Unraveling Low-Level Gamma Radiation–Responsive Changes in Expression of Early and Late Genes in Leaves of Rice Seedlings at litate Village, Fukushima

8/11/2019 Unraveling Low-Level Gamma RadiationResponsive Changes in Expression of Early and Late Genes in Leaves of

1/16

The American Genetic Association 2014. All rights reserved.For permissions, please e-mail: [email protected]

723

Unraveling Low-Level GammaRadiationResponsive Changes in

Expression of Early and Late Genesin Leaves of Rice Seedlings at litateVillage, FukushimaGOHEIHAYASHI, JUNKOSHIBATO, TETSUJIIMANAKA, KYOUNGWONCHO, AKIHIROKUBO, SHOSHIKIKUCHI,

KOUJISATOH, SHINZOKIMURA, SHOJIOZAWA, SATOSHIFUKUTANI, SATORUENDO, KATSUKIICHIKAWA,

GANESHKUMARAGRAWAL, SEIJISHIODA, MANABUFUKUMOTO, ANDRANDEEPRAKWAL

From the Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan (Hayashi and Fukumoto); ResearchReactor Institute, Kyoto University, Osaka, Japan (Hayashi, Imanaka, and Fukutani); the Department of Anatomy I, School of

Medicine, Showa University, Shinagawa, Tokyo, Japan (Shibato, Shioda, and Rakwal); the Laboratory of Exercise Biochemistry

& Neuroendocrinology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Japan

(Shibato); the Seoul Center, Korea Basic Science Institute (KBSI), Seoul, South Korea (Cho); the Environmental Stress

Mechanisms Section, Center for Environmental Biology and Ecosystem Studies, National Institute for Environmental

Studies, Tsukuba, Ibaraki, Japan (Kubo); the Plant Genome Research Unit, Agrogenomics Research Center, National

Institute of Agrobiological Sciences (NIAS), Tsukuba, Ibaraki, Japan (Kikuchi and Satoh); the Laboratory of International

Epidemiology, Center for International Cooperation, Dokkyo Medical University, Tochigi, Japan (Kimura); 913727 Kusabana,

Akiruno, Tokyo, Japan (Ozawa); the Quantam Energy Applications, Graduate School of Engineering, Hiroshima University,

Higashi-Hiroshima, Japan (Endo); the Office Brain, Tama Tsurumaki, Tokyo, Japan (Ichikawa); the Research Laborator y

for Biotechnology and Biochemistry (RLABB), Kathmandu, Nepal (Agrawal and Rakwal); the GRADE Academy Private

Limited, Birgunj, Nepal (Agrawal and Rakwal); and the Organization for Educational Initiatives, University of Tsukuba, 1-1-1

Tennoudai, Tsukuba, Ibaraki 3058577, Japan (Rakwal).

Address correspondence to Randeep Rakwal at the address above, or e-mail: [email protected].

Abstract

In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we

examined the effects of gamma radiation on rice at a highly contaminated eld of Iitate village in Fukushima, Japan. Weinvestigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gammaradiation up to 4 Sv h1, about 80 times higher than natural background level. After exposure to gamma rays, expressionproles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions

were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6,

12, 24, 48, and 72 h). For example, OsPCNAmRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells respondedto radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoidpathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We nextproled the transcriptome using a customized rice whole-genome 4 44K DNA microarray at early (6 h) and late (72 h) timeperiods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulatedgene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma

ray exposure. An inventory of a large number of gamma radiationresponsive genes provides new information on novelregulatory processes in rice.

