eder M, Krivoshein AV, Backer M, Backer JM, Haberkorn U, Eisenhut M.
ScVEGF-PEG-HBED-CC and scVEGF-PEG-NOTA conjugates: comparison of easy-
to-label recombinant proteins for [68Ga]PET imaging of VEGF receptors in
angiogenic vasculature. Nucl Med Biol. 2010;37:405–12.
39
133. Wang H, Gao H, Guo N, Niu G, Ma Y, Kiesewetter DO, Chen X. Site-
Specific Labeling of scVEGF with Fluorine-18 for Positron Emission Tomography
Imaging.Theranostics. 2012;2:607–617.
134. De Leon-Rodriguez LM, Lubag A, Udugamasooriya DG, Proneth B,
Brekken RA, Sun X, Kodadek T, Dean Sherry A. MRI detection of VEGFR2 in
vivo using a low molecular weight peptoid-(Gd)8-dendron for targeting. J Am
Chem Soc.2010;132:12829–31.
135. Willmann JK, Paulmurugan R, Chen K, Gheysens O, Rodriguez-Porcel M,
Lutz AM, Chen IY, Chen X, Gambhir SS. US imaging of tumor angiogenesis with
microbubbles targeted to vascular endothelial growth factor receptor type 2 in
mice. Radiology.2008;246:508–18.
136. Backer MV, Backer JM. Imaging key biomarkers of tumor angiogenesis.
Theranostics. 2012;2:502–15
137. Nagengast WB, de Vries EG, Hospers GA, Mulder NH, de Jong JR,
Hollema H, Brouwers AH, van Dongen GA, Perk LR, Lub-de Hooge MN. In vivo
VEGF imaging with radiolabeled bevacizumab in a human ovarian tumor
xenograft. J Nucl Med.2007;48:1313–9.
138. Stollman TH, Scheer MG, Leenders WP, Verrijp KC, Soede AC, Oyen WJ,
Ruers TJ, Boerman OC. Specific imaging of VEGF-A expression with
radiolabeled anti-VEGF monoclonal antibody. Int J Cancer. 2008
139. Helisch A, Forster GJ, Reber H, Buchholz HG, Arnold R, Goke B, Weber
MM, Wiedenmann B, Pauwels S, Haus U, Bouterfa H, Bartenstein P. Pre-
therapeutic dosimetry and biodistribution of 86Y-DOTA-Phe1-Tyr3-octreotide
versus 111In-pentetreotide in patients with advanced neuroendocrine
tumours. Eur J Nucl Med Mol Imaging. 2004;31:1386–92.
140. Scheer MG, Stollman TH, Boerman OC, Verrijp K, Sweep FC, Leenders
WP, Ruers TJ, Oyen WJ. Imaging liver metastases of colorectal cancer patients
with radiolabelled bevacizumab: Lack of correlation with VEGF-A
expression. Eur J Cancer.2008;44:1835–40.
40
141. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM Estimates of
worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J
Cancer.2010;127:2893–2917.
142. Vogl G, Bartel H, Dietze O, Hauser-Kronberger C. HER2 is unlikely to be
involved in directly regulating angiogenesis in human breast cancer. Appl
Immunohistochem Mol Morphol. 2006;14:138–145.
143. Kostopoulos I, Arapantoni-Dadioti P, Gogas H, et al. Evaluation of the
prognostic value of HER-2 and VEGF in breast cancer patients participating in a
randomized study with dose-dense sequential adjuvant chemotherapy. Breast
Cancer Res Treat. 2006;96:251–261
144. Fuckar D, Dekanic A, Stifter S, et al. VEGF expression is associated with
negative estrogen receptor status in patients with breast cancer. Int J Surg
Pathol. 2006;14:49–55.
145. Liu Y, Tamimi RM, Collins LC, et al. The association between vascular
endothelial growth factor expression in invasive breast cancer and survival
varies with intrinsic subtypes and use of adjuvant systemic therapy: results
from the Nurses’ Health Study. Breast Cancer Res Treat. 2011;129:175–184.
146. Nagengast WB, de Vries EG, Hospers GA, et al. In vivo VEGF imaging
with radiolabeled bevacizumab in a human ovarian tumor xenograft. J Nucl
Med. 2007;48:1313–1319.
147. Nagengast WB, de Korte MA, Oude Munnink TH, et al. 89Zr-
bevacizumab PET of early antiangiogenic tumor response to treatment with
HSP90 inhibitor NVP-AUY922. J Nucl Med. 2010;51:761–767.
148. Oosting SF, Brouwers AH, Van Es SC, et al. 89Zr-bevacizumab PET
imaging in metastatic renal cell carcinoma patients before and during
antiangiogenic treatment. J Clin Oncol. 2012;30(suppl): abstract 10581.
149. Bluff JE, Menakuru SR, Cross SS, et al. Angiogenesis is associated with
the onset of hyperplasia in human ductal breast disease. Br J Cancer.
2009;101:666–672.
150. Helisch A, Forster GJ, Reber H, Buchholz HG, Arnold R, Goke B, Weber
MM, Wiedenmann B, Pauwels S, Haus U, Bouterfa H, Bartenstein P. Pre-
41
therapeutic dosimetry and biodistribution of 86Y-DOTA-Phe1-Tyr3-octreotide
versus 111In-pentetreotide in patients with advanced neuroendocrine tumours.
Eur J Nucl Med Mol Imaging. 2004;31:1386–92
151. Perk LR, Visser OJ, Stigter-van Walsum M, Vosjan MJ, Visser GW,
Zijlstra JM, Huijgens PC, van Dongen GA. Preparation and evaluation of (89)Zr-
Zevalin for monitoring of (90)Y-Zevalin biodistribution with positron emission
tomography. Eur J Nucl Med Mol Imaging. 2006;33:1337–45
152. Liu X, Laforest R. Quantitative small animal PET imaging with
nonconventional nuclides. Nucl Med Biol. 2009;36:551–9
153. Herzog H, Tellmann L, Scholten B, Coenen HH, Qaim SM. PET imaging
problems with the non-standard positron emitters Yttrium-86 and Iodine-124. Q
J Nucl Med Mol Imaging. 2008;52:159–65.
154. Buchholz HG, Herzog H, Forster GJ, Reber H, Nickel O, Rosch F,
Bartenstein P. PET imaging with yttrium-86: comparison of phantom
measurements acquired with different PET scanners before and after applying
background subtraction. Eur J Nucl Med Mol Imaging. 2003;30:716–20
155. Palm S, Enmon RM, Jr, Matei C, Kolbert KS, Xu S, Zanzonico PB, Finn
RL, Koutcher JA, Larson SM, Sgouros G. Pharmacokinetics and Biodistribution of
(86)Y-Trastuzumab for (90)Y dosimetry in an ovarian carcinoma model:
correlative MicroPET and MRI. J Nucl Med. 2003;44:1148–55
156. Nayak TK1, Garmestani K, Baidoo KE, Milenic DE, Brechbiel MW. PET
imaging of tumor angiogenesis in mice with VEGF-A-targeted (86)Y-CHX-A″-
DTPA-bevacizumab. Int J Cancer. 2011 Feb 15;128(4):920-6.
157. O’Connor MK, Li H, Rhodes DJ, Hruska CB, Clancy CB, Vetter RJ.
Comparison of radiation exposure and associated radiation-induced cancer risks
from mammography and molecular imaging of the breast. Med Phys.
2010;37:6187–6198.
158. de Jong JR, Warnders FJ, Nagengast WB, et al. Radiation dosimetry of
111In-bevacizumab for VEGF-SPECT in melanoma patients. Eur J Nucl Med Mol
Imaging. 2010;37(suppl):S477–S477.
42
159. Börjesson PK, Jauw YW, de Bree R, et al. Radiation dosimetry of 89Zr-
labeled chimeric monoclonal antibody U36 as used for immuno-PET in head and
neck cancer patients. J Nucl Med. 2009;50:1828–1836
160. Murano T, Minamimoto R, Senda M, et al. Radiation exposure and risk-
benefit analysis in cancer screening using FDG-PET: results of a Japanese
nationwide survey. Ann Nucl Med. 2011;25:657–666.
161. Gaykema SB1, Brouwers AH, Lub-de Hooge MN, Pleijhuis RG, Timmer-
Bosscha H, Pot L, van Dam GM, van der Meulen SB, de Jong JR, Bart J, de
Vries J, Jansen L, de Vries EG, Schröder CP. 89Zr-bevacizumab PET imaging in
primary breast cancer. J Nucl Med. 2013 Jul; 54:1014-8.
43
FIGURE 1. Coronal CT image (A) with clear subcutaneous localization of SKOV-
3 tumor (arrow). Fusion of microPET and CT images (B) (168 h after injection)
enables adequate quantitative measurement of 89Zr-bevacizumab in the tumor.
FROM: J Nucl Med. 2007;48:1313-1319
FIGURE 2. Coronal planes of microPET images 24 h (A), 72 h (B), and 168 h
(C) after injection of 89Zr-bevacizumab. At 24 h, most uptake is in well-perfused
organs. In time, relative uptake in the tumor (arrow) increases.
FROM: J Nucl Med. 2007;48:1313-1319
44
FIGURE 3. (A) In-111-bevacizumab scan: Scintigraphic imaging of a liver
metastasis with In-111-bevacizumab. (B) 4-phase CT scan: Imaging of liver
metastasis. (C) PET/CT scan: Combined FDG-PET scan and CT scan of the liver
lesion. FROM: European Journal of Cancer. 2008;44:1835-1840
FIGURE 4. IHC analysis. Expression of VEGFR1 in mouse subcutaneous tissue
implanted and colonized by human HT 29 colon carcinoma cells. VEGFR1
appears heterogeneously distributed between tumor cells. (10x, boxed area:
20x).
45
FIGURE 5. IHC analysis. Expression of VEGFR2 in mouse subcutaneous tissue
implanted and colonized by human HT-29 colon carcinoma cells (10x). VEGFR2
immunoreactivity is present between tumor cells and it is particularly expressed
in the wall of the blood vessels. (boxed area: 40x)
FIGURE 6. Immunohistochemical staining for VEGF-A in human glioblastoma (GBM) in a 7-year old patient. Numerous tumor cells show strong cytoplasmic staining for VEGF-A. Human GBM stem-like cells (giant multinucleated cells proliferating) form three typical rings (GBSCs). (40x)
46
FIGURE 7. Immunohistochemical staining for VEGF-A in a case of
nasopharyngeal angiofibroma (age of patient: 14 years). Marked
immunoreactivity is visible in the fibrous tissue and in pathological vessels. IHC
for VEGF demonstrates expression in more than 50% of stromal cells (boxed
area: 40x).
47
Chapter 2
Immunohistochemical profile of
neurotrophins in Human Cranial Dura
Mater and Meningiomas
M. Artico, E. Bronzetti*, E. Pompili*, B. Ionta ,
V. Alicino, A. D'Ambrosio*, A. Santoro§,
F.S. Pastore°, I. Elenkov* and L. Fumagalli*
Department of Otorhinolaringology, Audiology and Phoniatry “G. Ferreri",
*Department of Cardiovascular and Respiratory Sciences, Section of
Experimental Morphology,
§Department of Neurological Sciences, Neurosurgery, University of Rome "La
Sapienza", °Division of Neurosurgery, University of Rome "Tor Vergata", Rome,
Italy
Oncology Reports 2009; 21 (6): 1373-1380
Key words: neurotrophins (NTs) - human - dura mater -
immunohistochemistry – meningioma
48
Abstract
The immunohistochemical profile of neurotrophins and their receptors in the
human cranial dura mater was studied by examining some dural zones in
specimens harvested from different regions (frontal, temporal, parietal and
occipital). Dural specimens were obtained (pending the informed written
consent of the patients) during neurosurgical operations performed in ten
patients for surgical treatment of intracranial lesions (meningiomas, traumas,
gliomas, vascular malformations). The dural fragments were taken in the area
of the craniotomy at least 8 centimeters from the lesion as well as in the area
in which the meningioma had its the dural attachment. Immunohistochemical
characterization and distribution of neurotrophins, with their receptors, were
analyzed and discussed. The concrete role played by these neurotrophic factors
in general regulation, vascular permeability, algic responsivity and release of
locally active substances in the human dura mater is still controversial. Our
study revealed a general structural alteration of dural tissue due to the strong
invasivity of meningiomatous lesions, together with an improved expression of
BDNF in highly proliferating neoplastic cells and an evident production of NGF
in inflammatory cells, suggesting that BDNF has a role in supporting the
proliferation rate of neoplastic cells, while NGF is envolved in the activation of a
chronic inflammatory response in neoplastic areas.
Introduction
Meningiomas are the most common benign intracranial tumors but some
meningiomas show malignancy with invasion into the surrounding structures,
as well as a high recurrence rate and extracranial metastases (1). Meningiomas
arise from arachnoidal cells, most of which lie in close proximity to the venous
sinuses: in fact, this is the most common site for meningioma formation. They
49
are most frequently attached to the dura mater over the superior parasagittal
surface of the frontal and parietal lobes, along the sphenoid ridge, in the
olfactory grooves, the Sylvian region, superior cerebellum along the falx
cerebri, cerebellopontine angle, and spinal cord. The tumor is usually well-
circumscribed, with the base lying on the dura mater.
Histologically, the cells are relatively uniform, with a tendency to form highly-
circumscribed whorls and to generally disrupt the distribution and the structure
of collagen fibers (main component of dural tissue) and to originate
“psammoma bodies” (laminated concretions) which can calcify, and are often
strongly vascularized.
The remarkable proliferation rate and vascularisation which determine a rapid
replacement of normal dural tissue by the neoplastic cells, is regulated by
several different growth factors, such as NGF related to an increased activation
of the inflammatory cells at the beginning of the neoplastic invasion, and BDNF,
involved in the increased activation of the tumoral cells.
Neurotrophins (NTs), also known as neurotrophic factors, constitute a family of
dimeric proteins working as polypeptidic growth factors and acting like
extracellular ligands. NTs , including NGF (Levi-Montalcini , 1952), BDNF, NT-3,
NT-4, are involved in vertebrate neuronal cell development, differentiation,
survival and functional activities.
Neurotrophins are also involved in the modulation of adult central nervous
system functions and organization, as well as in the neural control of different
activities related to vegetative innervation of several organs (2-6). A definite
role of NTs in the dural and leptomeningeal compartments is not well
ascertained but a previous study on the expression of mRNAs for NTs revealed
high levels of NT3 and NGF in the normal rat dura mater (7). Our observations
on the localization and possible roles in different non-neuronal tissues as
lymphoid, lung and prostate (8-11) encouraged us to persist in our
experimental investigations in order to find a possible involvement of NTs in
dura mater, both in physiological and pathological conditions (meningiomas).
50
In fact our study investigates the immunohistochemical localization of NTs and
their receptors both in the normal human cranial dura mater and in the dural
tissue close to the dural attachment of the meningiomatous mass, focusing on
a possible correlation between the dural distribution of these neurotrophic
factors and the physiopathological mechanisms involved in meningioma
development.
Materials and Methods
Patients
Neurosurgical operations were performed on ten adult patients (age range 30-
75 years) and 2 fragments (for each subject) of dura mater were obtained
from occipital (1 basal -posterior cranial fossa and 1 apical), frontal (1 basal -
anterior cranial fossa- and 1 apical -parasagittal-), parietal (1 parasagittal and 1
convexity), and temporal (1 basal -middle cranial fossa- and 1 apical-
corresponding with the dural area located at least 1 cm behind the temporal
crest ) regions.
The dural fragments were taken from the craniotomy area distant at least 8
centimeters from the lesion or in the areas close to the meningioma (four
meningotheliomatous-psammomatous and five transitional). Human dural
tissue was surgically removed and processed for immunohistochemical and RT-
PCR analysis. Experiments were performed in compliance with the Italian laws
and guidelines concerning the informed consent of the patients. The following
molecules were investigated: nerve growth factor (NGF), brain derived
neurotrophic factor (BDNF), NT-3, NT-4 and the neurotrophin receptors such as
tyrosine kinase A (TrKA), tyrosine kinase B (TrKB), tyrosine kinase C (TrKC) and
protein 75 (p75).
51
Immunohistochemistry
Small fragments of dural tissue were washed in PBS, fixed in 10 % formalin
and embedded in paraffin according to a standard procedure. Serial 10 m
thick sections were cut using a rotatory microtome, mounted on gelatin-coated
slides and processed for immunohistochemistry. To study the
immunolocalization of neurotrophins and their own receptors, the antibodies
used were: i) rabbit anti nerve growth factor (anti NGF) polyclonal antibody
(Santa Cruz, CA, U.S.A.). It displayed less than 1% cross-reactivity against
recombinant human NT-3, NT-4 and BDNF; ii) rabbit anti tyrosine kinase A (
anti TrKA) polyclonal antibody (Santa Cruz, CA, USA). It recognized an epitope
corresponding to aminoacids 763 to 777, mapping adjacent to the carboxy
terminus of human TrKA p140; iii) goat polyclonal antibody to human p75 NT
receptor (Santa Cruz, CA, U.S.A.). It recognized the amino acid sequence
mapping the carboxy terminus of the p75 NT receptor precursor of human
origin; iv) rabbit anti brain derived neurotrophic factor (anti-BDNF) polyclonal
antibody (Santa Cruz, CA, U.S.A.). It recognized the amino-terminal of mouse
BDNF; v) rabbit anti tyrosine kinase B (anti TrKB) polyclonal antibody (Santa
Cruz, CA, U.S.A.). It recognized an epitope corresponding to aminoacids 794 to
808 of mouse TrKB p145; vi) rabbit anti neurotrophin 3 (anti NT-3) polyclonal
antibody (Santa Cruz, CA, U.S.A.). It was raised against the amino-terminal of
mouse NT-3; vii) rabbit polyclonal anti tyrosine kinase C (anti TrKC) antibody
(Santa Cruz, CA, U.S.A.). It recognized an epitope corresponding to aminoacids
798 to 812 of porcine TrKC p140. The immunohistochemical recognition of
macrophages was performed using a mouse monoclonal anti human CD68
antibody (DakoCytomation, Denmark). Incubation with primary antibodies was
performed overnight at 4° C at a final concentration of 2-5 μg/ml. Optimal
antisera dilutions and incubation times were assessed in a series of preliminary
experiments. After exposure to the primary antibodies, slides were rinsed twice
in phosphate buffer and incubated (1 h and 30 min at room temperature) with
the appropriate secondary antibody conjugated to horseradish peroxidase
52
(HRP) (final dilution 1:100). The secondary antibody-HRP linked against rabbit
immunoglobulins was purchased from Boehringer (Boehringer Mannheim
GmbH, Mannheim, Germany), while secondary antibodies-HRP linked against
mouse and goat immunoglobulins were from Sigma (Sigma Chemicals Co, St
Louis, MO, USA). After a further wash with phosphate buffer, slides were
treated with 0.05% 3,3-diaminobenzidine and 0.1% H2O2. Finally, sections
were counterstained with Mayer's hematoxylin and observed by using a light
microscope. To block endogenous peroxidase activity, slides were pretreated
with 3 % H2O2, whereas the non-specific binding of immunoglobulins was
prevented by adding 3 % fetal calf serum to the incubation medium. Negative
control experiments were done: i) by omitting the primary antibody; ii) by
substituting the primary antibody with equivalent amount of non specific
immunoglobulins; iii) by pre-incubating the primary antibody with the specific
blocking peptide (antigen/antibody = 5 according to customer's instructions).
In preliminary experiments, immunohistochemistry was also performed on
frozen sections of human dural tissue. No differences were found in the
intensity or distribution of immunostaining using the two types of sections, but
microanatomical details were better preserved in paraffin-embedded material.
The intensity of immune reaction was assessed microdensitometrically by an
IAS 2000 image analyzer (Delta Sistemi, Rome, Italy) connected via a TV
camera to the microscope. The system was calibrated taking the background
obtained in sections exposed to non-immune serum as zero. Ten 100 μm2
areas were delineated in each section by a measuring diaphragm. Quantitative
data of the intensity of the immune staining were analyzed statistically by
analysis of variance (ANOVA) followed by Duncan's multiple range test as a
post hoc test. The parameters examined by quantitative analysis were: 1) the
dural regions from which the fragments were taken (A=basal region of the
cranial dura, B=apical region of the cranial dura); 2) examined zones (I = vasal
zone, strictly corresponding to vasal perimeter; II=perivasal zone,
corresponding to a ring 100 m in diameter around the vessel; III = dural or
53
intervasal zone, at least 50 m away from the nearest vessel boundary); 3)
distribution of the immunoreactivity. These values were transformed into a
single number expressed as conventional unit, including the standard deviation.
This number can be read on the display of the Quantimet 500 image analyzer.
RT-PCR
Total RNA was isolated from human dural tissue by using TRIzol reagent
(Invitrogen, Carlsbad, CA, USA) according to customer’s instructions. cDNA was
synthezised from 1 g total RNA in a final reaction volume of 20 l. Briefly, a
mixture of total RNA, oligo (dT), dNTP mix and DEPC-treated distilled water
was preincubated for 5 min at 65 °C; then SuperScript III reverse transcriptase
(200U), RNase Ribonuclease Inhibitor, DTT and buffer (250 mM Tris pH 8.3,
375 mM KCl, 15 mM MgCl2) were added to the mixture and incubation was
continued for 45 min at 50°C. Finally, Superscript III was disactivated by
heating for 15 min at 70° C. All reagents were from Invitrogen. Three to five l
of the resulting cDNA were amplified by polymerase chain reaction (PCR). Each
PCR tube contained the following reagents: 0.2 mM of both sense and
antisense primers, 3 to 5 ml template cDNA, 0.2 mM 4-dNTP mix (Invitrogen,
CA, U.S.A.), 2.5 U Platinum Taq DNA polymerase (Invitrogen, CA, U.S.A.) and
1X reaction buffer (Invitrogen, CA, U.S.A.). MgCl2 was added at a final
concentration of 1 mM for BDNF, NT3, TrKA and TrKB and at a final
concentration of 1.5 mM for NGF, TrKC and p75. The final volume was 50 ml.
The PCR primers used for amplifying neurotrophins and their receptors (M-
Medical, Florence, Italy) were: for NGF forward TCATCATCCCATCCCATCTT,
reverse CTTGACAAAGGTGTGAGTCG; for BDNF forward
AGCCTCCTCTGCTCTTTCTGCTGGA, reverse CTTTTGTCTATGCCCCTGCAGCCTT;
for NT3 forward TTTCTCGCTTATCTCCGTGGCATCC, reverse
GGCAGGGTGCTCTGGTAATTTTCCT; for NT4 forward GCTGTGGACTTGCGTGG,
reverse GCCCGCACATAGGACTG; for TrKA forward TCTTCACTGAGTTCCTGGAG,
reverse TTCTCCACCGGGTCTCCAGA; for TrKB forward
54
AAGACCCTGAAGGATGCCAG, reverse AGTAGTCAGTGCTGTACACG; for TrKC
forward GGAAAGGTCTTCCTGGCCGAGTGC, reverse
GCTTTCCATAGGTGAAGATCTCCC; for p75 forward TGGACAGCGTGACGTTCTCC,
reverse GATCTCCTCGCACTCGGCGT. The specificity of the primers was verified
by searching for every possible homology to cDNAs of unrelated known
proteins in the NCBI data base. PCR reaction consisted of incubation for 2 min
at 94° C followed by 30-35 cycles of incubation at 94° C for 30 sec, 56° C (for
NGF, NT4, TrKA and TrKB) or 62° C (for BDNF, NT3, p75 and TrKC) for 30 sec
and 72° C for 1 min. PCR products were separated by agarose gel
electrophoresis (Submarine Agarose Gel Unit, Hoefer, San Francisco, CA, USA)
and visualized using a digital gel documentation system (GelDoc 2000
System/Quantity One Software; Bio-Rad Laboratories, Hercules, CA, USA).
Results
Immunohistochemistry
Immunoreactivity for neurotrophins and their receptors has been observed both
in the normal dura mater and in the dural tissue close to the meningiomatous
area. The sections harvested from normal dura mater generally revealed a
marked immunoreactivity in the endothelium of the dural vessels, in collagene
fibers and in fibroblasts .
In fact, immunoreaction for NGF was clearly demonstrated in fibroblasts and
collagen fibers and also appeared to same degree in the endothelium of the
dural vessels (Fig.1A). In the same way TrkA immunoreactivity was strongly
marked in the dural vessel endothelium, in fibroblasts and collagen fibers
(Fig.1C). A moderate immunoreactivity for the p75NTR was demonstrated in
the dural vessel endothelium and weakly expressed in fibroblasts and collagene
fibers (Fig.1E). BDNF immunoreactivity was appreciable in the dural vessel
wall, in fibroblasts and collagen fibers (Fig.2A), and in the same compartments
we observed a reaction for TrkB (Fig.2C). Moderate immunoreactivity was
55
demonstrated for NT-3 and NT-4 in the previous compartments (Fig.3A,3C). On
the other hand, TrkC immunoreactivity was appreciable in the same areas
(Fig.3E ). Meningiomatous sections revealed a general structural alteration of
collagen fiber with compressed fibroblasts within the well-circumscribed whorls,
which completely replaced the normal dural tissue. We also observed an
evident immunoreaction in the dural vessel wall, in the aggregates of
fibroblasts/macrophages and in the whorls (vorticoid areas), which may calcify
in some histotypes, thus forming laminar concentrically arranged masses
named psammomatous bodies. The macrophage aggregates showed a strong
immunoreactivity for NGF and TrkA, while a moderate reaction was
demonstrated for blood vessel endothelium (Fig.1B,1D); P75NTR
immunoreactivity was, on the contrary, very weak in the same compartments
(Fig.1F). The neoplastic cells in the whorls showed a remarkable
immunoreactivity for BDNF and TrkB (Fig.2B,2D), thus confirming our previous
results in other neoplastic tissues, as lung and prostate (11, 12), in which we
demonstrated a significant role of BDNF in the increased proliferation rate of
neoplastic lesions. NT-3 was weak and NT-4 immunoreaction was moderate in
the neoplastic cells of the whorls (Fig.3B,3D), in the dural vessel wall and in
the macrophage aggregates. The same result was observed for TrkC and p75
(Fig.3F).
RT-PCR
RT-PCR analysis confirmed the findings of the immunohistochemical
investigation both in the normal dura and in the dural area close to
meningiomatous tissue. In fact, we observed a strong expression of specific
transcripts for BDNF and TrKB, moderate for NT-4 in the meningiomatous
tissue, and a relevant expression of NGF in the dura mater close to the tumor
lesion (Fig 4 ).
56
Discussion
Notwithstanding the common (mesodermal) origin of all the meninges there
are, in any case, relevant differences in the biological behaviour of the
leptomeninx (arachnoid and pia mater) and pachimeninx (dura mater). In fact,
only the leptomeninx contains the meningoblasts (cells responsible for the
genesis and the development of meningiomas).The dura mater does not play a
role in the onset of meningiomas (it only rarely developing other unusual
tumors such as some sarcomas) but often has close a relationship with the
meningiomatous lesions which are characterized by a close contiguity with the
pachimeninx itself, with the exception of those rare meningiomas without dural
attachment that are often intraventricular. These close relationships between
meningiomas and dura mater persuaded us to investigate the
immunohistochemical profile of neurotrophins in the normal dura and in the
dura adjacent to the meningiomatous lesion in order identify any differences in
the localization of neurotrophins in that compartments, and to demonstrate a
possible direct role in tumorigenesis and in the progression of these specific
neoplastic lesions. Numerous studies have stressed the relevance of the
morphological structure of dural innervation, in fact some interesting
investigations in rats (12-17) have focused on the peptidergic,
catecholaminergic and nitroxidergic innervation of dura mater encephali (18),
revealing a possible relationship with the etiopathogenesis of headache and
dural pain (13,15,19-20). The dura mater shows a high density of sympathetic
nerve fibers and an impressive population of mast cells, mainly perivascular. It
also receives significant sensory projections from the trigeminal system. The
presence of these three elements in the meningeal layer suggests a relevant
functional interaction between the nervous and the immune system, both
mediated by neurotrophic factors (6,13-14,20-21). It is well known that NGF
has an inflammatory role and its increase is directly related to inflammation and
diseases of the immune system (4,6,22), probably due to the direct action of
57
NGF on mast cells and sensory neurons, as proposed by Woolf et al. (19).
Interestingly, dura mater cells contain high levels of NGF and TrKC, and
moderate levels of BDNF and NT-4, suggesting that NGF is essential in
preserving the integrity of the mast cell/nerve unit (7). Neurotrophins (NTs) are
neurotrophic signalling polypeptides which include nerve growth factor (NGF),
brain derived growth factor (BDNF), neurotrophin-3 (NT-3), NT-4/5 and NT-6,
the latter apparently being specific for fish (2-3). The biological effects of NTs
are mediated by the binding with two families of membrane receptors, the high
affinity tyrosine kinase (TrK) and low affinity p75 receptor (p75NT receptor)
(2). The TrK family includes TrKA, TrKB and TrKC receptors, whereas p75NT
receptor belongs to the trans-membrane molecules serving as receptor for
tumor necrosis factor and cytokines (3). TrKA is specifically activated by NGF,
whereas TrKB and TrKC are primarily receptors for BDNF and NT-3 respectively
(3). The physiological role of NTs in the development, maintenance and
regeneration of the sympathetic and sensory nervous system has been well
established (23-25) and mainly NGF induces differentiation and decreases
growth rate in a variety of neoplastic cells from neurogenic and non neurogenic
origin (26-29). There is increasing evidence that NTs may act together with a
paracrine mechanism in the regulation of the functional activity of neuronal and
non-neuronal structures (30). We have investigated the possible role of NTs in
the physiopathology of dura diseases, especially in neoplastic lesions. NGF
showed an appreciable expression rate in the normal dura mater and in the
dural close to the meningiomatous tissue, but the distribution of this growth
factor and its high affinity receptor TrkA in the whorls (vorticoid areas)
appeared markedly different. In fact NGF and TrKA resulted markedly
expressed in macrophages, thus confirming their functional involvement in the
persistence of a chronic inflammatory condition in the tumoral lesion. BDNF
and TrKB were, on the contrary, strongly expressed in the vorticoid areas and
this finding suggests that they play a direct role in the development and
progression of the meningiomatous cells. NGF is found in many tissues and
cells including the brain, meninges, and cerebrospinal fluid (32), while BDNF is
58
expressed throughout the central nervous system as well as in the periphery,
mainly in sensory neurons expressing NGF receptors. Peripheral noxious stimuli,
such as trauma or inflammation, up-regulate NGF in the affected tissue, as well
as BDNF in the sensory ganglia. However , while NGF contributes specifically to
inflammation and neuropathic pain inducing the sensitization of peripheral
nociceptors, BDNF released within the central nervous system acts as role a
pain modulator contributing to the central sensitization, probably via the
activation of NMDA receptors (22). BDNF is directly produced by meningeal
cells (22,25,28,31-33) together with pro-inflammatory cytokines, reducing
cellular apoptosis (1,33) and promoting cellular survival in an autocrine or
paracrine manner in TrKB expressing human neuroblastoma (30,33-34). The
expression of p75 appeared moderate in the normal dura mater, but weak both
in the meningiomatous tissue and in the surrounding dural compartment,
because this receptor, as it is known in literature, is lost during tumor
progression (28). RT-PCR analysis has confirmed our immunohistochemical
observations: in fact, we have described a moderate expression of NGF and its
high-affinity receptor TrKA in normal dura mater, in the meningioma tissues
and in the surrounding dural compartments. This finding encouraged us to
believe in a direct role of NGF/TrKA in the maintenance of a chronic
inflammatory condition, necessary to the beginning and the consequent
progression of the neoplastic lesion. On the other hand, other neurotrophins
such as BDNF, its hifh-affinity TrKB and NT-4 were markedly expressed both in
the meningioma specimens and in the surrounding dural tissue. This finding
suggests a direct envolvement of BDNF/NT-4 in the development and
proliferation of the tumor cells (see Table I-II). The data described above
confirmed our previous experimental findings (8-11), hence improving our
knowledge about the role of the neurotrophins in the regulation of the
meningeal microenvironment, and their direct participation in the neoplastic
transformation and cellular survival, both essential aspects of the malignant
development.
59
Table I - Normal Dura Mater
Fibroblasts Collagen
Fibers
Macrophages Blood vessels
endothelium
NGF ++ ± + BDNF + - + NT-3 ± - ± NT-4 ± - ± TrKA + ± + TrKB ± - ± TrKC + - + P75NTR + - ±
Table II – Meningioma/Surrounding Dural Tissue
Fibroblasts
Collagen Fibers
Macrophages Vorticoid
areas
Blood vessels
endothelium
NGF ± ++ ± + BDNF ± ± ++ + NT-3 - ± +/++ ± NT-4 - ± +/++ ± TrKA ± + ± ± TrKB - ± ++ ± TrKC - ± + ± P75NTR - - ± ±
Table Legends: ±,weak immunoreactivity; +, moderate immunoreactivity;
++, strong immunoreactivity.
60
Fig.1. Micrographs of NGF immunostaining in normal human dura mater (A)
and in the transitional meningioma (B)/surrounding dural tissue, 40x. The
immunoreactivity for NGF is evident in close to proximity the blood vessels
endothelium (e), in fibroblasts (f) and collagen fibers (cf) in the normal dura
mater and in dural tissue close to meningioma .The immunostaining for NGF in
the transitional meningioma (B) is more evident in the aggregated
macrophages (m) and fibroblasts (f). Micrographs of TrKA immunostaining
normal human dura mater (C) and in the meningotheliomatous-psammomatous
meningioma (D)/surrounding dural tissue. In micrographs (C) a vessel with its
endothelium (e) is clearly visible. Moreover another small vessel within the wall
of the vessel (vasum vasorum) may be observed and an intense
immunoreactivity for TrkA is present in the wall of this vessel and in the
aggregated fibroblasts (f) and collagen fibers (cf). Micrographs of TrKA
reactivity in a meningotheliomatous-psammomatous meningioma (D) and
61
surrounding dural tissue, macrophages and the endothelium of the vessels are
characterized by a moderate immunoreaction. Micrographs of the
immunoreactivity for p75NTR in the normal dura (E) and in a transitional
meningioma (F)/surrounding dural tissue. P75NTR shows a moderate
immunoreaction in the endothelium, a weak expression in macrophages (m),
fibroblasts (f) and collagen fibers (cf).
Fig.2. Micrographs of BDNF immunoreactivity in normal human dura mater (A)
and in meningotheliomatous-psammomatous meningioma (B)/surrounding
dural tissue, 40x. An appreciable immunoreactivity is visible in fibroblasts (f)
and collagen fibers (cf), as well as in the endothelium of vessels (e). An
analogous positive immunoreactivity for BDNF is markedly visible in the
vorticoid areas (va) and in the endothelium (e) and moderate immunoreactivity
may be observed in the aggregates of macrophages (m) . The TrkB
immunoreactivity appears to be moderate or weak in the fibroblasts (f) and
collagen fibers (cf) of the dura mater (C), but is more intense in the vorticoid
areas (va) of the transitional meningioma (D).
62
Fig.3 Micrographs of NT-3 and NT-4 immunoreactivity in normal dura mater (A,
C), in transitional meningioma (B) and in meningotheliomatous-psammomatous
meningioma (D)/surrounding dural tissue, 40x. The immunoreactivity for NT-3
appears weak or moderate in all the observed structures both in the normal
dura mater (A) and in the transitional meningioma (B)/surrounding dural tissue.
A moderate immunoreactivity for NT-4 may be observed in the normal dura
mater (C) while the immunoreactivity appears to be appreciable in the
meningiomatous vorticoid areas (va) . Micrographs of the immunoreaction for
TrkC in the normal dura mater (E) and in the meningotheliomatous-
psammomatous meningioma (F)/ surrounding dural tissue; the
immunoreactivity appears to be moderate both in fibroblasts (f) and collagen
fibers (cf) and in the endothelium of the vessels (e) in the normal dura mater.
An appreciable immunoreactivity is visible in the vorticoid areas (va) of the
meningioma (F).
63
Fig.4 RT-PCR comparative analysis between normal dura mater and
meningioma/surrounding dural tissue. Specific transcripts for NGF, BDNF, NT-3,
NT-4 and high affinity receptors TrkB andTrkC.
64
References
1. Nagashima G, Aoyagi M, Yamamoto M, Yamamoto S.: P53
overexpression and proliferative potential in Malignant Meningiomas. Acta
Neurochir 1999; 141: 53 – 61.
2. Barbacid M: The TrK family of neurotrophin receptors. J Neuroimmunol
1994; 25 : 1386 – 1403.
3. Kaplan DR and Miller FD: Signal transduction by the neurotrophin
receptors. Current Opin Cell Biol 1997; 9 : 213 – 221.
4. Vega JA, Garcia-Suarez O, Hannestad J, Perez-Perez M, Germanà A.:
Neurotrophins and the immune system. J Anat 2003; 203 (1): 1 – 19. Review.
5. Otten U, Marz P, Heese K, Hock C, Kunz D, Rose-John S.: Cytokines and
neurotrophins interact in normal and diseased states. Ann N Y Acad Sci 2000;
917 : 322 – 330. Review.
6. Stanisz AM and Stanisz JA.: Nerve growth factor and neuroimmune
interactions in inflammatory diseases. Ann NY Acad Sci 2000; 917: 268 – 272.
7. Timmusk T : Expression of mRNA for neurotrophins and their receptors
in the rat choroid plexus and dura mater. Neuroreport 1995; 6 (15) : 1997 –
2000.
8. Bronzetti E, Artico M, Lo Vasco VR, Felici LM, Bosco S, Magliulo G,
Pompili E, Fumagalli L: Expression of neurotransmitters and neurotrophins in
human adenoid tissue. Int J Mol Med. 2005; 15 (6) : 921 – 928.
9. Bronzetti E, Artico M, Pompili E, Felici LM, Stringaro A, Bosco S, Magliulo
G, Colone M, Arancia G, Vitale M, Fumagalli L: Neurotrophins and
meurotransmitters in human palatine tonsils: an immunohistochemical and RT-
PCR analysis. Int J Mol Med 2006; 18 (1) : 49 – 58.
10. Ricci A, Felici LM, Mariotta S, Mannino F, Schmid G, Terzano C, Cardillo
G, Amenta F, Bronzetti E: Neurotrophins and neurotrophin receptor protein
expression in the human lung. Am J Respir Cell Mol Biol 2004; 30 (1) : 12 – 19.
Epub 2003 Jun 5.
65
11. Bronzetti E, Artico M, Forte F, Pagliarella G, Felici LM, D’Ambrosio A,
Vespasiani G, Bronzetti B: A possible role of BDNF in prostate cancer detection.
Oncology Reports 2008; 19 : 969 – 974.
12. Goadsby PJ, Edvinsson L: Human in vivo evidence for trigeminovascular
activation in cluster headache. Neuropeptide changes and effects of acute
attacks therapies. Brain 1994; 117: 427 – 434.
13. Artico M, De Santis S, Cavallotti C: Cerebral dura mater and cephalalgia:
relationships between mast cells and cathecolaminergic nerve fibers in the rat.
Cephalalgia 1998; 18 : 183 – 191.
14. Keller JT, Dimlich RVW, Zuccarello M.: Relationship of trigeminovascular
and sympathetic nerve fibers to mast cells in the dura mater of the rat. J Cer
Blood Flow Metab 1989a; 9 : S685.
15. Olesen J, EdvinssonL.: Basic Mechanisms of Headache. Elsevier,
Amsterdam 1988; p.1492
16. Keller JT, Marfurt CF, Dimlich RVW, Tierney BE.: Sympathetic
innervations of the supratentorial dura mater of the rat. J Comp Neurol 1989b;
290: 310 – 321.
17. Fricke B, Duering von M, Andres KH.: Topography and
immunocytochemical characterization of nerve fibers in the leptomeningeal
compartments of the rat. A light- and electron-microscopical study. Cell Tissue
Res 1997; 287: 11 – 22.
18. Andres KH, von Duering M, Muszynski K, Schmidt RF.: Nerve fibers and
their terminals of the dura mater encephali of the rat. Anat Embryol 1987; 175:
289 – 301.
19. Woolf CJ, Ma QP.: Peripheral cell types contributing to the hyperalgesic
action of nerve growth factor in inflammation. J Neurosci 1996; 16: 2716 –
2723.
20. Dimitriadou et al.: Functional relationships between sensory nerve fibers
and mast cells of dura mater in normal and inflammatory conditions.
Neuroscience 1997; 7 : 829 – 839.
66
21. Lomen HC, Shooter EM.: Widespread neurotrophin receptor expression in
the immune system and other non-neuronal rat tissue. J Neurochem 1995; 64:
1780 – 1789.
22. Blandini F et al.: Peripheral levels of BDNF and NGF in primary
headaches. Cephalalgia, 2005; 26: 136 – 142.
23. Snider WD.: Functions of the neurotrophins during nervous system
development: what the knockouts are teaching us. Cell 1994; 77 (5) : 627 –
638.
24. Weiner HL.: The role of growth factor receptors in central nervous
system development and neoplasia. Neurosurgery 1995; 35 : 179 – 194.
25. Barbara E. Lazio, MD, and Lawrence S. Chin., M.: Growth factors in
central nervous system development and tumorigenesis. Neurosurg Focus
1997; 3 (3).
26. Yaeger MJ, Koestner A, Marushige Y.: The reverse transforming effects
of nerve growth factor on five human neurogenic tumor cell lines : in vitro
results. Acta Neuropathol 1991; 83 (1) : 72 – 80.
27. Pawel P, Jagodzinski, Wojciech Kaczmarski, Ryszard Zukiel.: Nuclear
accumulation of nerve growth factor and its receptor in meningioma and glioma
tumoury cells. Bulletin of the Polish Academy of Sciences/Biological Sciences
1992; 40: 145 – 152.
28. Cross M, Dexter TM.: Growth factors in development, transformation,
and tumorigenesis. Cell 1991; 64: 270 – 280.
