University of Groningen

The occurrence and ecological role of plasmids in bacterial mycosphere dwellersZhang, Miaozhi

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Zhang, M. (2015). The occurrence and ecological role of plasmids in bacterial mycosphere dwellers. [S.n.].

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 01-05-2022

Chapter 6

IncP-1 and PromA group plasmids are major

providers of horizontal gene transfer capacities

across bacteria in the mycosphere

of different soil fungi

Miaozhi Zhang, Sander Visser, Michele C Pereira e Silva, Jan Dirk van Elsas

Microbial Ecology (2015) 69:169-179.

Abstract

Plasmids of the IncP-1β group have been found to be important carriers of accessory

genes that enhance the ecological fitness of bacteria, whereas plasmids of the PromA group

are key agents of horizontal gene transfer (HGT) in particular soil settings. However, there is

still a paucity of knowledge with respect to the diversity, abundance and involvement in

horizontal gene transfer of plasmids of both groups in the mycosphere. Using triparental

exogenous isolation based on the IncQ tracer plasmid pSUP104 as well as direct molecular

detection, we analyzed the pool of mobilizer and self-transferable plasmids in mycosphere

soil. Replicate mushroom types that were related to Russula, Inocybe, Ampulloclitocybe and

Galerina spp. were sampled from a forest soil area and bulk soil was used as the control. The

data showed that the levels of IncP-1β plasmids are significantly raised across several of the

mycospheres analyzed, whereas those of PromA group plasmids were similar across the

mycospheres and corresponding bulk soil. Moreover, the frequencies of triparental exogenous

isolation of mobilizer plasmids into a Pseudomonas fluorescens recipient strain were

significantly elevated in communities from several mycospheres as compared to those from

bulk soil. Molecular analysis of selected transconjugants, as well as from directly-isolated

strains, revealed the presence of plasmids of three size groups, i.e. (1) 40-45 kb, (2) 50-60 kb

and (3) >60 kb, across all isolations. Replicon typing using IncN, IncW and IncA/C proxies

revealed no positive signals. In contrast, a suite of plasmids produced signals with IncP-1β as

well as PromA type replicon typing systems. Moreover, a selected subset of plasmids,

obtained from the Inocybe and Galerina isolates, was transferred out further, revealing their

capacities to transfer and mobilize across a broad host range.

Plasmids provide gene transfer capacity in the mycosphere

111

6

Introduction

Horizontal gene transfer (HGT) is the key driving force behind the rapid bacterial

diversification and adaptation (van Elsas et al., 2003; Sota and Top, 2008) that is observed in

many environmental habitats. HGT by conjugation is considered to be a major genetic

strategy used by bacteria to enhance their adaptive strength in fast-changing environments.

Conjugation is often mediated by plasmids (Sota and Top, 2008), i.e. genetic elements that

can self-replicate and transfer into other cells. These plasmids frequently contain genes that

encode proteins which are beneficial to the bacterial host (Sambrook and Russel, 2001). Thus,

plasmids have been key in the evolution as well as spread of antibiotic resistance and

biodegradation genes, playing important roles when plasmid-carrying hosts were confronted

with anthropogenic selective pressures (Thomas, 2000).

Plasmids can transfer among narrow or quite broad spectra of hosts. The latter is of

particular interest in many ecological settings, as such broad-host-range (BHR) transfers

allow the establishment of genetic interconnections across many members of complex

bacterial communities. Moreover, mobilization or retro-mobilization of other, mobilizable,

plasmids is an important characteristic of BHR plasmids. Although not fully known, there

are indications that the IncP-1 and PromA groups of plasmids may have major roles as gene

transfer vehicles in soil bacterial communities (Heuer and Smalla, 2012; van der Auwera et

al., 2009). Of these, IncP-1 plasmids, which are traditional carriers of antibiotic resistance or

xenobiotic-degradation traits (Dennis, 2005; Thomas, 2000), can replicate and maintain

stability in the majority of Proteobacteria. The IncP-1 plasmids are currently classified into

five major sub-groups (named IncP-1α through IncP-1ε), mainly on the basis of the sequences

of the replication protein TrfA. Among the different types, the IncP-1β group stands out as a

key soil-bound plasmid group (Schluter et al., 2007). Another BHR plasmid group that may

be typical for soil, PromA, so far includes just five key plasmids, i.e. pIPO2, pSB102,

pTer331, pMRAD02 and pMOL98 (van der Auwera et al., 2009). PromA plasmids typically

transfer between members of the (α, β and γ) Proteobacteria. The canonical PromA group

plasmid, pIPO2 was isolated by triparental exogenous isolation from the rhizosphere of young

wheat plants, and turned out to be a cryptic plasmid with huge mobilization and self-transfer

capabilities (van Elsas et al., 1998; Tauch et al., 2002).

The mycosphere can be defined as the habitat surrounding fungal hyphae, and the

dense bundle of hyphae that is present below fungal fruiting bodies constitutes a mycosphere

Plasmids provide gene transfer capacity in the mycosphere

112

6

with exemplary (concentrated) effects (Warmink and van Elsas, 2008). In this particular soil

habitat, bacterial numbers have been shown to be significantly higher than those in

corresponding bulk soil, revealing a selective effect of the mycosphere on local soil bacteria

(Warmink and van Elsas, 2008). Unfortunately, we still lack a thorough understanding of the

prevalence and ecological role of plasmids in such mycosphere communities. The ‘raison

d’etre’ of plasmids may lie in the fact that they provide sporadic ecological benefits to their

hosts, which is exemplified by the aforementioned antibiotic (as well as heavy metal)

resistances, next to hydrocarbon-degradative pathways (Smalla et al., 2000; Frost et al., 2005).

Such plasmids thus promote bacterial survival under such (often temporary) environmental

stresses, and their transfer potential might spread the adaptive capacities across diverse

bacteria under the stress condition. We thus posed the question whether the mycosphere

constitutes a habitat in which such “genetic dynamism” might be prevalent, and whether

plasmids of the two groups might play any role in it.