Subject areas: Genomics and gene mapping

Key words: DNA repair, gamma radiation, Oryza sativa, OsPCNA, seedling leaf, stress response

Journal of Heredity 2014:105(5):723738doi:10.1093/jhered/esu025
mailto:[email protected]?subject=mailto:[email protected]?subject=


2/16

Journal of Heredity

724

Living organisms are affected by numerous environmen-tal factors related with normal growth and development.Radiation, in particular radioactive contaminationbothexternal and internal, is a stress factor that is highly damagingto life on this planet (Bertell 1985). Radiation has the capacityto severely affect growth and development of cells, tissues/organs, and organisms, although much of the current focus ison mammalian models for obvious reasons of anxiety relatedto the effects of radiation on humans (Smirnova 2010). Whatis the effect of radiation on plants was the question that thisresearch by Rakwal and Agrawal sought to address in the year2003. Our first study on the effects of ultralow-level dose ofgamma radiation (Kimura et al. 2008) examined specificallythe morphological and molecular genetic levels in the cerealcrop/grass model rice, Oryza sativaL., using the japonica cul-tivar Nipponbarea model genome (Goff et al. 2002; Yuet al. 2002; Kikuchi et al. 2003; Kikuchi 2008; InternationalRice Genome Sequencing Project 2005;Agrawal and Rakwal2006, 2011). To remind the readers, rice is the crop that feedsthe world, and rice is life (2004 was the International Year ofRice, http://www.fao.org/rice2004/index_en.htm; http://

www.fao.org/rice2004/en/concept.htm). Considering theabove characteristics of rice plant biology and a move towardunderstanding rice as a whole, the rice species has become a

model on par with the human/mammalian models to studyenvironmental stress, including the effects of radiation.

How does gamma radiation affect rice or how do rice

plants respond to the environment with abnormal radiation?Our first 2 studies (Kimura et al. 2008; Rakwal et al. 2009)used ultralow-dose gamma radiation exposure on leaves ofrice seedlings, for which the 2-week-old rice seedling modelsystem was established to demonstrate the stress responses atthe molecular level (Jwa et al. 2006). Initial studies examined

the effects of external radiation exposure on rice plants, in par-ticular on cut leaf segments, for a short period of 72 h. In thefirst study, early genome-wide transcriptional profiling data inrice leaf segments exposed to gamma radiation (5.34 Gy/day; 10.90-fold relative to natural background control level)emitted from contaminated soil sample (Masany, 10 km fromthe Chernobyl nuclear reactor) revealed 516 differentiallyexpressed genes that were categorized into the following 3main functions: Information storage and processing, cellularprocesses and signaling, and metabolism (Kimura et al. 2008).The second study was built up on the incredulous claim of

the first study (Kimura et al. 2008) that ultralow-level gammaradiation affects rice self-defense mechanisms and repli-

cated the experiment using an in-lab fabricated gamma ray137Cs source at 6 dose rates (13 1, 25 2, 45 2, 110 10,190 10, and 380 20 Gy/3 days) on leaves of rice seed-lings (Rakwal et al. 2009). The results arising from the useof both naturally emitting and in-lab fabricated gamma raysources provided the first evidence for ultralow-level gammaradiation triggering changes at the molecular level in the mul-tilayered defense/stress-related biological processes in riceleaves, laying the foundation for future studies. Meanwhile,our group has carried out additional research using whole

plants exposed to high-dose ionizing radiation, such as car-bon ion beams (Rakwal et al. 2008), gamma rays, and X-rays

(Rakwal R, unpublished data). These data are yet to be pub-lished, but they indicate a wide-ranging response (related todefense/stress) at the level of the genome in rice leaves afterexposure to high-dose radiation.

The events following the 11 March 2011 nuclearaccident at the Fukushima Daiichi Nuclear Power Plant(FDNPP) after the Great Tohoku Earthquake unexpect-edly provided an opportunity to initiate a new researchproject with fellow physicists/radiation experts at thehighly contaminated fields in Iitate village of FukushimaPrefecture, Japan (Imanaka et al. 2012). The highly con-taminated Iitate Farm (ITF), which is located 31 km fromthe damaged nuclear power plant and has a field radia-tion level more than 100 times (~5 Sv/h) higher than thenatural background level, was the designated place for thereexamination of low-level gamma radiation experimentsusing rice as a model system (Figure 1). Because our grouphad a decade of experience, in addition to data on the

effects of gamma radiation on leaf segments (Kimura et al.2008; Rakwal et al. 2009), the experiment was designed insuch a way as to expose whole rice plants to gamma radia-tion being emitted from the contaminated ground andexamine the morphological and molecular genetic changesin the leaves after growth under varying radiation doses.