29. Alex Kruttgen, Imke Schneider, Joachim Weis.: The dark side of the NGF
family: Neurotrophin in neoplasias. Brain Pathol 2006; 16: 304 – 310.
30. Lewin GR, Renz H.: Abundant production of brain-derived neurotrophic
factor by adult visceral epithelia implications for paracrine and target-derived
neurotrophic functions. Am J Pathol 1999; 155: 1183 – 1193.
31. Damien B.: Differential Gene Expression during Meningeal-Meningococcal
interaction: evidence for self-defense and early release of cytokines and
chemokines. Infection and Immunity 2001; 69: 2718 – 2722.
32. Tsujino Kumiko.: Establishment and characterization of cell lines derived
from a transplantable rat malignant meningioma: morphological heterogeneity
67
and production of nerve growth factor. Acta Neuropathologica 1997; 93: 461 –
470.
33. Eberhart CG, Kaufman WE, Tihan T, Burger PC.: Apoptosis, neuronal
maturation and neurotrophin expression within medulloblastoma nodules. J
Neuropathol Exp Neurol 2001; 60: 462 – 469.
34. Lavoie JF, Lesauteur L, Kohn J, Wong J, Furtoss O, Thiele CJ, Miller FD,
Kaplan DR.: TrKA induces apoptosis of neuroblastoma cells and does so via a
p53-dependent mechanism. J Biol Chem 2005; 280: 29199 – 29207.
68
Chapter 3
Neurotrophins, their receptors and MIB-1
in Human GH-secreting Pituitary
Adenomas : an immunohistochemical
analysis
M. Artico 1, E. Bianchi 1, G. Magliulo 1, M. De Vincentiis 1,
E. De Santis 2, A. Orlandi 3, A. Santoro 4, F.S. Pastore 5,
F. Giangaspero 6 , R. Caruso 4, M. Re 7 and L. Fumagalli 2
1Department of Sensory Organs, University of Rome “Sapienza”, 2Department of
Anatomical Histological, Forensic and Locomotor system Sciences, University of
Rome “Sapienza”, Rome,Italy; 3Chair of Pathology, University of Rome “Tor
Vergata”, Italy ; 4Department of Neurological Sciences, Neurosurgery,
University of Rome “Sapienza”, Rome, Italy; 5Division of Neurosurgery,
University of Rome “Tor Vergata”, Rome, Italy; 6Department of Radiology,
Oncology and Pathology, University of Rome “ Sapienza” & IRCCS Neuromed,
Pozzilli (Is), Italy; 7Department of Clinical Sciences, Polytechnic University of
Marche, Ancona, Italy
International Journal of Immunopathology and
Pharmacology 2012; 25 (1): 117-125
Key words: Pituitary Gland – Adenoma – Neurotrophins – MIB-1 –
Immunohistochemistry
69
Abstract
Pituitary Adenomas are a diverse group of tumors arising from the pituitary
gland. Typically, they are small, slow – growing, hormonally inactive lesions
that come to light as incidental findings on radiologic or postmortem
examinations, although some small, slow – growing lesions with excessive
hormonal activity may manifest with a clinical syndrome. The family of
neurotrophins plays a key role in the development and maintenance of the
pituitary endocrine cell function and in the regulation of hypothalamo – pituitary
– adrenocortical axis activity. The objective of our experimental study was to
investigate the localization of the neurotrophins, their relative receptors and
detect the expression level of MIB-1 (anti-ki67) to determine if all these factors
participate in the transformation and development of human pituitary
adenomas. A very strong expression of NT-3 and its receptor TrKC was
observed in the extracellular matrix (ECM) and vessel endothelium, together
with a clear/marked presence of BDNF and its receptor TrKB, thus confirming
their direct involvement in the progression of pituitary adenomas. On the
contrary, NGF and its receptor TrKA and p75NTR were weakly expressed in the
epithelial gland cells and the ECM.
70
Introduction
Pituitary Adenomas are a diverse group of tumors arising from the pituitary
gland (1 – 2) which can be sub-classified as either functional or nonfunctional,
depending on their hormonal activity in vivo (2 – 4). Small, slow – growing,
hormonally inactive lesions are typically identified as incidental findings on
radiologic or postmortem examinations: other small, slow – growing lesions
with excessive hormonal activity can manifest with a clinical syndrome (2 – 4).
Tumors that grow more rapidly, even if hormonally inactive, are capable of
producing symptoms related to the presence of an intracranial mass, such as
visual field disturbances. Given the small size of many pituitary tumors and their
propensity to exist with only insidious, nonspecific symptoms, an accurate
estimate of the incidence of pituitary adenomas in the general population
appears challenging (4). Ezzat S et al found prolactinomas to be the most
common form of pituitary adenoma (1). Burrow and co – workers (5)
evaluated postmortem radiographic, macroscopic and microscopic findings in
the pituitary tumors and found a significant incidence (11%) of prolactinoma in
both men and women at all ages, despite the fact that the etiologies of most
pituitary tumors remain unknown, as confirmed by more recent experimental
findings (6 – 7). The family of neurotrophins plays a key role in the
development and maintenance of nerve cell populations in the peripheral and
central nervous system (8 – 12). Several lines of evidence suggest that
neurotrophins, more particularly NGF, may be involved in pituitary endocrine
cell function (13 – 14). Animal studies have shown that neurotrophins,
especially NGF, play a dual role in pituitary physiology. Firstly, a local role, in
the anterior pituitary gland, as a stimulator of differentiation and proliferation of
somatomammotroph cells into mammotroph or lactotrope cells during
development (15 – 18) as well as a stimulator of proliferation of the thyrotrope
cells (18). Secondly, a systemic role as a neurohormone which is co – secreted
with prolactin into the bloodstream (16). Furthermore, NGF may regulate
endocrine function by stimulating the hypothalamo – pituitary – adrenocortical
axis activity during stress responses, pregnancy and lactation (19). In vitro
71
studies revealed that escape from NGF control appears to be one of the
mechanisms involved in the development and progression of human
prolactinomas (20). NGF and Trk receptors have been identified in endocrine
cells (cells containing conventional anterior – pituitary hormones) in the anterior
pituitary gland of adult rats (14, 17 – 18), and Aguado et al (14) reported the
presence of numerous endocrine cells containing TrkA and TrkB receptors in
human anterior pituitary gland and some pituitary adenomas, suggesting a
direct role of the neurotrophins in the normal development of the pituitary
gland and in the progression of some pituitary adenomas. Previous observations
found that prolactinomas, the most common pituitary tumor, express NGF and
its receptors (TrkA and TrkB) and are therefore highly sensitive to the action of
that neurotrophic factor. In fact, NGF mediates a long – lasting conversion of
the more transformed dopamine – resistant prolactinomas into a differentiated,
less malignant lactotroph – like phenotype re – expressing the D-2 receptor
protein: the latter is very important in the pharmacological therapy of these
tumors because D-2 receptor agonists are strongly effective in lowering plasma
PRL levels in patients with prolactinomas (21). It has been also suggested that
BDNF, expressed together with its receptor TrkB in the anterior lobe of the
pituitary gland, is involved in the control of thyroid function, in the proliferation
and differentiation of melanotrope cells and in the regulation of the
hypothalamic – pituitary – adrenal axis (22 – 23). All these findings prompted
us to investigate the localization and intra – cellular distribution of the
neurotrophins and their relative receptors, to determine whether these growth
factors participate in the transformation and development of the human
pituitary adenomas. Although most pituitary microadenomas can be completely
excised, it is difficult to totally remove invasive pituitary macroadenomas and,
until now, no routine markers have been available to predict the aggressive
behavior or recurrence of this lesion. However, Ki-67, a nuclear antigen
recognized by the monoclonal antibody MIB-1 has proved to be useful in
assessing several brain tumors, providing information about cell proliferation
and, consequently, long – term prognosis (24 – 28). Generally, the Ki-67
labeling index (LI) in pituitary adenomas is relatively low in comparison to other
72
brain tumors (29 – 31), in which it is employed, together with a thorough
clinical, hormonal and MR image follow – up, to identify the predicted
recurrence of the tumor as early as possible. Hence, we decided to investigate,
together with the analysis of the neurotrophins pattern, the expression level of
MIB-1 (anti-Ki67) to define its possible role as a prognostic factor in pituitary
adenomas.
Materials and Methods
Patients
Small specimens of human GH – secreting pituitary adenomas were harvested,
during surgical operation, from 10 patients, and then processed for
immunohistochemical analysis. Control specimens were obtained from 2
autoptic cases. Experiments were performed in compliance with the Italian laws
and guidelines concerning the informed consent of patients (Dir. 2001/20/CE).
The following molecules were investigated: nerve growth factor (NGF), brain -
derived neurotrophic factor (BDNF), NT-3, NT-4, TrKA, TrKB, TrKC, p75NTR and
MIB– 1.
Immunohistochemical analysis
For light microscope immunohistochemical analysis, small fragments of human
GH – secreting adenomas were washed in PBS, fixed in 10% formalin and
embedded in paraffin according to a standard procedure. Serial 4 μm thick
sections were cut using a rotatory microtome, mounted on gelatine-coated
slides and processed for immunohistochemistry. To study the
immunolocalization of neurotrophins and their receptors, the antibodies we
used were: i) rabbit anti-NGF polyclonal antibody (Santa Cruz Biotechnology,
CA, USA), which display <1% cross-reactivity against recombinant human NT-3,
NT-4 and BDNF; ii) rabbit anti-BDNF polyclonal antibody (Santa Cruz), which
recognizes the amino-terminus of mouse BDNF and does not cross-react with
NT-3 or NGF; iii) rabbit anti- NT3 polyclonal antibody (Santa Cruz
73
Biotechnology), raised against the amino-terminus of mouse NT-3, which does
not cross-react with NGF or BDNF; iv) rabbit anti-NT4 polyclonal antibody
(Santa Cruz Biotechnology); v) rabbit anti- TrKA polyclonal antibody (Santa
Cruz Biotechnology), which recognizes an epitope corresponding to amino acids
763 to 777, mapping adjacent to the carboxy-terminus of human TrKA p140
and is not cross-reactive with TrKB or TrKC; vi) rabbit anti-TrKB polyclonal
antibody (Santa Cruz Biotechnology), which recognizes an epitope
corresponding to amino acids 794 to 808 of mouse TrKB p145 and is not cross-
reactive with TrKA or TrKC; and vii) rabbit anti-TrKC polyclonal antibody (Santa
Cruz Biotechnology), which recognizes an epitope corresponding to amino acids
798 to 812 of porcine TrKC p140 and is not cross-reactive with TrKA or TrKB;
viii) goat polyclonal antibody to human NGF receptor p75 (Santa Cruz
Biotechnology), which recognizes the amino acid sequence mapping the
carboxy-terminus of the NGF receptor p75 precursor of human origin and is not
cross-reactive with other growth factor receptors; viiii) MIB-1, a rabbit
polyclonal antibody raised against amino acids 2641-2940 mapping at the C-
terminus of Ki-67 of human origin (Santa Cruz, CA, USA). Incubation with
primary antibodies was performed overnight at 4˚C at a final concentration of
2-5 μg/ml. Optimal antisera dilutions and incubation times were assessed in a
series of preliminary experiments. After exposure to the primary antibodies,
slides were rinsed twice in phosphate-buffer and incubated (1h and 30 min at
room temperature) with the appropriate secondary antibody conjugated to
horseradish peroxidase (HRP) (final dilution 1:100). The secondary antibody-
HRP linked against rabbit immunoglobulins was purchased from Boehringer
(Boehringer Mannheim GmbH, Mannheim, Germany), while secondary
antibodies-HRP linked against mouse and goat immunoglobulins were from
Sigma (Sigma Chemicals Co, St. Louis, MO, USA). After a further wash with
phosphatebuffer, slides were treated with 0.05% 3,3-diaminobenzidine and
0.1% H2O2. Finally, sections were counterstained with Mayer's hematoxylin and
observed by using a light microscope. To block endogenous peroxidase activity,
slides were pre-treated with 3% H2O2, whereas the non-specific binding of
immunoglobulins was prevented by adding 3% fetal calf serum to the
74
incubation medium. The intensity of the immune reaction was assessed
microdensitometrically using an IAS 2000 image analyzer (Delta Sistemi, Rome,
Italy) connected via a TV camera to the microscope. The system was calibrated
taking as zero the background obtained in sections exposed to nonimmune
serum. Ten 100 μm2 areas were delineated in each section by a measuring
diaphragm. Quantitative data regarding the intensity of the immune staining
were analyzed statistically by analysis of variance (ANOVA) followed by
Duncan's multiple range test as a post hoc test.
Results
Immunohistochemistry
Sections of GH – secreting adenomas samples exposed to the
primary/secondary antibodies developed a dark-brown (intense), yellow-brown
(slight) or no appreciable immunostaining. Immunoreactivity was specific since
no immunostaining was obtained in positive control sections incubated with
each primary antibody adsorbed with the specific peptide or with pre-immune
serum (data not shown). Immunolabeling was located in the epithelial glands
(described as epithelial neoplastic cells), extracellular matrix (ECM) and vessel
endothelium (see the Table). Immunoreaction for NGF was moderate on
epithelial glands (ep) and also appeared weak in the ECM (em), but was totally
absent on the endothelium of the vessels (en) (Fig. 1A). Similarly TrkA
immunoreactivity was moderate on epithelial glands (ep) and less appreciable
in the ECM (em), but absent on the vessel endothelium (en) (Fig. 1B). A weak
immunoreactivity for the p75NTR was described on epithelial glands (ep) and in
the ECM (em), while it was absent on the endothelium of vessels (en) (Fig. 1C).
BDNF immunoreactivity was highly appreciable in the ECM (em) and on
epithelial glands (ep), but it resulted moderate on the vessel endothelium (en)
(Fig. 2A). A strong immunoreactivity for TrKB was observed in the ECM (em),
appreciable in the vessel endothelium (en) and weak on epithelial glands (ep)
of the neoplastic area (Fig. 2B). A very strong immunoreactivity was revealed
by NT-3 and TrKC in the ECM (em), an appreciable expression also on the
75
vessel endothelium (en) and a weak immunoreactivity on epithelial glands (ep)
for these factors (Fig. 3A - 3B). Finally MIB – 1 immunoreactivity was weakly
expressed on epithelial glands (ep) and on the vessel endothelium (en) (Fig. 4A
- 4B). Illustrations regarding autoptic findings (2 cases) are not provided
because they were not significant.
Discussion
Pituitary adenomas account for 10-15% of all primary brain tumors and benign
tumors and are usually slow growing (1 – 4). In particular, growth hormone-
secreting adenomas account for about 20 % of all pituitary adenomas. GH-
producing adenomas have been histology classified into densely and sparsely
granulated adenomas (32). They derive from the acidophil cell line. This
lineage, comprising somatotroph, mammotroph and thyrotroph cells, is
controlled by a common transcription factor named PIT-1. Previous studies
suggest that neurotrophins, especially NGF, may be involved in pituitary
endocrine cell proliferation, growth and differentiation (13 – 14). NGF is a
particularly interesting neurotrophin in pituitary function and physiology (15 –
18). Immunohistochemical studies have also shown that NGF is selectively
expressed by somatotroph, mammotroph and thyrotroph cells, stored in
secretory granules. Moreover, neurotrophins and their receptors have been
shown to play a role in cancer, promoting tumor progression. In particular, NGF
cooperates with EGF and bFGF in directing differentiation of lactotrophs cells
stimulating PRL synthesis and D-2 dopaminergic receptor expression (21), via
binding to p75NTR and activation of NF – kB in a TrkA – independent way. In
fact, short – term treatment of patients with bromocriptine – resistant
prolactinomas, with NGF resulted in differentiation of the tumors into less
aggressive, lactotrope – like cells, re – expressing D-2 receptors, thus restoring
the molecular target for conventional therapy with D-2 agonists (21). TrkA as
well as TrkB expression has been found in tumor and non – tumoral
adenohypophyseal cells from human pituitary adenomas by Aguado et al (14).
However the localization of the neurotrophin receptors in human normal
76
pituitary gland and their expression in human pituitary adenomas is still
unclear. In our observations we described a moderate immunoreaction for NGF,
and its relative receptor TrKA and p75NTR, on epithelial glands and less
appreciable in the ECM, similarly to the experimental observations of
Assimakopoulou et al (13) but different to the Aguado's et al findings (14), thus
suggesting the role of NGF and its signaling in the development of normal
pituitary gland but not in the progression and proliferation of the pituitary
adenomas. BDNF and its receptor TrKB resulted highly appreciable in the ECM
and moderate on the vessel endothelium, suggesting their role in the
proliferation of a neoplastic microenvironment, involving the extracellular matrix
components and the angiogenetic network, given that vascular endothelial cells
synthesize and secrete BDNF (32). On the other hand a very strong
immunoreactivity was revealed by NT-3 and TrKC in the ECM, and an
appreciable expression also on the vessel endothelium, differently from the
Aguado's et al findings (14), leading us to describe this neurotrophin as the
principal neurotrophic factor involved in the progression of pituitary adenomas.
This discrepancy may be due to different immunohistochemical experimental
protocols. Considering the efficiency of the antibodies used for this
investigation, the expression revealed by these molecules in human pituitary
adenomas (GH – secreting) suggests a functional direct role of BDNF and NT-3
on this tumors. Finally MIB – 1 resulted weakly detectable in epithelial glands,
but totally absent on the vessel endothelium, confirming the low proliferation
rate of Gh-producing adenomas which generally show a label index less than 3
%. However the distribution and localization of all these factors in human
pituitary adenomas (GH – secreting) still remains unclear. Additional studies
would be necessary to better explain the biological role of these molecules in
the development and progression of this type of tumors.
77
References
1. Ezzat S, Asa SL, Couldwell WT, Barr CE, Dodge WE, Vance ML,
McCutcheon IE. The prevalence of pituitary adenomas: a systematic review.
Cancer 2004; 101(3): 613 – 619
2. Asa SL. Tumors of the pituitary gland. In: Rosai J, editor. Atlas of tumor
pathology. 3rd series Fascicle 22. Washington DC: Armed Forces Institute of
Pathology, 1998: 1 – 214
3. Asa SL, Ezzat S. The pathogenesis of pituitary tumors. Nat Rev Cancer
2002; 2: 836 – 849
4. Nammour GM, Ybarra J, Naheedy MH, Romeo JH, Aron DC. Incidental
pituitary macroadenoma: a population – based study. Am J Med Sci 1997; 314:
287 – 291
5. Burrow GN, Wortzman G, Rewcastle NB et al. Microadenomas of the
pituitary and abnormal sellar tomograms in an unselected autopsy series. N
Engl J Med 1981; 304: 156 – 158
6. Ezzat S. Editorial: Pituitary Tumor Pathogenesis – The Hunt for novel
candidate genes continues. Journ Clin Endocr Metabol 2003; 88(11): 5116 –
5118
7. Asa SL, Ezzat S. The Pathogenesis of pituitary tumors. Annual Review of
Pathology: Mechanisms of Disease 2009; 4: 97 – 126
8. Lewin GR and Bardle YA. Physiology of neurotrophins. Ann Rev Neurosci
1996; 9: 217 – 289
9. Barbacid M. The TrK family of neurotrophin receptors. J Neuroimmunol
1994; 25: 1386 – 1403
10. Kaplan DR and Miller FD. Signal transduction by the neurotrophin
receptors. Curr Opin Cell Biol 1997; 9: 213 – 221
11. Snider WD. Functions of the neurotrophins during nervous system
development: what the knockouts are teaching us. Cell 1994; 77: 627 – 638
12. Tessarollo L. Pleiotropic functions of neurotrophins in development.
Cytokine Growth Factor Rev 1998; 9: 125 – 137
78
13. Assimakopoulou M, Vassiliki Z, Chondrogianni C, Gatzouins G, Varakis J.
p75NTR and TrkC Neurotrophin receptors demonstrate a different
immunoreactivity profile in comparison to TrkA and TrkB receptors in human
normal pituitary gland and adenomas. Neuroendocrinology 2008; 88: 127 – 134
14. Aguado F, Majò G, Aranda G, Ferrer I. Trk neurotrophin receptor family
immunoreactivity in rat and human pituitary tissues. Neuroscience Letters 1998;
243: 13 – 16
15. Missale C, Boroni F, Sigala S, Zanellato A, Dal Toso R, Balsari A and
Spano P. Nerve growth factor directs differentiation of the bipotential cell line
GH-3 into the mammotroph phenotype. Endocrinology 1994; 135 (1): 290 –
298
16. Missale C, Boroni F, Sigala S, Buriani A, Fabris M, Leon A, Dal Toso R and
Spano F. Nerve growth factor in the anterior pituitary: localization in
mammotroph cells and cosecretion with prolactin by a dopamine-regulated
mechanism. Proc Natl Acad Sci 1996; 93: 4240 – 4245
17. Patterson J and Childs G. Nerve growth factor and its receptor in the
anterior pituitary. Endocrinology 1994; 135(4): 1689 – 1696
18. Patterson J and Childs G. Nerve growth factor in the anterior pituitary:
regulation of secretion. Endocrinology 1994; 135(4): 1697 – 1704
19. Taglialatela G, Angelucci L, Scaccianoce S, Foreman PJ, Perez-Polo JR.
Nerve growth factor modulates the activation of the hypothalamo – pituitary –
adrenocortical axis during the stress response. Endocrinology 1991; 129: 2212
– 2218
20. Missale C, Fiorentini C, Finardi A, Spano PF. Growth factors in human
pituitary tumors. Pituitary 1999; 1: 153 – 158
21. Missale C, Boroni F, Losa M, Giovanelli M, Zanellato A, Dal Toso R, Balsari
A and Spano PF. Nerve growth factor suppresses the transforming phenotype of
human prolactinomas. Proc Natl Acad Sci , Pharmacology 1993; 90: 7961 –
7965
22. Kramer B ,Cruijsen P, Ouwens D, Coolen M, Martens G, Roubos E and
Jenks B. Evidence that Brain – derived neurotrophic factor acts as an autocrine
79
factor on pituitary melanotrope cells of Xenopus laevis. Endocrinology 2002;
143(4): 1337 – 1345
23. Kononen J, Soinila S, Persson H, Honkaniemi J, Hokfelt T, Pelto-Huikko
M. Neurotrophins and their receptors in the rat pituitary gland: regulation of
BDNF and trkB mRNA levels by adrenal hormones. Brain Res Mol Brain Res
1994; 27(2): 347 – 354
24. Ekramullah SM, Saitoh Y, Arita N, Ohnishi T, Hayakawa T. The
correlation of Ki – 67 staining indices with tumor doubling times in regrowing
non – functioning pituitary adenomas. Acta Neurochir (Wien) 1996; 138: 1449 –
1455
25. McCormick D, Chong H, Hobbs C, Datta C, Hall PA. Detection of the Ki –
67 antigen in fixed and wax – embedded sections with the monoclonal antibody
MIB-1. Histopathology 1993; 22: 355 – 360
26. Kim SY, Chung SH, Kim HJ, Whang K, Han YP, Hong SK. Bcl-2 and Bax
expression and Ki-67 proliferative index in astrocytic tumors: in relation to
prognosis. J Korean Neurosurg Soc 2004; 35: 465 – 471
27. Parkins CS, Darling JL, Gill SS, Revesz T, Thomas DG. Cell proliferation in
serial biopsies through malignant brain tumors: measurement using Ki-67
antibody labeling.Br J Neurosurg 1991; 5: 289 – 298
28. Kitz K, Knosp E, Koos WT, Korn A. Proliferation of pituitary adenomas.
Measurement by MAb Ki-67. Acta Neurochir (Wien) 1991; 53: 60 – 64
29. Paek KI, Kim SH, Song SH, Choi SW, Koh HS, Youm JY, Kim Y. Clinical
significance of Ki-67 labeling index in pituitary macroadenoma. J Korean Med
Sci 2005; 20: 489 – 494
30. Kim JH, Seo JS, Lee BW, Lee SY, Jeon SH, Lee KB. The Characteristics of
incidental pituitary microadenomas in 120 korean forensic autopsy cases. J
Korean Med Sci 2007; 22: 61 – 65
31. Nakahashi T, Fujimura H, Altar A, Li J, Kambayashi J-I, Tandon NN, Sun
B. Vascular endothelial cells synthesize and secrete brain-derived neurotrophic
factor. FEBS Lett 2000; 470: 113 – 117
32. Kontogeorgos G, Watson Jr RE, Lindell EP. Growth hormone producing
adenoma. In: DeLellis RA, Lioyd RV, Heitz PU, Eng C eds. World Health
80
Organization Classification of Tumors: Pathology and Genetics of Tumors of
Endocrine Organs. Lyon, France: International Agency for Research on Cancer
Press 2004; 14-19
81
Fig. 1. Micrographs of NGF-TrKA-P75 immunostaining in GH-secreting pituitary
adenomas. NGF immunoreactivity was moderate in the epithelial compartment of the
neoplastic area, weak in the extracellular matrix (em) and totally absent in the vessel
endothelium (en) (not shown)(A: 20X). Immunoreaction for TrKA was moderate in the
nucleus of the neoplastic cells, weak in the extracellular matrix (not shown) and totally
absent in the vessel endothelium (en) (not shown) (B: 40X). P75NTR immunoreactivity
was weak in the epithelial neoplastic cells and in the extracellular matrix (em), but
totally absent in the vessel endothelium (en) (C: 20X).
82
Fig. 2. Micrographs of BDNF-TrKB immunostaining in GH-secreting pituitary adenomas.
BDNF showed a significantly high expression in the extracellular matrix (em) and on
epithelial glands, but moderate on the vessel endothelium (en) (A: 20X). TrKB
Immunoreactivity was strong in the extracellular matrix (em), appreciable in the vessel
endothelium (en) and weak on epithelial glands of the neoplastic area (B: 20X).
83
Fig. 3. Micrographs of NT3-TrKC immunostaining in GH-secreting pituitary adenomas.
NT-3 was strongly expressed in the extracellular matrix (em) and on the vessel
endothelium (en), but it was moderate expressed in the epithelial neoplastic cells. (A:
20X). A strong immunoreactivity for TrKC was observed in the extracellular matrix (em)
and a weak expression on the vessel endothelium (en) and on epithelial glands (ep)
(B: 20X).
84
Fig. 4. Micrographs of Ki-67 immunostaining in GH-secreting pituitary adenomas. Ki-67
immunoreactivity was weak on epithelial neoplastic cells and on the vessel endothelium
(en), but it was relevant in the extracellular matrix (em) (A, B: 20X).
85
Table I. Results of the immunohistochemical analysis for NTs and NT receptors
in human GH-secreting pituitary adenomas.
Epithelial glands Extracellular
matrix
Vessel
endothelium
NGF + +/- -
BDNF ++ +++ +
NT3 + +++ ++
MIB-1 +/- ++ -
TrkA + +/- -
TrkB +/- ++ +
TrkC +/- +++ ++
P75NTR +/- +/- -
+++: strong immunoreactivity; ++: relevant immunoreactivity; +: moderate
immunoreactivity; +/-: weak immunoreactivity; -: absence of immunoreactivity
Table II. Results of the immunohistochemical analysis in percentages.
Epithelial glands Extracellular
matrix
Vessel
endothelium
NGF ±50% ±25% ±0%
BDNF ±75% ±100% ±50%
NT3 ±50% ±100% ±75%
MIB-1 ±25% ±75% ±0%
TrkA ±50% ±25% ±0%
TrkB ±25% ±75% ±50%
TrkC ±25% ±100% ±75%
P75NTR ±25% ±25% ±0%
+++: strong immunoreactivity; ++: relevant immunoreactivity; +: moderate
immunoreactivity; +/-: weak immunoreactivity; -: absence of immunoreactivity
86
Chapter 4
Immunohistochemical profile of VEGF,
TGF- and PGE2 in human pterygium and
normal conjunctiva: experimental study
and review of the literature
E. Bianchi1, F. Scarinci2, C. Grande1, R. Plateroti1,
P. Plateroti1, A. M. plateroti1, L. Fumagalli3,
P. Capozzi4 , J. Feher1* and M. Artico1
1Department of Sensory Organs, *Ophthalmic Neuroscience Program
2G.B. Bietti Eye Foundation-IRCCS, Rome
3Department of Anatomical, Histological, Medico-legal and Locomotor System
Sciences, University of Rome ‘Sapienza’,
4Bambino Gesù Children’s Hospital IRCCS, Ophthalmic Department , Rome,
Italy.
International Journal of Immunopathology and
Pharmacology 2012; 25 (3): 607-615
Key words: immunohistochemistry - pterygium - conjunctiva - VEGF - TGF-
beta - PGE2
87
Abstract
Human pterygium is made up of chronic proliferative fibro-vascular tissue
growing on the ocular surface. This disease exhibits both degenerative and
hyperplastic properties. Some fibroangiogenic factors have recently been shown
to play a potential role in fibrovascular diseases via the angiogenesis process.
The aim of this study is to evaluate VEGF, TGF- and PGE2 expression in the
epithelial, endothelial and stromal cells of human pterygium and normal
conjunctiva in order to determine whether these factors participate in the
development of pterygium. Ten specimens from patients with pterygium and
two normal conjunctivas (cadavers) were analyzed by immunohistochemistry
using specific antibodies against these growth factors. The technique used was
ABC/HRP (Avidin complexed with biotinylated peroxidase). Immunoreactivity of
VEGF was significantly increased in the epithelium, vascular endothelium and
stromal cells in primary pterygium as compared with normal conjunctiva. A
moderate expression of TGF- in the pterygium was observed in the epithelial
and stromal layers. On the contrary, immunolabeling of this growth factor in
the human normal conjunctiva was weak. PGE2 was strongly expressed in the
epithelium of patients with pterygium, as in control conjunctival tissues and the
immunolabeling was moderate in the stroma from the same patients. Our
results suggest that these growth factors may contribute to the progression of
primary pterygium by increasing angiogenesis, thus leading to the formation of
new blood vessels from the pre-existing vasculature. We conclude that VEGF,
TGF- and PGE2 may be potential therapeutic targets in the treatment of this
disease although proof of this evidence requires further studies.
88
Introduction
Pterygium is a lesion of the ocular surface that begins to grow from limbal
epithelium and invades the cornea by conjunctival epithelium, leading to visual
impairment (1,2). Recently, published data have shown that this pathological
condition is an active process of cellular proliferation, ongoing connective tissue
remodeling, angiogenesis and inflammation. Histologically, actively growing
pterygia exhibit both degenerative and hyperplastic changes as well as
proliferative and infiammatory disorders (3,4). This disease consists of an
overlying conjunctival epithelium, which may appear normal or mildly
hyperplastic. The underlying fibrovascular tissue usually presents a chronic
inflammatory cellular infiltrate and rich vasculature (4). It causes discomfort,
lachrymation and photophobia. After surgical intervention, relapses are
frequent. Many therapies, including antimitotics and corticosteroids, have been
proposed for the prevention of recurrence, but no really effective therapy has
been established (5). When pterygium takes a more aggressive course,
although considered a relatively benign process, it may be come locally invasive
with various degrees of abnormalities, ranging from mild dysplasia to carcinoma
in situ (6). The pathogenesis of pterygium is still controversial, although
epidemiological studies have firmly established that ultraviolet radiation is an
etiologic agent for this disease (7). In addition, many fibroangiogenic growth
factors have been implicated in pterygium pathogenesis, such as tumor necrosis
factor- (TNF-), basic fibroblast growth factor (bFGF), platelet-derived growth
factor (PDGF), and transforming growth factor- (TGF-) (8). Angiogenesis is
defined as the formation of new blood vessels from pre-existing vasculature
and underlies a large number of physiological processes (9), such as growth
and differentiation, wound healing, and abnormal conditions, such as neoplasia
and eye diseases, which cause severe loss of vision (10). The process of
vascularization involves the activation of cell-derived angiogenic factors as well
as the appropriate synthesis of extracellular matrix components necessary for
anchorage of migrating endothelium. One of the most potent and specific
89
angiogenic factors is vascular endothelial growth factor (VEGF), also known as
vascular permeability factor and vasculotropin (11). VEGF is a heparin-binding
glycoprotein that has several important effects on vascular endothelial cells.
This growth factor may be produced in response to environmental stimuli,
mainly hypoxia, certain cytokines and estradiol (12). VEGF is considered to be
the most selective mitogen for endothelial cells (13): it increases vascular
permeability (14), induces alterations in ion flow, cell proliferation (15), and
migration and release of proteinases (16). Prostanoids are a group of lipid
mediators forming in response to various stimuli, including prostaglandin and
thromboxane A2. They are released extracellularly immediately after their
synthesis and they act by binding to a G-protein-coupled rhodopsin-type
receptor on the surface of target cells. There are 8 types of prostanoid
receptors that are conserved in mammals: the PGD receptor (DP), a subtypes
of the PGE receptor (EP1, EP2, EP3 and EP4), the PGF receptor (FP), the PGI
receptor (IP), and the TXA receptor (TP). The ocular surface, especially the
human conjunctival epithelium, showed EP2, EP3 and EP4 receptors, that may
down-regulate ocular surface inflammation (17). In the current study we
investigated the expression of VEGF, PGE2 and TGF- by immunohistochemical
techniques in some cases of primary pterygia and 2 normal conjunctiva
specimens as controls, to elucidate the etiopathogenesis of this disease, that
can have significant clinical consequences in terms of surgical treatment,
preventing the frequent post-surgery relapses. Also, it may play a role in
developing new non-surgical treatments to reduce relapses, severity of
inflammation, tissue invasion, proliferation and angiogenesis.
Materials and Methods
Ethical considerations
The study group included 10 cases of surgically excised pterygium from patients
(6 males and 4 females) aged 45-80 years, together with 2 autoptic specimens
harvested as control cases (normal nasal epibulbar conjunctiva segments that
showed the same features for immunohistochemical study; in fact, is it
90
impossible to use control specimens from normal conjunctiva of patients with
pterygium due to potential abnormalities in the conjunctiva adjacent to the
lesions). During excision, apart from topical anaesthesia, no other chemical or
pharmaceutical product was administered. Experiments were performed in
compliance with the Italian laws and guidelines concerning the patients
informed consent. The ethical committee of the Hospital approved our study
according to the European Community and Italian laws. Control morphological
sections were stained with hematoxylin-eosin. The following molecules were
investigated: vascular endothelial growth factor (VEGF), prostaglandin E2
(PGE2) and transforming growth factor- (TGF-).
Immunohistochemical analysis
Small fragments from pterygium and nasal epibulbar conjunctival tissues near
the limbus (autoptic specimens) samples were washed in PBS, fixed in 10%
formalin and embedded in paraffin according to a standard procedure. The
method employed for immunohistochemical tests was ABC/HRP technique
(avidin complexed with biotinylated peroxidase). Serial 3-μm thick sections
were cut using a rotative microtome, mounted on gelatin-coated slides and
processed for immunohistochemistry. These sections were deparaffinized in
xylene and dehydrated. They were immersed in citrate buffer (PH 6) and
subjected to microwave irradiation twice for 5 minutes. Subsequently, all
sections were treated for 30 minutes with 0.3% hydrogen peroxide in methanol
to quench endogenous peroxidase activity. To block non-specific binding, the
slides were incubated in 3% normal goat serum in PBS for 30 minutes at room
temperature. The slides were incubated overnight at 4°C with primary mouse
monoclonal antibodies against human VEGF diluted 1/100 (abcam Cambridge
Science Park, UK, ab1316), against human TGF- diluted 1/100 (abcam
Cambridge Science Park, UK, ab49574) and with primary rabbit polyclonal
antibody against human PGE2 diluted 1/500 (Abcam Cambridge Science Park,
UK, ab2318). Optimal antisera dilutions and incubation times were assessed in
a series of preliminary experiments. After exposure to the primary antibodies,
slides were rinsed twice in phosphate buffer and incubated for 1 h at room
91
temperature with the appropriate secondary biotinylated goat anti-mouse or
anti-rabbit IgG (vector laboratories Burlingame, CA, USA, BA9200 and BA1000)
and with peroxidase-conjugated avidin (Vector laboratories, Burlingame, CA,
USA, Vectastain Elite ABC Kit Standard* PK 6-100) for 30 minutes. After a
further wash with phosphate buffer, slides were treated with 0.05% 3,3-
diaminobenzidine (DAB) and 0.1% H2O2. Finally, sections were counterstained
with Mayer's hematoxylin and observed by using a light microscope. Negative
control experiments were done: i) by omitting the primary antibody; ii) by
substituting the primary antibody with an equivalent amount of non-specific
immunoglobulins; iii) by pre-incubating the primary antibody with the specific
blocking peptide (antigen/antibody = 5 according to supplier's instructions).
The staining assessment was made by two experienced observers in light
microscopy. We assessed the immunoreactivity for VEGF, TGF- and PGE2 in
epithelial, endothelial and stromal cells of these tissues. The intensity of the
immune reaction was assessed microdensitometrically using an IAS 2000 image
analyzer (Delta Sistemi, Rome, Italy) connected via a TV camera to the
microscope. The system was calibrated taking the background obtained in
sections exposed to non-immune serum as zero. Ten 100 m2 areas were
delineated in each section by a measuring the diaphragm. Quantitative data of
the intensity of the immune staining were analyzed statistically by analysis of
the variance (ANOVA) followed by Duncan’s multiple range test as a post hoc
test.
Statistical analysis
The comparison of the expression levels of VEGF, TGF- and PGE2 in the
pterygium and normal conjunctiva was carried out by t-test. Statistical analyses
were performed using the SPSS statistical software package version 12.0. The
results were considered as statistically significant when P-value<0.05.
92
Results
Under light microscope fragments of primary pterygium from 10 patients
treated with surgical ablation were examined. These specimens are composed
of epithelium, endothelium and different kinds of stroma, in accordance with
the evolutive stage. Intense angiogenic activity was observed particulary in the
subepithelial region. Furthermore, pterygium tissues were more vascularized
than normal conjunctiva. The particular distribution of the blood vessels can be
explained by the need of the proliferating pterygium for increased nutritive
support. We noted the presence both of small vessels as well as elongated,
tortuous and ramified blood vessels: the morphology of these vessels is
suggestive for the presence of an active angiogenesis in subepithelial
connective tissue. The epithelium of the conjunctival tissues is stratified,
columnar towards the sclera and squamous non-keratinized towards the
cornea. In some areas, the epithelium invaginates into the stroma and an
increased number of goblet cells are present in this area (Fig 1A). The
epithelium is thick and often elevated by the proliferation of the underlying
connective tissue. In the pterygium, the stroma is made of connective tissue,
rich in fibroblasts, numerous connective fibrils and many blood vessels. In the
stationary phase, sclerosis is observed, the infiammatory process is reduced
and the connective fibrils are set in compact bundles (Fig 1B). Our study
showed relevant immunoreactivity of VEGF in epithelial cells, except goblet cells
(Fig. 1C); the normal conjunctiva demonstrated a statistically significant
difference in comparison with pterygium, that presented extremely high
expression level for VEGF in the epithelial layer. A strong reaction to VEGF was
observed in the vascular endothelium, and in fibroblastic and inflammatory
stromal cells of the pterygium tissue (Fig. 1D). In contrast to this pathologic
tissue, no VEGF immunoreactivity was observed in endothelial or stromal cells
of normal conjunctival tissues (Fig. 1C). The staining reaction was diffuse,
granular, cytoplasmic, with intensification at the superficial layers of the
epithelium. In the epithelium of pterygium we observed an increase of reaction
towards the superficial region (Fig. 1D). TGF- immunolabeling was very weak
93
in fibroblasts from normal conjunctiva, in contrast to the primary pterygium,
that appeared strong in some stromal cells (Fig. 2A-B). These findings
demostrated that this growth factor may interact directly or indirectly in the
pathogenesis of pterygium. Finally, we detected prostaglandin E2 (PGE2) in the
conjunctival epithelium of pterygium patients as we did in the control autoptic
conjunctival epithelium. Our study suggests that PGE2 is strongly expressed in
the conjunctival epithelium of patients with pterygium, as in control conjunctival
tissues. PGE2 immunolabeling was moderate in the stroma from patients with
pterygium, because vascular endothelium expressing the PGE2 protein
increased in the presence of inflammatory infiltrating cells in sub-conjunctival
tissues (Fig. 2C-D). The intensity of staining for VEGF, TGF-β and PGE2 in
human normal conjunctiva and pterygium is presented in Tables I and II
(Tables I-II). The percentage values of growth factors-positive cells and P-
values are shown in Table III (Table III).
Discussion
Pterygium represents a vascular, potentially invasive surface ocular lesion,
which originates from activated stem cells of the limbus (18).
Immunopathogenic mechanisms and overexpression of extracellular matrix
components seems to be implicated in its pathogenesis (19). Recent studies
show that pterygium may be the result of a defective wound healing process,
during which molecular events that lead to programmed cell death are modified
(20). Normal conjunctiva contains a local surface immune system called
conjunctiva-associated lymphoid tissue (CALT) that presents T cells, B cells, and
plasma cells as well as local secretions of immunoglobulins (IgA, IgM, IgG, IgG,
and IgE) and complement (21). Previous studies indicated that both immune
cells and immunoglobulins are pathologically increased in pterygium tissue,
suggesting that immunological process might be involved in its pathogenesis
(21). Although T cells are the most frequently encountered type of
inflammatory cell, CD68-positive macrophages are the most common cells
encountered in pterygium and they are distributed both in the epithelial and
94
stromal layers, suggesting that they are related to the pathogenesis of the
disease. Additionally, a previous study indicated that some of these
macrophages strongly expressed COX-2 and VEGF in pterygium (22). COX-2
protein can upregulate VEGF production via the protein kinase C pathway in
lung cancer cells (23). Prostaglandin E2 (PGE2), the product of COX-2 activity, is
also angiogenic by direct influence on endothelial cells or by inducing the
release of angiogenic growth factors, such as VEGF (24). In fact, the present
study revealed an intense expression of PGE2 in the columnar stratified
epithelium and moderate immunolabeling in endothelial and stromal cells,
indicating the importance of this factor in the pathogenesis of pterygium.