In previous work, plasmids of the IncP-1β group were found in several strains

affiliated with Variovorax paradoxus, that had been obtained from the mycosphere of the

ectomycorrhizal fungus Laccaria proxima. Moreover, preliminary evidence was found for the

provision of iron acquisition capacity by one such plasmid, i.e. pHB44, to its host (Boersma,

2009). In addition, the coincidental finding of a PromA group plasmid, i.e. the pIPO2

analogue pTER331, in Collimonas fungivorans (Mela et al., 2008), which is mycophagous on

Fusarium spp., points to a putative role of this plasmid class in mycospheres. On the basis of

these observations, we set out to assess the incidence of plasmids across the mycospheres of

dominant fungi (mushrooms) growing in a temperate climate forest in Noordlaren, Drenthe,

The Netherlands. We quantified plasmids of the IncP-1β and PromA groups across the

bacterial populations of selected mycosphere and bulk soils, and performed triparental

exogenous isolations of an IncQ tracer plasmid to define the plasmid-mobilizing capacities

across these habitats.

Materials and methods

Samplings and sample location

All samples were taken across a forest soil area in Noordlaren, Drenthe, the

Netherlands, in September 2012 and October 2013. In the first sampling, triplicate individuals

of four different mushrooms (defined by morphology) were sampled, taking care that the

Plasmids provide gene transfer capacity in the mycosphere

113

6

mushroom feet soil was included. Moreover, replicate bulk soil samples (as well as fallen

wood, the basis of one mushroom) were obtained from sites about 40 cm away from the

mushroom individuals, in which no detectable (naked eye) fungal hyphae were found. In the

second sampling, one prominent mushroom type was resampled, in triplicate, next to the

corresponding bulk soil triplicates. All mushroom samples were obtained by collecting each

complete fruiting body including the soil adhering to the hyphal network under the mushroom

feet. Samples were taken to the laboratory and processed immediately for subsequent plating,

triparental exogenous plasmid isolation and DNA extractions. Moreover, soil pH and water

contents were measured.

Identification of fungi using fruiting body tissues

By assessing the colors and morphological properties (size, shape and texture) of the

fungal fruiting bodies using a determination database ( http://www.soortenbank.nl/), all were

presumptively identified. This initial identification was followed by DNA extraction from the

fruiting bodies by using the Wizard genomic DNA purification kit (Promega Corporation

Madison, WI, USA, catalog number A1120). Then, the ITS region (between the 18S and 25S

rRNA genes) was amplified by PCR according to Smit et al. (1999), and products were

purified using the Wizard® SV Gel and PCR Clean-Up System (Promega Corporation

Madison, WI, USA, catalog no. A9281) according to the manufacturer’s protocol. Following

quality controls, the amplicons were sent for sequencing by LGC (Berlin, Germany) in order

to identify the fungal species.

Processing of mycosphere and bulk soil samples

Tightly-adhering soil was obtained from the foot of each fungal fruiting body after

removing the loosely-attached soil. The soil was collected into sterile tubes. Corresponding

bulk soil was also placed in tubes, following mixing. These mycosphere and bulk soil samples

were tenfold diluted, placing 0.5 g in 5 ml sterile 0.85% NaCl. The resulting suspensions were

homogenized by mixing on a Vortex shaker (three times, 1 min each time). Following this

treatment, the samples were centrifuged at 100 rpm for 30 s, after which they were allowed to

settle for 10 min. Supernatants were then obtained and centrifuged at maximum speed for 15

min. The resulting cell pellets were resuspended in sterile water. These suspensions were then

used for CFU counting following dilution plating as well as for triparental exogenous plasmid

isolations. Furthermore, selected mushroom fruiting bodies were surface-disinfected by

treating with bleaching agent followed by two washes with sterile water. Following this, caps

Plasmids provide gene transfer capacity in the mycosphere

114

6

and feet of each mushroom were separated and cut into pieces < 2mm, after which 0.5 g of

each was placed in 5 ml sterile 0.85% NaCl and vortex-mixed three times for 1 min. The

resulting suspensions were used for dilution plating and bacterial counts.

Culturable bacterial communities in fungal tissues, mycosphere and bulk soil, and screening

of colonies for plasmids

The aforementioned bacterial cell suspensions were used for (serial tenfold) dilution

plating on R2A agar (Becton, Dickinson and Company, Sparks, MD). The inoculated plates

were incubated at 24°C for up to 15 d. Colony-forming unit (CFU) counts were obtained at

regular time intervals, until maximal numbers were obtained, after which the sizes of the

culturable bacterial communities per g dry soil were determined.

Twenty randomly-picked colonies obtained from each of the four mycospheres as well

as the bulk soil and the rotting wood supporting one mushroom (120 in total), next to those

from the fungal cap and foot (30 colonies), were screened for the presence of trfA2 (proxy for

IncP-1β) or repA (proxy for PromA; Table 2) using the relevant PCR based detection systems

(Gotz et al., 1996). The first system has been validated earlier (Gotz et al., 1996), whereas the

second system was developed in this study, on the basis of the known repA sequences of all

PromA plasmid group members. The system was specific for its target, as shown under

Detection and quantification (see further). In the screens, DNA extracted from plasmids R751

(IncP-1β) and pIPO2 (PromA) were used as the positive controls.

Total community DNA extraction from mycosphere and bulk soil

DNA was extracted from all mycosphere and bulk soil samples using the PowerSoil

DNA Isolation Kit (MO BIO Laboratories, Carlsbad, CA, USA, catalogue number 12888-100)

in accordance with the manufacturer’s protocol. The only change made in the protocol was

that 0.5 g of soil was used, which was shaken three times for one min using a mini-bead

beater (BioSpec Products, Bartlesville, OK, USA). The quality and quantity of the extracted

mycosphere and bulk soil DNAs were checked using visual observation of ethidium bromide

stained gels following electrophoresis of 1.0 % agarose gels. Thus estimates of DNA quantity

and quality were obtained, which were checked using a NanoDrop 2000 Spectrophotometer

(Thermo scientific, Wilmington, DE, USA).

Detection and quantification of IncP-1β and PromA plasmids in mycosphere and bulk soils

Plasmids provide gene transfer capacity in the mycosphere

115

6

To detect IncP-1β and PromA group plasmids, trfA2 (marker for IncP-1β) and repA

(marker for PromA) specific PCRs were applied to mycosphere and bulk soil DNAs. The 20-

μL PCR mixtures consisted of 9.82 μL MilliQ water, 2 μL 10x Stoffel PCR buffer, 4.8 μL

MgCl2 (25 mM), 0.2 μL formamide (100%), 0.02 μL T4 gene 32 protein (5 mg/mL), 0.16 μL

deoxynucleoside triphosphate (25 mM), 0.4 μL Stoffel Taq polymerase (5000 U/mL), 0.8 μL

of each primer (10 μM) and 1 μL of DNA sample (containing up to 5 ng of DNA). The

following PCR program was used: 96°C for 5 minutes (1 cycle); 96°C for 45 seconds, 57°C

for 1 minute, 72°C for 1 minute (35 cycles); 72°C for 10 minutes (1 cycle). The amplicons

(predicted to be 241 bp and 452 bp in size, respectively) were run on 1.0% agarose gels using

electrophoresis to determine the amounts, size and quality. DNA from plasmids R751 and

pIPO2 were used as positive controls for the trfA2 and repA-specific PCRs, respectively.