The experiment was performed 3 times in July, August,and September 2012. Results presented here provided thefirst support to our previous research conducted in thelaboratory using cut rice leaf segments (in vitro experi-ment), which revealed gamma radiationinduced self-defense response. Second, the current research providednew details on the genomewide response of rice plants to

low-level gamma radiation in a radioactively contaminatedfield environment. This is the first article in a series of

research reports that will examine, present, and discusshow rice plants behave in response to low-level gammaradiation directly in the field.

Materials and Methods

Rice Seedling Growth and ITF

Japonica type rice (Oryza sativa L.) cv. Nipponbare wasused as the test material. The seeds were received fromthe National Institute for Environmental Studies (NIES),

Tsukuba, Japan. Rice seedlings were grown in the green-house facility at NIES (Supplementary Figure 1). Briefly,

the healthy seeds of cv. Nipponbare were allowed to imbibewater for 12 days under darkness at 30 C and allowed togerminate. Similarly germinated seeds were placed in neatrows in seedling pots (4 rows per pot having 1012 seedseach) having commercial soil (nursery soil for rice seedlinggrowth and transplantation, purchased from JA Zen-Noh,

Japan; https://www.zennoh.or.jp/) with recommendedNPK (nitrogen, phosphorus, and potassium) doses in acontrolled (25 C, 70% relative humidity, and natural lightconditions) greenhouse at NIES, Tsukuba, Japan during July,

August, and September 2012. At the age of 14 days (fromstart of germination protocol), healthy rice seedlings were
http://www.fao.org/rice2004/index_en.htmhttp://www.fao.org/rice2004/en/concept.htmhttp://www.fao.org/rice2004/en/concept.htmhttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://www.fao.org/rice2004/en/concept.htmhttp://www.fao.org/rice2004/en/concept.htmhttp://www.fao.org/rice2004/index_en.htm


3/16

Hayashi et al. Low-Level Gamma RadiationTriggered Rice Gene Expression

725

transported to designated experimental sites at ITF (Iitatevillage, Fukushima, Japan) for initiating the experiment. Toknow the radiation levels during growth and transport ofthe rice to ITF, accumulated radiation dose was calculatedusing a MYDOSE mini electronic pocket dosimeter (modelPDM-22252, ALOKA, Japan) (Supplementary Figure 1).

To observe the gene expression level in leaves of seedlingsafter reaching ITF, leaves were sampled at 05.00 AM (calledthe 0-h NIES sample), the time just before departure toIitate village. The rice leaves were also sampled on reachingITF (09:40 AM); this sample was called the 0-h ITF sampleand marked the start of gamma radiation exposure). In thisstudy, the results of the experiment performed in July 2012are presented and discussed.

Plot Design, Gamma Radiation Exposure, and Sampling

The plot design is schematically presented in Figure 2. At theITF, a leveled ground was overlaid with a blue tarpaulin sheetin the designated area that had an average contamination level(ground 137Cs) of 700 kBq/m2 (Supplementary Figure 2)and that emitted a constant radiation dose of ~5 Sv/h. This

area was defined as a low-level gamma field. As shown inFigure 2A,B, the 3 cylindrical boxes were placed at a distanceof 2 m apart and were shielded with a recently fabricated

shielding material (Nihon Matai Co., Ltd., Moriyama, Shiga,Japan; http://www.matai.co.jp/r02_factory/s_sheet.html) tocontrol the amount of radiation reaching the target in thetarget area, namely, rice seedlings at the center of the box.The effect of the shielding material around and below theboxes 1 (double shield, ~1.6 Sv/h: low dose) and 2 (singleshield, ~2.6 Sv/h: middle dose) can be seen by the amountof gamma ray dose reaching inside (Figure 2C). Box number3 was not shielded and served as the high-dose (~4.2 Sv/h)

condition. The rice plants in the 3 cases of exposures wereplaced in the center of each box, and the gamma ray dose was

recorded by 2 MYDOSE mini electronic pocket dosimetersplaced near the 3rd fully formed leaf. Gamma ray exposuretimes were set at 6, 12, 24, 48, and 72 h after arrival at ITF,and the rice leaves at the 3rd position (from the base) from 6to 10 seedlings were sampled, by cutting the 3rd fully formedleaf at the base of attachment to the sheath, for each dose