Although the pathogenicity of pterygium is not fully understood, it is generally
accepted that ultraviolet radiations are the most important etiological factor
involved in its onset. Ultraviolet radiations trigger a series of events that
ultimately lead to damage of DNA, RNA and extracellular matrix (25). Chronic
ultraviolet-B (UV-B) exposure contributes to the pathogenesis of primary
pterygium, which causes oxidative stress, leading to upregulation of many
potential mediators of pterygium growth, such as cytokines and growth factors.
Di Girolamo et al. (26) demostrated that UV may induce the VEGF expression in
the pterygium epithelial cells in a dose- and time-dependent manner (26).
Therefore, the expression of VEGF in the epithelium of primary pterygium might
be relevant due to UV-B exposure. The ingrowth of these vessels into the
epithelium might be interpreted as a reaction to hypoxia or some cytokines.
This process deserves further investigation and research. Angiogenesis is
characterized by growing new blood vessels from pre-existing vessels. VEGF is
one of the most potent and specific proangiogenic factors. It is also known to
be a vascular permeability factor or vasotropin. VEGF is considered the most
selective mitogen of endothelial cells (27); it increases vascular permeability
(28), induces alterations of ionic fluxes, cellular proliferation (15), migration and
release of proteases (16). Our study showed an increased expression of VEGF,
mainly in the epithelium, endothelial cells and fibroblasts of the pterygium.
Such reactivity is an argument for the pathogenic role played by this growth
factor in the development of pterygium. The relationship between VEGF signal
95
transduction and the modifications in the behavior of epithelial cells from
pterygium/conjunctiva has not been fully ascertained. Overexpression of VEGF
in epithelial cells is, on the other hand, not capable of inducing angiogenesis
and is seemingly consistent with allow level of vascular microdensity. This may
be the result of VEGF lacking in endothelial and stromal cells. On the contrary,
VEGF expression in the pterygium endothelial and stromal cell can induce
angiogenic activity, demostrated by increased vascular microdensity. Therefore,
it seems that VEGF buildup in the epithelial cells is only a reflection of their
secretory capacity, while buildup in the endothelial and stromal cells reflects its
angiogenic activity. In this respect, Aspiotis M et al. demostrated a higher
vascular microdensity in the fibrous subtype than in the vascular type, thus
confirming the assumption that stroma plays a role in the pathogenesis of
pterygium (29). Furthermore, the presence of pro-inflammatory cytokines
secreted from the surface epithelium or from lacrimal inflammatory cells
induces the fibroblastic production of proteins related to remodelling of
extracellular matrix and angiogenesis. Growth factors with potent angiogenic
activity, such as FGF, PDGF, TGF- and TNF, have been found to be secreted
from fibroblastic and inflammatory pterygium cells as well as in tissue cultures
from pterygium fibroblasts (8). Our study showed a moderate expression of
TGF-β in the epithelial and stromal cells of pterygium compared to normal
conjunctiva, which presented weak staining in the endothelial, epithelial and
stromal layers. From this and other studies, we can postulate that various
cytokines and growth factors, including VEGF, might be involved in cellular
proliferation, inflammatory reaction, remodelling of extracellular matrix and
angiogenesis of pterygium. These data suggests that VEGF, PGE2 and TGF-
can be therapeutic targets in the treatment of pterygium. Anti-angiogenesis
therapy using anti-VEGF has recently been reported to be effective both for
controlling primary pterygium and preventing recurrence after pterygium
excision (30). We conclude that the overexpression of angiogenic factors and
the concurrent decreased expression of angiogenesis inhibitors probably
represents a possible pathogenic mechanism in the formation of pterygium. The
development of synthetic inhibitors growth factors for therapeutic intervention
96
could bring about a reduction of relapse rate, inflammation intensity, tissue
invasiveness, proliferation and angiogenesis in pterygium. Additional clinical and
experimental investigations appear to be necessary to better clarify the
biological role of these molecules in the development and progression of this
type of disease.
97
References
1. Spencer WH. Ophthalmic Pathology: An Atlas and Textbook, 3rd edn. WB
Saunders Co: Philadelphia, 1985, pp 304.
2. Reese AB. Tumors of the Eye, 3rd edn. Harper & Row: New York, 1976,
pp 53-55
3. Cameron ME. Histology of pterygium: an electron microscopic study. Br J
Ophthalmol 1983; 67:604-608.
4. Hill JC, Maske R. Pathogenesis of pterygium. Eye 1989; 3:218-226.
5. Sodhi PK, Verma L, Pandey RM, Ratan S. Comparison between the role
of intraoperative mitomycin C and doxorubicin in preventing the recurrence of
primary pterygium.Ophthalmic Res 2005; 37:1-6.
6. Dushku N, Reid TW. Immunohistochemical evidence that human pterygia
originate from an invasion of vimentin-expressing altered limbar epithelial basal
cells. Curr Eye Res 1994; 13:473-481.
7. Taylor HR, West SK, Rosenthal FS, Munoz B, Newland HS, Emmett EA.
Corneal changes associated with chronic UV irradiation. Arch Ophthalmol 1989;
107:1481-1484.
8. Kria L, Ohira A, Amemiya T. Immunohistochemical localization of basic
fibroblast growth factor, platelet derived growth factor, transforming growth
factor-beta and tumor necrosis factor-alpha in the pterygium. Acta Histochem
1996; 98:195-201.
9. Folkman J, Klagsbrun M. Angiogenic factors. Science, 1987; 235:442-
447.
10. Tsanou E, Ioachim E, Stefaniotou M, Gorezis S, Charalabopoulos K, Bagli
H et al. Immunohistochemical study of angiogenesis and proliferative activity in
epiretinal membranes. Int J Clin Pract 2005; 59:1157-1161.
11. Ferrara N. Vascular endothelial growth factor. Eur J Cancer 1996;
32:2413-2422.
98
12. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability
factor/vascular endothelial growth factor, microvascular hyperpermeability, and
angiogenesis.
Am J Pathol 1995; 146:1029-1039.
13. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular
endothelial growth factor is a secreted angiogenic mitogen. Science 1989;
246:1306-1309.
14. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF.
Tumor cells secrete a vascular permeability factor that promotes accumulation
of ascites fluid. Science 1983; 219:983-985.
15. Dvorak HF. Tumors: wounds that do not heal. Similarity between tumor
stroma generation and wound healing. N Engl J Med 1986; 315: 1650-1659.
16. Unemori EN, Ferrara N, Bauer EA, Amento EP. Vascular endothelial
growth factor induces interstitial collagenase expression in human endothelial
cells. J Cell Physiol 1992; 153:557-562.
17. Ueta M, Matsuoka T, Yokoi N, Kinoshita S. Prostaglandin E2 suppresses
polyinosine-polycytidylic acid (polyl:C)-stimulated cytokine production via
prostaglandin E2 receptor (EP) 2 and 3 in human conjunctival epithelial cells. Br
J Ophthalmol 2011; 95:859-863.
18. Dushku N, Reid TW. Immunohistochemical evidence that human pterygia
originate from an invasion of vimentin-expressing altered limbal epithelial basal
cells. Curr Eye Res 1994; 13: 473-481.
19. Karukonda SR, Thompson HW, Beuerman RW, Lam DS, Wilson R, Chew
SJ, Steinemann TL. Cell cycle kinetics in pterygium at three latitudes. Br J
Ophthalmol 1995; 79:313-317.
20. Tan DT, Tang WY, Liu YP, Goh HS, Smith DR. Apoptosis and apoptosis
related gene expression in normal conjunctiva and pterygium. Br J Ophthalmol
2000; 84:212-216.
21. Pinkerton OD, Hokama Y, Shigemura LA. Immunologic basis for the
pathogenesis of pterygium. Am J Ophthalmol 1984; 98:225-228.
22. Choul Yong Park, Jong Sun Choi, Sung Jun Lee, Sang Won Hwang, Eo-jin
Kim, Roy S. Chuck. Cyclooxygenase-2-expressing macrophages in human
99
pterygium co-express vascular endothelial growth factor. Molecular Vision 2011;
17:3468-3480.
23. Luo H, Chen Z, Jin H, Zhuang M, Wang T, Su C, Lei Y, Zou J, Zhong B.
Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein
kinase C pathway in non-small cell lung cancer. J Exp Clin Cancer Res 2011;
30:6.
24. Rizzo MT. Cyclooxygenase-2 in oncogenesis. Clin Chim Acta 2011;
412:671-687.
25. Solomon A, Li DQ, Lee SB, Tseng SC. Regulation of collagenase,
stromelysin, and urokinase-type plasminogen activator in primary pterygium
body fibroblasts by inflammatory cytokines. Invest Ophthalmol Vis Sci 2000;
41:2154-2163.
26. Di Girolamo N, Wakefield D, Coroneo MT. UVB-mediated induction of
cytokines and growth factors in pterygium epithelial cells involves cell surface
receptors and intracellular signaling. Invest Ophthalmol Vis Sci 2006; 47:2430-
2437.
27. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular
endothelial growth factor is a secreted angiogenic mitogen. Science 1989;
246:1306-1309.
28. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF.
Tumor cells secrete a vascular permeability factor that promotes accumulation
of ascites fluid. Science 1983; 219:983-985.
29. Aspiotis M, Tsanou E, Gorezis S, Ioachim E, Skyrlas A, Stefaniotou M,
Malamou-Mitsi V. Angiogenesis in pterygium: study of microvessel density,
vascular endothelial growth factor, and thrombospondin-1. Eye 2007; 21:1095-
1101.
30. Fallah Tafti MR, Khosravifard K, Mohammadpour M, Hashemian MN,
Kiarudi MY. Efficacy of intralesional bevacizumab injection in decreasing
pterygium size. Cornea 2011; 30:127-129.
100
Table I. Results of the immunohistochemical analysis for
VEGF, TGF- and PGE2 in normal human conjunctiva.
EPITHELIAL
CELLS
VASCULAR
ENDOTHELIUM
STROMAL
CELLS
VEGF + - -
TGF-
PGE2 + - -
+++, strong immunoreactivity; ++ , relevant immunoreactivity; +, moderate
immunoreactivity; +/-, weak immunoreactivity; -, absence of
immunoreactivity.
Table II. Results of the immunohistochemical analysis for
VEGF, TGF-Β and PGE2 in pterygium.
EPITHELIAL
CELLS
VASCULAR
ENDOTHELIUM
STROMAL
CELLS
VEGF +++ ++ ++
TGF- + +
PGE2 ++ + +
+++, strong immunoreactivity; ++ , relevant immunoreactivity; +, moderate
immunoreactivity; +/-, weak immunoreactivity; -, absence of
immunoreactivity.
101
Table III. Levels of VEGF, TGF- and PGE2 examined in
pterygium and control specimens, and respective levels of
statistical significance (t-test)
PTERYGIUM CONTROLS p-VALUE
VEGF
Epithelial cells
Vascular endothelium
Stromal cells
72.92%
72.92%
87.80%
42.03%
0%
0%
p=0.0035
-
-
TGF-
Epithelial cells
Vascular endothelium
Stromal cells
32.32%
22.16%
47.70%
22.30%
19.10%
19.36%
p=0.0294
p=0.0380
p=0.0209
PGE2
Epithelial cells
Vascular endothelium
Stromal cells
62.03%
47.70%
49.90%
36.26%
0%
0%
p=0.0334
-
-
102
Figure legends: Fig. 1-A. Hematoxylin and eosin stain of human normal
conjunctival tissue. The epithelium of the conjunctival tissue is columnar
stratified and elevated numbers of goblet cells are present in this area (40X).
Fig. 1-B. Hematoxylin and eosin stain of human pterygium. Irregular
epithelium and richly vascularized stroma. The epithelium is adapted to
smoothen the stromal irregularities and in some areas becomes invaginated.
The stroma of the pterygium is made up of connective tissue, rich in new blood
vessels, in fibroblasts and connective fibrils (40X). Fig. 1-C.
Immunohistochemical analysis of normal conjunctiva for VEGF. A moderate
expression of VEGF is seen in the epithelial conjunctival cells while VEGF
expression was not found in the vascular endothelial and stromal cells (40X).
Fig. 1-D. Immunohistochemical analysis of human pterygium for VEGF. VEGF
immunoreactivity appears to be strongly positive in the endothelial cells of
blood vessels, epithelial cells and in the stromal inflammatory tissue (40X).
103
Figure legends: Fig.2-A. Immunohistochemical analysis of normal
conjunctiva for TGF-. TGF- immunolabeling was very weak in the epithelial,
endothelial and stromal layers. Fig. 2-B. Immunohistochemical analysis of
human pterygium for TGF-. Evident expression of TGF- in the epithelial cells
is visible. Immunoreactivity in the fibroblasts of the connectival tissue appeared
strong in some cells. Weak immunolabeling in the endothelial cells of blood
vessels is also visible (40X). Fig. 2-C. Immunohistochemical analysis of normal
conjunctiva for PGE2. PGE2 immunolabeling was moderate in the epithelial cells.
PGE2 expression was not found in the endothelial cells of the vessels (40X).
Fig. 2-D. Immunohistochemical analysis of human pterygium for PGE2. Intense
expression of PGE2 in the columnar stratified epithelium and moderate
immunolabeling in stromal cells are visible (100X).
104
Chapter 5
Growth factors, their receptor expression
and markers for proliferation of
endothelial and neoplastic cells in human
osteosarcoma
E. Bianchi1*, M. Artico1*, C. Di Cristofano2, M. Leopizzi2,
S. Taurone1, M. Pucci1, P. Gobbi3, F. Mignini4,V. Petrozza2,
I. Pindinello1, M.T. Conconi5 and C. Della Rocca2
* THESE AUTHORS CONTRIBUTE EQUALLY TO THIS ARTICLE
1Department of Sensory Organs, University of Rome “ Sapienza”,Rome, Italy
2Department of Medical-Surgical Sciences and Biotechnologies, University of
Rome “ Sapienza”,Rome, Italy
3Department of SteVA, University “Carlo Bo”, Urbino, Italy
4School of Drug and Health Products Sciences, University of Camerino,
Camerino, Italy
5Department of Pharmaceutical Sciences, University of Padua, Padua, Italy
International Journal of Immunopathology and
Pharmacology 2013; 26 (3): 621-632
Key Words: neurotrophins - vascular endothelial growth factor (VEGF) -
prostaglandin E2 (PGE2) - transforming growth factor-β (TGF β) - Ki-67 –
osteosarcoma
105
Abstract
Osteosarcoma is the most common primary malignant tumour of the bone.
Although new therapies continue to be reported, osteosarcoma-related
morbidity and mortality remain high. Modern medicine has greatly increased
knowledge of the physiopathology of this neoplasm. Novel targets for drug
development may be identified through an understanding of the normal
molecular processes that are deeply modified in pathological conditions. The
aim of the present study was to investigate, by immunohistochemistry, the
localisation of different growth factors and of the proliferative marker Ki-67 in
order to determine if these factors are involved in the transformation of
osteogenic cells and in the development of human osteosarcoma. We observed
a general positivity for NGF – TrKA – NT3 – TrKC - VEGF in the cytoplasm of
neoplastic cells and a strong expression for NT4 in the nuclear compartment.
TGF-β was strongly expressed in the extracellular matrix and vascular
endothelium. BDNF and TrKB showed a strong immunolabeling in the
extracellular matrix. Ki-67/MIB-1 was moderately expressed in the nucleus of
neoplastic cells. We believe that these growth factors may be considered
potential therapeutic targets in the treatment of osteosarcoma although proof
of this evidence requires further investigations.
Introduction
Osteosarcoma is the most common primary malignant bone tumour in
adolescents and young adults. Osteosarcoma includes several different
pathological entities, differing in clinical, radiological, and histological features.
Clinical-pathological subtypes range from low-grade lesions with low malignant
potential, towards high-grade lesions that express a marked potentiality for
metastatic dissemination (1). Although the efficacy of the oncological treatment
of osteosarcoma, consisting of chemotherapy and a surgical excision of the
tumor, continues to improve, osteosarcoma-related morbidity and mortality
106
remain high. The survival of patients affected by osteosarcoma is conditioned
by metastasis. Metastatic tumours are often not responsive or only partially
responsive to current therapeutic strategies and are the primary cause of
cancer-related mortality. Little is known about the molecular mechanisms that
control the pathogenesis of osteosarcoma. There is evidence that the course
of this disease may be influenced by the presence of various proteins which
play a key-role in proliferation, chemo-resistance and angiogenesis (2).
Angiogenesis, the sprouting of new capillaries from pre-existing blood vessels,
is a regulated process essential in reproduction, development and tissue repair
(3). It is known that angiogenesis is an essential component in cancer
development, supplying the tumour with nutrients, oxygen and growth factors
as well as for metastatic spreading. A more extensive angiogenic response may
indicate a very aggressive tumour with a less favourable prognosis and
quantification of this characteristic could provide an indication of tumour
behaviour. Angiogenesis is induced by a variety of growth factors, but the most
important factor of angiogenesis is the vascular endothelial growth factor
(VEGF). VEGF, also known as vascular permeability factor, exists in different
isoforms which are generated by alternative splicing of a single gene (4).
Although the different isoforms seem to express identical biological activities,
only the two smaller forms (VEGF121 and VEGF165) are secreted in soluble form,
whereas the larger ones remain cell-associated (5). The expression of VEGF is a
signal of the tyrosine kinase cascate activation initiated by binding VEGF to the
VEGF receptor (VEGFR). As a result of this process, new vessel formation
around the tumor is initiated (6). Prostaglandins (PGE1 and PGE2), potent
stimulators of bone formation, and other growth factors rapidly induce VEGF
expression in osteoblasts (7). The transforming growth factor βs (TGF-βs) are a
family of multifunctional cell peptides that regulate cell growth, differentiation,
and extracellular matrix production. Three TGF-β isoforms have been identified
in human tissues and bone matrix. Previous studies showed that TGF-β was
localized in osteoblasts and osteoclasts of fetal bones from different species (8).
TGF-β1 is released by the osteoblasts in the extracellular matrix in a latent form
and may be activated by the osteoclasts during the resorptive phase (9). The
107
active molecule may also influence bone resorption by inhibiting the formation
of new osteoclasts from their precursors and decreasing the activity of mature
osteoclasts (10). In a previous study, employing osteosarcoma cell lines, Kloen
et al. (11) were able to demonstrate that these neoplastic cells produce TGF-β
that stimulates their own proliferation, suggesting that an autocrine loop
involving TGF-β may contribute to the growth of human osteosarcomas.
Another study showed that high-grade osteosarcomas had a significantly higher
expression of TGF-β1 than low-grade osteosarcomas, while levels of TGF-β2 and
TGF-β3 were comparable in the two groups (12). There are no data in the
literature on the expression of neurotrophins in osteosarcoma cell lines.
Neurotrophins (NTs), also known as neurotrophic factors, constitute a family of
dimeric proteins working as polypeptidic growth factors, which include nerve
growth factor (NGF), brain derived growth factor (BDNF), neurotrophin-3 (NT-
3), NT-4/5 and NT-6, the last being apparently specific for fish (13). Biological
actions of NTs are mediated by the binding with two families of membrane
receptors, the high-affinity tyrosine kinase (Trk) and the low-affinity p75
(p75NT receptor) receptors (14). The Trk family includes TrkA, TrkB and TrkC
receptors, whereas p75NT receptor belongs to the trans-membrane molecules
serving as receptor for tumor necrosis factor and cytokines (15). TrkA is
specifically activated by NGF, whereas TrkB and TrkC are primarily receptors for
BDNF and NT-3 respectively (16, 17). NTs are involved in vertebrate neuronal
cell development, differentiation, survival and functional activities. NTs are also
involved in the modulation of adult central nervous system functions and
organization, as well as in the vegetative innervation of several organs (16).
Moreover, detailed studies have revealed significant actions of neurotrophins in
a wide variety of tissues outside the nervous system, especially in the immune
system (18). All these findings prompted us to investigate the localization and
intracellular distribution of the above mentioned growth factors and their
relative receptors, to determine whether these growth factors are involved in
the insorgence and development of the human osteosarcoma. In the present
study we also investigated the expression of VEGF, PGE2, TGF-β and
neurotrophins by immunohistochemical and immunofluorescence techniques in
108
some tissue samples of osteosarcoma not otherwise specified (NOS) and
osteosarcoma cell lines: the aim of this investigation was to elucidate the role
of these proteins in osteosarcoma carcinogenesis. Ki-67, a nuclear antigen that
has proved to be useful in assessing several tumors, provides informations
about cell proliferation and, consequently, long – term prognosis (19). Hence,
we decided to investigate, together with the analysis of the growth factors
pattern, the expression level of Ki67 to define its possible role as a prognostic
factor in osteosarcoma. The identification of these growth factors is crucial for
understanding tumor dissemination and for the development of novel therapies.
Materials and Methods
Population Study
The population of this study included 50 formalin-fixed, paraffin-embedded
blocks of surgical osteosarcoma specimens obtained from the files of the
Department of Medical Surgical Sciences and Biotechnologies, Sapienza
University of Rome, Polo Pontino, I.C.O.T, Latina, Italy. The osteosarcoma
specimens were harvested from 50 patients with osteosarcoma not otherwise
specified (NOS) aged 10-38 years. During excision, apart from anaesthesia, no
other chemical product or pharmaceutical drug had been administered. Core
tissue biopsies of 1 mm in diameter were taken from representative regions of
each paraffin-embedded tumor (donor block) and arrayed into a new recipient
paraffin block (45 mm x 20 mm) using the ATA-100 chemicon International
System. To minimize the influence of tumor and tissue hetero-geneity, three
different core biopsies for each donor block were harvested. Each array
contained 50 tissue cylinders. Experiments were performed in compliance with
the Italian laws and guidelines concerning the patients written informed
consent. The ethical committee of the Hospital Policlinico Umberto I approved
our study according to the European Community and Italian laws.
109
Cell Culture
Human osteosarcoma cell lines (SaOS-2, MG-63, 143 PML BK TK and HS888.T)
were grown under subconfluent or confluent conditions in medium, at 37°C
with 5% of CO2. Saos-2 is a non-transformed cell line derived from the primary
osteosarcoma of a 11 year old Caucasian female (osteogenic sarcoma). MG-63
is a cell line derived from an osteosarcoma of a 14 year old Caucasian male
(high yields of interferon). 143 PML BK TK is a cell line derived from primary
osteosarcoma of a 13 year old Caucasian female (adherent cells with
fibroblastic morphology). Hs888.T is a cell line derived from osteosarcoma of a
20 year old Caucasian male (adherent cells with mixed morphology). Cells were
cultured in Dulbecco's minimum essential medium (Sigma) supplemented with
10% fetal bovine serum (GIBCO) with penicillin (100μg/ml), streptomycin
(100U/ml) and sodium pyruvate. Cells were cultured on cover glass for
immunofluorescence analysis and were fixed with 3%
paraformaldehyde/phosphatase-buffered saline.
Immunohistochemical analysis
The method employed for immunohistochemical tests was ABC/HRP technique
(avidin complexed with biotinylated peroxidase). Serial 3-μm thick sections
were cut using a rotative microtome, mounted on gelatin-coated slides and
processed for immunohistochemistry. These sections were deparaffinized in
xylene and dehydrated. They were immersed in citrate buffer (pH 6) and
subjected to microwave irradiation twice for 5 minutes eachtime.
Subsequently, all sections were treated for 30 minutes with 0.3% hydrogen
peroxide in methanol to quench endogenous peroxidase activity. To block non-
specific binding, the slides were incubated in 3% normal goat serum in PBS for
30 minutes at room temperature. In order to study the immunolocalization of
neurotrophins and their own receptors, the following antibodies were used: i)
rabbit anti-NGF polyclonal antibody (Santa Cruz Biotechnology, CA, USA; ii)
rabbit anti-BDNF polyclonal antibody (Santa Cruz Biotechnology, CA, USA; iii)
rabbit anti-NT3 polyclonal antibody (Santa Cruz Biotechnology; iv) rabbit anti-
NT4 polyclonal antibody (Santa Cruz Biotechnology); v) rabbit anti-TrKA
110
polyclonal antibody (Santa Cruz Biotechnology); vi) rabbit anti-TrKB polyclonal
antibody (Santa Cruz Biotechnology); vii) rabbit anti-TrKC polyclonal antibody
(Santa Cruz Biotechnology); viii) mouse anti-VEGF monoclonal antibody (abcam
Cambridge Science Park, UK); ix) mouse anti-TGF-β1 monoclonal antibody
(abcam Cambridge Science Park, UK); x) rabbit anti-PGE2 polyclonal antibody
(abcam Cambridge Science Park, UK); xi) rabbit anti-ki-67 polyclonal antibody
(Santa Cruz Biotechnology). Incubation with primary antibodies was performed
overnight at 4˚C at a final concentration of 2-5 μg/ml. Optimal antisera
dilutions and incubation times were assessed in a series of preliminary
experiments. After exposure to the primary antibodies, slides were rinsed twice
in phosphate buffer and incubated for 1 h at room temperature with the
appropriate secondary biotinylated goat anti-mouse or anti-rabbit Ig-G (vector
laboratories Burlingame, CA, USA, BA9200 and BA1000) and with peroxidase-
conjugated avidin (Vector laboratories, Burlingame, CA, USA, Vectastain Elite
ABC Kit Standard* PK 6-100) for 30 minutes. After a further wash with
phosphate buffer, slides were treated with 0.05% 3,3-diaminobenzidine (DAB)
and 0.1% H2O2. Finally, sections were counterstained with Mayer's hematoxylin
and observed using a light microscope. Negative control experiments were
done: i) by omitting the primary antibody; ii) by substituting the primary
antibody with an equivalent amount of non-specific immunoglobulins; iii) by
pre-incubating the primary antibody with the specific blocking peptide
(antigen/antibody = 5 according to supplier's instructions). The staining
assessment was made by two experienced observers in light microscopy. The
intensity of the immune reaction was assessed microdensitometrically using an
IAS 2000 image analyzer (Delta Sistemi, Rome, Italy) connected via a TV
camera to the microscope. The system was calibrated taking the background
obtained in sections exposed to non-immune serum as zero. Ten 100 μm2 areas
were delineated in each section by a measuring the diaphragm. Quantitative
data of the intensity of the immune staining were analyzed statistically by
analysis of the variance (ANOVA) followed by Duncan’s multiple range test as a
post hoc test.
111
Immunofluorescence in osteosarcoma cell lines
Cellular cultures (SaOS, MG-63, 143 PML BK TK and HS888.T) were incubated
with primary antibody and then with fluoresceinated secondary antibody. The
anti-mouse Alexa Fluor 488 antibody or anti-rabbit Alexa Fluor 488 antibody
(1:300) was applied for 2h at 37°C after three washes in 0.1% Tween in PBS
for 10min each. Slides were counterstained with DAPI (Vectashield Mounting
Medium with DAPI) after extensive washing with PBS. The reaction was
examined by confocal laser microscope (Nikon TE2000) for immunofluorescence
analysis. Membranous, cytoplasmic, and nuclear expressions were
independently assessed.
Results
Immunohistochemical analysis
Sections of bone tissues taken from patients suffering from not otherwise
specified osteosarcoma (NOS) exposed to the primary/secondary antibodies,
developed a dark-brown (intense), yellow-brown (slight) or no appreciable
immunostaining. Immunoreactivity was specific since no immunostaining was
obtained in positive control sections incubated with each primary antibody
adsorbed with the specific peptide or with pre-immune serum (data not shown).
Osteosarcoma is a heterogeneous group of malignant spindle cell tumors whose
common feature is the production of immature bone which, if non calcified, is
also known as osteoid. The sections harvested from osteogenic tissues showed,
in the neoplastic cells, a relevant immunoreactivity for NGF in the cytoplasmic
compartment while it was absent in the nuclear compartment (Fig. 1A). TrKA
immunoreactivity was significantly high in the cytoplasmic compartments of the
neoplastic cells, but moderate in the extracellular space (Fig. 1B). BDNF showed
a high expression in the extracellular compartment and was moderate in the
cytoplasmic compartment of neoplastic cells (Fig. 2A). TrKB was moderately
expressed in the cytoplasmic compartment of the neoplastic cells and
extracellular matrix (Fig. 2B). NT-3 was appreciable in the cytoplasmic
112
compartment of osteogenic tissue and weakly expressed in the extracellular
space (Fig. 3A). NT-4 showed a strong expression in the nuclear compartment
of the neoplastic cells in the osteogenic tissue and weak in the extracellular
matrix (Fig. 3B). Immunoreactivity for TrKC was strongly present in cytoplasmic
compartment of the neoplastic cells and moderate in the extracellular space.
These results showed a direct proportionality between the profiles of the
expression of neurotrophins and their target receptors. Positive
immunoreactivity for Ki67 was found only in the nuclear compartment of the
neoplastic cells (Fig. 4). VEGF expression was observed not only in tumor cells
but also throughout the extracellular matrix and endothelial cells of the
surrounding vessels (Fig. 5). TGF-β was not observed in the cytoplasmic and
nuclear compartments of tumor cells but was strongly expressed in the
extracellular matrix and vascular endothelium (Fig. 6). VEGF was expressed
more strongly within the vascular endothelial cells of the extracellular matrix
than within the tumor cells (insert here figures 4-6). The presence of VEGF-A in
osteosarcoma biopsy samples was observed with variable intensity within the
cytoplasm and/or membrane of osteosarcoma cells. These data are specified in
detail in Table I. The percentage values of growth factor-positive cells and P-
values are shown in Table II (t-test).
Immunofluorescence protein expression in cell culture
The immunofluorescence was performed on osteosarcoma cell lines as
described above (SaOS, MG-63, 143 PML BK TK and HS888.T) to evaluate the
level of expression and localization of VEGF, TGF-β and PGE2. All of these cell
lines were positive for VEGF and PGE2 proteins (Table III). In osteosarcoma cell
lines no signal for TGF-β was observed (Fig. 8). VEGF and PGE2 showed a high
intensity of fluorescence, whereas only a diffuse signal was appreciable in the
cytoplasmic compartment (Fig. 7A-B) (insert here figures 7-8).
Immunofluorescence on osteosarcoma cell lines confirmed the localization of
VEGF in cytoplasmic area of neoplastic cells and the total absence of TGF-β in
these cells as shown by immunohistochemical studies. Results concerning the
immunoreactivity for VEGF, TGF-β and PGE2 are summarized in Table III.
113
Discussion
Osteosarcoma is the most common primary malignant bone tumour in pediatric-
age patients in which the osteoid or bone is produced directly by tumor cells
(20). The prognosis of osteosarcoma patients resulted in a significant
improvement after the introduction of neoadjuvant chemotherapy.
Notwithstanding the advances made in the therapeutic approach to these
lesions, approximately 20-30% of patients with an osteosarcoma will eventually
develop a metastasis, which may cause death (21). The treatment of
osteosarcoma is based on a combined approach of primary antiblastic
chemotherapy and tumour surgery, followed by adjuvant chemotherapy (22).
The identification of molecular events related to tumour biology and growth is
crucial for understanding tumor dissemination and for the development of a
novel therapy. The course of the disease may be modified by the contribution
of various proteins which play a key role in proliferation, chemoresistance and
angiogenesis. Angiogenesis, which is defined as the formation of new blood
vessels from existing capillaries, is a normal and vital process in the growth and
development of both normal tissues and tumours. One of the most potent and
specific angiogenic factors is vascular endothelial growth factor (VEGF), also
known as vascular permeability factor and vasculotropin. Recent reports
showed that patients with VEGF-positive osteosarcoma have lower survival
rates than VEGF-negative ones (23). Other studies failed to show a correlation
between the levels of VEGF or microvascular density and survival of patients
with osteosarcoma (24). The purpose of this study was to demonstrate the
strong association between a high expression of VEGF and development of the
bone tumour. Our data showed that the expression of immunoreactivity for the
VEGF growth factor was higher within the vascular endothelial cells, rather than
inside osteoblastic tumour cells, thus demonstrating the involvement of this
vascular growth factor in the induction and regulation of pathological
angiogenesis. In the future, the assessment of VEGF may be helpful both for
predicting the prognosis of patients with osteosarcoma and also for indicating a
114
particular target therapy. Prostaglandins E1-E2 (PGE1-PGE2), strong stimulators
of bone formation, rapidly induced VEGF expression in osteoblastic cells (7).
Our data showed strong cytoplasmic expression of PGE2 in human osteoblastic
osteosarcoma cell lines (SaOS, MG-63, 143 PML BK TK and HS888.T) similarly
to VEGF, confirming a close correlation between the expression of PGE2 and
VEGF in osteosarcoma. Transforming growth factor-β (TGF-β) is a polypeptide
with multiple physiological functions. This growth factor plays an important role
in the control of the cell cycle and in the regulation of cell-cell interactions
(25). Local production of large amounts of TGF-β in the skeletal tissue
combined with its pivotal role in osteoblast behaviour suggest the presence of a
well-balanced autocrine control in normal bone (26). A deregulation of TGF-β
autocrine control in the bone could lead to the disease states characterized by
decreased bone formation, such as osteoporosis, or malignant transformation
such as that which occurs in osteosarcoma (27). The production of endogenous
TGF-β may induce a direct positive autocrine growth effect in fibroblasts and
osteoblasts. Our studies showed that TGF-β was not present in tumour cells,
but only in the extracellular matrix and in the endothelial cells of the
surrounding vessels. These results suggest that TGF-β operates not only on the
growth of tumour cells, but also on the changes in local micro-environment.
These data also suggest that TGF-β isoform alone is not sufficient to explain the
entire aspect of metastasization and requires further studies. In view of the
importance of TGF-β for controlling the growth of osteosarcoma, elucidation of
the mechanisms involved in the regulation of its expression could improve our
understanding of the biological behaviour of these neoplasms and plays a role
in the development of new therapeutic strategies. Ki-67, a nuclear antigen
recognized by the monoclonal antibody MIB-1, was statistically elevated in
higher-grade tumors and metastatic lesions, but was not influenced by tumour
type or patient's sex. Significant differences in Ki-67 expression were noted
among primary tumours, treated tumours and metastatic lesions: treatment
resulted in a reduction of tumor proliferative activity, while tumour progression
was associated with increased proliferative activity. In addition, proliferative
activity was noted to be associated with tumour grade and aggressiveness (28).
115
In our studies Ki-67 resulted mildly detectable in tumoural cells, but totally
absent in the vascular endothelium. However, the distribution and localization
of this factor in human neoplastic bone cells is confirmed to be nuclear. These
findings could be of clinical significance for monitoring disease progression and
response to treatment with chemotherapy and radiotherapy. Neurotrophic
growth factors (NGF, BDNF, NT-3 and NT-4) binding TrK receptors (TrKA, TrKB
and TrKC) cause neuronal cell differentiation, proliferation and survival, thus
regulating neuronal development and maintenance of neuronal networks (29).
In addition to their involvement in the nervous system, TrK receptors and
neurotrophins appear to participate in homeostatic and reparative bone
morphogenesis (30) as well as to play a role in some pathological processes,
including tumourigenesis. Previous studies have suggested that TrkA signalling
exerts antiapoptotic effects in murine and human immortalized bone-forming
cells. In the MC3T3-E1 murine osteoblast cell line, activation of TrKA with NGF
reduces apoptotic DNA breakdown in osteoblasts secondary to cytotoxic
treatments (31). In the human osteoblast cell line hFOB, the antiapoptotic
effects of TrKA signalling appear to be cell-cycle dependent (32). NGF-mediated
signalling through the TrKA receptor appears to protect proliferating osteoblast
cells from programmed cell death. In our observations we found a relevant
immunoreactivity for neurotrophins in the cytoplasmic compartment of the
human neoplastic cells similarly to their receptors, whereas a weak level was
observed in the extracellular matrix. On the other hand, NT-4 showed a
moderate expression in the nuclear compartment of bone neoplastic cells,
suggesting the direct role of this neurotrophin in increasing the proliferation
rate of the neoplastic cells. To sum up, we observed a generally relevant
positive immunoreaction for NGF – TrKA – NT3 – TrKC in the cytoplasmic
compartment and for NT-4 in the nucleus of tumoural bone cells, suggesting a
direct role of these molecules in increasing the cell proliferation rate in the
neoplastic tissue. Moreover, we found a strong expression for BDNF in the
extracellular space, suggesting that this factor directly influences spreading of
neoplastic cells, attributable to an increase in tumor size, also due to a high
vascularization network. Neurotrophins and their receptors may finally be used
116
all together as a panel of possible diagnostic factors, to monitor the histological
transformation and development of osteosarcomas. The current antiproliferative
chemotherapies used to treat patients with osteosarcoma may induce
debilitating side effects, including hematological, liver, renal, cardiac,
neurological and gonadal toxicity. These agents are also mutagenic and can
cause secondary malignancies, most commonly leukemia, brain cancer, soft
tissue sarcomas and breast cancer (32). In conclusion, treatment regimens
against specific targets such as growth factors (neurotrophins, tyrosine kinases,
VEGF, PGE2 and TGF-β) are likely to produce less toxic side effects.
Consequently, such targeted therapies may offer patients the hope of an
improved quality of life as well as increased survival. Additional studies are,
however, necessary to better explain the biological role of these molecules in
the development and progression of this type of tumours.
117
References
1. Yonemoto T, Tatezaki S, Ishii T, Satoh T, Kimura H, Iwai N. Prognosis of
osteosarcoma with pulmonary metastases at initial presentation is not dismal.
Clin Orthop Relat Res 1998; 349: 194-199.
2. Kaya M, Wada T, Akatsuka T, Kawaguchi S, Nagoya S, Shindoh M, Higashino
F, Mezawa F, Okada F, Ishii S. Vascular endothelial growth factor expression in
untreated osteosarcoma is predictive of pulmonary metastasis and poor
prognosis. Clin Cancer Res 2000; 6:572-577.
3. Folkman J, Shing Y. Angiogenesis. J Biol Chem 1992; 267: 10931-10934.
4. Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC,
Abraham JA. The human gene for vascular endothelial growth factor. Multiple
protein forms are encoded through alternative exon splicing. J Biol Chem 1991;
266:11947-11954.
5. Houck KA, Leung DW, Rowland AM Winer J, Ferrara N. Dual regulation of
vascular endothelial growth factor bioavailability by genetic and proteolytic
mechanisms. J Biol Chem 1992; 267: 26031-26037.
6. Prior BM, Yang HT, Terjung RL. What makes vessels grow with exercise
training? J App Physiol 2004; 97: 1119-1128.
7. Harada S-I, Nagy JA, Sullivan KA, Thomas KA, Endo N, Rodan GA, Rodan SB.
Induction of vascular endothelial growth factor expression by prostaglandin E2
and E1 in osteoblasts. J Clin Invest 1994; 93:2409-2496.
8. Sandberg M, Autio-Harmainen H, Vuorio E. Localization of the expression of
types I, III and IV collagen, TGF-β1 and c-fos genes in developing human
calvarial bones. Dev Biol 1988; 130: 324-334.
9. Oreffo RO, Mundy GR, Seyedin SM, Bonewald LF. Activation of the bone-
derived latent TGF beta complex by isolated osteoclasts. Biochem Biophys Res
Commun 1989; 158: 817-823.
10. Hattersley G, Chambers TJ. Effects of transforming growth factor β1 on the
regulation of osteoclastic development and function. J Bone Miner Res 1991; 6:
165-172.
118
11. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. Expression
of transforming growth factor-beta (TGF-β) receptors, TGF-β1 and TGF-β-2
production and autocrine growth control in osteosarcoma cells. Int J Cancer
1994; 58: 440-445.
12. Franchi A, Arganini L, Baroni G, Calzolari A, Capanna R, Campanacci D,
Caldora P, Masi L, Brandi ML, Zampi G. Expression of transforming growth
factor beta isoforms in osteosarcoma variants: association of TGF-β1 with high-
grade osteosarcomas. J Pathol 1998; 185: 284-289.
13. Lewin GR, Barde YA. Physiology of neurotrophins. Annu Rev Neurosci 1996;
9: 289-317.
14. Barbacid M. The Trk family of neurotrophin receptors. J Neurobiol 1994; 25:
1386-1403.
15. Serra M, Picci P, Ferrari S, Bacci G. Prognostic value of P-glycoprotein in
high-grade osteosarcoma. J Clin Oncol 2007; 25:4858-4860.
16. Lomen-Hoerth C, Shooter EM. Widespread neurotrophin receptor expression
in the immune system and other non-neuronal rat tissue. J Neurochem 1995;
64: 1780-1789.
17. Lommatzsch M, Braun A, Mannsfeldt A, Botchkarev VA, Botchkareva NV,
Paus R, Fischer A, Lewin GR, Renz H. Abundant production of brain-derived
neurotrophic factor by adult visceral epithelia. Implications for paracrine and
target-derived neurotrophic functions. Am J Pathol 1999; 155: 1183-1193.
18. Otten U, Gadient RA. Neurotrophins and cytokines--intermediaries between
the immune and nervous systems. Int J Dev Neurosci 1995; 13: 147-151.
19. Kim SY, Chung SH, Kim HJ, Whang K, Han YP, Hong SK. Bcl-2 and Bax
expression and Ki-67 proliferative index in astrocytic tumors: in relation to
prognosis. J Korean Neurosurg Soc 2004; 35: 465 – 471.
20. Campanacci M, editor. Bone and soft tissue tumors. Ed. Springer-Verlag:
Wien-New York 1999.
21. Bacci G, Ferrari S, Bertoni F, Picci P, Bacchini P, Longhi A, Donati D, Forni C,
Campanacci L, Campanacci M. Histologic response of high-grade nonmetastatic
osteosarcoma of the extremity to chemotherapy. Clin Orthop Relat Res 2001;
386:186-196.
119
22. Ferrari S, Zanella L, Alberghini M, Palmerini E, Staals E, Bacchini P.
Prognostic significance of immunohistochemical expression of ezrin in non-
metastatic high-grade osteosarcoma. Pediatr Blood Cancer 2008; 50:752-756.
23. Qu JT, Wang M, He HL, Tang Y, Ye XJ. The prognostic value of elevated
vascular endothelial growth factor in patients with osteosarcoma: a meta-
analysis and systemic review. J Cancer Res Clin Oncol, 2012; 138:819-825.