The DNA samples were then used for real-time PCR on the ABI prism 7300

thermocycler (Applied BioSystems, Carlsbad, PO, USA, catalog number 4359284). Thus the

trfA2, repA and bacterial 16S rRNA genes were quantified. Primers for the 16S rRNA (Bach

et al., 2002) and trfA2 genes (Gotz et al., 1996) were as previously described. For detection

of repA, forward primer repAqf (TTGCCATACGGCACCCTGCCCCGGCTGCTGCTGAC)

and reverse primer repAqr (AGCGTCGTCATGGCGTGCTTCAAGCGCGTGATGTC) were

designed. These primers were specific for the PromA group repA gene, as experimentally

verified using a suite of reference plasmids. PCR amplifications were performed in a 25-μL

reaction volume containing 12.5 μL Power SYBR Green PCR master mix, 0.5 μL bovine

serum albumine (20 mg/mL), 0.8 μM of each primer and 2 μL DNA template at 5 ng/ μL.

The amplification was as follows: 10 min 95°C, and 40 cycles consisting of 20 s 95°C and 20

s 57 °C for trfA2 and repAq, or 27 s 95°C, 60 s 62°C and 60 s 72°C for 16S rRNA genes.

Standard curves were generated using serial dilutions of plasmids R751 (IncP-1β), pTer331

(PromA) or of a vector containing the cloned 16S rRNA gene from Burkholderia terrae

BS001. Dilutions ranged from 107 to 10

2 gene copy numbers per μL. The amplification

efficiency was calculated by using the formula Eff=[10(-1/slope)-1]. Potential inhibition of

the reaction was tested by diluting the soil DNA and mixing with known amount of standard

DNA. The Ct values showed no change in the presence of soil DNA, revealing no inhibition

occurring.

Triparental exogenous plasmid isolation

Plasmids provide gene transfer capacity in the mycosphere

116

6

Triparental exogenous plasmid isolation with whole bacterial communities from

mycosphere and bulk soil samples was applied to obtain self-transferable plasmids with IncQ

plasmid mobilizing capacity (Bale et al., 1988). The system used consisted of recipient strain

Pseudomonas fluorescens R2f Rpr (rifampicin [Rp] resistant) and helper strain Escherichia

coli CSH52 (pSUP104) containing the IncQ tracer plasmid pSUP104. The two strains were

mixed with the microbial community (total extracted cells, normalized at about 2-5x108 cells

per ml) obtained from each mycosphere and bulk soil sample. The system allowed to monitor

the transfer of the mobilizable plasmid pSUP104 into strain P. fluorescens R2f Rpr under the

influence of any (broad-host-range) mobilizing activity from the mycosphere/soil microbial

community. In each experiment, the system was controlled by running recipient strain alone,

helper strain alone and soil microbial community alone.

The P. fluorescens R2f Rpr recipient strain was pre-cultured in LB broth supplemented

with 50 μg/ml rifampicin (overnight, 28°C, 200 rpm). Helper strain E. coli CSH52 (pSUP104,

conferring resistance to chloramphenicol [Cm] and tetracyclin [Tc]) was grown in LB broth

supplemented with tetracycline (25 μg/ml) and chloramphenicol (25 μg/ml) at 37°C with

shaking at 200 rpm. Following their selection, putative transconjugant clones were grown in

LB broth with rifampicin (50 μg/ml), tetracycline (25 μg/ml) and chloramphenicol (25 μg/ml),

at 28°C.

The triparental exogenous matings were performed as follows. 50 μl each of washed

overnight cultures of P. fluorescens Rpr and E. coli CSH52 (pSUP104), each having about

2x107 cells, were applied to the center of a 5-mm thick LB agar plate together with 50 μl of

the soil or mycosphere bacterial suspensions (containing approximately 107 cells). The plates

were incubated overnight at 28°C. Following incubation, the mixtures were Vortex-shaken in

1 ml of sterile water to resuspend the bacterial cells. Dilution plating was done onto R2A agar

containing rifampicin (50 μg/ml), tetracycline (25 μg/ml) and chloramphenicol (25 μg/ml), in

order to obtain and enumerate putative P. fluorescens transconjugants. After 48 h at 28°C,

CFUs were counted and putative transconjugants streaked to purity for further

characterization. Controls (mating mixes with one partner missing) were used to indicate

frequencies of mutation of P. fluorescens R2f to the antibiotics used. Transfer frequencies

were calculated as the ratio of the total number of transconjugants to the total number of

recipients. Transconjugants were first verified by (1) their greenish fluorescence typical of P.

fluorescens R2f, and (2) BOX-PCR fingerprintings according to Versalovic et al. (1994).

Plasmids provide gene transfer capacity in the mycosphere

117

6

Detection of plasmids in putative transconjugants

Putative transconjugants were screened for the presence of plasmids. To this end, a

modified plasmid extraction protocol (Birnboim and Doly, 1979) was used. Overnight

cultures of each clone were centrifuged, in an Eppendorf centrifuge, at 7,000 rpm (10 min at

4°C). After removing the supernatant, the pellet was resuspended in 100 μL resuspension

buffer (50 mM glucose; 10 mM EDTA; 10 mM Tris-D), followed by adding 200 μL lysis

solution (0.2M NaOH; 1% SDS), mixing by inversion and incubating at room temperature for

5 min. Then, 150 μL of 7.5 M ammonium acetate plus 150 μL of chloroform were added.

After mixing by inversion, the tube was incubated on ice for 10 min. Then, the tube was spun

for 10 min at 7,000 rpm at 4°C, after which the supernatant was transferred to 200 μL

precipitation solution (30% polyethylene glycol 8000; 1.5 M NaCl) and chilled on ice for 15

min. After centrifuging at 13,000 rpm for 15min, the supernatant was removed and the pellet

was air-dried. Finally, the pellet was resuspended in PCR water. The quantity and quality of

the extracted plasmid DNA were checked on 1.0% agarose by using gel electrophoresis,

verifying the presence of plasmid DNA bands using ethidium bromide staining. The resulting

images were digitized.

Molecular typing of plasmids by PCR

Eighty two randomly-picked transconjugant clones from different mycospheres were

used for PCR-based replicon typing to assess whether they belonged to the PromA, IncP-1,

IncA/C, IncN or IncW plasmid groups, mainly in accordance with (Alvarado et al., 2013).

The newly developed PromA group primers used are shown in Table 1. The 25-μL PCR

mixtures consisted of 2.5 μL PCR buffer, 2% dimethyl sulfoxide, 0.2 mM deoxynucleoside

triphosphate, 100 U/mL Roche Taq polymerase and 0.2 μM of each primer. The following

PCR program was used: 94°C for 5 minutes (1 cycle); 94°C for 45 seconds, 60°C for 45

seconds, 72°C for 45 seconds (35 cycles); 72°C for 5 minutes (1 cycle). PCR products were

run on a 1.0% agarose gel using gel electrophoresis to determine the size and quality.

Plasmids provide gene transfer capacity in the mycosphere

118

6

Table 1. Primers and PCR conditions for detection of PromA plasmids. Y: C/T.

Primer

name Primer sequence 5’-3’

Amplic

on size

Annealing

temperature Reference

virD4-1 TCGACGTGGTGGACGTACTG 224bp 60°C This paper

virD4-2 GCCGATGAYGATGCCGGTWTTG 224bp 60°C This paper

repA-1 TACGGCACCCTGCCCCGGCTGCTGCTGAC 452bp 57°C This paper

repA-2 CGCTTCGATAGGTAGCTCATGCG 452bp 57°C This paper

Primers were designed using the program PRIMER 6 (Clarke et al., 2006), and tested on plasmid pIPO2T and

pTer331. BLAST-N searches against the database revealed that both primer systems are specific for the PromA

group of plasmids.

Statistical analysis of the data

All treatments (samplings) were set up using three independent biological replicates,

which were analysed separately. Results of the triplicates were log-transformed, averaged and

standard errors were determined. The assumption of normality was tested with Shapiro–Wilk

statistics and differences between treatments were tested for significance with One-Way

ANOVA and Tukey’s HSD test (p < 0.05), in the statistical program PAST (Hammer et al.,

2001). Error bars in graphics and numbers between brackets behind the data represent the

standard error of the mean (SE).

Results

Presumptive identification of sampled mushrooms

The different mushrooms sampled in autumn 2012 were first identified as members or

affiliates of the fungal genera Russula, Ampulloclitocybe/Clitocybe, Galerina and Inocybe by

morphological determination. Subsequent ITS-PCR based sequencing confirmed the

identification of these fruiting bodies as related to (between brackets, % homology shown)

Russula exalbicans (95%) (Melzer and Zvara, 1927), Ampulloclitocybe clavipes (96%)

(Redhead et al., 2002), Galerina sp. KAL2 (96%) (Earle, 1909) and Inocybe aff. PBM2453

(95%) (Atkinson, 1918). Although the relatedness of our mushroom samples with the

described fungal genera was not very high, we will, from this point on, use the

Plasmids provide gene transfer capacity in the mycosphere

119

6

aforementioned genus names as the proximate identities of the sampled mushrooms. The

fungal fruiting bodies collected at the same location in 2013, of a single morphological type,

were readily identified as Russula spp. by their color, size, shape, texture and spore structure.

Total and culturable bacterial communities in mycosphere and bulk soils

The total bacterial abundances of the 2012 samples, as quantified by 16S rRNA gene

based quantitative PCR, ranged from about 109 to 10

10 per g dry soil in the mycosphere and

bulk soils (Fig. 1A). Moreover, although three of four mycospheres revealed raised bacterial

abundances as compared to those in the bulk soil (Fig. 1A), these differences were never

significant (P>0.05). Interestingly, the mycosphere of Galerina sp. revealed a significantly

lowered bacterial abundance in the mycosphere than in the wood sample (F=769.5; P<0.05).

The 16S rRNA gene based qPCR of the bacterial communities from the Russula mycosphere

and bulk soil samples of 2013 demonstrated a trend similar to the above, with copy numbers

ranging from 109 to 10

10 per g dry soil, and no significant differences between the

mycosphere and bulk soil values (P>0.05).

The bacterial densities determined from CFU counts for all mycosphere and bulk soils

sampled in 2012 are shown in Fig. 1B. The values in the bulk soils, of about 107 per g dry soil,

were as expected. Interestingly, the bacterial abundances at Russula were significantly

increased as compared to those in the corresponding bulk soil (F=22.27; P<0.05). Although

the values were also elevated for the Ampulloclitocybe and Inocybe mycospheres, in this case

the differences with bulk soil were not significant (P>0.05). In contrast, the CFU numbers in

the Galerina sp. mycosphere were significantly lowered as compared to those of the

corresponding wood samples (F=12.31; P<0.05). The bacterial densities in the Russula

mycosphere soil sampled in 2013 showed a similar effect as in 2012, at values of about 107

CFU per g dry soil (mycosphere) versus about 106 CFU per g dry soil in corresponding bulk

soil. Thus, in 2012 and 2013, the Russula sp. mycospheres exerted a stimulating influence on

the densities of the culturable mycosphere-associated bacterial communities.

Plasmids provide gene transfer capacity in the mycosphere

120

6

Fig. 1 Quantification of bacterial communities in the mycospheres of fungi related to Russula exalbicans,

Ampulloclitocybe, Inocybe, and Galerina, next to bulk soil (year 2012).

A.Total bacterial communities: real-time quantitative PCR of bacterial 16S rRNA genes in mycosphere and bulk

soils. Error bars: standard errors of the mean across triplicates. Similar letters above bars indicate no significant

differences (P>0.05), different letters above bars indicate significant differences (P<0.05).

B. Culturable bacterial communities: colony-forming unit (CFU) counts per gram dry mycosphere or bulk soil.

Error bars: standard errors of the mean across triplicates. Similar letters above bars indicate no significant

differences (P>0.05); different letters above bars indicate significant differences (P<0.05).

Statistical classes in A and B: read left part separate from right part, as basis of units is different.

Plasmids provide gene transfer capacity in the mycosphere

121

6

In the current study, we did not address the bacterial diversities across the different

mycospheres, as the focus was on plasmids and HGT potential. However, previous work

performed in the same forest area indicated that consistent shifts in bacterial community

structures in the soil were brought about by the presence of mushrooms (Warmink and van

Elsas, 2008).