24. Ek ET, Ojaimi J, Kitagawa Y, Choong PF. Does the degree of intratumoral
microvessel density and VEGF expression have prognostic significance in
osteosarcoma? Oncol Rep 2006; 16:17-23.
25. Chang HL, Gillett N, Figari I, Lopez AR, Palladino MA, Derynck R. Increased
transforming growth factor beta expression inhibits cell proliferation in vitro, yet
increases tumorigenicity and tumor growth of Meth A sarcoma cells. Cancer
Res 1993; 53:4391-4398.
26. Arrick BA, Lopez AR, Elfman F, Ebner R, Damsky CH, Derynck R. Altered
metabolic and adhesive properties and increased tumorigenesis associated
with increased expression of transforming growth factor beta 1. J Cell Biol
1992; 118: 715-726.
27. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. Expression
of transforming growth factor-beta (TGF-beta) receptors, TGF-beta 1 and TGF-
beta 2 production and autocrine growth control in osteosarcoma cells. Int J
Cancer 1994; 58:440-445.
28. Hernandez-Rodriguez NA, Correa E, Sotelo R, Contreras-Paredes A, Gomez-
Ruiz C, Green L, Mohar A. Ki-67: a proliferative marker that may predict
pulmonary metastases and mortality of primary osteosarcoma. Cancer Detect
Prev 2001; 25:210-215.
29. Hennigan A, O’Callaghan RM, Kelly AM. Neurotrophins and their receptors:
Roles in plasticity, neurodegeneration and neuroprotection. Biochem. Soc Trans
2007; 35:424-427.
30. Asaumi K, Nakanishi T, Asahara H, Inoue H, Takigawa M. Expression of
neurotrophins and their receptors (TrK) during fracture healing. Bone 2000;
26:625-633.
120
31. Mogi M, Kondo A, Kinpara K, Togari A. Anti-apoptotic action of nerve
growth factor in mouse osteoblastic cell line. Life Sci 2000; 67:1197-1206.
32. Pinski J, Weeraratna A, Uzgare AR, Arnold JT, Denmeade SR, Isaacs JT. TrK
receptor inhibition induces apoptosis of proliferating but not quiescent human
osteoblasts. Cancer Res 2002; 62:986-989.
121
Figure 1. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for NGF (A) and TrKA (B). (A) NGF immunoreactivity
appears to be positive in the cytoplasmic compartment of neoplastic cells and
absent in extracellular matrix and endothelial cells of vessels. (B) TrKA
immunoreactivity was significantly high in the cytoplasmic area of the neoplastic
cells, but moderate in the extracellular space (20X).
Figure 2. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for BDNF (A) and TrKB (B). (A) BDNF and (B) TrKB
immunoreactivity appears to be moderately expressed in the cytoplasmic
compartment of neoplastic cells and strongly expressed in extracellular matrix,
but totally absent in vascular endothelium (40X).
122
Figure 3. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for NT3 (A) and NT4 (B). (A) NT-3 immunoreactivity
appears to be appreciable in the cytoplasmic compartment of osteogenic tissue
and weak in the extracellular matrix. (B) NT-4 was strongly expressed in the
nuclear compartment of the neoplastic cells in the osteogenic tissue (40X).
Figure 4. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for Ki-67. Ki-67 immunoreactivity appears to be
moderately positive in the nuclear region of neoplastic cells (20X).
123
Figure 5. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for VEGF. VEGF immunoreactivity appears to be positive
in the cytoplasmic compartment of neoplastic cells and strongly expressed in
extracellular matrix and endothelial cells of vessels (10X).
Figure 6. Immunohistochemical analysis of specimens of human osteosarcoma
not otherwise specified for TGF-β. TGF-β appears to be weakly expressed in
the cytoplasmic area of tumoral cells, moderately positive in endothelial cells of
blood vessels and in extracellular tissue (20X).
124
Figure 7. Immunofluorescent staining of VEGF (A) and PGE2 (B) in SaOS
osteosarcoma cell culture. VEGF and PGE2 were localized at cytoplasmic level of
these neoplastic cells (40X).
Figure 8. Immunofluorescent staining of TGF- β MG-63 osteosarcoma cell
culture. In osteosarcoma cell lines no signal for TGF-β was observed (40X)
125
Table I. Results of the immunohistochemical analysis for neurotrophins and
their receptors, VEGF, TGF-β and Ki-67 in osteosarcoma tissues.
NEOPLASTIC CELLS EXTRACELLULAR
MATRIX
VASCULAR
ENDOTHELIUM
NGF ++ (cytoplasmic) - -
TrKA ++(cytoplasmic) + -
BDNF +(cytoplasmic) ++ -
TrKB + (cytoplasmic) + -
NT3 ++ (cytoplasmic) +/- -
NT4 ++(nuclear) +/- -
TrKC ++ (cytoplasmic) + -
VEGF ++ (cytoplasmic) +++ +++
TGF-β -(cytoplasmic) ++ +
Ki-67 + (nuclear) - -
+++: strong immunoreactivity; ++ : relevant immunoreactivity; + : moderate
immunoreactivity; +/- : weak immunoreactivity; -: absence of
immunoreactivity.
126
Table II. Levels of neurotrophins, neurotrophin receptors, VEGF, TGF-β, PGE2
and Ki67 examined in neoplastic cells of osteosarcoma specimens, and
respective levels of statistical significance (t-test)
Age of patients N° of patients
(EXPRESSION 50)%
N° of patients
(EXPRESSION 50%)
NGF 14 years
14 years
30 (60%)
4 (8%)
p-value=0.0007
14 (28%)
2 (4%)
p-value=0.0041
TrKA 14 years
14 years
35 (70%)
4 (8%)
p-value=0.0006
8 (16%)
3 (6%)
p-value=0.0136
BDNF 14 years
14 years
23 (46%)
12 (24%)
p-value=0.0035
11 (22%)
4 (8%)
p-value=0.0136
TrKB 14 years
14 years
38 (76%)
3 (6%)
p-value=0.0004
8 (16%)
1 (2%)
p-value=0.0059
NT3 14 years
14 years
37 (74%)
5 (10%)
p-value=0.0002
6 (12%)
2 (4%)
p-value=0.0121
NT4 14 years
14 years
34 (68%)
6 (12%)
p-value=0.0006
8 (16%)
2 (4%)
p-value=0.0194
TrKC 14 years
14 years
33 (66%)
9 (18%)
p-value=0.0009
7 (14%)
1 (2%)
p-value=0.0082
VEGF 14 years
14 years
40 (80%)
5 (10%)
p-value=0.0030
4 (8%)
1 (2%)
p-value=0.0000
TGF-β 14 years
14 years
3 (6%)
0 (0%)
p-value=0.0377
39(78%)
8 (16%)
p-value=0.0003
Ki-67 14 years
14 years
30 (60%)
2 (4%)
p-value=0.0003
3 (6%)
15 (30%)
p-value=0.0019
127
Table III. Results of the immunofluorescence analysis for VEGF, TGF-β and
PGE2 in human osteoblastic osteosarcoma cell lines (SaOS, MG-63, 143 PML BK
TK and HS888.T).
VEGF
++ (cytoplasmic)
PGE2
++ (cytoplasmic)
TGF-β
+/- (cytoplasmic)
+++, strong immunoreactivity; ++ , relevant immunoreactivity; +, moderate
immunoreactivity; +/-, weak immunoreactivity; -, absence of
immunoreactivity.
128
Chapter 6
Immunohistochemical profile of cytokines
and growth factors expressed in
vestibular schwannoma and in normal
vestibular nerve tissue
S. Taurone1*, E. Bianchi1*, G. Attanasio1, C. Di Gioia2,
R. Ierinó2, C. Carubbi3, D. Galli3, F.S. Pastore4,
F. Giangaspero2,5, R. Filipo1, C. Zanza1 and M. Artico1
Departments of 1Sensory Organs and 2Radiology, Oncology and Human
Pathology, Sapienza University of Rome, Rome; 3Department of Biomedical,
Biotechnological and Translational Sciences, University of Parma, Parma,
Emilia-Romagna; 4Division of Neurosurgery, Tor Vergata University of Rome,
Rome; 5Neuromed Institute, Pozzilli, Isernia, Italy
Molecular Medicine Reports 2015; 12: 737-745
Key words: Schwann cells - acoustic neuromas - transforming growth
factor-β1 - interleukin-1β - tumor necrosis factor-α - interleukin-6 - vascular
endothelial growth factor - intracellular adhesion molecule-1
129
Abstract
Vestibular schwannomas, also known as acoustic neuromas, are benign tumors,
which originate from myelin-forming Schwann cells. They develop in the
vestibular branch of the eighth cranial nerve in the internal auditory canal or
cerebellopontine angle. The clinical progression of the condition involves slow
and progressive growth, eventually resulting in brainstem compression. The
objective of the present study was to investigate the expression level and the
localization of the pro-inflammatory cytokines, transforming growth factor-β1
(TGF-β1) interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α), as well
as the adhesion molecules, intracellular adhesion molecule-1 and vascular
endothelial growth factor (VEGF), in order to determine whether these factors
are involved in the transformation and development of human vestibular
schwannoma. The present study investigated whether changes in inflammation
are involved in tumor growth and if so, the mechanisms underlying this
process. The results of the current study demonstrated that pro-inflammatory
cytokines, including TGF-β1, IL-1β and IL-6 exhibited increased expression in
human vestibular schwannoma tissue compared with normal vestibular nerve
samples. TNF-α was weakly expressed in Schwann cells, confirming that a lower
level of this cytokine is involved in the proliferation of Schwann cells. Neoplastic
Schwann cells produce pro-inflammatory cytokines that may act in an autocrine
manner, stimulating cellular proliferation. In addition, the increased expression
of VEGF in vestibular schwannoma compared with that in normal vestibular
nerve tissue, suggests that this factor may induce neoplastic growth via the
promotion of angiogenesis. The present findings suggest that inflammation may
promote angiogenesis and consequently contribute to tumor progression. In
conclusion, the results of the present study indicated that VEGF and
pro-inflammatory cytokines may be potential therapeutic targets in vestibular
schwannoma. Further studies are necessary to confirm the involvement of
these factors in the growth of neoplasms and to develop inhibitors of
pro-inflammatory cytokines as a potential treatment option in the future.
130
Introduction
Vestibular schwannomas (VS), also known as acoustic neuromas, are the most
frequent benign tumor of the lateral skull base, and originate from Schwann
cells of the vestibular branch of the eighth cranial nerve. VSs are neoplasms
that occur as a result of the increased proliferation of Schwann cells and are
diagnosed histopathologically by the presence of singular architectural patterns
called AntoniA and AntoniB areas. VS represents 8% of all primary intracranial
tumors(1). Individuals between 30and 60years old are the most frequently
affected, and there is no gender prevalence(2,3). The majority of VSs are
sporadic and, in general, are benign slow-growing neoplasms. They exhibit a
wide variability in growth rate and size. If growth continues it may result in
complex pathological conditions, including brainstem compression and
hydrocephalus. Magnetic resonance imaging has a central role in the diagnosis
of this condition, and complete surgical resection remains the preferred
treatment. The growth of VS is not directly correlated with tumor size,
symptoms, duration of symptoms or the patient's age(4). The growth rate of VS
is heterogeneous, at 0.3-1.42mm/year. VS evolves from an abnormal growth
and proliferation of Schwann cells, at their junction with glial cells surrounding
the vestibular nerve. This neoplasm is exclusively formed from the hyperpro-
liferation of Schwann cells and associated neovasculature(5,6). Schwann cells
are principal glial cells of the peripheral nervous system. During embryogenesis,
they migrate along axons and synthesize a basal lamina, consisting
predominantly of laminin, collagen and proteoglycans. Schwann cells have an
important role in nerve regeneration following laceration, when they replace
damaged Schwann cells and synthesize a new basal lamina and myelin sheath.
Following nerve injury, successful remyelination of damaged axons by Schwann
cells relies upon a combination of signals that Schwann cells receive from
demyelinated axons during in the inflammatory response. These signals initially
prompt Schwann cells to re-enter the cell cycle and subsequently to
differentiate into myelinating cells(6). Axonal myelination is important for the
131
functional recovery of injured peripheral nerves. In particular, it facilitates rapid
saltatory impulse conduction by producing a faster conduction velocity of action
potentials(7,8). In order to better understand the molecular mechanisms of
Schwann cells, including cell proliferation, migration, survival and apoptosis
during peripheral nerve injury, the present study aimed to invetigate the
involvement of certain inflammatory cytokines and growth factors in VS. The
majority of the pathogenetic mechanisms regulating neoplastic growth in
vestibular nerve cells, remain to be elucidated. A number of studies have
demonstrated that neurotrophins and growth factors have a role in governing
the development of homeostasis, cell survival and regeneration processes
within Schwann cells(9,10). Although further neoplastic growth appears to
depend on cytokines with angiogenic and mitogenic properties, data concerning
the involvement of growth factors in VS growth are not currently available.
Trophic factors, including transforming growth factor-β1 (TGF-β1) and vascular
endothelial growth factor (VEGF), have been designated as possible key
mediators of VS growth. TGFs are a family of polypeptides involved in wound
healing and tumorigenesis invivo. TGF-β1 may act as either an inhibitor or
stimulator of cell proliferation, depending on the cell type and growth
conditions. TGF-β1 may be involved in the development of VS, stimulating the
proliferation of Schwann cells. The signalling pathway of TGF-β1 is activated by
two transmembrane serine/threonine kinases, TGF-βR1 and TGF-βR2. The
type2 receptor (TGF-βR2) is involved in the antiproliferative activity of TGF-β,
whereas the type1 receptor (TGF-βR1) appears to cause cellular proliferation
following cell-matrix interactions(11). Interactions between cytokines and
Schwann cells are involved in the development of disorders of the peripheral
nervous system. Tumor necrosis factor-α (TNF-α) is a pro-inflammatory
cytokines produced by activated macrophages in response to pathogens and
other noxious stimuli. TNF-α is released by Schwann cells as well as by
macrophages(12). TNF-α, one of the major initiators of the inflammatory
cascade, activates pleiotropic functions in physiological and pathological
conditions by binding to its receptors, typeI (TNFRI) and typeII (TNFRII). Wang
et al. (13) described the involvement of TNF-α-associated signalling molecules,
132
including a baculoviral inhibitor of apoptosis repeat-containing protein (BIRC) 2,
BIRC3 and TNFRI, in the anti-apoptotic process of injured peripheral nerves,
indicating that a higher level of TNF-α may induce apoptosis in Schwann cells
invitro, while a lower level of TNF-α may not act in the same way. Wagner and
Myers(12) confirmed that the production of TNF-α by peripheral nerve glial cells
has a pathogenic role in nerve injury. A number of studies have investigated
the possible role of interleukin (IL)-6 in peripheral nerve regeneration(14,15).
However, the molecular mechanisms underlying the involvement of IL-6 in the
development of Schwann cells remain to be fully elucidated. The induction of
pro-inflammatory genes by IL-6 in Schwann cells may indicate that IL-6 is
involved in the degeneration of injured neurons, in cooperation with other
inflammatory cytokines, such as TNF-α. Certain pro-inflammatory cytokines,
including TNF-α, IL-1β and IL-6 are known to induce the expression of adhesion
molecules. Adhesion molecule expression, including that of intracellular
adhesion molecule-1 (ICAM-1), is tightly-regulated by cytokines generated
during an inflammatory response(16). ICAM-1 is able to facilitate leukocyte
attachment and interactions with cells from the target tissue(17). The
expansion of any solid tumor with a volume >2-3mm is reliant upon
angiogenesis to provide oxygen and nutrients to the enlarging tumor. VEGF
induces angiogenesis through endothelial cell proliferation and migration. It is
considered to be one of the most potent pro-angiogenic factors, causing
vasodilatation, vascular permeability and angiogenesis. Angiogenesis is defined
as the process of new blood vessel formation from pre-existing vasculature and
involves a cascade of processes, during which the vessel's basal membrane and
the surrounding extracellular matrix are modified by endothelial cell
proliferation and migration(18). The binding of VEGF to high-affinity receptors,
VEGFR-1 and VEGFR-2, promotes extravasation of plasma proteins from tumor
vessels, thereby forming a temporary extravascular matrix which favors the
migration and proliferation of endothelial cells, resulting in new blood vessel
formation(19). The aim of the present study was to investigate the expression
of pro-inflammatory cytokines in VS compared with normal vestibular nerve
tissue, using immunohistochemistry, in order to improve understanding of the
133
pathogenesis of this disease. An increased knowledge of this subject may have
significant clinical consequences in terms of improvement in clinical treatment,
prevention of the postsurgical relapse, and a reduction in the severity of
inflammation, tissue invasion, tumor proliferation and angiogenesis.
Materials and methods
Ethical considerations and VS samples
In accordance with approval of the ethical committee of Policlinico Umberto,
Sapienza University of Rome (Rome, Italy), tissues were harvested from ten
randomly selected patients, four females and six males, with unilateral, sporadic
VS that had been removed surgically, and ten healthy control samples, which
consisted of three females and seven males with Ménière's syndrome following
vestibular neurectomy. The patients, aged between 45 and 69years, consisted
of four females and six males. Routine histopathological examination confirmed
the diagnosis of benign VS in the samples, which included one patient with a
tumor recurrence. Prior to signing the consent form, patients were informed
about the study in detail and were given sufficient time to ask questions. The
study was conducted in accordance with the Declaration of Helsinki. Each
clinical unit selected specimens and assigned a number to each sample,
followed by a letter indicating the participating unit. For each case, a report was
prepared, indicating the age and gender of the patient, as well as their clinical
signs and symptoms. Control morphological sections were stained with
hematoxylin and eosin(H&E), or processed for immunohistochemistry. The
following molecules were investigated in the tumoral samples and in normal
vestibular nerve specimens: VEGF, TGF-β1, IL-1β, IL-6, ICAM-1 and TNF-α.
Immunohistochemical analysis
For light microscopic immunohistochemical analysis, small fragments of VS were
processed according to the avidin-biotin complex/horseradish peroxidase
134
technique. These samples were washed in phosphate-buffered saline (PBS),
fixed in 10% formalin and embedded in paraffin according to a standard
procedure(20). Serial 3-μm sections were cut using a rotative
microtome(RM2265; Leica Biosystems, Wetzlar, Germany), mounted on gelatin-
coated slides and processed for immunohistochemistry. These sections were
deparaffinized in xylene and dehydrated. They were immersed in citrate buffer
(pH6.0; 15M103; BioOptica Milano, S.p.A, Milan, Italy) and subjected to
microwave irradiation twice for 5min. Subsequently, all sections were treated
for 30min with 0.3% hydrogen peroxide in methanol in order to quench
endogenous peroxidase activity. To block non-specific binding, the slides were
incubated in 3% normal goat serum(S-100; Vector Laboratories Burlingame,
CA, USA) in PBS(15M108; BioOptica Milano, S.p.A.) for 30min at room
temperature. The slides were incubated overnight at 4˚C with the following
antibodies all purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA):
Rabbit anti-IL-1β polyclonal antibody(1:50; sc-7884); rabbit anti-IL-6 polyclonal
antibody(1:200; sc-7920); mouse anti-TNF-α monoclonal antibody(1:100; sc-
52791); mouse anti-VEGF monoclonal antibody(1:200; sc-152); mouse anti-
ICAM-1 monoclonal antibody(1:50; sc-107); and rabbit anti-TGF-β1 polyclonal
antibody(1:200; sc-146). Optimal antisera dilutions and incubation times were
assessed in a series of preliminary experiments. Following exposure to the
primary antibodies, slides were rinsed twice in PBS and incubated for 1h at
room temperature with the appropriate secondary biotinylated goat anti-mouse
or anti-rabbit immunoglobulinG (1:200; cat. nos. BA9200 and BA1000; Vector
Laboratories) and with peroxidase-conjugated avidin (Vectastain Elite ABC kit
standard* PK 6-100; Vector Laboratories) for 35min. Following a further wash
with PBS, slides were treated with 0,05% 3,3-diaminobenzidine (DAB) and
0,1% H2O2 (DAB substrate kit for peroxidase, Vector Laboratories; SK-4100).
Finally, sections were counter-stained with Mayer's hematoxylin and observed
using a light microscope (Axio Lab.A1; Zeiss, Oberkochen, Germany). Negative
control experiments were performed by omitting the primary antibody,
substituting the primary antibody with an equivalent quantity of non-specific
immunoglobulins or pre-incubating the primary antibody with the specific
135
blocking peptide (antigen/antibody=5 according to the manufacturer's
instructions). The staining assessment was made by two observers experienced
in light microscopy. Immunoreactivity was assessed for IL-1β, IL-6, TNF-α,
VEGF, ICAM-1 and TGF-β1 in Schwann cells, vascular endothelium and dense
connective tissue of neoplastic vestibular nerve samples, and compared with
that of the healthy samples. The intensity of the immune reaction was assessed
microdensitometrically using an IAS2000 image analyzer (Delta Sistemi, Rome,
Italy) connected via a TV camera to the microscope. The system was calibrated
using zero as the background obtained in sections exposed to non-immune
serum. A total of ten 100-μm2
areas were delineated in each section using a
measuring diaphragm. The quantitative data regarding the intensity of immune
staining were analyzed statistically using an analysis of variance followed by
Duncan's multiple range test as a posthoctest.
Statistical analysis
The comparison of the expression levels of TNF-α, TGF-β1, IL-1β, IL-6 and
VEGF between the VS and normal vestibular nerve samples was performed
using a t-test. Statistical analyses were performed using the SPSS statistical
software package version 12.0 (SPSS, Inc., Chicago, IL, USA). P<0.001 was
considered to indicate a statistically significant difference.
Results
Morphological analysis of vestibular nerves using H&E
staining
A total of 10 patients, ranging in age between 45 and 69years, with a diagnosis
of VS were investigated. A total of 10 samples of healthy vestibular nerves were
obtained via vestibular neurectomy to serve as controls. The control peripheral
nerve samples consisted of a single fascicle surrounded by a dense
perineurium, containing small vessels(Fig. 1). The greatest number of nuclei
136
within the fascicle were attributed to Schwann cells. The shape and the
arrangement of these nuclei reflected the course of individual axons. The
fibroblasts of the endoneurium were dispersed amongst numerous Schwann
cells, and exhibited thinner nuclei and increased cellular condensation
compared with the Schwann cells. The nuclei of Schwann cells were elongated
along the major axis of the nerve(Fig. 1A). Sections of VS samples exhibited
compact spindle cell areas, which were densely populated, and formed a
fascicular, storiform and whorled-growth pattern. Histologically, schwannomas
are composed of spindle cells arranged in bundles with elongated nuclei that
form Verocay's bodies(Fig. 1B). Phenomena associated with cystic degeneration
are common. Thickening and hyalinization of the vessel walls are associated
with microhemorrhagic phenomena. The sections were exposed to primary and
secondary antibodies, resulting in the development of dark-brown (intense),
yellow-brown (slight) or no immune staining. Immunoreactivity was deemed to
be specific as no immunostaining was observed in control sections incubated
with primary antibodies absorbed with the specific peptide or with the
pre-immune serum.
Immunohistochemical analysis of human healthy vestibular
nerve and schwannoma samples
All VS samples examined in the present study exhibited a marked
immunoreactivity for TGF-β1. TGF-β1 immunoreactivity was detected primarily
in the cytoplasm of Schwann cells and revealed differences in the number of
immunopositive cells between AntoniA and AntoniB tissue types. AntoniA and
AntoniB tissue types represent distinct histologic architectural patterns that aid
in the histopathologic diagnosis of schwannoma(21). Type A tissue is highly
cellular and demonstrates nuclear palisading as well as associated Verocay
bodies, which reflects their prominent extracellular matrix and secretion of
laminin. Type B tissue is loosely organized with myxomatous and cystic change
and may represent degenerated Antoni A tissue. AntoniA cellular areas
expressed more prominent TGF-β1 immunoreactivity than AntoniB areas. The
AntoniB regions exhibited less dense cellular areas than AntoniA regions, in
137
which there were compactly arranged spindle cells with long and oval nuclei
(Fig. 2A). TGF-β1 reactivity was also demonstrated in the blood vessel walls
distributed in the neoplastic dense connective tissue. No immunoreactivity for
TGF-β1 was observed in vascular endothelial cells, or Antoni A and Antoni B
areas in the control specimens (Fig. 2B). TNF-α was weakly expressed by the
majority of human VS specimens in the endothelial cells of vessels, and AntoniA
and AntoniB regions. Numerous immunopositive nuclei were detected in the
AntoniA regions compared with the Antoni B regions (Fig. 3A). No
immunoreactivity for TNF-α was detected in the healthy control vestibular nerve
samples (Fig. 3B). There was increased expression of IL-1β within the VS
tissues (Fig. 4A), which was localized to the cytoplasm of Schwann cells.
Antoni A and B regions exhibited approximately the same number of
immunopositive nuclei for IL-1β. A moderate expression for IL-1β was also
observed in the blood vessels. No staining was observed in control tissues (Fig.
4B). Immunohistochemistry for IL-6 was positive in the VS cells, with weak
expression in the cytoplasm (Fig. 5A), while in the control nerves samples it
was undetectable (Fig. 5B). The findings confirmed that these cytokines are
involved in the development and progression of VS via stimulation of Schwann
cell proliferation. Pro-inflammatory cytokines, including TGF-β1, TNF-α, IL-1β
and IL-6, may be secreted by activated leukocytes, fibroblasts and Schwann
cells. These cytokines are known to induce the expression of adhesion
molecules, such us ICAM-1 and VCAM-1, and are able to facilitate leucocyte
attachment and interactions with cells from the trigger tissue, an area of the
neuron that contains a high membrane concentration of voltage-gated Na+
channels. A significantly higher ICAM-1 expression was observed in the
cytoplasm of Schwann cells (Fig. 6A), compared with the control nerve samples,
in which no staining was identified (Fig. 6B). Immunohistochemical staining for
VEGF was positive in 9/10 of the VS cases(Fig. 7A). A positive expression of
VEGF was observed in the tumor samples. VEGF exhibited finely granular
cytoplasmic staining in the Schwann cells with intensified focal staining in the
perinuclear region. There was only a small variation of staining within the
tissues of individual tumors. Staining for VEGF also occurred in the cytoplasm of
138
endothelial cells and in polymorphonuclear leukocytes within vessels. These
data confirm that VEGF may have a significant impact on the growth VSs,
stimulating the mitogenic activity of Schwann cells and angiogenesis in these
tumors. VEGF immunoreactivity was absent in the control nerve samples (Fig.
7B).
Statistical analysis of growth factors and cytokines expres-
sion
The intensity of staining for TGF-β1, TNF-α, IL-1β, IL-6 and VEGF in human VS
and control nerve samples is shown in Table I. The percentage values of
pro-inflammatory cytokine-positive cells and P-values are also shown in Fig. 8.
Discussion
VSs are rare and slow-growing neoplasms, which occur as a result of increased
proliferation of Schwann cells of the vestibular branch of the eighth cranial
nerve. The tumors generally originate near the myelin-glial junction, close to
the internal auditory canal (22). Neoplastic growth appears to rely upon
cytokines, which possess angiogenic and mitogenic properties. Limited data
concerning the expression of growth factors and its implication on VS growth
are available. The aim of the present study was to investigate the role of
certain pro-inflammatory cytokines in sporadic VS, associated with angiogenesis
and tumor growth. The mechanisms underlying schwannoma development,
growth and growth arrest remain to be elucidated. In order to develop an
improved understanding of the mechanisms responsible for the growth of these
neoplasms, associations between an abnormal proliferation of Schwann cells
and the expression of certain inflammatory cytokines were investigated.
Although VSs are relatively slow-growing neoplasms, their continued growth
depends on a functional vascular system, as with any other tumor (23). The
positive expression of VEGF in VS specimens suggests that angiogenesis is
involved in facilitating the growth of this tumor. Indeed, angiogenesis is a
139
prerequisite for the proliferation and progression of a number of neoplasms
(23). Despite the evidence suggesting that VS are generally slow-growing
tumors, and therefore do not require excessive vascularization, the presence of
a functional vascular system remains paramount for tumor development. The
results of the present study have revealed a marked expression of VEGF in the
cytoplasm of Schwann cells and in vascular endothelial cells from neoplastic
peripheral nerves. The present findings confirm that VEGF expression may be
involved in the development and expansion of benign tumors as well as
malignant ones. In addition to its role as an angiogenic factor, VEGF also
possesses neurotrophic and neuroprotective properties in the peripheral and
central nervous system, which exert a direct action not only on neurons, but
also on Schwann cells (24). The mechanisms responsible for an inflammatory
reaction in VS required further elucidation. Inflammation contributes to tumor
progression by stimulating the angiogenic process and providing neoplastic cells
with growth factors. VEGF and TGF-β1 have are putative key mediators of VS
growth (25). Overexpression of TGF-β1 increases the invasiveness of neoplastic
cells by increasing their proteolytic activity and promoting their binding to cell-
adhesion molecules (26). Previous animal studies have identified TGF-β1 as a
potent mitogen for Schwann cells. It has also previously been reported that
Schwann cells secrete and activate the latent form of TGF-β1 (27), thereby
stimulating the proliferation of Schwann cells. TGF-β1 has been hypothesized to
be involved in the regulation of peripheral nerve tumors by modulating cell
proliferation and differentiation, by different mechanisms from those of glial
growth factors and fibroblast growth factor, which are responsible for the
mitogenic activity of Schwann cells (28,29). The results of the present study
suggested that TGF-β1 may be affect tumor progression by indirectly
stimulating angiogenesis through the upregulation of VEGF expression in VS.
Cytokines are the primary mediators of communication between cells in the
inflammatory tumor micro-environment. It has been established that neoplastic
cells express pro-inflammatory mediators, including cytokines, such as TGF-β1,
IL-6, IL-1β and TNF-α (30). TNF-α is known to be a major mediators of
inflammation; in addition, TNF-α was reported to be produced by tumors and to
140
function as an endogenous tumor promoter. TNF-α has been associated with
numerous processes involved in tumorigenesis, including cellular trans-
formation, promotion, survival, proliferation, invasion, angiogenesis and
metastasis (31). TNF-α upregulates ICAM-1 on the Schwann cell surface,
suggesting that these cells also carry functional TNF-α receptors (32). While
TNF-α is toxic to numerous types of cell, it is not injurious to cultured Schwann
cells (33). However, it does inhibit unstimulated cell proliferation and
connexin46 expression (34). In the present study, it was identified that
moderate expression of TNF-α in the cytoplasm of Schwann cells was
predominantly localization in AntoniA regions, while this cytokine was
completely absent in normal vestibular nerve samples. The cytotoxic or
protective effects of TNF-α depend on its receptor, cell type and the presence
of other factors. To date, two types of cell surface receptors for TNF-α have
been identified: TNFRI (p55) and TNFRII (p75) (35). Activation of TNFRII
receptor results in a complex signalling pathway involving numerous other TNF-
receptor-activated proteins (36,37). Receptor signaling, via this pathway,
triggers the proteolysis of cytoplasmic protein IκB, which, in turn, allows
translocation of the nuclear transcription factor nuclear factor-κB (38). This has
been observed to lead to apoptosis in specific cell types, whilst it is protective in
others (39). In the present study, TNF-α appeared to induce a protective effect
in Schwann cells, possibly as a result of the presence on the cellular surface of
TNFRII. IL-1β, secreted by neoplastic cells or infiltrating leukocytes, is involved
in increasing tumor adhesion, invasion, angiogenesis and immune suppression
(40). The results of the present study demonstrated that VS is associated with
elevated expression of IL-6 and VEGF, indicating that IL-6 is a possible
mediator of the association between VS and systemic inflammatory responses
in patients with this disease. Interleukin-6 is involved in peripheral nerve
regeneration (41). However, the molecular mechanisms underlying IL-6
function in Schwann cell physiology are yet to be elucidated. The induction of
proinflammatory genes by IL-6 in Schwann cells may indicate that IL-6 is
involved in the degeneration of the injured nerve, in association with other
inflammatory cytokines, including TNF-α. IL-6 may facilitate the demyelination
141
of peripheral nerves following nerve injury, and appears to induce degenerative
changes in Schwann cells following nerve injury and to activate
proinflammatory signals in Schwann cells (42). The majority of IL-6 target
genes are involved in cell cycle progression and in the suppression of apoptosis,
which emphasizes the importance of IL-6 in tumorigenesis (43). Accordingly,
cytokines, including TNF-α and IL-1β, are emerging as putative targets for
anticancer therapies (44). Specific inhibition of pro-inflammatory mediators,
including TNF-α, IL-6, TGF-β1 and IL-1β, may lead to a reduction in tumor
development and inhibition of transcription associated with the inflamma-
toryprocess. TNF-α, IL-6, TGF-β1 and IL-1β have been shown to upregulate
adhesion molecules, such as ICAM-1, in human Schwann cells. In the present
study, ICAM-1 was observed to be highly expressed in VS samples and its
expression was associated with tumor size and the inflammatory process.
Cellular immunity against tumor cells requires the presence of adhesion
molecules, such as ICAM-1 on the endothelial surface, which mediate the arrest
of leukocytes (16). The induction of the expression of ICAM-1 in Schwann cells
by pro-inflammatory cytokines suggests a possible role for adhesion molecules
in the pathogenesis of inflammation in the peripheral nerve. The absence of
immunoreactivity observed in the control specimens indicates that the
hyperexpression of growth factors and cytokines is associated with tumor devel-
opment or inflammatory conditions. The current findings suggested that chronic
inflammation, through its promotion of angiogenesis, is involved in tumor
progression. Angiogenesis appears to be important for the induction of growth
of VS as well as the growth of other neoplasms, including glioblastoma in
children (45) and primary or metastatic breast cancer (46). Numerous previous
studies have reported a significant correlation between the concentration of
VEGF and VEGFR-1 expression in VS, and tumor growth rate, but did not
describe symptom duration or tumor size (47-49). The present findings
confirmed the expression of VEGF, with cytoplasmic localization, in VS samples.
Previous experiments in nude mice injected with malignant tumor cells have
demonstrated that intravenous infusion of anti-VEGF monoclonal antibodies
reduces the growth of tumors by up to 96% (50). The anti-VEGF therapy was
142
directed toward the suppression of VEGF or its receptors. This treatment, based
on the inhibition of VEGF and its receptors, may be a potential option with
which to counteract the development of VS. Additional studies on the
involvement of chronic inflammatory processes in the development of VS are
required. The first stage may be to further identify the inflammatory cells
present in VS. Furthermore, their activation and association with angiogenic
growth factors should be examined. VS cells produce and secrete
pro-inflammatory cytokines, which may act in an autocrine manner, stimulating
cellular proliferation. The potential use of novel therapeutic approaches based
on the combined administration of inhibitors of proinflammatory cytokines and
VEGF may hold promise for the development of therapies for neoplastic
diseases involving the peripheral nervous system. In conclusion, the present
study demonstrated that the development of synthetic inhibitors of growth
factors may potentially reduce the recurrence rate of VS and enable non-
surgical management of this disease. Additional clinical and experimental
investigations are necessary to clarify the biological role of these molecules in
the development and progression of this type of neoplasm.
143
References
1. McDonaldR: Acoustic neuroma: what the evidence says about evaluation
and treatment. J Fam Pract60: E1-E4, 2011.
2. Celis-AguilarE, LassallettaL, Torres MartinM, RodriguesFY, NistalM,
CastresanaJS, etal: The molecular biology of vestibular schwannomas and its
association with hearing loss: a review. Genet Res Int2012: 856157, 2012.
3. BondiS, LimardoP, TomaS and BussiM: Non-vestibular head and neck
schwannomas: a 10-year experience. EurArch Otorhinolaryngol270: 2365-2369,
2013.
4. van LeeuwenJP, CremersCW, ThewissenNP, HarhangiBS and MeijerE:
Acoustic neuroma: correlation among tumor size, symptoms, and patient age.
Laryngoscope105: 701-707, 1995.
5. CarrollSL: Molecular mechanisms promoting the pathogenesis of Schwann
cell neoplasms. Acta Neuropathol123: 321-348, 2012.
6. KlenkeC, WideraD, SepehrniaA, MoffatDA, KaltschmidtC, KaltschmidtB,
EbmeyerJ and SudhoffH: Clinical and biological behaviour of vestibular
schwannomas: signalling cascades involved in vestibular Schwannoma resemble
molecular and cellular mechanisms of injury-induced Schwann cell dedifferen-
tiation. Head Neck Oncol16: 20, 2013.
7. MirskyR, ParmantierE, McMahonAP and JessenKR: Schwann cell-derived
desert Hedgehog signals nerve sheath formation. Ann NY Acad Sci883: 196-
202, 1999.
8. ChenZL and StricklandS: Laminin gamma1 is critical for Schwann cell
differentiation, axon myelination, and regeneration in the peripheral nerve. JCell
Biol163: 889-899, 2003.
9. WeerdaH, GambergerTI, SiegnerA, GjuricM and TammER: Effects of
transforming growth factor-β1 and basic fibroblast growth factor on
proliferation of cell cultures derived from human vestibular nerve schwannoma.
ActaOtolaryngol118: 337-343, 1998.
144
10. DiensthuberM, BrandisA, LenarzT and StoverT: Co-expression of
transforming growth factor-β1 and glial cell line-derived neurotrophic factor in
vestibular schwannoma, OtolNeurotol25: 359-365, 2004.
11. LöttrichM, MawrinC, ChamaonK, KirchesE, DietzmannK, and FreigangB:
Expression of transforming growth factor-beta receptor type 1 and type 2 in
human sporadic vestibular Schwannoma. Pathol Res Pract203: 245-249, 2007.
12. WagnerR and MyersRR: Schwann cells produce tumor necrosis factor
alpha: expression in injured and non-injured nerves. Neuroscience73: 625-629,
1996.
13. WangY, TangX, YuB, GuY, YuanY, YaoD, DingF and GuX: Gene network
revealed involvements of Birc2, Birc3 and Tnfrsf1a in anti-apoptosis of injured
peripheral nerves. PloS One7: e43436, 2012.
14. LeeHK, SeoIA, SuhDJ, HongJI, YooYH and ParkHT: Interleukin-6 is
required for the early induction of glial fibrillary acidic protein in Schwann cells
during Wallerian degeneration. JNeurochem108: 776-786, 2009.
15. BolinLM, VerityAN, SilverJE, ShooterEM and AbramsJS: Interleukin-6
production by Schwann cells and induction in sciatic nerve injury.
JNeurochem64: 850-858, 1995.
16. ConstantinG, PiccioL, BussiniS, PizzutiA, ScarpiniE, BaronP, ContiG, PizzulS
and ScarlatoG: Induction of adhesion molecules on human Schwann cells by
proinflammatory cytokines, an immunofluorescence study. JNeurol Sci170: 124-
130, 1999.
17. BevilacquaMP: Endothelial-leukocyte adhesion molecules. Annu Rev
Immunol11: 767-804, 1993.
18. MøllerMN, WertherK, NallaA, StangerupSE, ThomsenJ, Bøg-HansenTC,
NielsenHJ and Cayé-ThomasenP: Angiogenesis in vestibular schwannomas:
expression of extracellular matrix factors MMP-2, MMP-9 and TIMP-1.
Laryngoscope120: 657-662, 2010.
19. FerraraN, GerberHP and LeCouterJ: The biology of VEGF and its receptors.
Nat Med9: 669-676, 2003.
20. Bancroft JD and Gamble M(eds): Theory and Practice of Histological
Techniques. 6th edition. Churchill Livingstone Elsevier, London, 2008.
145
21. Joshi R: Learning from eponyms: Jose Verocay and Verocay bodies, Antoni
A and B areas, Nils Antoni and Schwannomas. Indian Dermatol Online J. 3:
215-219, 2012.
22. CharabiS: Acoustic neuroma/vestibular schwannoma invivo and invitro
growth models. A clinical and experimental study. Acta Otolaryngol Suppl530:
1-27, 1997.
23. FolkmanJ: Tumor angiogenesis: therapeutic implications. NEngl J Med285:
1182-1186, 1971.
24. NamiecińskaM, MarciniakK and NowakJZ: VEGF as an angiogenic
neurotrophic, and neuroprotective factor. Postepy Hig Med Dosw (Online) 59:
573-583, 2005 (InPolish).
25. KramerF, StöverT, WameckeA, DiensthuberM, LenarzT and WisselK: BDNF
mRNA expression is significantly upregulated in vestibular schwannomas and
correlates with proliferative activity. J Neurooncol98: 31-39, 2010.
26. MaeharaY, KakejiY, KabashimaA, EmiY, WatanabeA, AlkazawaK, BabaH,
KohnoeS and SugimachiK: Role of transforming growth factor-beta 1 in invasion
and metastasis ingastric carcinoma. J Clin Oncol17: 607-614, 1999.
27. RidleyAJ, DavisJB, StroobantP and LandH: Transforming growth factors-
beta 1 and beta 2 are mitogens for rat Schwann cells. J Cell Biol109: 3419-
3424, 1989.
28. LemkeGE and BrockesJP: Identification and purification of glial growth
factor. J Neurosci4: 74-83, 1984.
29. RatnerN, BungeRP and GlaserL: Schwann cell proliferation invitro. An
overview. Ann NY Acad Sci486: 170-181, 1986.
30. CandidoJ and HagemannT: Cancer-related inflammation. JClin Immunol33:
S79-S84, 2013.
31. Sethi G, Sung B and Aggaewal BB: TNF: a master switch for inflammation
to cancer. Front Biosci13: 5094-5107, 2008.
32. LisakRP and BealmearB: Upregulation of intercellular adhesion molecule-1
(ICAM-1) on rat Schwann cells invitro: comparison of interferon-gamma, tumor
necrosis factor-alpha and interleukin-1. J Peripher Nerv Syst2: 233-243, 1997.
146
33. MithenF, ColburnS and BirchemR: Human alpha tumor necrosis factor does
not damage cultures containing rat Schwann cells and sensory neurons.
Neurosci Res9: 59-63, 1990.