Culturable bacterial communities inside mushroom caps and stems

Overall, culturable bacterial communities were below detection in 20 of the 24

mushrooms sampled in 2012 (detection limit estimated to be around 102 CFU per g fungal

tissue). However, the remainder of the samples was found to contain potentially endomycotic

culturable bacteria. Thus 3.7x104 and 4.4x10

4 CFU per g fungal tissue were detected

respectively in the cap of two samples of Russula and one of Inocybe. In one Galerina sample,

2.9x105 and 1.5x10

3 CFU per g fungal tissue were obtained from the cap and stem,

respectively. In the samples of 2013, 5.65x105 CFU/g fungal tissue were found from the stem

of one Russula sample, whereas the other two samples were devoid of detectable CFUs.

Subsets (30 each) of colonies obtained from the bacteria-containing fungal tissues were

further screened for the presence of plasmids using the trfA2 or repA based PCR systems and

plasmid extractions.

Detection of different replicons and quantification of trfA2 and repA gene homologs in

mycosphere and bulk soil DNA

No signals were obtained with the IncN, IncW and IncA/C specific replicon typing

systems applied to any of the 2012 mycosphere and bulk soil DNAs, whereas the positive

controls yielded the expected signals (data not shown). Hence, we concluded that the levels of

these plasmids, if present at all, were low, i.e. below the detection limit of the direct molecular

assessment, across all samples. Application of the trfA2 (IncP-1β) and repA (PromA group)

specific PCRs to mycosphere and bulk soil DNAs revealed that all Russula, Ampulloclitocybe,

Galerina and Inocybe samples were positive for trfA2, whereas wood and bulk soil DNA did

not yield amplicons in any of the amplifications. Moreover, PromA type plasmids were

indicated to be present across all mycospheres of the Russula, Ampulloclitocybe, Galerina and

Inocybe like fungi, as well as the wood and bulk soil DNAs, as evidenced by the positive

signals shown in the repA PCR.

Plasmids provide gene transfer capacity in the mycosphere

122

6

Quantitative PCR based on the trfA2 gene showed that the copy numbers of this gene

were generally low across all samples (Fig. 2A), i.e. between the detection limit to up to the

order 103 per g dry soil. Remarkably, these numbers were significantly higher in the

mycosphere soils of Russula, Ampulloclitocybe and Inocybe than in the corresponding bulk

soils (F=12.20; P<0.05). The relative abundance of trfA2 in the Inocybe mycosphere soil was

the highest among all the samples (Fig. 2C). This was followed by the Russula and

Ampulloclitocybe mycospheres. On the other hand, the qPCR performed for PromA group

plasmids (proxy: repA) revealed a different picture (Fig. 2B, 2C). Overall, the repA copy

numbers per g dry soil were rather elevated, i.e. in the range of 105 per g, however no

difference was observed, at any time, between the repA levels in the bulk and mycosphere

soils (P>0.05).

The prevalences of IncP-1β and PromA plasmids in the 2013 Russula mycosphere and

corresponding bulk soil samples were then examined. Q-PCR on the basis of the trfA2 gene

showed that the copy number of this gene was again low (around 102 per g dry soil), but it

was several-fold elevated in the mycosphere as compared with that in corresponding bulk soil.

Again, the qPCR of the repA gene revealed copy numbers per g dry soil in the range 104-10

5

per g, with no differences between bulk and Russula mycosphere soils (P>0.05) (data not

shown).

Plasmids provide gene transfer capacity in the mycosphere

123

6

Fig. 2 Quantification of IncP-1β and PromA group plasmids in Russula, Ampulloclitocybe, Inocybe and Galerina

mycospheres, bulk soils and wood, using trfA2 as a proxy for IncP-1β (A) and repA as a proxy for PromA (B).

Both quantifications were also normalized over the bacterial 16S rRNA gene abundances (C). Error bars:

standard errors of the means. Similar letters above bars indicate similar statistical classes (P>0.05). *Means

below detection, plotted at 50 % of LDL (lower detection limit).

A. trfA2 gene copy numbers per gram dry soil. Read left part separate from right part, as basis of units is

different.

B. repA gene copy numbers per gram dry soil. Read left part separate from right part, as basis of units is

different.

Plasmids provide gene transfer capacity in the mycosphere

124

6

C. Relative abundances of trfA2 and repA genes in mycosphere, corresponding bulk soils and wood. Left and

right parts are comparable

Plasmids from mycosphere, bulk soil and fungal tissue isolates

None of the examined colonies (n=150) from the mycosphere or bulk soils or the

fungal tissues yielded any positive signal with the trfA2 primers, as evidenced via gel

electrophoresis of the amplification mixes. In addition, the majority of the colonies (111/120

and 30/30) were also negative for the PromA PCR system. However, the remainder (9/120) of

the mycosphere and bulk soil/wood extracted colonies showed evidence for the presence of

homologs of the repA gene. Specifically, two isolates (KX043, KX046) from Inocybe, two

(KX063, KX074) from Galerina, three from wood (KX089, KX090, KX100) and two from

bulk soil (KX111, KX113) revealed such signals (see supplementary Table 1). The presence

of intermediate-sized (40-60 kb) plasmids in these strains was confirmed by plasmid

extraction followed by gel electrophoresis. Moreover, plasmid extracts of these strains used as

template DNA also yielded positive signals with the repA gene primer system.

To assess their transfer and mobilization capacities, the nine strains containing

putative PromA group plasmids were used as donors in triparental matings with the E. coli

(pSUP104) helper and P. fluorescens R2f Rpr recipient strains. In two of these transfers (i.e.

those with KX043 and KX113 as mobilizer strains), pSUP104 mobilization and co-transfer of

a 40-50 kb plasmid to the recipient strain could be confirmed.

Exogenous isolation of mobilizer plasmids from mycosphere and bulk soils

Overall, exogenous isolation of mobilizer plasmids by triparental matings met with

different degrees of success. The transconjugation frequencies of the matings performed with

the 2012 samples are shown in Fig. 3. Using the bacterial communities obtained from the

respective mycosphere soils, frequencies ranging from 10-8

to 10-6

per recipient were found.

In contrast, transfers were below detection when bacterial communities from corresponding

bulk soil samples were used. The communities obtained from the Inocybe mycosphere soil

showed the highest transconjugation frequencies, followed by those from the Russula and

Ampulloclitocybe mycosphere soils. The Galerina and wood samples displayed no differences

in transconjugation frequencies (P>0.05), which ranged from 10-10

to 10-8

per recipient.