34. ChandrossKJ, SprayDC, CohenRI, KumarNM, KremerM, DermietzelR and
KesslerJA: TNF-alpha inhibits Schwann cell proliferation, connexin46 expression
and gap junctional communication. Mol Cell Neurosci7: 479-500, 1996.
35. UrenAG and VauxDL: Molecular and clinical aspects of apoptosis.
Pharmacol Ther72: 37-50, 1996.
36. Nagano K, Alles N, Mian AH, etal: The tumor necrosis factor type 2
receptor plays a protective role in tumor necrosis factor-α-induced bone
resorption lacunae on mouse calvariae. JBone Miner Metab29: 671-681, 2011.
37. Tracey D, Klareskog L, Sasso EH, Salfeld JG and Tak PP: Tumor necrosis
factor antagonist mechanism of action: a comprehensive review. Pharmacol
Ther117: 244-279, 2008.
38. BakerSJ and ReddyEP: Transducers of life and death: TNF receptor
superfamily and associated proteins. Oncogene12: 1-9, 1996.
39. BegAA and BaltimoreD: An essential role for NF-kappaB in preventing TNF-
alpha-induced cell death. Science274: 782-784, 1996.
40. ColottaF, AllavenaP, SicaA, GarlandaC and MantovaniA: Cancer-related
inflammation, the seventh hallmark of cancer: links to genetic instability.
Carcinogenesis30: 1073-1081, 2009.
41. ZhongJ, DietzelID, WahleP, KopfM and HeumannR: Sensory impairments
and delayed regeneration of sensory axons in interleukin-6-deficient mice. J
Neurosci19: 4305-4313, 1999.
42. LeeHK, WangL, ShinYK, LeeKY, SuhDJ and ParkHT: Interleukin-6 induces
proinflammatory signaling in Schwann cells: a high-throughput analysis.
Biochem Biophy Res Commun382: 410-414, 2009.
43. HauraEB, TurksonJ and JoveR: Mechanisms of disease: insights into the
emerging role of signal transducers and activators of transcription in cancer.
Nat Clin Pract Oncol2: 315-324, 2005.
44. KlampferL: Cytokines, inflammation and colon cancer. Curr Cancer Drug
Targets11: 451-464, 2011.
147
45. Artico M, Cervoni L, Celli P, Salvati M and Palma L: Supratentorial
glioblastoma in children a series of 27 surgically treated cases. Childs Nerv
Syst9: 7-9, 1993.
46. Gobbi G, Mirandola P, Micheloni C, etal: Expression of HLA class I antigen
and proteasome subunits LMP-2 and LMP-10 in primary vs. metastatic breast
carcinoma lesions. Int J Oncol25: 1625-1629, 2004.
47. Cayé-ThomasenP, WertherK, NallaA, etal: VEGF and VEGF receptor-1
concentration in vestibular schwannoma homogenates correlates to tumor
growth rate. Otol Neurotol26: 98-101, 2005.
48. Brieger J, Bedavanija A, Lehr HA, Maurer J and Mann WJ: Expression of
angiogenic growth factors in acoustic neurinoma. Acta Otolaryngol123: 1040-
1045, 2003.
49. Koutsimpelas D, Bjelopavlovic M, Yetis R, etal: The VEGF/VEGFR axis in
sporadic vestibular schwannoma correlates with irradiation and disease
recurrence. ORL J Otorinilaryngol Relat Spec74: 330-338, 2012.
50. KimKJ, LiB, WinerJ, etal: Inhibition of vascular endothelial growth factor-
induced angiogenesis suppresses tumour growth invivo. Nature362: 841-844,
1993.
148
Figure 1. H&E staining of human healthy vestibular nerve and schwannoma
samples. (A) H&E staining of a control nerve section revealed nuclei of Schwann
cells in the endoneurium, which also contained several fibroblasts. (B) H&E
staining of vestibular schwannoma section that exhibited Verocay Bodies
(AntoniA regions), consisting of spindle cells arranged in bundles with elongated
nuclei (indicated by *). Magnification, x20. H&E, hematoxylin and eosin.
Figure 2. Immunohistochemical analysis of human healthy vestibular nerve
and schwannoma samples for TGF-β1. (A) TGF-β1 expression in vestibular
schwannoma tissue section revealed a cytoplasmic localization in Schwann cells.
Immunoreactivity was increased in AntoniA areas (*) compared with AntoniB
regions (◄). TGF-β1 reactivity was also observed in the endothelial cells of the
blood vessels distributed in the endoneurium ( ). (B) Immunoreactivity for
TGF-β1 was not detected in the control samples. Magnification, x40. TGF-β1,
transforming growth factor-β1.
149
Figure 3. Immunohistochemical analysis of human healthy vestibular nerve
and schwannoma samples for TNF-α. (A) TNF-α immunoreactivity in vestibular
schwannoma tissue section revealed a weak expression in the blood vessel wall
and in AntoniA andB regions. In addition, AntoniA regions exhibited the same
immunoreactivity as that in the nuclei of Schwann cells ( ). (B) Absence of TNF-
α expression in the control samples was observed. Magnification, x20. TNF-α,
tumor necrosis factor-α.
Figure 4. Immunohistochemical analysis of human healthy vestibular nerve
and schwannoma samples for IL-1β. (A) IL-1β immunoreactivity in vestibular
schwannoma tissue section revealed marked expression in the AntoniA andB
regions. This expression was localized in the cytoplasm of Schwann cells.
Moderate immunoreactivity was observed in vascular endothelium. (B) No
immunoreactivity for IL-1β in Schwann cells and blood vessels was detected in
the control samples. Magnification, x40. IL-1β, interleukin-1β.
150
Figure 5. Immunohistochemical analysis of human healthy vestibular nerve
and schwannoma samples for IL-6. (A) IL-6 immunoreactivity in vestibular
schwannoma tissue section revealed weak cytoplasmic expression in Schwann
cells. (B) No immunoreactivity for IL-6 in the cytoplasm of Schwann cells was
detected in the control samples. Magnification, x40. IL-6, interleukin-6.
Figure 6. Immunohistochemical analysis of human healthy vestibular nerve
and schwannoma samples for ICAM-1. (A) Immunoreactivity for ICAM-1 in
vestibular schwannoma tissue sections revealed marked expression in the
cytoplasm of Schwann cells. (B) No immunoreactivity for ICAM-1 was observed
in the control samples. Magnification, x40. ICAM-1, intracellular adhesion
molecule-1.
151
Figure 7. Immunohistochemical analysis for VEGF in human normal vestibular
nerve and schwannoma samples. (A) VEGF immunoreactivity was observed as a
marked granulated cytoplasmic stain in Schwann cells obtained from the
vestibular schwannoma tissue sections. Positive staining was also detected in
vascular endothelium of neoplastic tissue. (B) VEGF immunoreactivity was
absent in the control samples. Magnification, x40. VEGF, vascular endothelial
growth factor.
Table I. Levels of cytokines and growth factors in vestibular schwannoma
tissue samples and in healthy vestibular nerve samples, and corresponding
statistical significance (t-test).
152
Figure 8. Histogram indicating the percentage of growth factor expression in
the vestibular schwannoma cells compared with control tissue. The data
underline the differences between the expression of these factors in the two
different specimens: Black=schwannoma samples; white=control samples. All
differences between the vestibular schwannoma and control samples were
statistically significantly(P<0.001). TGF-1, transforming growth factor-1; TNF-α,
tumor necrosis factor-α; IL, interleukin; ICAM-1, intracellular adhesion
molecule-1; VEGF, vascular endothelial growth factor.
153
Chapter 7
Involvement of pro-inflammatory
cytokines and growth factors in the
pathogenesis of the Dupuytren’s
contracture: a novel target for a possible
future therapeutic strategy?
E. Bianchi1, S. Taurone1, L. Bardella2, A. Signore3,
E. Pompili4, V. Sessa5, C. Chiappetta6, L. Fumagalli4,
C. Di Gioia7, F.S. Pastore8, S. Scarpa9, and M. Artico1
1Dept. of Sensory Organs, “Sapienza” University of Rome, Rome. 2Dept. of
Neurology and Psychiatry, “Sapienza” University of Rome. 3Dept. of Oncological
Sciences, S. Andrea Hospital, “Sapienza” Univ. of Rome. 4Dept. of Anatomical,
Histological, Forensic and Locomotor System Sciences, “Sapienza” Univ. of
Rome. 5Division of Orthopedics, S. Giovanni Calibita Fatebenefratelli Hospital,
Rome. 6Dept. of Medical-Surgical Sciences and Biotecnologies,“Sapienza”
University of Rome. 7Dept. of Radiology, Oncology and Pathology, “Sapienza”
University of Rome. 8Dept. of Systems Medicine, “Tor Vergata” University of
Rome. 9Dept. of Experimental Medicine, “Sapienza” University of Rome.
Clinical Science 2015; 129 (8): 711-720
Key words: IHC - Dupuytren’s contracture – myofibroblasts – cytokines -
growth factors
154
Abstract
Dupuytren’s contracture (DC) is a benign fibroproliferative disease of the hand
causing fibrotic nodules and fascial cords which determine debilitating
contracture and deformities of fingers and hands. The present study was
designed to characterize pro-inflammatory cytokines and growth factors
involved in the pathogenesis, progression and recurrence of this disease, in
order to find novel targets for alternative therapies and strategies in controlling
DC. The expression of pro-inflammatory cytokines and of growth factors was
detected by immunohistochemistry in fibrotic nodules and normal palmar fascia
resected respectively from patients affected by Dupuytren's contracture and
Carpal Tunnel Syndrome (as negative controls). RT-PCR analysis and
immunofluorescence were performed to quantify the expression of TGF-β1, IL-
1β and VEGFa by primary cultures of myofibroblasts and fibroblasts isolated
from Dupuytren's nodules. Histological analysis showed high cellularity and high
proliferation rate in Dupuytren’s tissue, together to the presence of
myofibroblastic isotypes; immunohistochemical staining for macrophages was
completely negative. In addition, a strong expression of TGF-β1, IL-1β and
VEGFa was evident in the extracellular matrix and in the cytoplasm of
fibroblasts and myofibroblasts in Dupuytren’s nodular tissues, as compared to
control tissues..These results were confirmed by RT-PCR and by
immunofluorescence in pathological and normal primary cell cultures. These
preliminary observations suggest that TGF-β1, IL-1β and VEGFa may be
considered potential therapeutic targets in the treatment of Dupuytren's
disease.
Introduction
Dupuytren’s disease (DD) has been defined as a benign progressive
proliferative fibroplasia of the fascia palmaris of the hand, which results in
contracture of the fingers leading to reduction in the movement and inability to
155
extend them [1]. The pathogenesis of DD still remains unclear; the stages of
the fibrotic disease are classified as proliferative, involutional, and residual on
the basis of the histological appearance of the affected fascia palmaris [2]. The
proliferative phase is characterized by proliferation and differentiation of
fibroblasts into myofibroblasts under the influence of several different factors,
causing formation of the nodules [3, 4]. In the second phase, the involutional
stage, myofibroblasts proliferate and align along the long axis of surrounding
collagens bundles thus giving way to the formation of fibrotic cords [5]. Finally,
in the residual phase, the myofibroblasts are replaced by fibrocytes that
progressively decrease in number causing the formation of the avascular
collagen cord [2]. Myofibroblasts seem to play a central role in the
pathogenesis of the fibrotic disease. These cells show an intermediate
phenotype between fibroblasts and smooth muscle cells and generate the
forces responsible for palmar fascia contracture [6]. Myofibroblasts are
responsible for matrix deposition and consequent contraction in Dupuytren’s
disease. Many growth factors and cytokines seem to be implicated in the
etiology of Dupuytren’s contracture, among all transforming growth factor beta
(TGF-β) has been suggested to play a predominant role [7]. TGF-β is
responsible for the up-regulation of collagens and also of other extracellular
matrix components, all fundamental for connective tissue remodeling [8]. TGF-
β transduces a signal through an heteromeric complex for formation of related
type I and type II transmembrane serine/threonine kinase receptors [9]; the
signal of the activated type I receptor induces SMAD signaling cascade and the
heteromeric SMAD complexes (SMAD2/3-SMAD4) accumulated in the nucleus
regulate the expression of a large array of target genes involved in
myofibroblast proliferation, differentiation and extracellular matrix synthesis
[10-11]. Several studies have identified pro-inflammatory cytokines in
Dupuytren’s tissues, but the molecular mechanisms by which inflammatory
mediators activate myofibroblast differentiation are still unknown [12]. Il-6 is
involved in the modulation of TGF-β and its receptor TGF-βRII, inducing then
fibroblasts proliferation [13]. TNF-α is another central mediator of the fibrotic
process, similar to TGF-β [14]: it has been identified as a mediator involved in
156
the differentiation of fibroblasts into myofibroblasts in the palm of patients
affected by Dupuytren’s disease, via activation of Wnt signaling pathway [15].
TNF-α may directly regulate TGF-β1 expression, as shown in lung fibroblasts
[16]. Yet, hypoxia and subsequent angiogenesis seem to play a role in the
pathophysiology of this disease [17]. Angiogenesis is induced by several growth
factors, but the most important molecule is vascular endothelial growth factor
(VEGF), also known as vascular permeability factor [18]. Hypoxia activates the
transcription of hypoxia-inducible factor alpha (HIF-1α), which itself positively
regulates VEGF synthesis [19]. All these findings prompted us to investigate
the structural alterations of the fibromatous palmar fascia in patients affected
by Dupuytren’s contracture and to analyze expression and localization of the
previously described growth factors in surgical samples of palmar aponeurosis.
In parallel, immunofluorescence and RT-PCR analysis were conducted on
primary cultures of fibroblasts and myofibroblasts explanted from Dupuytren’s
nodules in the proliferative or involutional phases.
Materials and Methods
Tissue samples were obtained from 26 patients (22 males and 4 females, mean
age 58 years, mean duration of clinical history 2,5 years) undergoing surgical
dermo-fasciectomy for Dupuytren’s contracture (n=18) and Carpal Tunnel
Syndrome (n=8, as negative controls). Pathological tissues were sampled from
areas of Dupuytren's nodules (4 specimens for each nodule). Control samples
(2 specimens for each tissue fragment), characterized by normal palmar fascia
tissues, were collected from patients undergoing hand surgery for Carpal
Tunnel Syndrome (CTS). During excision, apart from anesthesia, no other
chemical products or pharmaceutical drugs have been administered. All samples
were collected with the informed consent of the patient and the study protocol
conformed to the ethical guidelines of the 1975 Declaration of Helsinki.
Experiments were performed in compliance with the Italian laws and guidelines
concerning the patients’ written informed consent. The Ethics Committee of the
Policlinico Umberto I Hospital approved our study according to European
157
Community and Italian laws.
Samples (72 from DD and 16 from control patients) were fixed in formalin and
embedded in paraffin to be processed for histological staining and
immunohistochemistry. The sections were subjected to Hematoxylin & Eosin
and Masson’s Trichrome staining. In parallel, other tissue samples were used to
obtain primary cultures of pathological and normal fibroblasts.
Immunohistochemistry
The immunohistochemical analysis was conducted using the ABC/HRP
technique (avidin complexed with biotinylated peroxidase) on 4 µm thick
paraffin sections that were cut using a rotative microtome. These sections were
deparaffinized and hydrated through decreasing ethanol series to distilled
water, then subjected to microwave irradiation and immersed in citrate buffer
(pH = 6) twice for 5 minutes each time. Subsequently, endogenous peroxidase
activity was quenched using 0.3% hydrogenous peroxide in methanol for 30
minutes. To evaluate the immunolocalization of pro-inflammatory factors, VEGF,
marker of myofibroblasts and proliferating cell nuclear antigen (PNCA), the
following antibodies were employed: mouse anti-αSMA monoclonal antibody
(Leica, USA 1:100); rabbit anti-TGF-β1 polyclonal antibody (Santa Cruz, CA,
USA 1:200); rabbit anti-IL1β polyclonal antibody (Santa Cruz, CA, USA 1:100);
rabbit anti-IL6 polyclonal antibody (Santa Cruz, CA, USA 1:50); mouse anti-
VEGFa monoclonal antibody (Santa Cruz, CA, USA 1:100); mouse anti-TNF-
alpha monoclonal antibody (Santa Cruz, CA, USA 1:200); mouse anti-ICAM-1
monoclonal antibody (Santa Cruz, CA, USA 1:25) and mouse anti-PNCA
monoclonal antibody (Santa Cruz, CA. USA 1:100).
Incubation with the primary antibodies was performed overnight at 4ºC.
Optimal antibody dilution and incubation times were assessed in preliminary
experiments. As negative control, the primary antibodies were omitted. After
exposure to the primary antibodies all slides were rinsed twice in phosphate
buffer (pH=7.4) and incubated for 1 hour with the appropriate secondary
biotinylated antibody at the final dilution of 1:200. The secondary biotinylated
antibodies against rabbit and mouse immunoglobulins were purchased from
158
Abcam (biotinylated goat anti-mouse antibody and biotinylated goat anti-rabbit
antibody). The slides were then incubated with peroxidase-conjugated avidin
(Vector laboratories, Burlingame, CA, USA, Vectastain Elite ABC kit Standard*PK
6-100) for 30 min. Slides were washed in phosphate buffer (pH=7.4) and
treated with 0.05% 3,3-diaminobenzidine (DAB) and 0.1% H2O2. Finally,
sections were counterstained with Mayer’s hematoxylin and dehydrated rapidly.
The staining assessment was made by three experts. The intensity of the
immune reaction was assessed microdensitometrically using an IAS 2000 image
analyzer (Delta Sistemi, Rome, Italy) connected via a TV camera to the
microscope. Twelve 100 µm2 areas were delineated in each section by
measuring the diaphragm. The system was calibrated taking the background
obtained in sections exposed to non-immune serum as zero. Quantitative data
of the intensity of immune staining were analyzed statistically by analysis of
variance (ANOVA) followed by Dunca’s multiple range test as a post hoc test.
The comparison of the expression levels of each antigen between the palmar
fascia from Dupuytren’s disease and CTS patients was carried out by Student’s
t-test. Statistical analysis was performed using the GraphPad Prism (La Jolla,
CA). The results were considered statistically significant with p-value <0.05.
Cells Cultures
Dupuytren’s nodule tissues and normal palmar fascia tissues from CTS patients
were obtained by surgery. All samples were minced using a sterile technique
and placed in sterile 30 mm single well culture dishes. The wells were then
flooded with 2.0 ml of Dulbecco’s essential medium (DMEM, Gibco, Grand
Island, NY) containing 4% penicillin/streptomycin (PS, Gibco, Grand Island, NY)
and 10% fetal bovine serum (FBS, Gibco, Grand island, NY). The media was
renewed three times weekly. Cells were observed adhering to the bottom of the
wells and were allowed to grow to confluence. The cells were lifted from the
wells using Trypsin/EDTA, pelleted, washed and re-suspended in DMEM with
10% FBS and 4% penicillin/streptomycin. Four cell strains were used in these
experiments (4 from DD patients and 4 from control patients) and sub-cultured
by less than 10 passages. These primary cultures of pathological and normal
159
cells were used for establishing protein and mRNA expression of specific pro-
inflammatory factors and VEGF by immunofluorescence and RT-PCR.
Immunofluorescence
For immunofluorescence fibroblast primary cultures were grown directly on
Labteck chamber slides (Nunc) for at least 24 h, the cells were then washed
with PBS with Ca/Mg, and fixed with 4 % buffered paraformaldehyde for 20 min
at 4 °C. Fixed cells were incubated overnight at 4°C with the primary antibody
for α-SMA, TGFβ1, IL1β, IL6, TNF-α and VEGFa. After three washes in 0.1%
Tween in PBS for 10 min each, the cells were incubated with the secondary
antibody, anti-mouse-fluorescein antibody (Abcam USA (MA) 1:200) or anti-
rabbit– rhodamine antibody (Abcam USA (MA), 1:200) for 2 hours at room
temperature. The nuclei were stained with DAPI (Vectashield Mounting Medium
with DAPI, Vector Laboratories, Burlingame, CA, USA). The
immunofluorescence was examined by confocal laser microscope (Nikon
TE2000). Student’s t-test was used to evaluate the expression of each
analyzed antigen in DD and control cells. The data were considered statistically
significant with p-value <0.05.
RT-PCR
Cultured cells were suspended in TRIzol reagent (Invitrogen Corporation, CA)
and total RNA was isolated using RNeasy Micro Kit (Qiagen, CA, USA). Real time
PCR was conducted to determine the differences in mRNA expression levels of
TGF-β1, IL-1β and VEGFa between normal and pathological fibroblasts in
culture. The purity of the RNA was assessed using a UV/visible spectophotomer
(SmartSpec 3000, Bio-Rad Laboratories, CA, USA). 1 µg total RNA was reverse
transcribed using a High Capacity cDNA Reverse Transcription (RT) kit (Applied
Byosystems, CA, USA) according to the manufacturer’s instructions. RNA
samples, RT buffer, dNTP mix, RT random primers, multiscribe reverse
transcriptase, RNase inhibitor and DEPC-treated distilled water were added in
RNase-free tubes on ice at the final volume of 20 µl. The thermal cycler was
programmed as follows: 25ºC for 10 min, 37ºC for 120 min and the reaction
160
was stopped at 85ºC for 5 min. For the RNA reactions we used the follow
primer pairs (Bio Basic In, NY, USA): for TGF-β1 primer forward 5’-
GCTGGACAGGAAGCTGGG-3 and primer reverse 5’-GGACACAACACGAGCAGAGA-
3’, for IL-1β primer forward 5’-GCTTCTGGTGATTCCCGCAA-3’ and primer
reverse 5’- GGGCTGTGAGAGTTCTTGGG-3’, for VEGFa primer forward 5’-
AACCCCTAGGCCAGGTTGTA-3’ and primer reverse 5’-
CGGGATATGGAAGGGAAGCC-3. For glyceraldehyde 3 phosphate dehydrogenase
(GAPDH) we used primer forward 5’-GAGCAGTCCGGTGTCACTAC-3' and primer
reverse 5’-TAGTAGCCGGGCCCTACTTT-3’. The specificity of the primers was
verified by searching in the NCBI database for possible homology to the cDNA
of unrelated proteins. Each PCR tube contained the following reagents at the
final volume of 50 µl: 0.2 µM of forward and reverse primers, 1 µg template
cDNA, 0.2 mM dNTP mix, 2.5 U RedTaq Genomic DNA polymerase (Sigma-
Aldrich), MgCl2 and reaction buffer 1X. The amplification was started with an
initial denaturation step at 94°C (2 minutes) and was followed by 35 cycles
consisting of denaturation (30 seconds) at 94°C, annealing (30 seconds) at the
appropriate temperature for each primer pair and extension at 72 °C (1
minute). Using the comparative critical cycle methods, the expression levels of
the target genes were normalized to the GAPDH endogenous control. Data
were analyzed using the 7900 HT SDS software version 2.1 provided by applied
Biosystems. Statistical analysis was performed using Student’s t-test (GraphPad
Prism). The results were considered statistically significant when the p-value
was <0.05.
On the basis of these experiments we observed that TGF-β1 mRNA expression
was the most significant among the examined molecules, so we performed Real
Time PCR on paraffinized tissue in order to confirm mRNA expression data
obtained from cell cultures. For this last procedure we used the same number
of specimens as before (4 from DD patients and 4 from control patients). Real
Time PCR was performed with the same protocol employed in previously
described PCR.
161
Results
The rate of cell proliferation was first evaluated in Dupuytren’s tissues, by
analyzing the cellular proliferation marker known as Proliferating Cell Nuclear
Antigen (PCNA). Fibroblasts and myofibroblasts of Dupuytren's nodules had a
strong nuclear staining of PCNA (Fig. 1A), in contrast with the normal palmar
fascia tissue, in which cell staining was completely absent (Fig. 1B). We
quantified the number of positive cells on the total number of cells in 10
different areas for each experimental group and we expressed the ratio
between PCNA-positive cells and total cells as percentages (Fig 1C). The
incidence of PCNA-positive nuclei in the fibromatosis nodules (87,65 % ± 4,98
%) was significantly (P<0.0001) higher than that in the normal palmar fascia
tissues (18,43 % ± 7,15 %). Our data demonstrate that these pathological
samples are in the same proliferative stage of the disease that causes
thickening and contracture of the palmar fascia. CD68 immunostaining was
performed and it was completely negative in Dupuytren's nodules (Fig 2A)
similarly to normal tissues (Fig. 2B), thus confirming the absence of
macrophages and monocytes in the proliferative phase of the disease. Spindle-
shaped cells in Dupuytren's nodule resulted alpha-SMA-positive (Fig. 2C), this is
a reliable marker of the myofibroblastic phenotype; α-SMA staining was weak or
absent in the control tissues (Fig. 2D). The α-SMA high expression in
Dupuytren’s tissues confirmed the trans-differentiation from fibroblasts to
contractile myofibroblastic phenotype.
Then TGF-β1 was highly expressed in the extracellular matrix and by fibroblasts
and myofibroblasts of Dupuytren’s proliferative nodules (Fig. 3A); at the same
time, a weak expression of TGF-β1 was evidenced in the fibroblasts and
vascular endothelial cells of normal tissues, while it was completely negative in
the extracellular matrix of normal palmar fascia (Fig. 3B). IL-1β was then
evaluated, showing positive immunoreaction in the cytoplasm of fibroblasts and
myofibroblasts, extracellular matrix and vascular endothelial cells of the fibro-
proliferative nodules (Fig. 3C). This pro-inflammatory cytokine was completely
162
absent in the extracellular matrix of control samples, but weakly present in the
cytoplasm of capillary endothelial cells and fibroblasts (Fig. 3D).
Il-6 was strongly expressed in the extracellular matrix in its soluble form, and
moderately present in the proliferative myofibroblasts and fibroblasts of the
Dupuytren’s nodules (Fig. 3E). In the controls, IL-6 was completely absent at
level of the loose connective tissue but moderately expressed in the vascular
endothelial cells and in the fibroblasts (Fig. 3F), confirming that this cytokine is
involved in the inflammatory process that activate the fibrotic process of
Dupuytren’s disease.
TNF-α was then analyzed and it resulted moderately positive in the extracellular
matrix, fibroblasts and vascular endothelial cells of the Dupuytren’s proliferative
site (Fig. 4A) similarly to the control tissue (Fig. 4B). Finally, VEGFa was
strongly positive in vascular endothelium, fibroblasts and myofibroblasts of
Dupuytren’s nodules (Fig. 4C); differently, VEGF-a was completely absent in the
control tissues (Fig.4D). All these data were supported by immunofluorescence
of the cultured fibroblasts and myofibroblasts isolated from Dupuytren’s
nodules, in which α-SMA was expressed by 50% of the cells, with uniform
cytoplasmic distribution (Fig. 5A), confirming the presence of myofibroblasts;
while α-SMA was completely absent in the cells isolated from normal palmar
fascia (Fig. 5B). Pathological cultured fibroblasts and myofibroblasts were also
strongly positive for TGF-β1 expression, as compared to normal fibroblasts,
showing a granular cytoplasmic distribution (Fig. 5 C-D). Also IL-1beta was
strongly present in Dupuytren's cell cultures (Fig. 5E), but weakly present in
normal fibroblasts. Finally, IL-6 was weak and moderately present in
pathological (Fig. 5G) and normal (Fig. 5H) cultured cells. TNF alpha was
moderately expressed by pathological cells (fig 6A), similarly to control
fibroblasts (fig 6B). VEGFa was found to be strongly expressed in the cytoplasm
of fibroblasts and myofibroblasts isolated from Dupuytren's tissue (fig 6C),
while was totally absent in normal fibroblasts (Fig 6D). Our study confirmed
that there was no difference in the intensity of the expression of this pro-
inflammatory cytokine and in the percentage of TNF-α-positive cells between
control cells and pathological fibroblasts (Fig. 7). The difference in the number
163
of IL-6-positive cells between the pathological and the normal cell lines of
fibroblasts was significant for p<0.05 (Fig. 7). On the basis of the
immunohistochemical and immunofluorescence results that showed a stronger
expression of TGF-β, IL-1β and VEGFa in pathological tissue, respect to normal
tissues, we then quantified their differences in mRNA expression between
normal and pathological tissues by RT-PCR (Fig. 8). An upregulation of TGF-β1
(2.30 ± 0.05), IL-1β (2.02 ± 0.07) and VEGFa (1.97 ± 0.04) was demonstrated
in fibroblasts from Dupuytren’s nodules compared to normal fibroblasts (Fig.
9A). RT-PCR data were demonstrated either on cultured cells or in de-
paraffinized tissue samples with p-value <0.05.
Discussion
Dupuytren’s disease is a condition in which the formation of nodules in the palm
of the hand precedes eventual contracture of the fingers due to fibrosis [20].
Clusters of macrophages and T-lymphocytes have been observed, in addition to
myofibroblasts, in the pathological tissue [6, 21-24]. Several growth factors and
inflammatory cytokines have been reported in the literature as molecules
probably involved in the modulation of the pathogenesis of Dupuytren’s disease
[25-27]. TGF-β is undoubtedly one of the cytokines most involved in the
process of fibrosis and is present at high amounts in sites of chronic
inflammation [28-32]. Moreover, some studies have also demonstrated in vitro
that cultured Dupuytren’s cells produce TGF-β and that TGF-β stimulates the
growth of Dupuytren’s fibroblasts [33]. As demonstrated by Kulkarni and
Karlsson [34] TGF-β plays other important roles in the modulation of fibrosis
and inflammation. Our data confirm that TGF beta is more strongly present in
DD extracellular matrix and cells, than in the correspondent normal tissue and
cells. A new finding, not described in the previous available literature on this
topic, is the presence of a cytoplasmic granular fluorescent staining for TGF-β1,
whose characteristic appearance represents an interesting typical finding
observed in DD myofibroblasts. A recent study performed by Iqbal et al. [35]
confirmed the importance of myofibroblasts in the pathogenesis of DD also
164
introducing the possibility of alternative sources of DD myofibroblasts
originating from skin overlying nodule (SON) and perinodular fat (PNF). Verjee
et al. [15] have recently identified another possible therapeutic target in the
TNF, whose role may be hopefully relevant in the better future knowledge of
pathogenesis and therapy of DD. Nowadays, there are different therapeutic
options for the treatment of DD [36], but the real question remains still: what is
the primary cause in its pathogenesis? An important recent study [37]
postulates diverse origins of the myofibroblasts responsible for kidney fibrosis.
Notwithstanding the differences in comparison with DD a possible general
“common control” of the mechanisms of fibrosis may be activated even in
different areas of the body in response to appropriate stimuli. This “common
control” has to be elucidated in further studies, but it probably constitutes the
central problem in DD and in other fibrosis-related pathologies. Some authors
recently underline the possible role of Wnt signaling [38] in the pathogenesis of
DD, but this study implicates even nine different loci involved in genetic
susceptibility to Dupuytren's disease. The fact that six of these nine loci harbor
genes encoding proteins in the Wnt-signaling pathway suggests that
aberrations in this pathway may be key to the process of fibromatosis in
Dupuytren's disease. However further genome studies should be performed in
order to elucidate this interesting hypothesis.
Our results demonstrated that TGF-β, IL-1β and VEGFa are markedly expressed
in Dupuytren’s tissue and cultured myofibroblasts. This finding led us to
postulate a pivotal role for these molecules in the development of Dupuytren’s
contracture. The obtained informations may provide a basis for the research of
non-surgical treatment regimens to reduce the recurrence and the progression
of this disease, ultimately attenuating hospitalization and post-surgical
rehabilitation for patients.
Acknowledgments
This work was supported by a grant of the “Enrico ed Enrica Sovena”
Foundation, Italy. The authors are grateful to Mrs. Sharon Hobby for her kind
and careful revision of the English language of the manuscript.
165
References
1. Calandruccio, J.H. (1998) Dupuytren contracture. S. Terry Canale (Ed.)
Campbell’s Operative Orthopaedic. ninth ed. Mosby, pp. 4274-4276, St. Louis,
MN, USA.
2. Luck JV. (1959) Dupuytren's contracture: a new concept of the pathogenesis
correlated with surgical management. J Bone Joint Surg Am .41, 635-664.
3. Desai SS, Hentz VR. (2011) The treatment of Dupuytren disease. J Hand
Surg Am. 36, 936-42.
4. Shih B, Bayat A. (2010) Scientific understanding and clinical management of
Dupuytren disease. Nat Rev Rheumatol. 6, 715-726.
5. Schurch W, Skali I, Gabbiania G. Cellular biology. (1990) McFarlane RM,
McGrouther DA, Flint MH, eds. Dupuytren’s Disease, pp. 31-4, New York:
Churchill Livingstone.
6. Gabbiani G, Majno G. (1972) Dupuytren’s contracture: fibroblast contraction?
An ultrastructural study. Am J Pathol. 66, 131-138.
7. Kloen P. (1999) New insights in the development of Dupuytren’s contracture:
a review. Br J Plast Surg. 52, 629-635.
8. Badalamenti MA, Sampson SP, Hurst LC, Dowd A, Miyasaka K. (1996) The
role of TGF-beta in Dupuytren’s disease. J Hand Surg. 21A, 210-215.
9. Heldin CH, Miyazono K, Ten Dijke P. (1997) TGF-beta signaling from cell
membrane to nucleus through SMAD proteins. Nature. 390, 465-471.
10. Schmierer B, Hill CS. (2007) TGFβ-SMAD signal transduction: molecular
specificity and functional flexibility. Nat Rev Mol Cell Biol. 8, 970-982.
11. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. (2002)
Myofibroblasts and mechano-regulation of connective tissue remodeling. Nat
Rev Mol Cell Biol. 3, 349-363.
12. AndrewJG, Andrew SM, Ash A, Turner B (1991). An investigation into the
role of inflammatory cells in Dupuytren’s disease. J Hand Surg (Br). 16, 267-271
13. Ito H. (2003) IL-6 and Crohn’s disease. Curr Drug Targets Inflamm Allergy.
2, 125-130.
166
14. Sanchez-Muñoz F, Dominguez-lopez A, Yamamoto-Furusho JK. (2008) Role
of cytokines in inflammatory bowel disease. World J Gastroenterol. 14, 4280-
4288.
15. LS Verjee, JSN Verhoekx, JKK Chan, T Krausgruber, V Nicolaidou, D Izadi, D
Davison, M Feldmann, KS Midwood, and J Nanchahal. (2013) Unraveling the
signaling pathway promoting fibrosis in Dupuytren’s disease revels TNF as a
therapeutic targer. PNAS; 110, 928-937.
16. Sullivan DE, Ferris M,Pociask D, Brody AR. (2005) Tumor necrosis factor-
alpha induces transforming growth factor-beta 1expression in lung fibroblasts
through the extracellular signal-regulated kinase pathway. Am J Respir Cell Mol
Biol. 32, 342-349.
17. LA Holzer, A Cor, G Pfandlsteiner, G Holzer. (2013) Expression of VEGF, its
receptors, and HIF-1a in Dupuytren disease. Acta Orthopaedica. 84, 420-425.
18. Tischer E, Michell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC,
Abraham JA. (1991) The human gene for vascular endothelial growth factor.
Multiple protein forms are encoded through alternative exon splicing. J Biol
Chem. 266, 11947-54.
19. Ke Q, Costa M. (2006) Hypoxia-inducible factor-1 (HIF-1). Mol Pharmacol.
70, 1469-1480.
20. Meek R M , McLellan S, Crossan J F. (1999) Dupuytren’s disease: a model
for the mechanism of fibrosis and its modulation by steroids. Bone and Joint
Surgery. 81, 732-738.
21. Iwasaki H, Muller H, Stutte HJ, Brennscheidt U. (1984) Palmar fibromatosis
(Dupuytren’s contracture): ultrastructural and enzyme histochemical studies of
43 cases. Virch Arch A. 405, 41-53.
22. Scurch W, Seemayer TA, Gabbiani G. (1992) Myofibroblast. In: Sternberg
SS, ed. Histology for pathologists. New York, Raven Press. pp. 118-25.
23. Azzarone B, Failly-Crepin C, Daya-Grosjean L, Chaponnier C, Gabbiani G
(1983) Abnormal behaviour of cultured fibroblasts from nodule and non-
affected aponeurosis of Dupuytren’s disease. J Cell Physiol. 117, 353-61.
24. Baird KS, Alwan WH, Crossan JF, Wojciak B. (1993) T-cell mediated
response in Dupuytren’s disease. Lancet. 341, 1622-3.
167
25. Baird KS, Crossan JF, Ralston SH. (1993) Abnormal growth factor and
cytokine expression in Dupuytren’s contracture. J Clin Pathol. 46, 425-8.
26. Meek RMD, Wojciak B, Crossan JF. (1996) Dupuytren’s fibroblasts secrete
interleukin-8, a powerful lymphocyte chemoattractant. British Society for
Surgery of the Hand Birmingham.
27. Baird KS. (1994) Aetiopathogenesis of Dupuytren’s contracture. Rheumatol
Rev. 3, 111-23.
28. Roberts AB, Sporn MB, Assoain RK, et al. (1986) Transforming growth
factor type beta: rapid induction of fibrosis and angiogenesis in vivo and
stimulation of collagen formation in vitro. Proc Natl Acad Sci USA. 83, 4167-71.
29. Raghow R, Postlethwaite AE, Keski-Oja J, Moses HL, Kang AH. (1987)
Transforming growth factor-beta increases steady state levels of type I
procollagen and fibronectin messenger RNAs posttranscriptionally incultured
human dermal fibroblasts. J Clin Invest. 79, 1285-8.
30. Massague J, Heino J, Laiho M. (1991) Mechanisms in TGF-beta action. Ciba
Found Sym, 157, 51-9.
31 Ignotz RA, Massague J. (1986) Transforming growth factor beta stimulates
the expression of fibronectin and collagen and their incorporation into the
extracellular matrix. J Biol Chem. 261, 4337-45.
32. Wahl SM, Costa GL, Mizel DE, et al. (1993) Role of transforming growth
factor beta in the pathophysiology of chronic inflammation. J Peridontol. 64,
450-5.
33. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. (1995)
Transforming growth factor-beta: possible roles in Dupuytren’s contracture. J
Hand Surg Am. 20, 101-8.
34. Kulkarni AB, Karlsson S. (1993) Transforming growth factor-beta knockout
mice: a mutation in one cytokine gene causes a dramatic inflammatory disease.
Am J Pathol. 143, 3-9.
35. Iqbal SA, Manning C, Syed F, Kolluru V, Hayton M, Watson S, Bayat A.
(2012) Identification of mesenchymal stem cells in perinodular fat and skin in
Dupuytren’s disease: a potential source of myofibroblasts with implications for
pathogenesis and therapy. Stem Cells Dev. 21, 609-622.
168
36. Eaton C. (2014) Evidence-based medicine: Dupuytren contracture. Plast
Reconstr Surg. 133, 1241-51.
37. Falke LL, Gholizadeh S, Goldschmeding R, Kok RJ, Nguyen TQ. (2015)
Diverse origins of the myofibroblasts: implications for kidney fibrosis. Nat Rev
Nephrol. 11, 233-44.
38. Dolmans GH, Werker PM, Hennies HC, Furniss D, Festen EA, Franke L,
Becker K, Van Der Vlies P, Wolffenbuttel BH, Tinschert S, Toliat MR, Nothnagel
M, Franke A, Klopp N, Wichmann HE, Nürnberg P, Giele H, Ophoff RA,
Wijmenga C, Dutch Dupuytren Study Group, German Dupuytren Study Group,
the LifeLines Cohort Study, and the BSSH–GODD Consortium. (2011) Wnt
signaling and Dupuytren disease. N Engl J Med. 365, 307-317.
169
Figure 1. Immunohistochemical analysis of PCNA, CD68 and α-SMA markers in
Dupuytren’s nodules and control tissues. The photomicrographs of Dupuytren’s
nodular tissues showed an increasing number of PCNA (A) and α-SMA-positive
cells (C) compared to the control tissues in which these markers resulted
completely negative (D, F). Immunohistochemistry for CD-68 showed that the
macrophages and monocytes were completely absent in the pathological nodule
(B) similarly to the normal tissue (E). (magnification 40X).
170
Figure 2. Cell proliferation index in Dupuytren’s nodules and normal fascia
palmar tissues. PCNA proliferative index is represented as a percentage of
PCNA-positive nuclei on the total number of cells in Dupuytren’s nodules (87.65
% ± 4.98) and normal fascia palmar tissues (18% ± 7,15). The bar graph
indicates the mean percentage of PCNA positive cells ± SD. Statistical analysis
is performed using Student's t-test. *p-value < 0.05.
171
Figure 3. Immunohistochemical analysis of pro-inflammatory markers TGF-β,
IL-1β and IL-6 in Dupuytren’s nodules and controls. TGF-β was strongly
expressed in the extracellular matrix and cytoplasm of proliferative
myofibroblasts and fibroblasts in the pathological tissue (A). TGF-β was
moderately present in the cytoplasm of fibroblasts scattered in the loose
connective tissue of normal fascia palmar (D). Il-1β was strongly positive in
Dupuytren's myofibroblasts - rich nodules showing cytoplasmic localization (B).
IL-1beta was completely absent in the extracellular matrix and weakly present
in the vascular endothelium and fibroblasts of normal palmar fascia (E). IL-6
was moderately expressed in the extracellular matrix and fibroblasts of
Dupuytren’s tissues (C) similarly to the control tissue (F). (magnification 40X).
172
Figure 4. Immunohistochemical analysis of TNF-α and VEGF in Dupuytren’s
nodules and control tissues. A moderate expression of TNF-α is seen in the
extracellular matrix and fibroblasts of Dupuytren’s nodules (A) and control
tissues (C) (magnification 40X). VEGF immunoreactivity appears to be strongly
positive in the extracellular matrix, fibroblasts and myofibroblasts of
Dupuytren’s nodules (B) (magnification 40X). compared to controls in which the
staining was completely absent in the amorphous substance and weakly
expressed in the cytoplasm of normal fibroblasts (D) (magnification 20X).
173
Figure 5. Immunofluorescence for α-SMA and pro-inflammatory factors TGF-β,
IL-β, IL-6 in fibroblast cultures isolated from Dupuytren’s nodules and normal
palmar fascia. The pathological fibroblasts isolated from Dupuytren’s nodules
(A) showed a strong expression of α-SMA demonstrating that 50% of
fibroblasts differ in myofibroblasts. In the normal fibroblasts, α-SMA expression
was completely absent (E). TGF-β and IL-β were strongly expressed in the
pathological fibroblasts isolated from Dupuytren’s tissues (B, C,) compared to
the normal fibroblasts (F, G,) that showed a weak expression of these pro-
inflammatory factors. IL-6 was moderately expressed in the cytoplasm of
pathological (D) and normal fibroblasts (H) (magnification 20X).
174
Figure 6. Immunofluorescence for TNF-α and VEGF in fibroblast cells isolated
from Dupuytren’s nodules and normal palmar fascia. TNF-α was moderately
expressed in the pathological fibroblast cultures (A) similarly to the control
fibroblasts (C).A strong VEGF expression was found in the cytoplasm of
Dupuytren’s fibroblasts (B) differently from fibroblasts isolated from normal
palmar fascia in which this factor was completely absent (D). (magnification
20X).
175
Figure 7. Pro-inflammatory cytokines and VEGF positive cell index in the
fibroblasts isolated from Dupuytren's contracture and normal palmar fascia
tissue. The bar graph indicates the mean % growth factors-positive cells ± SD.
Statistical analysis is performed using Student's t-test. * p<0.0001 or **
p<0.05.
176
Figure 8. Quantitative PCR analysis in Dupuytren’s nodules-derived cells, in
control tissue and in paraffinized tissue samples. A (upper): PCR analysis of
mRNA expression for TGF-β1, IL-1β and VEGF-A in nodules-derived cells and in
control normal tissue. Data are presented as mean ± SEM . Statistical analysis
is performed using Student’s t-test. * p-value <0.05.
B (down): PCR analysis of mRNA expression for TGF-β1 in paraffinized tissue
samples from DD patients and control ones.
177
Chapter 8
Radiolabeling VEGF165 with 99mTc to
evaluate VEGFR expression in tumor
angiogenesis
*F. Galli1,2, *M. Artico3, S. Taurone3, I. Manni4,
E. Bianchi3, G. Piaggio4, B.D. Weintraub5,
M. Szkudlinski5, E. Agostinelli6, R.A.J.O. Dierckx2,
A. Signore1,2
*AUTHORS EQUALLY CONTRIBUTED
1Nuclear Medicine Unit, Department of Medical-Surgical Sciences and of
Translational Medicine, Faculty of Medicine and Psychology, “Sapienza”
University of Rome, Italy. 2Department of Nuclear Medicine and
Molecular Imaging, University Medical Centre Groningen, University of
Groningen, Groningen, The Netherlands. 3Department Sensory Organs,
“Sapienza” University of Rome, Italy. 4Molecular Oncogenesis Laboratory,
Experimental Oncology Department, Regina Elena National Cancer
Institute, Rome, Italy 5Trophogen Inc., Rockville, MD, USA. 6Department
of Biochemical Sciences "A. Rossi Fanelli", “Sapienza” University of
Rome, Rome, Italy.
Submitted to Intern. Journal of Oncology 2016
Key words: VEGF - nuclear medicine – angiogenesis - tumor imaging
178
Abstract
Introduction: Angiogenesis is the main process responsible for tumor growth
and metastatization. The principal effector of such mechanism is the vascular
endothelial growth factor (VEGF) secreted by cancer cells and other
components of tumor microenvironment, under specific stimuli. Radiolabelled
VEGF analogues may provide a useful tool to noninvasively imaging tumor
lesions and evaluate the efficacy of anti-angiogenic drugs, aimed at blocking
the VEGFR pathway. Aim of the present study was to radiolabel the human
VEGF165 analogue with 99mTechnetium (99mTc) and evaluate the expression
of VEGFR in both cancer and endothelial cells in the tumor microenvironment.
Material and Methods: The human VEGF-A165 analogue was successfully
labelled with 99mTc using an indirect method via succinimidyl-6-
hydrazinonicotinate hydrochloride conjugation. Several in vitro quality controls
(QC) including SDS-PAGE, cysteine challenge and cell binding assay on HUVEC
cells were performed. In vivo studies included biodistribution studies and tumor
targeting experiments in athymic nude CD-1 mice xenografted with different
cell lines (ARO, K1 and HT29). Immunohistochemistry was performed on
excised tumors to confirm VEGF receptor (VEFR) expression in the lesion and
endothelial cells.
Results: Human VEGF-A165 analogue was labelled with high labelling
efficiency (>95%) and high specific activity. The radiolabelled molecule
retained its biological activity and structural integrity as confirmed by in vitro
QC. In tumor targeting experiments, a focal uptake of radiolabelled VEGF165
was observed in every xenografted tumor with different tumor-to-background
ratios. Immunohistochemical analysis of excised tumors revealed an inverse
correlation between VEGF and uptake of the radioactive hormone. On the other
hand a positive correlation between radioactive VEGF165 and VEGFR1 was
observed.
Conclusion: Human VEGF-A165 was successfully radiolabelled with 99mTc.
When used for in vivo imaging of VEGFR expression in tumors, endogenous
179
VEGF produced by cancer and other cells of tumor microenvironment should be
taken in consideration because of possible saturation of VEGFRs.
Introduction
Angiogenesis is the vital physiological process involving the growth and
remodelling of new blood vessels from pre-existing one and is implicated in a
number of diseases including cancer. Indeed, neoangiogenesis is essential for
tumor growth as well as crucial for local and distant metastatization through
both blood and lymphatic vessels (1, 2). Therefore, many new targeted
therapies have been developed and they are based on drugs able to bind
vascular endothelial growth factor (VEGF) and its receptor (VEGFR), which have
been shown to be up-regulated in tumor and highly proliferating endothelial
cells. Such overexpression has been associated with progression,
metastatization and poor outcome in particularly aggressive cancers (4). Some
of these drugs have been approved for human use and proved to be effective in
many solid tumors (7). The most widely used in clinical practice is the anti-
VEGF monoclonal antibody (mAb) bevacizumab that binds the free VEGF.
Others, like the tyrosine kinase inhibitors (TKIs) sorafenib and sunitinib, are
able to target the VEGFR2 blocking the signalling cascade (8). It has been
reported that the majority of patients benefits from targeted therapies, but a
small fraction fails to show even initial benefits. The reasons may range from
the involvement of parallel angiogenic pathways to the absence of the targets
(9). Therefore, it would be important to predict which patients would benefit
from a specific targeted therapy and several studies indicated the possibility to
image angiogenic markers with the use of radiopharmaceuticals targeting VEGF
or VEGFR (10). In particular, since VEGFR is expressed also in some cancer
cells, this technique will be useful in both early detection and cancer treatment
monitoring (11-13). Radiopharmaceuticals to image tumor angiogenesis have
been described in the literature, but many of them showed limitations that
slowed or blocked the shift from preclinical to clinical trials. Among them the
most common were poor or variable binding affinity and exaggerated liver
180
uptake (14-15). In the present study we optimized the radiolabelling of
VEGF165 with 99m-technetium (99mTc) using HYNIC as bifunctional chelator,
obtaining a highly stable radiopharmaceutical with high in vitro receptor binding
affinity. In vivo we used 99mTc-HYNIC-VEGF165 to image VEGFR expression in
different tumor xenografts and correlated in vivo data with histological findings.
Materials and Methods
Labelling of VEGF-A165 with 99mTc
The human hVEGF-A165 analogue with a molecular weight of 19 KDa was
provided by Trophogen Inc. and radiolabelled with 99mTc through an indirect
method after conjugation with the bifunctional chelator 6-hydrazinonicotinamide
(HyNic). Radiolabelling was optimized by testing several labelling conditions
including different HYNIC:VEGF ratios (1:1, 4:1 and 8:1) and different amounts
of tricine (from 0.9 mg/ml to 200 mg/ml PBS) or SnCl2 (from 2 mg/ml to 20
mg/ml 0.1 M HCl). Briefly, VEGF165 (0.5 mg) was incubated with an excess of
succinimidyl-6-hydrazinonicotinate hydrochloride (SHNH, SoluLink, USA) for 2 h
at room temperature in the dark. At the end of the incubation free SHNH was
removed by size exclusion chromatography using a G-25 Sephadex PD10
column (GE Healthcare, UK) and nitrogen-purged phosphate buffer saline (pH
7.4) as eluent. The number of HYNIC groups bound per molecule of VEGF165
was determined by a molar substitution ratio (MSR) assay. Briefly, conjugated
VEGF165 (2 µl) was added to a 0.5 mM solution (18 µl) of 2-sulfobenzaldehyde
in 0.1 M 2-(N-morpholino) ethanesulfonic acid (MES) buffer (pH 5.0) and
incubated at room temperature for 2 hours. Phosphate buffer saline (PBS)
alone was used as blank and duplicates were prepared. After 2 hours the
absorbance at 345 nm of each reaction was measured with a
spectrophotometer and the number of HYNIC groups per molecule was
calculated as indicated in the SoluLink data sheet. Radiolabelling was performed
incubating 30 µg of VEGF165 (in 100 µl PBS) with 300 MBq of freshly eluted
99mTcO4- (100 µl), 100 µl of tricine (Sigma-Aldrich Chemicals, UK) and 5 µl
SnCl2 (Sigma-Aldrich Chemicals, UK). Labelling efficiency (LE) and colloids
181
percentage were measured up to 30 minutes of incubation. After labelling, an
additional purification by size exclusion chromatography was performed using a
Zeba Spin Column (Thermo Scientific, USA) to remove any free 99mTcO4-,
tricine and SnCl2.
In vitro quality controls
Quality controls were performed using instant thin layer chromatography-silica
gel (ITLC-SG) strip (Pall Life Sciences, USA). Results were analysed by a radio-
scanner (Bioscan Inc., USA) to calculate the LE of 99mTc-HYNIC-VEGF165. The
mobile phase for LE determination was a 0.9% NaCl solution, whereas the
amount of colloids was determined using a NH3:H2O:EtOH (1:5:3) solution.
Quality controls were performed before and after the purification with a Zeba
Spin column. Additionally, reverse phase HPLC was carried out using a C8
Kinetex 4.6 x 250 mm column and a gradient of H2O (A) and acetonitrile (B)
with 0.1 % TFA. The following gradient was used: 0-5 min 0-5% B, 5-20 min 5-
95% B, 20-25 min 95% B and 25-30 min 95-5%B. Stability assays were
performed adding 100 l of 99mTc-HYNIC-VEGF165 to a vial containing 900 l
of fresh human blood serum and to another containing 900 l of 0.9% NaCl
solution. Both vials were incubated up to 24 hours at 37°C. The radiochemical
purity was measured at 1, 3, 6 and 24 hours by ITLC analysis. In addition, a
cysteine challenge assay was performed incubating the labelled VEGF165 at
37°C for 60 min with different cysteine concentration, ranging from 1000:1
(cysteine:VEGF165) to 0.1:1 molar ratio. For each time point, radiochemical
purity was evaluated by ITLC as described above. All known chemical forms of
99mTc-cysteine have Rf values between 0.5 and 1, when normal saline was
used as mobile phase. Integrity of the labelled VEGF165 molecule was also
checked by sodium dodecyl sulphate–polyacrylamide gel electrophoresis under
non-reducing conditions, according to the method of Laemmli (16). Proteins
were visualized by staining the gels with Coomassie Brilliant Blue (Thermo
Scientific, USA). Radioactivity associated with each band was determined
scanning the gel with a radio-scanner.
182
Cell lines
VEGFR+ cell line, human umbilical veins endothelial cells (HUVEC) were
cultured in F-12K medium supplemented with 10% FCS, 100 IU/ml penicillin,
100 µg/ml streptomycin, 2 mM L-glutamine and EGM®-2 Bulletkit (Lonza, USA)
(17). The human anaplastic thyroid cancer cell line (ARO), the human colorectal
cancer cell line (HT29) and the human poorly differentiated thyroid cancer cell
line (K1) were grown in DMEM high glucose (Gibco, USA) supplemented with
10% FCS, 100 IU/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine
(18-20).
In vitro binding studies
Measurements of cell uptake and retention of labelled VEGF-A165, was
performed in vitro using the semi automatic system LigandTracerTM that allows
to follow binding over time (Ridgeview Instruments AB, Sweden) (21). Briefly,
106 HUVEC cells were seeded in a tilted Petri dish and incubated in a humified
incubator at 37°C and 5% CO2 for 24 hours. The dish was then placed in the
LigandTracer and allowed to rotate continuously for 15 minutes to allow release
of weakly attached cells. After one gentle wash, 2 ml of PBS containing
radiolabelled VEGF165 (30 nM) were added to the dish and it started to rotate
until reaching maximal binding. The device was then stopped, the liquid
removed and replaced with culture medium without labelled VEGF165 for
calculating release of radioactivity from cells. Association and dissociation
curves were obtained analysing data by non-linear regression analysis with
GraphPad Prism (GraphPad Software Inc, USA) to calculate the kon, koff and
Kd values.
In vivo studies
Biodistribution and imaging studies
For animal experiments, the institutional and national guide for the care and
use of laboratory animals was followed. Imaging studies were performed with a
previously described high-resolution portable mini-gamma camera (HRC), IP-
Guardian (Li-Tech S.r.l., Italy) (22). For in vivo biodistribution studies, 5.5 MBq
183
(190 MBq/nmol, 100 µl) of labelled VEGF165 were injected in the tail vein of 12
nude CD-1 mice and static planar posterior images were acquired using the
HRC at 1, 3, 6 and 24 hours, under light ether anaesthesia. At the end of each
imaging point three mice were euthanized and major organs were collected and
counted in a single well gamma-counter. In vivo cell-targeting experiments
were performed in 36 nude CD-1 mice that were divided in three groups. Each
group was injected subcutaneously in the right thigh with respectively 106 ARO,
HT29 and K1 cells mixed with BD Matrigel (BD Biosciences, USA) (1:1) After
tumor growth (approximately 0.6-1 cm3, in 20 days), 5.5 MBq of labelled
VEGF165 were administered i.v. in the tail vein and static planar posterior HRC
images were acquired at 1, 3, 6 and 24 hours, under light ether anaesthesia. At
each time point 3 mice were euthanized for ex-vivo counting. Major organs and
tumors were collected, weighted and counted for radioactivity with a single well
gamma-counter (Gammatom, Italy).
Blocking studies
Blocking studies were performed in four mice injected with 1 million HT29 cells
mixed with Matrigel® in the right thigh. After tumor growth, 5.5 MBq of
99mTc-VEGF165 were injected in the tail vein and images were acquired with a
portable mini-gamma camera at 1 h and 3 h post-injection. After 3 days,
99mTc-HYNIC-VEGF165 was pre-incubated for 1 h with 3.5 fold molar excess of
recombinant human VEGFR2-Fc chimera (BioLegend Inc., USA) that act as a
soluble decoy receptor (TRAP) that has been proved to prevent the binding of
VEGF to endothelial cells. After the incubation, a dose of 5.5 MBq was injected
in the tail vein of 3 of the 4 mice previously imaged and images were acquired
with a portable mini-gamma camera at 1 h and 3 h post-injection. After 3 more
days, a 100 fold molar excess of unlabelled VEGF165 (COLD) was injected in
the tail vein of the same 3 mice and after 10 minutes 5.5 MBq of 99mTc-
HYNIC-VEGF165 were injected. Images were acquired with a portable mini-
gamma camera at 1 h and 3 h post-injection. Region of interest were drawn on
the tumor and on the contralateral leg in each image and target-to-background
(T/B) ratios were calculated.
184
Immunohistochemical analysis
For light microscope immunohistochemical analysis, small fragments of each
excised tumor (ARO, HT29 and K1) were processed according to ABC/HRP
technique (avidin complexed with biotinylated peroxidase). These samples were
washed in PBS, fixed in 10% formalin and embedded in paraffin according to a
standard procedure. Serial 3-µm thick sections were cut using a rotative
microtome, mounted on gelatin-coated slides and processed for
immunohistochemistry. These sections were de-paraffinized in xylene and
dehydrated. They were immersed in citrate buffer (pH 6) and subjected to
microwave irradiation twice for 5 minutes. Subsequently, all sections were
treated for 30 minutes with 0.3% hydrogen peroxide in methanol to quench
endogenous peroxidase activity. To block non-specific binding, the slides were
incubated with M.O.M. Mouse Ig Blocking Reagent (Vector Laboratories
Burlingame, CA, USA) for 1 h at room temperature. The slides were incubated
overnight at 4°C with the following antibodies: i) mouse anti-VEGF monoclonal
antibody (Santa Cruz Biotechnology, CA, USA); ii) mouse anti-VEGF Receptor 1
[Flt-1/EWC] monoclonal antibody (Abcam, ab9540, UK); iii) mouse anti-VEGF
Receptor 2 [KDR/EIC] monoclonal antibody (Abcam, ab9530, UK). Optimal
antisera dilutions and incubation times were assessed in a series of preliminary
experiments. After exposure to the primary antibodies, slides were rinsed twice
in phosphate buffer and incubated for 1h at room temperature with the
appropriate secondary biotinylated goat anti-mouse IgG (Vector Laboratories
Burlingame, CA, USA, BA9200 and BA1000) and with peroxidase- conjugated
avidin (Vectastain Elite ABC Kit Standard* PK 6-100) for 35 minutes. After a
further wash with phosphate buffer, slides were treated with 0.05% 3,3-
diaminobenzidine (DAB) and 0.1% H2O2 (DAB substrate kit for peroxidase,
Vector Laboratories SK-4100). Finally, sections were counterstained with
Mayer’s haematoxylin and observed using a light microscope. Negative control
experiments were carried out: i) by omitting the primary antibody; ii) by
substituting the primary antibody with an equivalent amount of non-specific
immunoglobulins; iii) by pre-incubating the primary antibody with the specific
185
blocking peptide (antigen/antibody = 5 according to supplier’s instructions).
The staining assessment was made by two experienced observers in light
microscopy. Immunoreactivity of VEGF, VEGFR1, and VEGFR2 was assessed in
all samples. The intensity of the immune reaction was assessed
microdensitometrically using an IAS 2000 image analyser (Delta Sistemi, Rome,
Italy) connected via a TV camera to the microscope. The system was calibrated
taking as zero the background obtained in sections exposed to non-immune
serum. Ten 100 μm2 areas were delineated in each section using a measuring
diaphragm. The quantitative data regarding the intensity of immune staining
were analysed statistically using analysis of variance (ANOVA) followed by
Duncan’s multiple range test as a post hoc test.
Results
Labelling with 99mTc and quality controls
Highest labelling efficiency was obtained when the analogue was conjugated
with a ratio HYNIC:VEGF165 of 8:1. Determination of molar substitution ratio of
HYNIC-conjugated VEGF165 demonstrated that an average of 4.3 molecules of
HYNIC groups were bound per molecule of analogue. Higher ratios were not
selected to avoid over-conjugation of the hormone and possible structural
modification. Optimization of the labelling procedure of the HYNIC-VEGF165
conjugate (30 µg) with 99mTc showed that, after 10 minutes of incubation, the
use of 100 l of tricine (0.5 mM) and 5 l of SnCl2 (50 nM) allowed to obtain
the highest LE (65 %) and the lowest amount of colloids (<5%). After Zeba
spin purification we were able to obtain a radiochemical purity of > 95 % as
confirmed by both ITLC and HPLC analysis (Figure 1). Specific activity of
resulting 99mTc-HYNIC-VEGF165 was 190 MBq/nmol. Radiolabelled VEGF165
was stable up to 24 h in both in human serum and in a 0.9% NaCl solution at
37 °C, as well as in solutions containing increasing cysteine concentrations. A
slight decrease in the radiochemical purity was observed only at high cysteine
concentrations (>500:1) (Figure 2). Gel electrophoresis of radiolabelled,
conjugated and unconjugated analogue showed no significant differences and
186
the absence of significant degradation or aggregation resulting from
conjugation and/or labelling (Figure 3).
In vitro binding studies
Kinetic biding assay with LigandTracer showed an increasing uptake of labelled
VEGF165 from HUVEC cells that reached a plateau after 50 minutes (Figure 4).
Retention studies revealed a slow dissociation rate from membrane bound
receptors in the following 2 hours, with a Kd of 192 pM.
In vivo studies
Biodistribution and imaging in mice
Biodistribution studies with 99mTc-HYNIC-VEGF165 matched qualitative
imaging (Figure 5) in mice showed a high and persistent uptake by the liver
and a moderate uptake by the kidneys with almost no signal from other organs
and blood pool. Single organ counting revealed a high %ID/g also in the lungs
and spleen. In vivo targeting experiments showed a focal uptake in the right
thigh of each group bearing tumor xenografts with a T/B ratio of 4.5 at 1 h p.i
in mice bearing a HT29 xenograft. Animals bearing ARO and K1 cells showed a
T/B of 3.5 and 2.3 respectively that decreased over time (Figure 6).
Blocking studies
Blocking studies with 99mTc-HYNIC-VEGF165 confirmed the results of previous
targeting experiments. After pre-incubation of the radiopharmaceutical with
recombinant VEGFR2-Fc, a main liver and spleen uptake, with reduced signal
from kidneys, was detected, resembling the typical biodistribution of a non-
specific radiolabelled antibody (Figure 7). The overall uptake in tissues was
lower and the uptake in the tumor was consistently reduced. Similar findings
were obtained after the pre-injection of a 100 fold molar excess of unlabelled
VEGF165 with the exception of the signal from kidneys, which looks similar to
the signal obtained with labelled VEGF only. Calculated T/B ratios for the “HOT”
group reflected the data obtained with the previous experiments with a
maximum uptake reached at 1 h that slowly decreases with time. The T/B ratio
187
in the TRAP group was reduced by 70% due to the co-incubation with VEGFR2-
Fc at 1 h and the T/B ratio in the “COLD” group was reduced by 60% at 1 h.
Minor blocking was evident at 3 h in both TRAP and “COLD” group mainly due
to the decreased activity in tumors of the control group.
Immunohistochemical analysis
IHC analysis on excised tumor showed the presence of VEGF, VEGFR1 and
VEGFR2 on both the lesion and the surrounding vessels at different extents
(Figure 8). After semi-quantitative analysis of expression levels, a higher
amount of free VEGF was present in lesions derived from K1 cell lines (33.2%),
followed by HT29 (15.7%) and ARO cells (10.6%). VEGFR1 and 2 were present
heterogeneously between tumor cells and blood vessels, revealing that even
cancer may express VEGF receptors on the plasma membrane. IHC data were
compared with the uptake of radioactive VEGF165 and an inverse correlation
was observed between endogenous VEGF and T/B ratio (r2=0.63; p=0.03,
Figure 9). On the other hand, a positive correlation was observed between
radioactive VEGF165 uptake and VEGFR1 (r2=0.64; p=0.03, Figure 9). In
addition, tumor weight positively correlates with VEGF production (r2=0.65;
p=0.03) and shows a trend to inversely correlate with radiolabelled VEGF
uptake (r2=0.31; p=0.35).
Discussion
Imaging of tumor microenvironment has been described as a promising
approach for non-invasive diagnosis of cancer metastases and to monitor the
efficacy of new anti-angiogenic drugs (23). Given their role in metastatization
and tumor growth VEGF and its receptors are optimal diagnostic and
therapeutic targets. As an example, in undifferentiated thyroid cancer, the use
of TKIs blocking the VEGF/VEGFR pathway showed its potential as a promising
therapeutic approach (24). Unfortunately, severe side effects have been
188
reported in some patients after long time treatment. Therefore, a non-invasive
diagnostic tool to predict the response to therapy and evaluate drug efficacy is
vitally needed. In the past many attempts have been done to develop
radiopharmaceuticals to image angiogenesis with promising results. Among
them, 111In, 89Zr or 64Cu radiolabelled bevacizumab was able to efficiently
image xenograft from ovarian cancer, but the high radiation burden to the
patient and the low availability of 89Zr and 64Cu were some of the drawbacks
of its use (25). Other groups tried to use recombinant human VEGF to
overcome the long half-life of mAbs and used radioiodine, 99mTc, 64Cu or
68Ga as the isotopes of choice (10, 14). In the present study, we followed the
same approach to strengthen the hypothesis that the use of recombinant
human VEGF to target angiogenesis is a promising methodology to develop
non-invasive diagnostic tools and monitor novel targeted drugs development. In
addition we improved the labelling method to produce a high specific activity
and highly stable radiopharmaceutical to bind VEGFR with high binding affinity
and avoid misinterpretation of in vivo studies. Furthermore, the use of
picomolar amounts of radiolabelled VEGF for a scintigraphic study should not
raise any concern about a potential biologic effect of such radiopharmaceuticals
and in particular on the pro-angiogenic effect that VEGF analogues may have
on existing blood vessels. Thus, in vivo results allowed us to image tumor
angiogenesis in xenografts from three different human cell lines with high T/B
ratio between 1 and 3 h post-injection (max T/B at 1 h for HT29 was 4.5).
Nevertheless a high liver uptake was observed in all mice till late time points,
confirming previous findings from other groups (26). Backer et al. raised the
problem that VEGF-based probes uptake in the tumor area is highly
heterogeneous, probably because of the combination of several mechanisms
like non-uniform perfusion of tumor vasculature, differential receptor occupancy
by host VEGF or differential accessibility of VEGF receptors on luminal and
subluminal surfaces of the endothelium (27). Moreover, it has been reported by
Chen et al. (28) that tumor size negatively influence the uptake of radiolabelled
VEGF by the tumor, probably because of the presence of necrotic areas. To
address, in particular, the role of necrosis and endogenous VEGF production,
189
we performed histological and immunohistochemical analysis of each tumor
imaged with 99mTc-VEGF165. Results confirmed variability in VEGFR1 and
VEGFR2 receptor expression and ligand occupancy in both host endothelium
and cancer cells. Moreover, we confirm that bigger tumors show lower uptake
of radiolabelled VEGF, despite we did not observe the presence of significant
necrotic areas in any tumor. On the other hand, we observed a positive
correlation between tumor size and production of endogenous VEGF (p=0.03),
suggesting that the reduced tumor uptake of the radiopharmaceutical could
depend on saturation of VEGFRs rather that size or necrosis, as previously
suggested (27, 28). Therefore, this study highlights an important aspect that
has not been considered before: the role of both endogenous VEGF production
and VEGFR expression on imaging strategies. While for other ligand receptor
system, the endogenous production of the ligand may not be highly relevant for
imaging the receptor ligand (i.e. IL-2 and IL-2 receptor), (29, 30), here we
show that the high production of endogenous VEGF by tumor cells hampers the
possibility to image its receptors. In the light of our results we can better
interpret previously published studies with radiolabelled VEGF (both VEGF121
and VEGF165) (26, 31) that showed very poor tumor uptake, in contrast with
studies with radiolabelled anti-VEGF mAb that showed high tumor uptake (32).
All together, these data confirm that the presence of high VEGF levels in
tumors, particularly those advanced with highly hypoxic tumor
microenvironment and aggressive phenotypes, may saturate VEGF receptors,
thus limiting the possibility to image receptors. Overexpression of soluble
VEGFR in some tumors and significant sequestration of VEGF on cell surface
heparin-sulfate proteoglycans may also contribute to highly variable imaging
results in different tumors. One possible limitation of our study is the limited
number of animals used. However, in mice bearing K1 tumors, or ARO or HT29,
we found highly consistent data supporting the very low variability within the
same cell line. Nevertheless, different tumors showed different levels of
VEGF/VEGFR. Another possible limitation could be that the semi-quantitative
evaluation of VEGF189 that we performed by immunohistochemistry may not
represent the real production of VEGF121 and VEGF165. However, these forms
190
are splicing variants of the same molecule and usually expressed in similar
quantities (33). Overall we believe that the above considerations may have a
limited impact on the final conclusion that VEGFR imaging in tumors by using
radiolabelled VEGF is extremely variable, influenced by the presence of
endogenous VEGF and unrelated to VEGFR receptor expression. It can be
extrapolated that an accurate in vivo evaluation of tumor angiogenesis should
include both VEGF and VEGFR imaging, unless it will be demonstrated the
predominant clinical relevance of one over the other. Finally, the development
of a VEGF superantagonist may be important either for its ability to bind the
receptor without inducing internalization (downmodulation), either to block the
VEGFR signalling.
Conclusions
Imaging of angiogenesis by targeting VEGFR with radiolabelled VEGF analogues
may be a complementary approach to evaluate angiogenic status of tumors.
This approach may allow the evaluation of anti-angiogenic drugs at both
preclinical and clinical stages in combination with VEGF imaging. Our results
indicate that VEGFR expression is variable in both tumors and its imaging is
hampered by endogenous VEGF production. Therefore, additional studies are
required to fully understand the VEGF/VEGFR relationships in different cancers
and establish a more accurate and angiogenic phenotype-determined imaging
protocols.
Acknowledgments
This STUDY was funded by grants from the Italian Association for Cancer
Research (AIRC IG-2013 14151) and by “Sapienza” University research projects.
We also wish to acknowledge the no-profit association Nuclear Medicine
Discovery for support.
Disclosure
Authors have no competing financial interests except for BW and MS that are
personnel of Trophogen Inc. and therefore have potential financial interests.
191
REFERENCES
1) Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other
disease. Nat Med 1995;1:27-31.
2) Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature
(Lond) 2000;407:249-257.
3) Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial
growth factor (VEGF) and its receptors. FASEB J 1999;13:9-22.
4) De Araujo-Filho VJ, Alves VA, de Castro IV et al. Vascular endothelial
growth factor expression in invasive papillary thyroid carcinoma. Thyroid
2009;19:1233-1237.
5) Weidner N, Carrol PR, Flax J, Blumenfeld W, Folkman J. Tumor
angiogenesis correlates with metastasis in invasive prostate carcinoma. Am J
Pathol 1993;143:401-409.
6) Joseph IB, Nelson JB, Denmeade SR, Isaacs JT. Androgens regulate
vascular endothelial growth factor content in normal and malignant prostatic
tissue. Clin Cancer Res 1997;3:2507-2511.
7) Hurwitz H, Fehrenbacher L, Cartwright T et al. Bevacizumab (a
monoclonal antibody to vascular endothelial growth factor) prolongs survival in
first-line colorectal cancer (CRC): results of a phase III trial of bevacizumab in
combination with bolus IFL (irinotecan, 5-fluorouracil, leucovorin) as first-line
therapy in subjects with metastatic CRC, in Proceedings of the Annual Meeting
of the American Society of Clinical Oncology; 2003 May 31; Chicago, IL. Vol 22,
pp 3646, American Society of Clinical Oncology, Chestnut Hill, MA.
8) Gruber JJ, Colevas AD. Differentiated Thyroid Cancer: Focus on Emerging
Treatments for Radioactive Iodine-Refractory Patients. Oncologist. 2015
Feb;20:113-26.
9) Gotink KJ, Verheul HMW. Anti-angiogenic tyrosine kinase inhibitors: what
is their mechanism of action? Angiogenesis. 2010;13: 1–14.
192
10) Blankenberg FG, Levashova Z, Sarkar SK, Pizzonia J, Backer MV, Backer
JM. Noninvasive assessment of tumor VEGF receptors in response to treatment
with pazopanib: a molecular imaging study. Transl Oncol. 2010 Feb;3:56-64.
11) Toi M, Inada K, Suzuki H, Tominaga T. Tumor angiogenesis in breast
cancer: its importance as a prognostic indicator and the association with
vascular endothelial growth factor expression. Breast Cancer Res Treat
1995;36:193-204.
12) Folkman J. Angiogenesis: an organizing principle for drug discovery? Nat
Rev Drg Discov. 2007;6:273-286.
13) Cai W, Rao J, Gambhir SS. How molecular imaging is speeding up anti-
angiogenic drug development and testing. Nat Clin Pract Oncol. 2007;4:556-
557.
14) Dijkgraaf I, Boerman OC. Molecular imaging of angiogenesis with SPECT.
Eur J Nucl Med Mol Imaging. 2010;37 Suppl 1:S104-13.
15) Cai W, Chen X. Multimodality molecular imaging of tumor angiogenesis. J
Nucl Med. 2008;49:113S–128S.
16) Laemmli UK. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 1970;227:680-685.
17) Zenner HL, Collinson LM, Michaux G, Cutler DF. High-pressure freezing
provides insights into Weibel-Palade body biogenesis. J Cell Sci 2007;120(Pt
12):2117-25.
18) Ke CC, Liu RS, Yang AH et al. CD133-expressing thyroid cancer cells are
undifferentiated, radioresistant and survive radioiodide therapy. Eur K Nucl Med
Mol Imaging. 2013;40:61-71.
19) Paudyal B, Paudyal P, Shah D, Tominaga H, Tsushima Y, Endo K.
Detection of vascular endothelial growth factor in colon cancer xenografts using
bevacizumab based near infrared fluorophore conjugate. J Biomed Sci
2014;21:35.
20) Galli F, Manni I, Piaggio G, et al. (99m)Tc-labeled-rhTSH analogue
(TR1401) for imaging poorly differentiated metastatic thyroid cancer. Thyroid
2014;24:1297-308.
193
21) Bjorke H, Andersson K. Automated, high-resolution cellular retention and
uptake studies in vitro. Appl Radiat Isot 2006;64:901-905.
22) Soluri A, Massari R, Trotta C et al. New imaging probe with crystals
integrated in the collimator’s square holes. Nucl Instrum Methods Phys Res A
2005;554:331-339.
23) Stacy MR, Maxfield MW, Sinusas AJ. Targeted Molecular Imaging of
Angiogenesis in PET and SPECT: A Review. Yale J Biol Med. 2012 Mar;85:75-86.
24) Schneider TC, Abdulrahman RM, Corssmit EP, Morreau H, Smit JW,
Kapiteijn E. Long-term analysis of the efficacy and tolerability of sorafenib in
advanced radio-iodine refractory differentiated thyroid carcinoma: final results
of a phase II trial.Eur J Endocrinol. 2012;167:643-50.
25) Stollman TH, Scheer MG, Franssen GM, Verrijp KN, Oyen WJ, Ruers TJ,
Leenders WP, Boerman OC. Tumor accumulation of radiolabeled bevacizumab
due to targeting of cell- and matrix-associated VEGF-A isoforms. Cancer Biother
Radiopharm. 2009;24:195-200.
26) Blankenberg FG, Backer MV, Levashova Z, Patel V, Backer JM. In vivo
tumor angiogenesis imaging with site-specific labeled (99m)Tc-HYNIC-VEGF.
Eur J Nucl Med Mol Imaging 2006;33:841-8.
27) Backer MV, Levashova Z, Patel V et al. Molecular imaging of VEGF
receptors in angiogenic vasculature with single chain VEGF-based probes. Nat
Med 2007;13:504-9.
28) Chen K, Cai W, Li ZB, Wang H, Chen X. Quantitative PET imaging of
VEGF receptor expression. Mol Imaging Biol. 2009;11:15-22.
29) Signore A, Chianelli M, Annovazzi A et al. 123I-interleukin-2 scintigraphy
for in vivo assessment of intestinal mononuclear cell infiltration in Crohn’s
disease. J Nucl Med 2000;41:242-9.
30) Signore A, Capriotti G, Chianelli M, Bonanno E, Galli F, Catalano C,
Quintero AM, De Toma G, Manfrini S, Pozzilli P; Action LADA Group. Detection
of insulitis by pancreatic scintigraphy with 99mTc-labeled IL-2 and MRI in
patients with LADA (Action LADA 10). Diabetes Care. 2015;38:652-8.
31) Kang CM, Koo HJ, Choe YS, Choi JY. 68Ga-NODAGA-VEGF121 for in vivo
imaging of VEGF receptor expression. Nucl Med Biol 2014;41:51-7.
194
32) Gaykema SB, Browers AH, Lub-de Hooge MN et al. 89Zr-bevacizumab
PET imaging in primary breast cancer. J Nucl Med 2013;54:1014-8.
33) Cai C, Bottcher MC, Werner JA, Mandic R. Differential expression of
VEGF121, VEGF165 and VEGF189 in angiomas and squamous cell carcinoma
cell lines of the head and neck. Anticancer Res 2010;30:805-10.
195
Figure. 1. HPLC profile showing UV (black) and radioactive (grey)
chromatograms of 99mTc-HYNIC-VEGF165.
Figure 2. Stability assay in saline and human serum (left panel) and cysteine
challenge (right panel) of 99mTc-HYNIC-VEGF165.
196
Figure 3. SDS-Page electrophoresis in non-reducing conditions showing native
(1), conjugated (2) and radiolabelled VEGF165 (4). Lanes 3 and 5 represents
the molecular weight marker and scan of well 4 with a linear radioactivity
scanner.
Figure 4. Kinetic binding assay of radiolabelled VEGF165 on HUVEC cells.
Fitting was obtained by nonlinear regression analysis determining kon (1.45 x
108), koff (0.0279) and kD (192 pM).
197
Figure 5. Single organ counts at 1 h (white bar), 3 h (black bar), 6 h (dotted
bar), and 24 h (lined bar). Data are shown as %ID/g (a) and %ID/organ (b)
over time. Each point is the mean of three mice. Error bars represent standard
deviation.
198
Figure 6. T/B ratios calculated at 1h, 3h and 6h in mice bearing a ARO (black
bar), HT29 (squared bar) or K1 (white) xenograft. Each point is the mean of
three mice. Error bars represent standard deviation.
199
Figure 7. a) Body images (top) and particulars of the back (bottom) of the
same mouse injected with 5.5 MBq of 99mTc-VEGF (left), 5.5 MBq of 99mTc-
VEGF following pre-incubation with a 3.5 fold molar excess of VEGFR2-Fc
(middle) and 5.5 MBq of 99mTc-VEGF following pre-injection of a 100 fold
molar excess of unlabelled VEGF (right). b) T/B ratios at 1 h and 3 h calculated
on the images obtained from the HOT (99mTc-VEGF), COLD (99mTc-
VEGF+unlabelled VEGF) and TRAP (99mTc-VEGF+VEGFR2-Fc) groups. Values
are the mean of 3 mice per each group and images were acquired at 1 h p.i.
Error bars represent standard deviation.
200
Figure 8. IHC analysis of VEGF and VEGFRs expression on HT29, K1 and ARO
excised tumors.
Figure 9. Correlation between 99mTc-VEGF165 uptake and VEGFR1 positive
cells (%) (a) and between 99mTc-VEGF165 uptake and VEGF positive cells (%)
(b) in ARO (grey), HT29 (white) and K1 (black) cell lines.
201
Chapter 9
Conclusions and future perspectives
Biomarkers, Growth Factors and Cytokines represent, owing to their complex
interactions within human normal and pathological tissues, the last frontier in
biological and medical research. Many progresses have been made in the last
20 years in the knowledge of different biomarkers and growth factors (such as
VEGF, Neurotrophins, TGF , and many others) as well as inflammatory
cytokines whose involvement in neoplastic, infectious and degenerative human
pathologies is now well ascertained. The real and hard challenge of modern
clinical research is represented by the discovery of new biological tissue targets
useful to modulate the activity of biomarkers, growth factors and cytokines and
to suppress or to downregulate their effects in humans with different diseases.
With regard to the clinical setting, the most important techniques for molecular
imaging are certainly PET and MRI. For preclinical studies specialized imaging
devices, that include small-animal PET, SPECT instrumentation, small-animal
MRI, and optical imaging devices for fluorescence and bioluminescence, are
currently available for studies of rodents and other animal species. In addition
to molecular imaging probes, these devices enable pharmacokinetic and
pharmacodynamic studies in animal models of cancer and in humans (1). The
knowledge of real distribution and localization of the above mentioned
biological molecules within human tissues represents an effective possibility to
address efforts and resources toward the identification of new therapeutic
strategies. Also immunohistochemistry may reveal tissue targets useful to reach
and to destroy tumour cells and metastases. Some experimental studies of our
team demonstrated interesting perspectives in the detection of VEGF and its
receptors immunoreactivity in an experimental mouse model transplanted with
202
neoplastic cultured cells. A visible target is a target that may be more easily
destroyed. The main difficulty remains still the possibility of tumor targeting
thus allowng the cure avoiding damage and destruction of normal tissues. In
this perspective, 89Zr-labelled radiopharmaceuticals may be useful bullets to
target angiogenesis and VEGF/VEGFR expression in tissues. PET imaging with
89Zr-bevacizumab may have a useful role in patient selection for bevacizumab-
related therapy as it would indicate accessibility of the antibody to VEGF-A
targets. 89Zr-bevacizumab might be potentially valuable for biologic
characterization of tumors and for prediction and evaluation of the effect of
VEGF-A–targeting therapeutics. VEGF-A is reported in several studies to be
overexpressed in malignant breast tumors and in ductal carcinoma “in situ”,
thus covering the full spectrum from early-stage breast cancer to more
advanced stages. Frequently VEGF-A staining was found to be related to
aggressiveness as assessed by VEGF-A staining in studies with breast tumors.
89Zr-bevacizumab PET proved to be able to detect a broad range of VEGF-A
expression levels. Quantitative tumor analyses showed a more than 10-fold
difference between individual SUVmax measurements, suggesting large
differences in VEGF-A tumor levels between patients. For these reasons 89Zr-
bevacizumab might be potentially valuable for biologic characterization of
tumors and for prediction and evaluation of the effect of VEGF-A–targeting
therapeutics. More and more deeped clinical studies are necessary to
ameliorate our knowledge of targeting of radiolabelled antibodies to tumor
tissues, but the encouraging results reported in the literature lead us to hope in
a not too distant future for a better management of primitive neoplastic and
metastatic lesions in nuclear medicine. However, imaging of VEGF and VEGFR
has not furnished exceptional results up to date and this finding may depend on
different factors whose relevance is probably based on three fundamental
conditions that are discussed as follows:
1) Scarcity and/or variable expression of the tissue target
2) Low affinity of the radiolabeled drug to the target
3) “In vivo” saturation of VEGFR binding sites by soluble VEGF
203
Scarcity and/or variable expression of the tissue target
Some experimental animal studies has demonstrated an important variability of
the expression of VEGF and VEGFR in canine tumor models and even in the
previously published literature on this topic there are different evidences about
this finding. In fact, the identification of VEGF and VEGFR-2 in most canine
simple mammary gland adenocarcinomas (SMGAs), and the presence of a
moderate correlation between VEGF expression and PI (Proliferation Index)
may indicate that VEGF promotes tumor growth and development by an
autocrine loop (2). These finding in dogs are similar to the ones described for
human breast cancer cells, which have been shown to have an autocrine VEGF
activity (3). This behaviour modality allows a survival signal for tumor cells
through the activation of the PI3/Akt pathway (4). Breast carcinoma cell line
coltures reveal also the reduction of VEGF expression with a significant
decrease in the basal activity of PI3-kinase possibly inducing apoptosis (5).