Expectedly, the overall statistical analyses using log-transformed frequencies revealed that the

Plasmids provide gene transfer capacity in the mycosphere

125

6

transfer frequencies with bacterial communities from the Russula, Ampulloclitocybe and

Inocybe mycospheres were significantly higher than with those from the corresponding bulk

soils (P<0.05). In the comparison between Galerina and wood extracted communities, no

significant differences were observed in the exogenous isolation frequencies (P>0.05).

Fig. 3 Frequencies of exogenous isolations across mycosphere and bulk soils. The log-transformed frequencies

for mycosphere and bulk soil samples are shown. No transconjugants were found in matings with bulk soil

communities, and hence a value half the lower detection limit (LDL) is indicated.

Error bars: standard errors of the means. Similar letters above bars indicate no significant differences (P>0.05),

different letters above bars indicate significant differences (P<0.05).

*Means below detection, plotted at 50 % of LDL

Exogenous isolation of plasmids from the communities of the Russula mycosphere

soil versus bulk soil sampled in 2013 yielded transconjugation frequencies with the

mycosphere bacterial communities of roughly 10-7

per recipient on average, whereas the

corresponding bulk soil communities again did not reveal transfer capacity (data not shown).

The exogenous isolations performed with the 2012 samples yielded totals of 251

transconjugant colonies obtained from mycosphere soils (about 50 colonies, on average, per

mycosphere) and wood (7 colonies on average). Furthermore, from the 2013 samples, totals

of 53 transconjugants were picked and added to the grand total (n=304) for determining the

presence of plasmids.

Plasmids provide gene transfer capacity in the mycosphere

126

6

Characterization of plasmids using colony PCR

Using all selected transconjugant colonies as sources of template DNA, different PCR-

based replicon typing systems were applied (Materials and methods). The results revealed that

there was no amplification with any of the samples offered as template DNA when using the

IncN, IncW or IncA/C primers (data not shown). However, several of the transconjugants did

produce signals with the IncP-1 and PromA specific primers, thus indicating that IncP-1and

PromA type plasmids had been captured by exogenous isolation.

We then selected all presumptive plasmid-containing transconjugants for plasmid

extractions, followed by further analyses. This resulted in a total of 72 strains, obtained from

all samples, from which plasmids were extracted. After comparison of the resulting agarose

gels, 65 of the 72 strains revealed the clear presence of plasmid bands, with diverse sizes,

ranging from roughly 30 to <100 kb (see supplementary Table 1). On the basis of the

estimated plasmid sizes and origins (mushrooms), the plasmids of nine plasmid-positive

strains were selected for further study (Table 2; plasmids named after their strain). Among

these, pTJ121, pTJ123 and pTJ225 are presumed IncP1 plasmids, pTJ110, pTJ139 and

pTJ143 presumed PromA plasmids (as evidenced on the basis of their positive signals with

the repA and virD4 PCR systems), whereas pTJ054, pTJ092 and pTJ098 have uncertain

affiliation. See Table 2.

Table 2. Replicon typing of selected transconjugants

Mushroom Strain

Code

Plasmid

Code Plasmid band* trfA2** trfA1 korA mob virD4 repA

Inocybe 1 TJ121 pTJ121 Big + - - + - -

Inocybe 1 TJ123 pTJ123 Big + - - + - -

Galerina 1 TJ225 pTJ225 Big + - - + - -

Inocybe 2 TJ110 pTJ110 Medium - - - - + -

Inocybe 2 TJ139 pTJ139 Medium - - - - + -

Inocybe 2 TJ143 pTJ143 Medium - - - - + -

Russula 3 TJ054 pTJ054 Small+medium + - - + - -

Ampulloclitocybe 2 TJ092 pTJ092 Small+medium + - - + - -

Ampulloclitocybe 2 TJ098 pTJ098 Small+medium+big + - - + - -

Plasmids provide gene transfer capacity in the mycosphere

127

6

* Plasmid band sizes: Big refers to estimated sizes >60kb; Medium refers to sizes between 40-45kb; Small refers

to sizes <30kb.

**trfA2:IncP-1β, expected size:241bp; trfA1:IncP-1α, expected size:889bp; korA: IncP-1β, expected size:294bp;

mob: IncP-1, expected size 180bp ; virD4: PromA, expected size 224bp; repA: PromA, expected size 452bp

+: clear band of expected size detected; -: no band detected.

Discussion

In the mycosphere, organic compounds that are released by fungal species stimulate

the growth of heterotrophic soil bacteria (Warmink and Elsas, 2008). This process can

selectively activate particular bacteria, stimulating organism-organism interactions. Moreover,

the formation of fruiting bodies by soil fungi can modulate the conditions in the soil

microhabitat, which enhances the ecological opportunities for local bacterial inhabitants. Thus,

the mycosphere might be considered to represent a hot spot for bacterial activities, including

HGT (Zhang et al., 2014). It is tempting to speculate that locally-selective genes may be

swapped across the activated microbial communities, potentially enhancing the adaptive

capabilities of recipient bacteria in the mycosphere. Plasmids, especially BHR ones, confer

fantastic genetic flexibilities to such bacterial communities and may thus constitute prime

vectors in such transfers. Heuer and Smalla (2012) recently addressed the importance of

plasmids in the soil environment, in particular in the context of contaminated soil or manure.

However, with the exception of a study on the role of plasmids in the mycosphere for local

Variovorax populations (Boersma, 2009), so far plasmids in the mycosphere and their

putative roles as accelerators of local adaptive processes have been rather neglected. In this

study, we sampled the mycospheres of four different mushrooms that emerged in autumn of

2012 in a forest area in Noordlaren, the Netherlands, and repeated this for one mushroom type

in 2013. Bacterial communities were obtained from these mycosphere and bulk soil samples,

and this was followed by detection and quantification of plasmids from mycosphere and bulk

soil DNA. Furthermore, exogenous isolation of mobilizer plasmids, i.e. plasmids with the

capacity to incite the movement of the IncQ tracer plasmid pSUP104 from an E. coli helper to

a P. fluorescens recipient strain, was performed, in order to obtain a representation of the thus

defined mobilome from the samples under study.

We found clear increases of bacterial abundances in most mycosphere environments

(except Galerina), as evidenced from both 16S rRNA gene quantifications and CFU counts.

Specifically, the bacterial CFU count data provided strong support for the contention that

Plasmids provide gene transfer capacity in the mycosphere

128

6

effects from host fungi in the mycospheres promote the culturability of bacterial communities.

It should be noted that an exception was formed by the mycosphere of the Galerina sp., which

revealed a culturable bacterial community size below that of the corresponding wood (as well

as the bulk soil). The number of culturable bacteria assessed from the wood mycosphere was

in accordance with that in the literature (Valaskova et al., 2009). It has been shown that fungi

colonizing beech wood blocks can have strong bactericidal effects, thus decreasing the

bacterial abundance on wood (Folman et al., 2008). This bactericidal effect could therefore

explain the observed decrease in culturable bacteria at the Galerina sp. Thus, with one

exception, the fungi sampled did, by virtue of their modulation of mycosphere conditions,

provide the local bacteria with the opportunity to increase in numbers.

The initial screenings of the cultured bacterial communities obtained from all

mycosphere, wood and bulk soil samples revealed that IncP-1 plasmids were not prevalent, i.e.

(considering the number of colonies screened) these might occur below roughly 10-15% of

the total cultured bacteria. Indeed, the subsequent PCR-based detections with the extracted

DNAs showed a low-level presence of IncP-1β plasmids in communities from the

Ampulloclitocybe, Galerina, Russula and Inocybe mycospheres, but not in those from bulk

soil. The abundance of trfA2 in Inocybe mycosphere communities was the highest among all

mycosphere samples (followed by Russula and Ampulloclitocybe mycospheres), which may

indicate the potential occurrence of stronger selective pressure for particular IncP-1β plasmids

in the former mycosphere. In this line, if bearing plasmids imposes a metabolic cost for

bacterial hosts, such hosts may be eventually lost from the community by the energy-

economy rules of community dynamics (Bergstrom et al., 2000), and so the elevated

prevalence of IncP-1β plasmids in some mycospheres might relate to potentially important

selective advantages offered to the hosts in these environments (Heuer and Smalla, 2012).

Sarand et al. (1998) hinted at such a function, as they showed that Pseudomonas fluorescens

obtained from a mycorrhizosphere contained plasmid-encoded xylE and xylMA genes, which

function in monoaromatics degradation.

In contrast with the IncP-1β plasmids, clear evidence was obtained for the presence of

PromA plasmids in the mycosphere, bulk soil and even wood samples. First, we did find

evidence for the presence of several plasmids of this group across the randomly- isolated

strains from these habitats, indicating a relatively high incidence (~ 10-25% positives among

all randomly selected isolates) of these in the cultured communities. Consistent with this

finding was the fact that the abundances of repA gene copies were also high, revealing no

Plasmids provide gene transfer capacity in the mycosphere

129

6

differences between mycosphere and wood and bulk soil samples. Thus, PromA group

plasmids apparently prevail across the Russula, Ampulloclitocybe, Galerina and Inocybe

mycosphere soils, as compared with plasmids of the IncP-1β group. However, the PromA

plasmids did occur, to a rather similar extent, across the bacterial populations in the

Noordlaren forest soil, irrespective whether these reside in mycospheres below fungal fruiting

bodies, mushroom-supporting (decaying) wood or bulk soil (litter). As we still do not know

their preferred or canonical host, the PromA plasmids can be considered to represent a

relatively abundant and widespread pool of vectors that confer the standing potential of

genetic variation in the forest soil. This provides support for the contention that this class of

plasmid may have a key role in HGT-driven adaptive processes in the studied mycospheres,

however without being specifically selected by the local soil fungi. On the other hand, we also

found “transfer-negative” plasmids of the PromA group. The lack of transfer of these

plasmids may be due to the repression or lack of essential genes involved in either transfer

and/or replication in a novel host or stabilization and maintenance once inside the novel host.

Our exogenous isolation experiments using the IncQ tracer plasmid pSUP104 yielded

revealing results. The bacterial communities from the Russula, Ampulloclitocybe and Inocybe

mycospheres incited similar (elevated) transconjugation frequencies, indicating the presence

of a fairly similar number of actively mobilizing plasmids throughout these mycospheres.

Comparison of these results with those of bulk soil communities (where transfer of plasmids

was below the detection limit) indicated clear selection for mobilizing plasmids across the

mycosphere communities. One may argue that the difference in mobilization rates between

mycosphere and bulk soils was due to the different densities and activities of potential donor

cells during cell recovery and triparental mating incubation phases. Whereas this is probably

very true, the data also appear to indicate the ‘tip-of-the-iceberg’ of plasmid mobilization

potential, that is, the potential for plasmid spread within the different communities when

confronted with conditions that are conducive to transfers such as those established by the

tight coexistence of cells on the plates used. There are quite obvious limitations and

constraints in the exogenous isolation approach used by us, such as the conceptual dichotomy

between the clonal outgrowth of just one major plasmid donor versus the activation of a suite

of donors, and the potential incompatibilities between donor, plasmid and recipient cell in

terms of the plasmid transfer and replication systems, among others. However, the current

approach and its findings represent key steps forward in our quest to increasingly dissect the

horizontal gene transfer and selective processes that take place in the mycosphere. From the

Plasmids provide gene transfer capacity in the mycosphere

130

6

data, one may indeed hypothesize that plasmids are indicated to play important roles in

adaptive processes in the mycosphere, given their ability to confer an easily accessible form

of adaptive power for bacteria living in close contact with fungal hyphae.

Taking the evidence together, the two plasmid classes, IncP-1β and PromA, may be

thought of as playing fundamentally different roles in the adaptation of bacteria in the

mycosphere. First, plasmids of the IncP-1β group might be selected and play key roles in

several bacterial species. This may be due to the accessory genes that are often carried by

such plasmids, which may allow different bacteria to adapt to different ecological conditions

in mycosphere. Second, plasmids of the PromA group stand out by their capacities to

mobilize as well as retro-mobilize other plasmids, thus conferring genetic flexibility to

bacterial communities by HGT rather than by serving as accumulators of accessory genes

(van Elsas et al., 1998). However, we are still at the beginning of this work. Clearly, assessing

the sequences of a larger range of PromA plasmids than the ones studied so far, as well as

addressing their effects on bacterial fitness under diverse conditions might shed more light on

this perspective.

Acknowledgements

We thank the CSC funding agency of China for providing support to Miaozhi Zhang.

We also thank Jan Warmink, Kexin Zhang and Aron te Winkel for their assistance in the lab.