Vascular endothelial growth factor autocrine signaling may also ensure an
increased expression of the chemokine receptor CXCR4 on tumor cells surface
(5). Moreover, the binding of this receptor to its ligand, stromal-derived factor-
1, stimulates tumor cell migration (6). In the literature has been reported a
moderate correlation between VEGF and histologic grade. In agreement with
this observation, a previous study found a significant difference in the number
of VEGF positive cells among the different histologic grade groups of malignant
canine mammary tumors (7). The absence of correlation between VEGFR-2 and
histologic grade in SMGAs in this study may be related to sample size, or may
indicate that VEGFR-2 is not related to histologic grade. On the contrary, in
some human tumours (such as the urothelial ones), experimental evidences
appear to be different in comparison to those found in canine neoplastic
models. In fact, according to Xia et al. (8), an increased VEGFR2 expression
correlates with several features that predict progression of urothelial cancer,
including disease stage and invasive phenotype. It is reasonable to assume that
the individual variability of size, development, vascularization, invasivity and
204
other different parameters may influence expression and detection of VEGF and
VEGF receptors in different species and models, as well as in a single patient.
Low affinity of the radiolabeled drug to the target
The right approach to a nuclear medicine treatment for a neoplastic malignant
pathology cannot disregard some fundamental parameters: 1) to identify the
'correct', biologically active concentration and dose schedule; 2) to select the
patients likely to benefit from treatment; 3) the monitoring of the inhibition of
the target protein or pathway; 4) the assessment of the response of the tumor
to therapy (1). All the above mentioned parameters are important for the
planning of the therapy, but they cannot prescind from the real affinity of
radiolabelled drugs to the target. In fact, this is the crucial problem in more
clinical conditions in which failure of the therapy may be related to an
unsatisfactory binding of the drug to the target. A possible mechanism involves
the low affinity of a radiolabelled drug to its target. Substantial differences in
the rates of drug clearance from the tumor have been observed among
different patients and tumor types. This heterogeneous pharmacokinetic
response might explain the lack of effectiveness of treatment in some patients.
Discrepancies between the plasma pharmacokinetics of the drug and the rate of
drug clearance from tumors have been determined by PET. In patients with
multiple lesions, intratumoral drug concentrations varied up to 3.4-fold. This
variance indicates that plasma pharmacokinetics cannot be used to predict
intratumoral drug concentrations. Radiolabeling of drugs frequently cannot
provide useful imaging probes for monitoring target inhibition because uptake
of the drug in the tumor may be characterized by a nonspecific binding to the
cell membrane or other cellular components. Moreover, notwithstanding the
drug concentration does not need to be higher at the target relative to the
surrounding tissues, this is a necessary condition for imaging probes (1).
205
“In vivo” saturation of VEGFR binding sites by soluble VEGF
Vempati et al. (9) in a complex and very nice study demonstrated that the
computational model predicts that the steady-state distribution of soluble VEGF
is isoform-independent when considering only diffusion and matrix binding.
They demonstrated also that differences in VEGF gradients can arise from
differences in VEGF degradation. VEGF degradation depends on two main
mechanisms: 1) a soluble VEGF degradation model; 2) a matrix-sequestered
VEGF degradation model. In any case VEGF degradation is related also to
various causes, including VEGF inactivation by isoform-selective VEGF inhibitors,
e.g. connective tissue growth factor, sVEGFR1, thrombospondin-1, or by
proteases that can cleave VEGF to fragments that are not recognized by
commonly employed antibodies (9). In any case, the mechanism of protease-
mediated redistribution of VEGF activity is very complex and is influenced by
multiple parameters. For instance proteases increase the functional soluble
VEGF concentration by inhibiting the process of VEGF degradation. Different
modes of VEGF redistribution, such as through MMP9, heparinases, or VEGF
inhibitor cleavage are implicated as pro-tumorigenic, mediating an angiogenic
switch. However, there are several notable exceptions where protease activity
instead leads to diminished tumor growth , an effect similar to the plasmin-
mediated loss of wound healing due to a loss of angiogenesis. According to
Vempati et al. (9), sprout formation and the subsequent patterning may be the
result of a complex, temporal orchestration of multiple extracellular VEGF
fractions, receptor signaling states, and cell types. VEGF and VEGFR “in vivo”
dynamics are also more complex than those observed in different “in vitro”
systems, even for a more rapid degradation and catabolism of biological
molecules in the “in vivo” systems. The possibility that an “in vivo” saturation of
VEGFR binding sites by soluble VEGF might therefore explain certain inefficacies
occurring during nuclear medicine treatment in animals and humans affected by
tumoral pathologies. In the near future might be important to elucidate these
hypotheses by further experimental studies addressed to answer to these
questions by combined nuclear medicine and immunohistochemistry
206
techniques. The contemporary use of radiolabelled anti-VEGF ed anti-VEGFR
drugs might be useful for a more accurate “in vivo” quantification of neoplastic
and non neoplastic angiogenesis.
207
References
1) Weber W.A, Czernin J., Phelps M.E. and Herschman H.R. Technology Insight:
novel imaging of molecular targets is an emerging area crucial to the development of
targeted drugs.Nature Clinical Practice Oncology(2008) 5,44-54.
2) Al-Dissi A.N., Haines D.M, Singh B. and Kidney B.A. Immunohistochemical
expression of vascular endothelial growth factor and vascular endothelial growth factor
receptor-2 in canine simple mammary gland adenocarcinomas Can Vet J. 2010 Oct;
51(10): 1109–1114.
3) Weigand M., Hantel P., Kreienberg R., Waltenberger J. Autocrine vascular
endothelial growth factor signalling in breast cancer. Evidence from cell lines and
primary breast cancer cultures in vitro. Angiogenesis. 2005; 8(3):197-204.
4) Bachelder R.E., Crago A., Chung J., Wendt M.A., Shaw L.M., Robinson
G., Mercurio A.M. Vascular endothelial growth factor is an autocrine survival factor for
neuropilin-expressing breast carcinoma cells. Cancer Res. 2001; 61:5736–540.
5) Bachelder R.E., Wendt M.A., Mercurio A.M. Vascular endothelial growth factor
promotes breast carcinoma invasion in an autocrine manner by regulating the
chemokine receptor CXCR4. Cancer Res. 2002;62:7203–7206.
6) Muller A., Homey B., Soto H., Ge N., Catron D., Buchanan M.E., McClanahan
T., Murphy E., Yuan W., Wagner S.N., Barrera J.L., Mohar A.,Verástegui E., Zlotnik A.
Involvement of chemokine receptors in breast cancer
metastasis. Nature. 2001;410:50–56.
7) Restucci B., Papparella S., Maiolino P., De Vico G. Expression of vascular
endothelial growth factor in canine mammary tumors. Vet Pathol. 2002;39:488–493.
8) Xia G., Kumar S.R., Hawes D., Cai J., Hassanieh L., Groshen S., Zhu S., Masood
R., Quinn D.I., Broek D., Stein J.P., Gill P.S. Expression and significance of vascular
endothelial growth factor receptor 2 in bladder cancer. J Urol. 2006 Apr;175(4):1245-
52.
9) Vempati P, Popel AS, Mac Gabhann F. Formation of VEGF isoform-specific
spatial distributions governing angiogenesis: computational analysis. BMC Syst Biol.
2011 May 2;5:59.
208
Chapter 10
Summary
Despite the success of antiangiogenic therapy, a large percentage of patients
does not benefit from this targeted therapy. Currently, it is impossible to predict
which patient will benefit from antiangiogenic therapy. Reasons for treatment
failure may be that the target for the drug is not present or that the drug may
not reach the target. Tumor cells produce VEGF, which can lead to paracrine
effects in the microenvironment. VEGF121 is freely soluble, whereas VEGF165 is
secreted, though a significant fraction remains localized to the extracellular
matrix, such as VEGF189 and VEGF206. This will most likely lead to locally high
VEGF levels. It is currently impossible to evaluate these local VEGF levels .
Noninvasive measurement of VEGF in the tumor (IHC, PCR, Western blotting)
might give insight to the available target for VEGF-dependent antiangiogenic
therapy and thus assist in tumor response prediction. Moreover, growth factors
and cytokines expression in normal and pathological tissues substantially
changes in different clinical and physiological conditions. These variations
(whose different tissue expressions may be effectively studied by
immunohistochemistry) are important and constitute the biological basis for a
correct tissue analysis. The last one may represent a previous modality
screening and a precious therapeutical support in order to ameliorate the
knowledge of nuclear medicine targets in oncological patients. Given these
assumptions reported in the 1st chapter of the thesis, in the 2nd chapter has
been studied the expression of neurotrophins in human meningiomas
confirming a potential role of NGF, BDNF and TrKB in the control of
development and proliferation of meningiomas; in the 3rd chapter of the thesis
have been studied neurotrophins, their receptors and Ki-67 in GH-secreting
human pituitary adenomas showing a very strong expression of NT-3 and its
receptor TrKC was observed in the extracellular matrix (ECM) and vessel
endothelium, together with a clear/marked presence of BDNF and its receptor
209
TrKB, thus confirming their direct involvement in the progression of pituitary
adenomas; in the 4th chapter of the thesis has been proved the increased
expression of immunoreactivity for VEGF, TGF-β and PGE2 in pteryigium tissue
and this finding has a relevant importance in the knowledge of inflammatory
mechanism which accompanies and promote this pathological condition; in the
5th chapter, in the study performed on cell cultures and neoplastic tissue
harvested from human osteosarcomas, we observed a generally relevant
positive immunoreaction for NGF – TrKA – NT3 – TrKC in the cytoplasmic
compartment and for NT-4 in the nucleus of tumoural bone cells, suggesting a
direct role of these molecules in increasing the cell proliferation rate in the
neoplastic tissue. Moreover, we found a strong expression for BDNF in the
extracellular space, suggesting that this factor directly influences spreading of
neoplastic cells, attributable to an increase in tumor size, also due to a high
vascularization network; in the 6th chapter of this thesis the
immunohistochemical study performed on vestibular schwannomas has proven
that VEGF and TGF-β1 have are putative key mediators of vestibular
schwannoma growth and this finding appears to be of relevance in the growth
and development of these tumors; in the 7th chapter the important role TGF-β,
IL-1β and VEGF-A in the modulation of the growth and proliferation of
Dupuytren’s tissue and cultured myofibroblasts is demonstrated and this finding
led us to postulate a pivotal role for these molecules in the development of
Dupuytren’s contracture; in the 8th chapter our study demonstrates that the
presence of high VEGF levels in tumors, particularly those advanced with highly
hypoxic tumor microenvironment and aggressive phenotypes, may saturate
VEGF receptors, thus limiting the possibility to image receptors; moreover,
overexpression of soluble VEGFR in some tumors and significant sequestration
of VEGF on cell surface heparin-sulfate proteoglycans may also contribute to
highly variable imaging results in different tumors; in the 9th chapter of this
thesis conclusions and future perspectives are also elucidated underlining the
importance of the investigated growth factors and cytokines in the development
and in the control of development of analyzed inflammatory and neoplastic
pathologies.
210
Chapter 11
Samenvatting
Therapie gericht op anti-angiogenese is vaak succesvol, maar desondanks zal
een deel van de patiënten geen voordeel ondervinden van deze behandeling.
Op dit moment is het niet mogelijk te voorspellen welke patiënt wel en welke
patiënt niet zal reageren op de ingestelde therapie. Er zijn verschillende
oorzaken voor het falen van de therapie: het kan zijn dat het target voor het
medicijn niet aanwezig is of dat het medicijn het target niet kan bereiken.
Veel tumorcellen produceren VEGF, wat paracriene (hormonale) effecten tot
gevolg kan hebben voor de cellen in de omgeving. Er zijn verschillende
isoformen van VEGF’s die zich ook nog eens verschillend gedragen. Zo is
VEGF121 vrij oplosbaar, terwijl VEGF165 wordt uitgescheiden. Er blijft echter
ook een belangrijk deel in de extracellulaire matrix, zoals VEGF189 en VEGF206.
Dit zorgt waarschijnlijk tot lokaal hoge concentraties van VEGF. Op dit moment
is het niet mogelijk om deze lokale concentraties te bepalen. Een niet-invasieve
bepaling van VEGF in de tumor (via immunohistochemie, PCR of Western
blotting) zou mogelijk inzicht kunnen geven over de hoeveelheid beschikbare
target voor VEGF afhankelijke therapie en zodoende kunnen bijdragen in het
voorspellen van tumor respons. Bovendien is het zo dat expressie van
groeifactoren en cytokines in normaal en pathologisch weefsel substantieel
verandert bij verschillende condities. Deze variaties in expressielevel (dat via
immunohistochemie bepaald kan worden) zijn belangrijk en vormen de
biologische basis voor een goede weefselanalyse, wat uiteindelijk de kennis van
targets voor medicijnen in oncologische patiënten kan vergroten en kan helpen
in therapiebeslissingen.
Op basis van deze veronderstellingen, die worden weergeven in hoofdstuk 1
van dit proefschrift, is in hoofdstuk 2 de expressie van neurotrophins in humane
211
meningeomen bestudeerd. De potentiele rol voor NGF, BDNF en TrKB in de
ontwikkeling en proliferatie van meningeomen werd hierbij bevestigd.
In hoofdstuk 3 van dit proefschrift werd het level van diezelfde neutrotrophins,
de receptoren hiervan en het level van Ki-67 bepaald in groeihormoon
uitscheidende humane hypofyse-adenomen. Een sterke expressie van NT-3 en
haar receptor TrKC werd gevonden in de extracellulaire matrix en in het
endotheel van bloedvaten, samen met een duidelijke aanwezigheid van BDNF
en haar receptor TrKB. Ook dit bevestigt de directe betrokkenheid van deze
neutrotrophins bij de progressie van hypofyse-adenomen.
In hoofdstuk 4 wordt aangetoond dat er een verhoogde expressie en
immuunreactie is voor VEGD, TGF-β en PGE2 in pterygium. Deze bevinding is
belangrijk voor de kennis van inflammatie die bij deze pathologische conditie
vaak gevonden wordt en mogelijk zelfs veroorzaakt.
In hoofdstuk 5 wordt een studie beschreven die werd uitgevoerd op celkweken
en neoplastisch weefsel van humane osteosarcomen. Een algemene positieve
immuunreactie voor NGF, TrKA, NT3 en TrKC werd gevonden in het cytoplasma
en voor NT-4 in de kernen van de tumorcellen. Dit suggereert dat deze
moleculen een directe rol spelen bij de celproliferatie bij deze tumoren. Verder
werd er een sterke expressie voor BDNF gevonden in de extracellulaire ruimte.
Mogelijk beïnvloedt deze factor direct de verspreiding van neoplastische cellen,
wat kan leiden tot een toename in tumorgrootte en een toename in
vascularisatie rondom.
In hoofdstuk 6 wordt een immunohistochemische studie beschreven in
vestibulaire schwannomen. VEGF en TGF-β1 blijken duidelijke sleutelspelers te
zijn voor groei van deze tumoren. Hoofdstuk 7 beschrijft een belangrijke rol
voor TGF-β, IL-1β en VEGFa bij groei en proliferatie van de ziekte van
Dupuytren en in gekweekte myofibroblasten. Ook hier blijken deze moleculen
een belangrijke rol te spelen in de contracturen die optreden bij Dupuytren.
Hoofdstuk 8 beschrijft de aanwezigheid van hoge concentraties VEGF in
tumoren. Vooral bij die tumoren die veel gebieden met hypoxie hebben en die
212
een agressief fenotype vertonen, kunnen de VEGF receptors verzadigd raken,
waardoor het moeilijk wordt de receptoren af te beelden. Verder kan ook
overexpressie van oplosbaar VEGFR bij sommige tumoren en een significante
sequestratie van VEGF op het celoppervlak van proteoglycanen bijdragen aan
grote variaties in resultaten van afbeeldende modaliteiten in verschillende
tumorsoorten.
In hoofdstuk 9 van dit proefschrift worden conclusies en toekomstperspectieven
beschreven. Het belang van de onderzochte groeifactoren en cytokines in de
controle en ontwikkeling bij de geanalyseerde inflammatoire en neoplastische
aandoeningen wordt nogmaals uiteengezet en verduidelijkt.
213
Chapter 12
CURRICULUM VITAE
Marco Artico, M.D., Pharm. D.
Education and Training
Marco Artico was born in Rome, Italy, on February 24th, 1962.
He graduated magna cum laude in Medicine and Surgery on July 9th, 1986 at
the School of Medicine, “Sapienza” University of Rome.
From 1986 to 1991 he undertook the postgraduate training in Neurosurgery at
“Sapienza” University of Rome (Program Director: Prof. A. Fortuna) and
graduated as Neurosurgeon on July 12th 1991, magna cum laude.
He graduated magna cum laude in Pharmacy on March 21th, 1995 at the School
of Pharmacy, “Sapienza” University of Rome.
From 2009 to 2014 he undertook postgraduate training in Clinical Pathology at
“Sapienza” University of Rome (Program Director: Prof. A. Santoni) and
graduated as Clinical Pathologist on June 25th 2014, magna cum laude.
Appointments and Positions
16/4/1988: Graduate technician at the Chair of Human Anatomy of the School
of Pharmacy, “Sapienza” University of Rome.
12/2/1992: Assistant Professor of Human Anatomy at the School of Pharmacy,
“Sapienza” University of Rome.
1/3/2001-20/09/2010: Associate Professor of Human Anatomy at the School of
Pharmacy, “Sapienza” University of Rome.
214
1/6/2010: Winner of a public selection for Full Professorship in Human
Anatomy, School of Medicine and Surgery, Modena and Reggio Emilia
University, Italy.
21/09/2010-present: Full Professor in Human Anatomy - Faculty of Medicine
and Dentistry, Department of Sensory Organs, “Sapienza” University of Rome.
2/2/2015: ASN (National Scientific Enabling 2013) for Full Professorship in
Human Anatomy.
2001-2013: Member of the Ph.D. Board in Pharmacology and Toxicology,
“Sapienza” University of Rome.
2014-present: Member of the Ph.D. Board in Innovative Technologies in the
Diseases of Bone, Skin and Craniofacial-Oral Compartment, “Sapienza”
University of Rome.
Membership in Professional and Scientific Societies
From 1990 Società Italiana di Anatomia
From 1990 International Congress for Vertebrate Morphology
Grants
PRIN (MIUR – ITALY) Research Grants: 1997, 2006, 2009
2001-2015: University “Sapienza” Research Grants
2009: Alpha-Wassermann research grant
2011-2014: Sovena Foundation (4 different scholarship grants for his PhD
students)
2014: Nobile s.p.a. industry research grant
2015: Nobile s.p.a. industry research grant
Honors and Prizes
1996: “Cesare Frugoni” Prize as the best microsurgeon of the II Corso Teorico-
Pratico di Microchirurgia (Padova, 25-27/1/1996)
1997: Prize as winner of the selection for the best POSTER PRESENTATION in
the XXXVII Congresso Nazionale S.N.O. (Como, 29/5/1997).
215
Publications
1 2016
Di Liddo R, Valente S, Taurone S, Zwergel C, Marrocco B, Turchetta R, Conconi
MT, Scarpa C, Bertalot T, Schrenk S, Mai A, Artico M (2016). Histone
deacetylase inhibitors restore IL-10 expression in lipopolysaccharide-induced
cell inflammation and reduce IL-1β and IL-6 production in breast silicone
implant in C57BL/6J wild-type murine model. Autoimmunity 20:1-11.
2 2016
Bianchi E, Ripandelli G, Taurone S, Feher J, Plateroti R, Kovacs I, Magliulo G,
Orlando MP, Micera A, Battaglione E, Artico M (2016). Age and diabetes related
changes of the retinal capillaries: An ultrastructural and immunohistochemical
study. Int J Immunopathol Pharmacol 29(1):40-53. doi:
10.1177/0394632015615592.
3 2015
D'Andrea Vito, Panarese Alessandra, Taurone Samanta, Cavallotti Carlo, Artico
Marco (2015). Human Lymphatic Mesenteric Vessels: Morphology and Possible
Function of Aminergic and NPY-ergic Nerve Fibers. LYMPHATIC RESEARCH AND
BIOLOGY, vol. 13, p. 170-175, ISSN: 1539-6851, doi: 10.1089/lrb.2015.0018
4 2015
Taurone S, Bianchi E, Attanasio G, di Gioia C, Ierinò R, Carubbi C, Galli D,
Pastore FS, Giangaspero F, Filipo R, Zanza C, Artico M. (2015).
Immunohistochemical profile of cytokines and growth factors expressed in
vestibular schwannoma and in normal vestibular nerve tissue. MOLECULAR
MEDICINE REPORTS, vol. 1, p. 737-745, ISSN: 1791-2997, doi:
10.3892/mmr.2015.3415
5 2015
Bianchi E, Taurone S, Bardella L, Signore A, Pompili E, Chiappetta C, Fumagalli
L, Di Gioia C, Scarpa S, Artico M (2015). Involvement of pro-inflammatory
cytokines and growth factors in the pathogenesis of Dupuytren's contracture: a
novel target for a possible future therapeutic strategy? Bianchi E, Taurone S,
Bardella L, Signore A, Pompili E, Sessa V, Chiappetta C, Fumagalli L, Gioia CD,
Pastore FS, Scarpa S, Artico M. Clin Sci (Lond). 2015 Oct 1;129(8):711-20. doi:
216
10.1042/CS20150088. Epub 2015 Jun 11. PMID: 26201022. CLINICAL
SCIENCE, vol. 8, p. 711-720, ISSN: 0143-5221, doi: 10.1042/CS20150088
6 2015
Bianchi E, Ripandelli G, Feher J, Plateroti A M, Plateroti R, Kovacs I, Plateroti P,
Taurone S, Artico M (2015). Occlusion of retinal capillaries caused by glial cell
proliferation in chronic ocular inflammation. FOLIA MORPHOLOGICA, vol. 74, p.
33-41, ISSN: 0015-5659, doi: 10.5603/FM.2015.0006
7 2015
Taurone Samanta, Ripandelli Guido, Pacella Elena, Bianchi Enrica, Plateroti
Andrea Maria, De Vito Stefania, Plateroti Pasquale, Grippaudo Francesca
Romana, Cavallotti Carlo, Artico Marco (2015). Potential regulatory molecules in
the human trabecular meshwork of patients with glaucoma:
immunohistochemical profile of a number of inflammatory cytokines.
MOLECULAR MEDICINE REPORTS, vol. 11, p. 1384-1390, ISSN: 1791-2997,
doi: 10.3892/mmr.2014.2772
8 2014
Di Liddo R, Grandi C, Dalzoppo D, Villani V, Venturini M, Negro A, Sartore L,
Artico M, Conconi MT, Parnigotto PP (2014). In vitro evaluation of TAT-OP1
osteogenic properties and prospects for in vivo applications. JOURNAL OF
TISSUE ENGINEERING AND REGENERATIVE MEDICINE, vol. 8, p. 694-705,
ISSN: 1932-7005, doi: 10.1002/term.1568
9 2014
F Mignini, M Sabbatini, L Mattioli, M Cosenza, M Artico, C Cavallotti (2014).
Neuro-immune modulation of the thymus microenvironment. INTERNATIONAL
JOURNAL OF MOLECULAR MEDICINE, vol. 6, p. 1392-1400, ISSN: 1107-3756,
doi: doi: 10.3892/ijmm.2014.1709
10 2014
Mignini F, Sabbatini M, Mattioli L, Cosenza M, Artico M, Cavallotti C (2014).
Neuro-immune modulation of the thymus microenvironment (Review).
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 33, p. 1392-1400,
ISSN: 1107-3756
217
11 2014
Di Liddo R, Paganin P, Lora S, Dalzoppo D, Giraudo C, Miotto D, Tasso A,
Barbon S, Artico M, Bianchi E, Parnigotto PP, Conconi MT, Grandi C (2014). Poli-
ε-caprolactone composite scaffolds for bone repair. INTERNATIONAL JOURNAL
OF MOLECULAR MEDICINE, vol. 34, p. 1537-1546, ISSN: 1107-3756, doi:
10.3892/ijmm.2014.1954
12 2013
V D'Andrea, E Bianchi, S Taurone, F Mignini, C Cavallotti, M Artico (2013).
Cholinergic innervation of human mesenteric lymphatic vessels. FOLIA
MORPHOLOGICA, vol. 4, p. 322-327, ISSN: 0015-5659
13 2013
Enrica Bianchi, Paola Mancini, Stefania De Vito, Elena Pompili, Samanta
Taurone, Isabella Guerrisi, Antonino Guerrisi, Vito D'Andrea, Vito Cantisani,
Marco Artico (2013). Congenital asymptomatic diaphragmatic hernias in adults:
a case series. JOURNAL OF MEDICAL CASE REPORTS, vol. 7, p. 125-133, ISSN:
1752-1947, doi: 10.1186/1752-1947-7-125
14 2013
Enrica Bianchi, Marco Artico, Claudio Di Cristofano, Martina Leopizzi, Samanta
Taurone, Marcella Pucci, Pietro Gobbi, Fiorenzo Mignini, Vincenzo Petrozza,
Ivano Pindinello, Maria Teresa Conconi, Carlo Della Rocca (2013). Growth
factors, their receptor expression and markers for proliferation of endothelial
and neoplastic cells in human osteosarcoma. INTERNATIONAL JOURNAL OF
IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 26, p. 621-632, ISSN: 0394-
6320
15 2013
Mirandola P, Gobbi G, Malinverno C, Carubbi C, Ferné FM, Artico M, Vitale M,
Vaccarezza M (2013). Impact of sulphurous water politzer inhalation on
audiometric parameters in children with otitis media with effusion. CLINICAL
AND EXPERIMENTAL OTORHINOLARYNGOLOGY, p. 7-11, ISSN: 1976-8710,
doi: 10.3342/ceo.2013.6.1.7
218
16 2013
Enrica Bianchi, Giuseppe Magliulo, Dario Marcotullio, Samanta Taurone, R.
Ierino, Elena Pompili, Lorenzo Fumagalli, P.p. Parnigotto, R. Di Liddo, Marco
Artico (2013). Inflammatory profile of neurotrophins, IL-6, IL1-β, TNF-α, VEGF,
ICAM-1 and TGF-β in the human Waldeyer's ring. EUROPEAN JOURNAL OF
INFLAMMATION, vol. 11, p. 763-775, ISSN: 1721-727X
17 2013
F Mignini, C Nasuti, D Fedeli, L Mattioli, M Cosenza, M Artico, R Gabbianelli
(2013). Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative
stress in Wistar rats. INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND
PHARMACOLOGY, vol. 26, p. 871-881, ISSN: 0394-6320
18 2013
Bianchi E, Scarinci F, Ripandelli G, Feher J, Pacella E, Magliulo G, Gabrieli CB,
Plateroti R, Plateroti P, Mignini F, Artico M. (2013). Retinal pigment epithelium,
age-related macular degeneration and neurotrophic keratouveitis.
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 1, p. 232-242,
ISSN: 1107-3756, doi: 10.3892/ijmm.2012.1164
19 2013
Riccardo Caruso, Marco Artico, Claudio Colonnese, Luigi Marrocco, Venceslao
Wierzbicki (2013). Supratentorial Endodermal Cysts: Review of Literature and
Case Report. JOURNAL OF NEUROLOGICAL SURGERY. PART A, CENTRAL
EUROPEAN NEUROSURGERY, vol. 74, p. 378-387, ISSN: 2193-6315, doi:
10.1055/s-0032-1304812
20 2013
F Mignini, M Sabbatini, M Capacchietti, C Amantini, E Bianchi, M Artico, A
Tammaro (2013). T-cell subpopulations express a different pattern of
dopaminergic markers in intra-and extra-thymic compartments. JOURNAL OF
BIOLOGICAL REGULATORS & HOMEOSTATIC AGENTS, vol. 27, p. 463-475,
ISSN: 0393-974X
219
21 2012
F. Mignini, C. Nasuti, M. Artico, F. Giovannetti, C. Fabrizi, L. Fumagalli, G.
Iannetti, E- Pompili (2012). Effects of trimethyltin on hippocampal dopaminergic
markers and cognitive behaviour. INTERNATIONAL JOURNAL OF
IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 1107-1119, ISSN:
0394-6320
22 2012
Marco Artico, Marco De Vincentiis, Brunella Ionta, Enrica Bianchi, Sandro Bosco,
M. Monteleone, Lorenzo Fumagalli, Giuseppe Magliulo (2012).
Immunohistochemical profile of neurotrophins and mib-1 in jugulotympanic
paragangliomas: prognostic value and review of the literature. INTERNATIONAL
JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 183-191,
ISSN: 0394-6320
23 2012
E. Bianchi, S. Taurone, M. Leopizzi, L. Bardella, R. Di Liddo, F. Nucci, F.S.
Pastore, M. Vitale, A. Mazzotti, M Artico (2012). Immunohistochemical profile of
VEGF, PGE2 and TGF-beta in inflammatory tenosynovitis of carpal tunnel
syndrome. EUROPEAN JOURNAL OF INFLAMMATION, vol. 10, p. 491-499,
ISSN: 1721-727X
24 2012
Bianchi E, Scarinci F, Grande C, Plateroti R, Plateroti P, Plateroti AM, Fumagalli
L, Capozzi P, Feher J, Artico M. (2012). Immunohistochemical profile of VEGF,
TGF-beta and PGE2 in human pterygium and normal conjunctiva: experimental
study and review of the literature. INTERNATIONAL JOURNAL OF
IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 607-615, ISSN: 0394-
6320
25 2012
R. Di Liddo, C. Grandi, D. Dalzoppo, V. Villani, M. Venturini, A. Negro, L.
Sartore, M. Artico, M.T. Conconi, P.P. Parnigotto (2012). In vitro evaluation of
TAT-OP1 osteogenic properties and prospects for in vivo applications. JOURNAL
OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE, ISSN: 1932-6254,
doi: 10.1002/term.1568
220
26 2012
Marco Artico, Enrica Bianchi, Giuseppe Magliulo, Marco De Vincentiis, Elena De
Santis, A. Orlandi, Antonio Santoro, F.S. Pastore, F.S. Pasture, Felice
Giangaspero, Riccardo Caruso, M. Re, Lorenzo Fumagalli (2012). Neurotrophins,
their receptors and ki-67 in human gh-secreting pituitary adenomas: an
immunohistochemical analysis. INTERNATIONAL JOURNAL OF
IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 117-125, ISSN: 0394-
6320
27 2012
Magliulo G, Appiani MC, Iannella G, Artico M. (2012). Petrous Bone Fractures
Violating Otic Capsule. OTOLOGY & NEUROTOLOGY, 33(9):1558-61, ISSN:
1531-7129, doi: 10.1097/MAO.0b013e31826bf135
28 2012
Marco Artico, G. Stevanato, Brunella Ionta, A. Cesaroni, Enrica Bianchi, C.
Morselli, Francesca Romana Grippaudo (2012). Venous compressions of the
nerves in the lower limbs. BRITISH JOURNAL OF NEUROSURGERY, vol. 26, p.
386-391, ISSN: 0268-8697, doi: 10.3109/02688697.2011.631616
29 2011
Marco Artico, R. Rigano, B. Buttari, E. Profumo, Brunella Ionta, Sandro Bosco,
M. Rasile, Enrica Bianchi, M. Bruno, Lorenzo Fumagalli (2011). Protective role of
parnaparin in reducing systemic inflammation and atherosclerotic plaque
formation in ApoE-/- mice. INTERNATIONAL JOURNAL OF MOLECULAR
MEDICINE, vol. 27, p. 561-565, ISSN: 1107-3756, doi: 10.3892/ijmm.2011.606
30 2010
Marco Artico, Elena Bronzetti, Valentina Alicino, Brunella Ionta, Sandro Bosco,
C. Grande, Bruno M. Tranquilli Leali Fm, G. Ionta, Lorenzo Fumagalli (2010).
Human gallbladder carcinoma: Role of neurotrophins, MIB-1, CD34 and CA15-3.
EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 54, p. 50-55, ISSN: 1121-
760X, doi: 10.4081/ejh.2010.e10
31 2010
Artico M, Bronzetti E, Ionta B, Bruno M, Greco A, Ruoppolo G, De Virgilio A,
Longo L, De Vincentiis M. (2010). Reinke's edema: investigations on the role of
221
MIB-1 and hepatocyte growth factor. EUROPEAN JOURNAL OF
HISTOCHEMISTRY, vol. 54, p. 133-136, ISSN: 1121-760X, doi:
10.4081/ejh.2010.e30
32 2009
Marco Artico, Elena Bronzetti, Elena Pompili, Brunella Ionta, V. Alicino, A.
D'Ambrosio, Antonio Santoro, F.S. Pastore, I. Elenkov, Lorenzo Fumagalli
(2009). Immunohistochemical profile of neurotrophins in human cranial dura
mater and meningiomas. ONCOLOGY REPORTS, vol. 21, p. 1373-1380, ISSN:
1021-335X, doi: 10.3892/or_00000363
33 2009
Marco Artico, S. Telera, C. Tiengo, C. Stecco, V. Macchi, A. Porzionato, E.
Vigato, A. Parenti, R. De Caro (2009). Surgical anatomy of the radial nerve at
the elbow. SURGICAL AND RADIOLOGIC ANATOMY, vol. 31, p. 101-106, ISSN:
1279-8517, doi: 10.1007/s00276-008-0412-8
34 2008
Elena Bronzetti, Marco Artico, F. Forte, G. Pagliarella, Laura Maria Felici, A.
D'Ambrosio, G. Vespasiani, B. Bronzetti (2008). A possible role of BDNF in
prostate cancer detection. ONCOLOGY REPORTS, vol. 19, p. 969-974, ISSN:
1021-335X, doi: 10.3892/or_
35 2008
Marco Artico, Elena Bronzetti, Vincenza Rita Lo Vasco, Brunella Ionta, Valentina
Alicino, A. D'Ambrosio, Giuseppe Magliulo (2008). Immunohistochemical profile
of various neurotransmitters, neurotrophins and MIB-1 in cholesteatomas of the
petrous bone. MOLECULAR MEDICINE REPORTS, vol. 1, p. 347-353, ISSN:
1791-2997
36 2008
Marco Artico, Elena Bronzetti, Laura Maria Felici, V. Alicino, Brunella Ionta, B.
Bronzetti, Giuseppe Magliulo, C. Grande, L. Zamai, G. Pasquantonio, Marco De
Vincentiis (2008). Neurotrophins and their receptors in human lingual tonsil: An
immunohistochemical analysis. ONCOLOGY REPORTS, vol. 20, p. 1201-1206,
ISSN: 1021-335X, doi: 10.3892/or_00000130
222
37 2008
J. SERRA MORENO, S. PANERO, M. ARTICO, P. FILIPPINI (2008). Synthesis and
charcterization of new electroactive polypyrrole-chondroitin sulphate A
substrates. BIOELECTROCHEMISTRY, vol. 72, p. 3-9, ISSN: 1567-5394, doi:
10.1016/j.bioelechem.2007.11.002
38 2008
A. Bellelli, P. Mancini, Marco Artico, C. Miglietta (2008). Technical note: MRI
device for active stress of the knee. The practical approach and preliminary
data. LA RADIOLOGIA MEDICA, vol. 113, p. 905-914, ISSN: 0033-8362, doi:
10.1007/s11547-008-0305-2
39 2007
Federica Vitali, Antonella Saija, F. Bonina, S. Franchitto, Marco Artico, Beatrice
Tita (2007). Antiulcer potential of a standardized extract of red orange juice in
the rat. INTERNATIONAL JOURNAL OF FOOD PROPERTIES, vol. 10, p. 331-344,
ISSN: 1094-2912, doi: 10.1080/10942910601113319
40 2007
E. BRONZETTI, M. ARTICO, I.KOVACS, L. FELICI, G. MAGLIULO, D. VIGNONE,
A. D'AMBROSIO, F. FORTE, R. DI LIDDO, J. FEHER (2007). Expression of
neurotransmitters and neurotrophins in neurogenic inflammation of the rat
retina. EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 51(4), p. 251-260,
ISSN: 1121-760X, doi: 10.4081/1149
41 2007
Vincenza Rita Lo Vasco, Cinzia Fabrizi, Marco Artico, Lucio Cocco, Anna Maria
Billi, Lorenzo Fumagalli, Francesco Antonio Manzoli (2007). Expression of
phosphoinositide-specific phospholipase C isoenzymes in cultured astrocytes.
JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 100, p. 952-959, ISSN: 0730-
2312, doi: 10.1002/jcb.21048
42 2007
M.ARTICO, E.BRONZETTI, L.SASO, L.M.FELICI, A. D'AMBROSIO, F.FORTE,
C.GRANDE, F.ORTOLANI (2007). Immunohistochemical profile of some
neurotrasmitters and neurotrophins in the seminiferous tubules of rats treated
223
by lonidamine. EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 51(1), p. 19-
24, ISSN: 1121-760X, doi: 10.4081/1007
43 2006
ARTICO M, CARLOIA S, PIACENTINI M, FERRETTI G, M. DAZZI, FRANCHITTO
S, BRONZETTI E (2006). Conjoined lumbosacral nerve roots: observation on
three cases and review of the literature. NEUROCIRUGIA, vol. Feb; 17 ( 1), p.
54-59, ISSN: 1130-1473, doi: 10.4321/S1130-14732006000100007
44 2006
Domenico Ribatti, Beatrice Nico, Enrico Crivellato, Marco Artico (2006).
Development of the blood-brain barrier: A historical point of view. THE
ANATOMICAL RECORD. PART B, NEW ANATOMIST, vol. 289, p. 3-8, ISSN:
1552-4906, doi: 10.1002/ar.b.20087
45 2006
FEHER J, KOVACS I, M. ARTICO, CAVALLOTTI C, PAPALE A, BALACCO
GABRIELI C (2006). Mitocondrial alterations of retinal pigment epithelium in
age-related macular degeneration. NEUROBIOLOGY OF AGING, vol. 27 , p. 983-
993, ISSN: 0197-4580, doi: 10.1016/j.neurobiolaging.2005.05.012
46 2006
Bronzetti E, Artico M, Pompili E, Felici LM, Stringaro A, Bosco S, Magliulo G,
Colone M, Arancia G, Vitale M, Fumagalli L (2006). Neurotrophins and
neurotransmitters in human palatine tonsils: An immunohistochemical and RT-
PCR analysis. INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 18,
p. 49-58, ISSN: 1107-3756
47 2005
C. Cavallotti, Marco Artico, S. Franchitto, F.M. Tranquilli Leali (2005). Dopamine
nerve fibres and related receptors in bronchus-associated lymphoid tissue
(BALT). ITALIAN JOURNAL OF ANATOMY AND EMBRYOLOGY, vol. 110, p. 25-
30, ISSN: 1122-6714
48 2005
Elena Bronzetti, Marco Artico, Vincenza Rita Lo Vasco, Laura Maria Felici,
Sandro Bosco, G. Magliulo, Elena Pompili, Lorenzo Fumagalli (2005). Expression
of neurotransmitters and neurotrophins in human adenoid tissue.
224
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 15, p. 921-928,
ISSN: 1107-3756, doi: 10.3892/ijmm.2005.
49 2004
Carlo Cavallotti, Marco Artico, Nicola Pescosolido, Francesca Maria Tranquilli
Leali, J. Feher (2004). Age-related changes in the human retina. CANADIAN
JOURNAL OF OPHTHALMOLOGY-JOURNAL CANADIEN D OPHTALMOLOGIE, vol.
39, p. 61-68, ISSN: 0008-4182
50 2004
ARTICO M., DE SANTIS S., TRANQUILLI LEALI F.M., CAVALLOTTI D.,
CELESTINI A., C. CAVALLOTTI (2004). Diabetic rats treated by low molecular
weight heparin OP 2123/parnaparin. Morphological changes in the kidney and
heart. JOURNAL OF DIABETES AND ITS COMPLICATIONS, vol. 18, p. 119-125,
ISSN: 1056-8727, doi: 10.1016/S1056-8727(02)00250-7
51 2004
M. ARTICO, G. BALLATI, S. BOSCO, D. CANTARELLI, G. NAGAR, A. GROSSO,
F.M. TRANQUILLI LEALI, C. CAVALLOTTI (2004). Direct demonstration of iron
in a term placenta in two cases of beta thalassemia. AMERICAN JOURNAL OF
HEMATOLOGY, vol. 75, p. 241-242, ISSN: 0361-8609, doi: 10.1002/ajh.20005
52 2004
C. Cavallotti, Francesca Maria Tranquilli Leali, Marco Artico, Vito D'Andrea, V.
Malinovska (2004). Experimental calcification of the aorta in rabbits: Effects of
chelating agents and glucagon. SCANDINAVIAN JOURNAL OF LABORATORY
ANIMAL SCIENCE, vol. 31, p. 215-219, ISSN: 0901-3393
53 2004
G. Gobbi, P. Mirandola, C. Micheloni, E. Solenghi, I. Sponzilli, Marco Artico,
Giuseppe Soda, G. Zanelli, G. Pelusi, T. Fiorini, L. Cocco, M. Vitale (2004).