References

Alvarado A, Garcillán-Barcia MP, de la Cruz F (2012) A degenerate primer MOB typing

(DPMT) method to classify Gamma-proteobacterial plasmids in clinical and

environmental settings. PLoS ONE 7(7): e40438.

Atkinson GF (1918) Some new species of Inocybe. American Journal of Botany 5(4): 210–

218.

Bach HJ et al (2002) Enumeration of total bacteria and bacteria with genes for proteolytic

activity in pure cultures and in environmental samples by quantitative PCR mediated

amplification. J Microbiol Meth 49:235-245.

Bale MJ et al (1988) Novel method for studying plasmid transfer in undisturbed river

epilithon. Appl Environ Microbiol 54(11):2756-2758.

Plasmids provide gene transfer capacity in the mycosphere

131

6

Bergstrom CT, Llipsitch M, Levin BR (2000) National selection, infectious transfer and the

existence conditions for bacterial plasmids. Genetics 155:1505-1519.

Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant

plasmid DNA. Nucleic Acids Res 7: 1513-1523.

Boersma FGH (2009) Mechanisms of bacterial selection in the mycosphere of

tricholomataceous fungi. PhD Thesis University of Groningen.

Clarke KR, Gorley RN (2006) PRIMER v6: User Manual/Tutorial. PRIMER-E, Plymouth.

Dennis JJ (2005) The evolution of IncP catabolic plasmids. Curr Opin Biotechnol 16:291-298.

Earle FS (1909) The genera of North American gill fungi. Bulletin of the New York Botanical

Garden 5:373-451.

Folman LB et al (2008) Impact of white-rot fungi on numbers and community composition of

bacteria colonizing beech wood from forest soil. FEMS Microbiol Ecol 63:181-191.

Frost LS, Leplae R, Summers AO, Toussaint A (2005) Mobile genetic elements: the agents of

open source evolution. Nat Rev Microbiol 3: 722–732.

Götz A et al (1996) Detection and characterization of broad-host-range plasmids in

environmental bacteria by PCR. Appl Environ Microb 62(7): 2621-2628.

Hammer Ø, Harper DAT, Ryan PD (2001) PAST: Paleontological statistics software package

for education and data analysis. Palaeontologia Electronica 4: 9.

Heuer H, Smalla K (2012) Plasmids foster diversification and adaptation of bacterial

populations in soil. FEMS Microbiol Rev 36(6): 1083–1104.

Mela F et al (2008) Comparative genomics of the pIPO2/pSB102 family of environmental

plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas

fungivorans Ter331. FEMS Microbiol Ecol 66: 45-62.

Melzer, Zvára (1927) Russula exalbicans (Pers.) Arch Prírodov Výzk Cech 17(4):97.

Redhead SA, Lutzoni F, Moncalvo JM, Vilgalys R (2002) Phylogeny of agarics: partial

systematics solutions for core omphalinoid genera in the Agaricales (euagarics).

Mycotaxon 83:19-57.

Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor

Laboratory Press, New York.

Sarand I, Timonen S, Nurmiaho-Lassila E-L, Koivula T, Haahtela K, Romantschuk M, Sen R

(1998) Microbial biofilms and catabolic plasmid harbouring degradative fluorescent

pseudomonads in Scots pine mycorrhizospheres developed on petroleum contaminated

soil. FEMS Microbiol. Ecol 27:115–126.

Schlüter A, Szczepanowski R, Pühler A, Top EM (2007) Genomics of IncP-1 antibiotic

resistance plasmids isolated from wastewater treatment plants provides evidence for a

widely accessible drug resistance gene pool. FEMS Microbiol Rev 31:449–477.

Plasmids provide gene transfer capacity in the mycosphere

132

6

Smalla K, Heuer H, Götz A, Niemeyer D, Krögerrecklenfort E, Tietze E (2000) Exogenous

isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high

prevalence and diversity of IncQ-like plasmids. Appl Environ Microbiol 66: 4854–

4862.

Smit E et al (1999) Analysis of fungal diversity in the wheat rhizosphere by sequencing of

cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel

electrophoresis. Appl Environ Microbiol 65(6): 2612-2621.

Sota M, Top EM (2008) Horizontal gene transfer mediated by plasmids. In: Lipps, G. (Ed.),

Plasmids: Current Research and Future Trends. Caister Academic Press, Norfolk, UK,

pp. 111–181.

Tauch A, Schneiker S, Selbitschka W, Puhler A, Van Overbeek LS, Smalla K (2002) The

complete nucleotide sequence and environmental distribution of the cryptic,

conjugative, broad-host-range plasmid pIPO2 isolated from bacteria of the wheat

rhizosphere. Microbiol 148:1637-1653.

Thomas CM (2000) The horizontal gene pool: Bacterial plasmids and gene spread.

Amsterdam: Harwood Academic Publishers.

Valášková V et al (2009) Phylogenetic composition and properties of bacteria coexisting with

the fungus Hypholoma fasciculare in decaying wood. ISME J 3:1218-1221.

van der Auwera GA et al (2009) Plasmids captured in C. metallidurans CH34: defining the

PromA family of broad-host-range plasmids. Antonie van Leeuwenhoek 96:193-204.

van Elsas JD, Gardener BBM, Wolters AC, Smit E (1998) Isolation, characterization, and

transfer of cryptic genemobilizing plasmids in the wheat rhizosphere. Appl Environ

Microbiol 64: 880–889.

van Elsas JD, Turner S, Bailey MJ (2003) Horizontal gene transfer in the phytosphere. New

Phytol 157: 525–537.

Versalovic J, Schneider M, Bruijn de FJ, Lupski JR (1994) Genomic fingerprinting of bacteria

using repetitive sequence-based polymerase chain reaction. Methods Mol Cell Biol

5:25-40.

Warmink JA, van Elsas JD (2008) Selection of bacterial populations in the mycosphere of

Laccaria proxima: is type III secretion involved? ISME J 2:887–900.

Warmink JA, Nazir R, van Elsas JD (2009) Universal and species-specific bacterial

‘fungiphiles’ in the mycospheres of different basidiomycetous fungi. Environ

Microbiol 11: 300–312.

Zhang M, Pereira e Silva MC, Chaib de Mares M, van Elsas JD. 2014. The mycosphere

constitutes an arena for horizontal gene transfer with strong evolutionary implications

for bacterial-fungal interactions. FEMS Microbiol Ecol 89:816-826.