Expression of HLA class I antigen and proteasome subunits LMP-2 and LMP-10
in primary vs. metastatic breast carcinoma lesions. INTERNATIONAL JOURNAL
OF ONCOLOGY, vol. 25, p. 1625-1629, ISSN: 1019-6439
54 2004
G. Arancia, A. Calcabrini, M. Marra, P. Crateri, Marco Artico, A. Martone, F.
Martelli, Enzo Agostinelli (2004). Mitochondrial alterations induced by serum
225
amine oxidase and spermine on human multidrug resistant tumor cells. AMINO
ACIDS, vol. 26, p. 273-282, ISSN: 0939-4451, doi: 10.1007/s00726-003-0055-3
55 2004
Marco Artico, Sandro Bosco, Elena Bronzetti, Laura Maria Felici, G. Pelusi,
Vincenza Rita Lo Vasco, M. Vitale (2004). Peribronchial innervation of the rat
lung. INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 14, p. 615-
620, ISSN: 1107-3756, doi: 10.3892/ijmm.2004.
56 2004
Marco Artico, D. Lorenzini, P. Mancini, P. Gobbi, S. Carloia, V. David (2004).
Radiological evidence of anatomical variation of the inferior vena cava: Report
of two cases. SURGICAL AND RADIOLOGIC ANATOMY, vol. 26, p. 153-156,
ISSN: 1279-8517, doi: 10.1007/s00276-003-0192-0
57 2003
F.M. TRANQUILLI LEALI, M. ARTICO, S. POTENZA, C. CAVALLOTTI (2003). Age
related changes of monoaminoxidases in rat cerebellar cortex. EUROPEAN
JOURNAL OF HISTOCHEMISTRY, vol. 47, p. 81-86, ISSN: 1121-760X, doi:
10.4081/810
58 2003
Marco Artico, Luigi Ferrante, F.S. Pastore, E. Orlando Ramundo, D. Cantarelli,
D. Scopelliti, Giorgio Iannetti (2003). Bone autografting of the calvaria and
craniofacial skeleton: Historical background, surgical results in a series of 15
patients, and review of the literature. SURGICAL NEUROLOGY, vol. 60, p. 71-
79, ISSN: 0090-3019, doi: 10.1016/s0090-3019(03)00031-4
59 2003
Marco Artico, Carlo Cavallotti, Francesca Maria Tranquilli Leali, M. Falconi, D.
Cavallotti (2003). Effect of interferon on human thymus microenvironment.
IMMUNOLOGY LETTERS, vol. 85, p. 19-27, ISSN: 0165-2478, doi:
10.1016/s0165-2478(02)00180-3
60 2002
Marco Artico, Carlo Cavallotti, D. Cavallotti (2002). Adrenergic nerve fibres and
mast cells: Correlation in rat thymus. IMMUNOLOGY LETTERS, vol. 84, p. 69-
76, ISSN: 0165-2478, doi: 10.1016/s0165-2478(02)00145-1
226
61 2002
CAVALLOTTI C, MANCONE C, M. ARTICO, CAVALLOTTI D (2002). Age-related
changes of the monoamine oxidases in rat heart. BIOMEDICAL RESEARCH, vol.
23, p. 109-113, ISSN: 0388-6107
62 2002
M. ARTICO, MASSA R., CAVALLOTTI D., FRANCHITTO S., CAVALLOTTI C.
(2002). Morphological changes in the sciatic nerve of diabetic rats treated with
low molecular weight heparin OP2123/Parnaparin. ANATOMIA HISTOLOGIA
EMBRYOLOGIA, vol. 34, p. 1-5, ISSN: 0340-2096, doi: 10.1046/j.1439-
0264.2002.00373.x
63 2002
Marco Artico, Sandro Bosco, Carlo Cavallotti, Enzo Agostinelli, G. Giuliani-
Piccari, S. Sciorio, L. Cocco, M. Vitale (2002). Noradrenergic and cholinergic
innervation of the bone marrow. INTERNATIONAL JOURNAL OF MOLECULAR
MEDICINE, vol. 10, p. 77-80, ISSN: 1107-3756
64 2002
C. CAVALLOTTI, N. PESCOSOLIDO, M. ARTICO, E. PACELLA, D. CAVALLOTTI
(2002). OCCURRENCE OF CATECHOLAMINERGIC NERVE FIBERS IN THE
HUMAN UVEOSCLERAL TISSUE IN CONDITIONS OF NORMAL AND RAISED
INTRACULAR PRESSURE. INTERNATIONAL OPHTHALMOLOGY, vol. 24(3), p.
133-139, ISSN: 0165-5701, doi: 10.1023/A:1021173115883
65 2002
CAVALLOTTI D., M. ARTICO, IANNETTI G., CAVALLOTTI C. (2002). Occurrence
of adrenergic nerve fibers in human thymus during immuneresponse.
NEUROCHEMISTRY INTERNATIONAL, vol. 40, p. 211-221, ISSN: 0197-0186,
doi: 10.1016/S0197-0186(01)00074-2
66 2002
GATTO MT, B. TITA, ARTICO M, SASO L (2002). Recent studies on lonidamine,
the lead compound of the antispermatogenic indazolcarboxylic acids.
CONTRACEPTION, vol. 65(4), p. 277-278, ISSN: 0010-7824, doi:
10.1016/S0010-7824(02)00289-5
227
67 2001
Carlo Cavallotti, Marco Artico, Nicola Pescosolido, J. Feher (2001). Age-related
changes in rat retina. JAPANESE JOURNAL OF OPHTHALMOLOGY, vol. 45, p.
68-75, ISSN: 0021-5155, doi: 10.1016/s0021-5155(00)00294-x
68 2001
M. ARTICO, CAVALLOTTI C. (2001). Catecholaminergic and Acetyl choline
esterase containing nerve of cranial and spinal Dura mater in humans and
rodents. MICROSCOPY RESEARCH AND TECHNIQUE, vol. 53, p. 212-220, ISSN:
1059-910X, doi: 10.1002/jemt.1085
69 2001
M. ARTICO, CAVALLOTTI C., IANNETTI G., CAVALLOTTI D. (2001). Effect of
interleukin 1 beta on rat thymus microenvironment. EUROPEAN JOURNAL OF
HISTOCHEMISTRY, vol. 45, p. 357-366, ISSN: 1121-760X, doi: 10.4081/1644
70 2001
M. ARTICO, CAVALLOTTI C., CAMERONI M., CAVALLOTTI D. (2001). Interleukin
1 beta as stimulator of the rat thymus. CYTOKINE, vol. 15(5), p. 261-265,
ISSN: 1043-4666, doi: 10.1006/cyto.2001.0924
71 2001
Luigi Rodella, Loris Zamai, Rita Rezzani, Marco Artico, Giovanni Peri, Mirella
Falconi, Andrea Facchini, Giuseppe Pelusi, Marco Vitale (2001). Interleukin 2
and interleukin 15 differentially predispose natural killer cells to apoptosis
mediated by endothelial and tumour cells. BRITISH JOURNAL OF
HAEMATOLOGY, vol. 115, p. 442-450, ISSN: 0007-1048, doi: 10.1046/j.1365-
2141.2001.03055.x
72 2001
C. Cavallotti, N. Pescosolido, M. Artico, E. Pacella, D. Cavallotti (2001).
Occurrence of catecholaminergic nerve fibers in the human uveoscleral tissue in
conditions of normal and raised intraocular pressure. INTERNATIONAL
OPHTHALMOLOGY, vol. 24, p. 133-139, ISSN: 0165-5701, doi:
10.1023/A:1021173115883
228
73 2000
M. ARTICO, PASTORE, NUCCI, GIUFFRÉ (2000). 290 surgical procedures for
ulnar nerve entrapment at elbow: physiopathology, clinical experience and
results. ACTA NEUROCHIRURGICA, vol. 142, p. 303-308, ISSN: 0001-6268, doi:
10.1007/s007010050039
74 2000
D. Cavallotti, Marco Artico, Carlo Cavallotti, G. Iannetti, Alessandro Frati (2000).
Acetylcholinesterase activity in rat thymus after immunostimulation with
interleukin beta. ANNALS OF ANATOMY, vol. 182, p. 243-248, ISSN: 0940-
9602, doi: 10.1016/s0940-9602(00)80029-1
75 2000
C. CAVALLOTTI, M.ARTICO, N.PESCOSOLIDO, F.M.TRANQUILLI, E.PACELLA
(2000). DISTRIBUTION OF PEPTIDERGIC NERVE FIBERS IN THE GUINEA PIG
TRABECULAR MESHWORK. ANATOMIA HISTOLOGIA EMBRYOLOGIA, vol. 29, p.
387-391, ISSN: 0340-2096, doi: 10.1046/j.1439-0264.2000.00290.x
76 2000
N. Pescosolido, C. Cavallotti, M. Artico, D. Cavallotti, E. Pacella, F: Gherardi
(2000). Distribution of catecholaminergic nerve fibers in normal and alkali
injured rabbit corneas. ANNALS OF OPHTHALMOLOGY, vol. 32, p. 307-312,
ISSN: 1530-4086, doi: 10.1007/s12009-000-0069-3
77 2000
CAVALLOTTI D., M. ARTICO, D'ANDREA V., CAVALLOTTI C. (2000). Gamma-
amino-butyric Acid-transaminase activity in the human thymus after
administration of interferons. HUMAN IMMUNOLOGY, vol. 61 (7), p. 697-704,
ISSN: 0198-8859, doi: 10.1016/S0198-8859(00)00130-0
78 2000
CAVALLOTTI D., M. ARTICO, CAVALLOTTI C., DE SANTIS S., TRANQUILLI
LEALI F.M. (2000). Interleukin 1beta and GABA-transaminase activity in rat
thymus. INTERNATIONAL JOURNAL OF IMMUNOPHARMACOLOGY, vol. 22, p.
719-728, ISSN: 0192-0561, doi: 10.1016/S0192-0561(00)00035-7
229
79 2000
N. PESCOSOLIDO, D. CAVALLOTTI, M. ARTICO, J. FEHER, S. DE SANTIS, C.
CAVALLOTTI (2000). Microfilaments in regenerating cells of rabbit
cornea:immunological and ultrastructural observations. EUROPEAN JOURNAL
OF MORPHOLOGY, vol. 38, p. 186-194, ISSN: 0924-3860, doi: 10.1076/0924-
3860(200007)
80 2000
C. CAVALLOTTI, D.CAVALLOTTI, M.ARTICO, G.D.IANNETTI (2000).
Quantification of acetylcholinesterase positive structures in human thymus
during development and aging. NEUROCHEMISTRY INTERNATIONAL, vol. 36,
p. 75-82, ISSN: 0197-0186, doi: 10.1016/S0197-0186(99)00090-X
81 2000
CAVALLOTTI D, M. ARTICO, CAVALLOTTI C (2000). Quantification of adrenergic
nerve fibers in human thymus at various ages. BIOMEDICAL RESEARCH, vol.
21, p. 73-83, ISSN: 0388-6107
82 2000
Marco Artico, G.M. De Caro, Maurizio Salvati, S. Carloia, E. Rastelli, V.
Wierzbicki, M. Manni (2000). Solitary metastases to the cranial vault. Report of
ten cases. JOURNAL OF NEUROSURGICAL SCIENCES, vol. 44, p. 33-38, ISSN:
0390-5616
83 1999
CAVALLOTTI D, M. ARTICO, CAVALLOTTI C (1999). Acetylcholinesterase
activity in the human thymus during immune response. BIOMEDICAL
RESEARCH, vol. 20, p. 187-195, ISSN: 0388-6107
84 1999
M. ARTICO, DE CARO, CARLOIA, SALVATI, D'AMBROSIO, DELFINI (1999).
Advances in diagnosis, treatment and prognosis of intracerebral tuberculomas
in the last 50 years.. NEUROCHIRURGIE, vol. 45, p. 129-133, ISSN: 0028-3770
85 1999
CAVALLOTTI C., ARTICO M., CAVALLOTTI D., F. TRANQUILLI LEALI, FRATI A.
(1999). Distribution of acetylcholinesterase activity in thymus of juvenile and
aged rats. BIOMEDICAL RESEARCH, vol. 20, p. 73-80, ISSN: 0388-6107
230
86 1999
COCCO L., RUBBINI S., MANZOLI L., BILLI A.M., FAENZA I., PERUZZI D.,
MATTEUCCI A., M. ARTICO, STEWART GILMOUR R., RHEE S.G. (1999).
Inositides in the nucleus: presence and characterisation of the isozymes of
phospholipase beta family in NIH 3T3 cells. BIOCHIMICA ET BIOPHYSICA ACTA,
vol. 1438, p. 295-299, ISSN: 0006-3002
87 1999
C. CAVALLOTTI, PESCOSOLIDO N., ARTICO M., FEHER J. (1999). Localization
of Dopamine receptors in rabbit cornea. CORNEA, vol. 18, p. 721-728, ISSN:
0277-3740, doi: 10.1097/00003226-199911000-00016
88 1999
CAVALLOTTI D., M. ARTICO, FEHER J., PESCOSOLIDO N., DE SANTIS S.,
CAVALLOTTI C. (1999). Microfilaments in regenerating cells of rabbit cornea:
immunological and ultrastructural observations. EUROPEAN JOURNAL OF
MORPHOLOGY, vol. 37, p. 1-9, ISSN: 0924-3860
89 1999
C. CAVALLOTTI, M.ARTICO, S.DE SANTIS (1999). Occurrence of GABA-
transaminase in the Thymus gland of juvenile and aged rats. EUROPEAN
JOURNAL OF HISTOCHEMISTRY, vol. 43, p. 293-299, ISSN: 1121-760X
90 1999
CAVALLOTTI C, M. ARTICO, CAVALLOTTI D. (1999). Occurrence of adrenergic
nerve fibers and of noradrenaline in thymus gland of juvenile and aged rats.
IMMUNOLOGY LETTERS, vol. 70, p. 53-62, ISSN: 0165-2478
91 1999
CAVALLOTTI D., M. ARTICO, DE SANTIS S., CAVALLOTTI C. (1999). Occurrence
of gamma -Amminobutyric acid-transaminase activity in nerve fibers of human
thymus. HUMAN IMMUNOLOGY, vol. 60, p. 1072-1079, ISSN: 0198-8859
92 1999
GOBBI P., FALCONI M., VITALE M., GALANZI A., M. ARTICO, MARTELLI A.M.,
MAZZOTTI G. (1999). Scanning electron microscopic detection of nuclear
structures involved in DNA replication. ARCHIVES OF HISTOLOGY AND
CYTOLOGY, vol. 62, p. 111-120, ISSN: 0914-9465
231
93 1998
CAVALLOTTI D., M. ARTICO, DE SANTIS S., IANNETTI G., CAVALLOTTI C.
(1998). Catecholaminergic innervation of human dura mater involved in
headache. HEADACHE, vol. 38, p. 352-355, ISSN: 0017-8748
94 1998
Carlo Cavallotti, F. Gherardi, Marco Artico, Nicola Pescosolido, J. Feher, Corrado
Balacco Gabrieli (1998). Catecholaminergic nerve fibres in normal and alkali-
burned rabbit cornea. CANADIAN JOURNAL OF OPHTHALMOLOGY-JOURNAL
CANADIEN D OPHTALMOLOGIE, vol. 33, p. 259-263, ISSN: 0008-4182
95 1998
M. Artico, S. De Santis, C. Cavallotti (1998). Cerebral dura mater and
cephalalgia: relationships between mast cells and catecholaminergic nerve
fibers in the rat. CEPHALALGIA, p. 183-191, ISSN: 0333-1024
96 1998
SALVATI M, CERVONI L, ARTICO M, R. CARUSO, GAGLIARDI F.M: (1998). Long
term survival in patients with supratentorial glioblastoma. JOURNAL OF NEURO-
ONCOLOGY, vol. 36, p. 61-64, ISSN: 0167-594X
97 1998
M. ARTICO, NERONI, PASTORE, CAVALLOTTI, FRAIOLI (1998). Metastatic
bronchogenic adenocarcinoma into a pituitary adenoma: case report and
literature review. EUROPEAN JOURNAL OF ONCOLOGY, vol. 3, p. 69-74, ISSN:
1128-6598
98 1998
Artico M, Iannetti G, Tranquilli Leali FM, Malinovsky L, Cavallotti C. (1998).
Nerve fibers-mast cells correlation in the rat parietal pleura. RESPIRATION
PHYSIOLOGY, vol. 113- 2, p. 181-188, ISSN: 0034-5687
99 1998
M. ARTICO, PASTORE, FRAIOLI, GIUFFRÉ (1998). The contribution of Davide
Giordano (1864-1954) to pituitary surgery: the transglabellar-nasal approach.
NEUROSURGERY, vol. 42, p. 909-912, ISSN: 0148-396X
232
100 1998
ARTICO M., MALINOVSKY L, CAVALLOTTI C, E. DE ANTONI, BIANCARI F,
D'ANDREA V, COLAIUDA S (1998). Venous drainage of the stomach in the
domestic rabbit (Oryctolagus cuniculus f. domestica,breed large Chinchilla) and
the domestic cat (felis catus L.F. domestica). ANNALS OF ANATOMY, vol.
180(6), p. 565-568, ISSN: 0940-9602
101 1998
TRANQUILLI LEALI F.M., M. ARTICO, CAVALLOTTI C., MALINOVSKA V.,
D'ANDREA V., DE SANTIS S., MALINOVSKY L. (1998). Venous drainage of the
stomach in the golden hamster (Mesocricetus auratus) and the Guinea pig
(Cavia aperea f. porcellus). ANNALS OF ANATOMY, vol. 180(6), p. 561-564,
ISSN: 0940-9602
102 1997
M. Artico, G.M.F. De Caro, B. Fraioli, R. Giuffrè: (1997). 1897 - Celebrating the
centennial - Hermann Moritz Gocht and the radiation therapy in the treatment
of trigeminal neuralgia. ACTA NEUROCHIRURGICA, ISSN: 0001-6268
103 1997
M. ARTICO, CERVONI, WIERZBICKI, D'ANDREA, NUCCI (1997). Benign Neural
Sheath Tumours of Major Nerves: Characteristics in119 Surgical Cases. ACTA
NEUROCHIRURGICA, vol. 139(12), p. 1108-1116, ISSN: 0001-6268, doi:
10.1007/BF01410969
104 1997
M. Artico, F.S. Pastore, M. Polosa, S. Sherkat, M. Neroni (1997). Intracerebral
aspergillus abscess: case report and review of the literature. NEUROSURGICAL
REVIEW, 20(2):135-8, ISSN: 0344-5607
105 1997
L. Cervoni, M. Artico, M. Salvati, S. Carloia (1997). Rathke's cleft cyst: a clinical
and radiographic review. ITALIAN JOURNAL OF NEUROLOGICAL SCIENCES, vol.
18, p. 37-40, ISSN: 0392-0461
233
106 1997
M. ARTICO, CERVONI, CARLOIA, STEVANATO, MASTANTUONO, NUCCI (1997).
Synovial cysts: clinical and neuroradiological aspects. ACTA
NEUROCHIRURGICA, vol. 139, p. 176-181, ISSN: 0001-6268
107 1996
M. Artico, Cervoni L, Nucci F, Giuffre R. (1996). Birthday of peripheral nervous
system surgery:the contribution of Gabriele Ferrara (1543-1627).
NEUROSURGERY, ISSN: 0148-396X
108 1996
L.Malinovsky, R.Umlauf, V.Malinovksa, M.Artico, V.D'Andrea (1996). Einige
Bemerkungen zur neuromorphologischen Grundlage der Vaginalakupunctur.
DEUTSCHE ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 39(3), p. 61-66, ISSN: 0415-
6412
109 1996
M. Salvati, L. Cervoni, M. Artico (1996). High-dose radiation-induced
meningiomas following acute lymphoblastic leukemia in children. CHILDS
NERVOUS SYSTEM, vol. 12, p. 266-269, ISSN: 0256-7040
110 1996
M. Salvati, L. Cervoni, M. Artico, A. Raco, P. Ciappetta, R. Delfini (1996).
Primary spinal epidural non-Hodgkin's lymphomas: a clinical study. SURGICAL
NEUROLOGY, vol. 46, p. 339-343, ISSN: 0090-3019
111 1996
M. Artico, L. Cervoni, P. Celli, F. Nucci: (1996). Purely epithelioid schwannoma:
two case reports and a review of the literature. NEUROCHIRURGIE, 42(1):61-5,
ISSN: 0028-3770
112 1995
L.Malinovsky, V.Malinovska, C.Cavallotti, M.Artico, V.D'Andrea (1995). A
contribution to the problem of thermosensors in skeletal muscles. ISRAELI
JOURNAL OF MEDICAL ACUPUNCTURE, vol. 1, p. 4-7, ISSN: 0793-3142
234
113 1995
Marco Artico, L. Cervoni, G. Stevanato, Vito D'Andrea, F. Nucci (1995). Bifid
median nerve: report of two cases. ACTA NEUROCHIRURGICA, vol. 136, p. 160-
162, ISSN: 0001-6268, doi: 10.1007/bf01410619
114 1995
M. Artico, L. Cervoni, S. Carloia, E. Palatinsky, R. Delfini (1995). Development of
intracranial meningioma at the site of cranial fractures. Remarks on 15 cases.
ACTA NEUROCHIRURGICA, ISSN: 0001-6268
115 1995
L. FERRANTE, M. ARTICO, B. NARDACCI, B. FRAIOLI, F. COSENTINO, A.
FORTUNA (1995). GLOSSOPHARYNGEAL NEURALGIA WITH CARDIAC
SYNCOPE. NEUROSURGERY, ISSN: 0148-396X
116 1995
L. Cervoni, M. Artico, R. Delfini (1995). Intraosseous cavernous hemangioma of
the skull. NEUROSURGICAL REVIEW, ISSN: 0344-5607
117 1995
ARTICO M, FERRANTE L, CERVONI L, C. COLONNESE, FORTUNA A (1995).
PEDIATRIC CYSTYC MENINGIOMA: report of three cases. CHILDS NERVOUS
SYSTEM, vol. 11(3), p. 137-140, ISSN: 0256-7040, doi: 10.1007/BF00570253
118 1995
M. Scarpinati, M. Artico, S. Artizzu (1995). Spinal cord compression by
eosinophilic granuloma of the cervical spine. Case report and review of the
literature. NEUROSURGICAL REVIEW, ISSN: 0344-5607
119 1995
M Artico, L Cervoni, M Salvati, F Fiorenza, R Caruso (1995). Supratentorial
arachnoid cysts: clinical and therapeutic remarks on 46 cases. ACTA
NEUROCHIRURGICA, vol. 132, p. 75-78, ISSN: 0001-6268, doi:
10.1007/BF01404851
120 1995
L. Malinovsky, Vito D'Andrea, Marco Artico (1995). Vascular anatomy of the
spleen. CLINICAL ANATOMY, vol. 8, ISSN: 0897-3806, doi:
10.1002/ca.980080511
235
121 1994
L. Cervoni, M. Artico, M. Salvati, R. Bristot, C. Franco, R. Delfini (1994).
Epileptic seizures in intracerebral hemorrhage: a clinical and prognostic study of
55 cases. NEUROSURGICAL REVIEW, vol. 17, p. 185-188, ISSN: 0344-5607
122 1994
R. Giuffré, F.S. Pastore, S. De Santis, M. Artico: (1994). Lesioni dell'emisfero
"dominante". Patologia vascolare nell'infanzia. MINERVA MEDICA, ISSN: 0026-
4806
123 1994
L.Malinovsky, C.Cavallotti, V.Malinovska, M.Artico, V.D'Andrea (1994).
Morphological basis of peripheral cold-action (cooling) in acupuncture..
DEUTSCHE ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 37(4), p. 91-93, ISSN: 0415-
6412
124 1994
M. Artico, L. Cervoni, M. Salvati, A. Raco, P. Ciappetta (1994). Ossifying fibroma
of the skull: clinical and therapeutic study. TUMORI, vol. 80, p. 64-67, ISSN:
0300-8916
125 1994
L.Malinovsky, V.Malinovska, C.Cavallotti, M.Artico, V.D'Andrea (1994).
Peripheral pain percepting structures in relation to the system of sensory nerve
formations (SNF). INTERNATIONAL JOURNAL OF AURICULAR MEDICINE, vol.
2, p. 17-23, ISSN: 0793-3150
126 1993
Massa S, Di Santo R, Costi R, Simonetti G, Retico A, Apuzzo G, Artico M. (1993).
Antifungal agents. III. Naphthyl and thienyl derivatives of 1H-imidazol-1-yl-4-
phenyl-1H-pyrrol-3-ylmethane. IL FARMACO, vol. 48, p. 725-736, ISSN: 0014-
827X
127 1993
A. Pierallini, S. Bastianello, G. Antonini, S. Giuliani, M. Artico, F. Nucci, M.
Millefiorini, L.M. Fantozzi, L. Bozzao (1993). CT findings in peripheral
mononeuropathies. ZENTRALBLATT FUR NEUROCHIRURGIE, ISSN: 0044-4251
236
128 1993
Luigi Cervoni, Marco Artico, Maurizio Salvati, R. Bristot, V. Wierzbicki, Franco
Maria Gagliardi (1993). Haemangiopericytoma and meningioma presenting
clinically with intracranial haemorrhage: report of three cases and review of the
literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 54, p. 20-23, ISSN:
0044-4251
129 1993
L.Malinovsky, V.D'Andrea, V.Malinovska, M.Artico (1993). Modulating cells in
sensory nerve formations (endings). INTERNATIONAL JOURNAL OF AURICULAR
MEDICINE, vol. 1, p. 5-12, ISSN: 0793-3150
130 1993
L.Malinovsky, M.Artico, I.Malinovska, V.D'Andrea (1993). Some comments to
histomorphology of acupuncture points.. DEUTSCHE ZEITSCHRIFT FÜR
AKUPUNKTUR, vol. 6, p. 129-130, ISSN: 0415-6412
131 1993
M. Artico, L. Cervoni, P. Celli, M. Salvati, L. Palma (1993). Supratentorial
glioblastoma in children: a series of 27 surgically treated cases. CHILD’S
NERVOUS SYSTEM, vol. 9, p. 7-9, ISSN: 0256-7040
132 1993
D'ANDREA V, MALINOVSKY L, AMBROGI V, ARTICO M, CAPUANO LG,
BUCCOLINI F, E. DE ANTONI (1993). Thymectomy as treatment of autoimmune
diseases other than myasthenia gravis. THYMUS, vol. 21(1), p. 1-10, ISSN:
0165-6090
133 1993
L. Malinovsky, M.Artico, V.D'Andrea (1993). Zur Diskussion. DEUTSCHE
ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 38(5), p. 118-119, ISSN: 0415-6412
134 1992
Giorgio Stefancich, Marco Artico, Giorgio Ortar, Romano Silvestri, Giovanna
Simonetti, Germana Apuzzo, Marino Artico (1992). Antibacterial and antifungal
agents. XV. Synthesis and antifungal activity of structural analogues of
bifonazole and ketoconazole. ARCHIV DER PHARMAZIE, vol. 325, p. 687-694,
ISSN: 0365-6233, doi: 10.1002/ardp.19923251102
237
135 1992
M. Salvati, F. Cosentino, M. Artico, M. Ferrari, D. Franchi, M. Domenicucci, E.
Ramundo Orlando, L. Tacconi, F. Cosentino Jr. (1992). Electrocardiographic
changes in subarachnoid hemorrhage secondary to cerebral aneurysm. Report
of 70 cases. ITALIAN JOURNAL OF NEUROLOGICAL SCIENCES, vol. 13, p. 409-
413, ISSN: 0392-0461
136 1992
M. Salvati, M. Artico, P. Lunardi, F. Gagliardi (1992). Intramedullary
meningioma: case report and review of the literature. SURGICAL NEUROLOGY,
vol. 37, p. 42-45, ISSN: 0090-3019
137 1992
M Artico, G Stefancich, R Silvestri, S Massa, G Apuzzo, M Artico, G Simonetti
(1992). Research on antibacterial and antifungal agents. 16. Synthesis and
antifungal activities of 1-[α-(1-naphthyl)benzyl]imidazole derivatives and related
2-naphthyl isomers. EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 27,
p. 693-699, ISSN: 0223-5234, doi: 10.1016/0223-5234(92)90089-J
138 1992
Giorgio Stefancich, Romano Silvestri, Augusta Retico, Marco Artico, Giovanna
Simonetti (1992). Researches on antibacterial and antifungal agents, XIV:
Thiophene analogues of bifonazole. ARCHIV DER PHARMAZIE, vol. 325, p. 199-
204, ISSN: 0365-6233, doi: 10.1002/ardp.19923250403
139 1992
Marco Artico, Maurizio Salvati, Antonino Raco, G. Innocenzi, Roberto Delfini
(1992). Primary Meckel's cave lymphoma. A case and review of the literature.
NEURO-CHIRURGIE, vol. 38, p. 368-371, ISSN: 0028-3770
140 1991
G. Rocchi, M. Artico, P. Lunardi, F.M. Gagliardi (1991). Intracranial schwannoma
of the facial nerve: report of two cases and review of the literature.
NEUROCHIRURGIA, ISSN: 0028-3819
141 1991
M. Salvati, M. Artico, R. Caruso, G. Rocchi, E.Ramundo Orlando, F. Nucci
(1991). A Report on Radiation-Induced Glioma. CANCER, p. 392-397, ISSN:
238
1045-7410, doi: 10.1002/1097-0142(19910115)67:2<392::AID-
CNCR2820670213>3.0.CO;2-V
142 1991
P. Ciappetta, M. Salvati, A. Raco, M. Artico, FM. Gagliardi (1991). Benign
osteoblastoma of the sphenoid bone. NEUROCHIRURGIA, vol. 34, p. 97-100,
ISSN: 0028-3819
143 1991
G. ANTONINI, BASTIANELLO S, NUCCI F, ARTICO M, BOZZAO L, MILLEFIORINI
M (1991). Ganglion of deep peroneal nerve: electrophysiology and CT scan in
the diagnosis. ELECTROMYOGRAPHY AND CLINICAL NEUROPHYSIOLOGY, vol.
31, p. 9-13, ISSN: 0301-150X
144 1991
M. Salvati, P. Ciappetta, M. Artico, A. Raco, A. Fortuna (1991). Intraspinal
hemangiopericytoma: case report and review of the literature.
NEUROSURGICAL REVIEW, vol. 14, p. 309-313, ISSN: 0344-5607
145 1991
ARTICO M, SALVATI M, V. D'ANDREA, RAMUNDO EO, NUCCI F (1991). Isolated
lesion of the axillary nerve:surgical treatment and outcome in 12 cases.
NEUROSURGERY, vol. 29(5), p. 697-700, ISSN: 0148-396X, doi:
10.1227/00006123-199111000-00009
146 1991
M. Artico, M. Scarpinati, M. Salvati, F. Nucci (1991). Late intraneural metastasis
of the brachial plexus from mammary carcinoma. Report of a case. JOURNAL
OF NEUROSURGICAL SCIENCES, vol. 35, p. 51-53, ISSN: 0390-5616
147 1991
P. Lunardi, P. Missori, M. Artico, A. Fortuna (1991). Posttraumatic intradiploic
leptomeningeal cyst in an adult: case report. SURGICAL NEUROLOGY, vol. 35,
p. 475-477, ISSN: 0090-3019, doi: 10.1016/0090-3019(91)90183-A
148 1991
Maurizio Salvati, Pasqualino Ciappetta, Antonino Raco, Marco Artico, Spartaco
Artizzu (1991). Primary intracranial actinomycosis. Report of a case and review
239
of the literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 51, p. 95-98,
ISSN: 0044-4251
149 1991
M. Salvati, M. Artico, S. Carloia, E. Ramundo Orlando, F. M. Gagliardi (1991).
Solitary cerebral metastasis from lung cancer with very long survival: report of
two cases and review of the literature. SURGICAL NEUROLOGY, vol. 36, p. 458-
461, ISSN: 0090-3019
150 1991
P. Ciappetta, M. Salvati, G. Capoccia, M. Artico, A. Raco, A. Fortuna (1991).
Spinal glioblastomas: report of seven cases and review of the literature.
NEUROSURGERY, vol. 28, p. 302-306, ISSN: 0148-396X
151 1990
L. Palma, M. Artico, P. Celli, M. Salvati, A. Cesaroni, N. Di Lorenzo (1990).
Glioblastomi sopratentoriali in età pediatrica: considerazioni su una serie di 18
casi trattati chirurgicamente nel periodo 1959-1988. MINERVA MEDICA, ISSN:
0026-4806
152 1990
L. Bardella, M. Artico, A. Maleci, S. Bastianello, A. Pierallini, F. Nucci (1990).
Considerazioni su una serie di 116 interventi per neuropatia del nervo ulnare al
gomito. MINERVA MEDICA, ISSN: 0026-4806
153 1990
P. Ciappetta, M. Artico, M. Salvati, A. Raco, F. M. Gagliardi (1990). Intradiploic
epidermoid cysts of the skull: report of 10 cases and review of the literature..
ACTA NEUROCHIRURGICA, vol. 102, p. 33-37, ISSN: 0001-6268
154 1990
Nucci F, Artico M, Santoro A., Bardella L, Delfini R, Bosco L, Palma L (1990).
Intraneural synovial cyst of the peroneal nerve : report of two cases and review
of the literature. NEUROSURGERY, vol. 26, p. 339-344, ISSN: 0148-396X
155 1990
M. Artico, L. Bardella, A. Maleci, F. Nucci (1990). Lesione isolata del nervo
ascellare: considerazioni su 74 casi, 10 dei quali trattati chirurgicamente. .
MINERVA MEDICA, ISSN: 0026-4806
240
156 1990
M. Domenicucci, M. Artico, F. Nucci, M. Salvati, L. Ferrante (1990). Meningioma
following high-dose radiation therapy. Case report and review of the literature..
CLINICAL NEUROLOGY AND NEUROSURGERY, vol. 92, p. 349-352, ISSN: 0303-
8467
157 1990
M. Artico, S. Massa, S. Panico, G. Simonetti, G. Stefancich (1990). Pirfloxacin
(Irloxacin) Activity Related to Other Antimicrobial Agents. FARMACI & TERAPIA,
vol. 7, p. 24-29, ISSN: 0393-9693
158 1990
A. Raco, M. Artico, P. Ciappetta, M. Salvati, L. Bardella, G. Cantore (1990).
Primary intracranial lymphomas.. CLINICAL NEUROLOGY AND NEUROSURGERY,
vol. 92, p. 125-130, ISSN: 0303-8467
159 1990
Silvio Massa, Roberto Di Santo, Antonello Mai, M. Botta, Marco Artico, S. Panico,
Giovanna Simonetti (1990). Research on antibacterial and antifungal agents.
XIII. Synthesis and antimicrobial activity of 1-arylmethyl-4-aryl-1H-pyrrole-3-
carboxylic acids. IL FARMACO, vol. 45, p. 833-846, ISSN: 0014-827X
160 1990
A. Pierallini, S. Bastianello, S. Giuliani, M. Artico, G. Antonini, F. Nucci, L. Bozzao
(1990). Studio con immagini del tunnel carpale in soggetti normali e sintomatici.
MINERVA MEDICA, ISSN: 0026-4806
161 1990
M. Salvati, E. Ramundo Orlando, M. Artico, S. Martini, R. Caruso, A. Fortuna
(1990). The tethered cord syndrome in the adult. Report of three cases and
review of the literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 51, p. 91-
93, ISSN: 0044-4251
162 1990
A. Raco, P. Ciappetta, M. Artico, M. Salvati, G. Guidetti, G. Guglielmi (1990).
Vertebral hemangiomas with cord compression: the role of embolization in five
cases. SURGICAL NEUROLOGY, vol. 34, p. 164-168, ISSN: 0090-3019
241
163 1989
L. Ferrante, M. Acqui, M. Artico, L. Mastronardi, G. Rocchi, A. Fortuna (1989).
Cerebral meningiomas in children. CHILDS NERVOUS SYSTEM, ISSN: 0256-
7040
164 1989
N. Di Lorenzo, L. Palma, M. Artico, A. Fortuna (1989). Cisti aracnoidee
malformative della fossa posteriore: trattamento chirurgico e risultati a distanza.
MINERVA MEDICA, ISSN: 0026-4806
165 1989
F. Nucci, M. Artico, G. Antonini, M. Millefiorini, S. Bastianello, L. Bozzao (1989).
Compression of the ulnar nerve in Guyon's canal by a giant cell tumor.
ZENTRALBLATT FUR NEUROCHIRURGIE, ISSN: 0044-4251
166 1989
M. Salvati, M. Ferrari, F. Fiorenza, E. Ramundo Orlando, M. Artico, F. Cosentino
Jr, F. Cosentino (1989). Differential diagnosis of multiple gliomas, multicentric
gliomas and the other main endocranial multifocal lesions. Presentation of a
case. GIORNALE ITALIANO DI ONCOLOGIA, vol. 9, p. 135-140, ISSN: 0392-
128X
167 1989
N. Di Lorenzo, E. Palatinsky, M. Artico, L. Palma (1989). Dural mesenchymal
chondrosarcoma of the lumbar spine. Case report. SURGICAL NEUROLOGY,
ISSN: 0090-3019
168 1989
M. Salvati, F. Cosentino, M. Ferrari, M. Artico, F. Fiorenza, F. M. Gagliardi
(1989). Familial cerebral aneurysms: case report and review of the literature.
RIVISTA DI NEUROLOGIA, vol. 59, p. 66-70, ISSN: 0035-6344
169 1989
Vito D'Andrea, Marco Artico, L. Capuano, Livio Gallottini, V. Ambrogi (1989).
IMMUNOHISTOCHEMICAL DEMONSTRATION OF NEUROPEPTIDE-Y IN NORMAL
HUMAN THYMUS AND IN THYMOMA. MEDICINA, vol. 9, p. 299-301, ISSN:
0392-6516
242
170 1989
G. P. Cantore, A. Raco, M. Artico, P. Ciappetta, R. Delfini (1989). Primary
chiasmatic lymphoma. CLINICAL NEUROLOGY AND NEUROSURGERY 91(1):71-
4. ISSN: 0303-8467
171 1989
M. Artico, L. Bardella, P. Ciappetta, A. Raco (1989). Surgical treatment of
subependymomas of the central nervous system. Report of 8 cases and review
of the literature. ACTA NEUROCHIRURGICA 98(1-2): 25-31 ISSN: 0942-0940
172 1988
F. Nucci, L. Mastronardi, M. Artico, L. Ferrante, M. Acqui (1988). Tuberculoma
of the ulnar nerve: case report. NEUROSURGERY 22(5):906-7 ISSN: 0148-396
173 1988
L. Bardella, M. Artico, F. Nucci (1988). Intramedullary subependimoma of the
cervical spinal cord. SURGICAL NEUROLOGY 29(4):326-9. ISSN: 0090-3019
174 1987
S. BIAGIONI, F. MANNELLO, F. STELLA, S. BATTISTELLI, F. MARCHEGGIANI, L.
CERRONI, M. ARTICO, C.TERZANO, R. TROCCOLI (1987). Lactate
dehydrogenase, isoenzyme patterns ande cation levels in human breast gross
cyst fluid. CLINICA CHIMICA ACTA 169(1):91-7. ISSN: 0009-8981
175 1987
Troccoli R, Stella F, Stella C, Battistelli S, Antonioni M, Marcheggiani F, Mannello
F, Biagioni S, Artico M, Terzano C. (1987) Carcinoembryonic antigen in a review
of cases in the literature. Quad Sclavo Diagn 23(3): 233-45.
Books and book chapters
2005 Marco Artico (2005). Appunti di Anatomia Microscopica. In: Appunti di
Anatomia Microscopica. p. 1-130
Proveniente dall'Archivio Istituzionale di UNIROMA1 con codice 509986
2005 Artico M, Castano P, Cataldi A, Falconi M, Milintenda F, Formigli L, Onori
P, Papa S, Pellegrini A, Pirino AS (2005). Anatomia Umana – Principi.
MILANO:Edi.Ermes, ISBN: 9788870512502
Proveniente dall'Archivio Istituzionale di UNIROMA1 con codice 507745
243
1996 Luigi Cervoni, Marco Artico, Paolo Celli, Riccardo Caruso, Franco M.
Gagliardi (1996). Gli Ependimomi Spinali: aspetti clinici e prognostici. p. 1-50,
Roma:CISU
Proveniente dall'Archivio Istituzionale di UNIROMA1 con codice 509987
1993 MALINOVSKY L, CAVALLOTTI C, TROCCOLI R, ARTICO M, MALINOVSKA V, V. D'ANDREA
(1993). MORPHOLOGY OF GLOMERULAR (KRAUSE) SENSORY CORPUSCLES:THEIR
VARIABILITY,DEFINITION AND RELATION TO BLOOD VESSELS. IN: CAVALLOTTI CARLO. ATTI DEL
DIPARTIMENTO DI SCIENZE CARDIOVASCOLARI E RESPIRATORIE. VOL. 3, P. 160-174,
ROMA:EDIZIONI UNIVERSITARIE ROMANE
Proveniente dall'archivio Istituzionale di Uniroma1 Con Codice 156188
244
Chapter 13
Acknowledgements
This thesis is the final work of my path towards Ph.D. This work has been made
possible through the precious advices and support of friends, colleagues of
different institutions. I would like to express my gratitude and deep thanks to
all those colleagues who made possible to complete this study in its present
form and who contributed to render this work interesting and unforgettable in
my personal experience. First and foremost my warmest and deep gratitude
goes to my first supervisor Prof. Alberto Signore, whose encouragement,
precious advices, patience and outstanding experience have been fundamental
in my own work during the drawing up and completion of this PhD thesis.
Special thanks should also be given to Prof. R.A.J.O. Dierckx for the wonderful
opportunities, the support and the guidance that he, with his marvelous
sympathy, had provided to me in my stimulating and amazing “Dutch
adventure”. Other special thanks should to be expressed to Dr. Sharon Poort
and Dr. Filippo Galli for being a paranimph in this ceremony. I am also
particularly grateful to the wonderful, ancient and prestigious University of
Groningen, which has made possible for me to reach this ultimate goal of PhD.
Finally, I would thank my fiancee Marialuisa for her sweet and patient capability
of supporting me during these years and for her participation to the ceremony
of my final dissertation.