(low, middle, and high). Postcutting, the leaves were placedin an aluminum foil under dry ice and immediately storedin dry ice packs in the deep freezer (30 C). Photographsof the leaves were taken by a digital camera (Coolpix S9100,Nikon, Tokyo, Japan). As a control, rice leaves were sampledin Tsukuba (NIES) and immediately after arrival at ITF; asample set was also taken at 72 h from healthy rice seedlings

in the greenhouse in NIES. Samples were taken back to thelaboratory and analyzed.

Grinding of Leaf Samples in Liquid Nitrogen

Prior to the downstream molecular analyses for gene expres-sion changes, rice leaf powders were prepared as described

in the study byAgrawal et al. (2013). Individual leaves takenfrom each seedling under each dose condition were pooledto give a sample for each treatment condition doselow,middle, and high, prior to grinding; to repeat, data presented

below are for pooled samples from the experiment carriedout in July 2012. Rice leaves were ground to a very fine pow-der with a prechilled mortar and pestle in liquid nitrogen

and stored at 80 C until further analysis (SupplementaryFigure 3). The advantage of preparing fine powders is theiruse in extracting total RNA (gene expression analysis), pro-tein, and metabolites from the same sample and in extremelylow amounts (Agrawal et al. 2013).

Figure 1. Iitate village in Fukushima Prefecture, and the location of the Iitate farm (ITF). (A) Part of Fukushima Prefecture isshown. (B) Enlarged view of Iitate village, and contours (Sv/h) of measured radiation dose (each dot represents the point of thesurvey) on 23 March 2012; for details, see Imanaka et al. (2012). The location of ITF is marked by a colored circle.
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://www.matai.co.jp/r02_factory/s_sheet.htmlhttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://www.matai.co.jp/r02_factory/s_sheet.htmlhttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


4/16

Journal of Heredity

726

Total RNA Extraction and Quantity and Quality

Control Analyses

Fine powders were used for extracting total RNA fol-lowing a previously published protocol (Cho et al. 2012).Briefly, the RNeasy Plant Mini Kit (QIAGEN, MD) wasused as per manufacturers instructions. A detailed step-by-step protocol is schematically presented in Supplementary

Figure 4. The quality of RNA, the yield, and its puritywere determined spectrophotometrically (NanoDrop,Wilmington, DE) and were visually confirmed using for-maldehydeagarose gel electrophoresis (SupplementaryFigure 5).

Complementary DNA Synthesis and Reverse

TranscriptionPolymerase Chain Reaction

Prior to the gene expression analyses using reverse transcrip-tionpolymerase chain reaction (RT-PCR) and the DNAmicroarray chip analysis, complementary DNA (cDNA) wassynthesized, and to check the quality of synthesized cDNA,RT-PCR was performed on the beta-actin (AK100267)gene using the following primer pairs: RJSR43 forward, 5CTCCTAGCAGCATGAAGATCAA3; and RJSR44 reverse5ATGATAACAGATAGGCCGGTTG3 (Cho et al.2012; Cho et al. 2013). Total RNA samples were first treated

with RNase-free DNase (Stratagene, Agilent Technologies,

Figure 2. Experimental plot and placement of the shielded boxes containing rice plants. (A) The dimensions of the plot of

land, measured radiation levels, and distances between each shielded box [1, double shield (++); 2, single shield (+); 3, no shield()] that contained the rice seedlings. (B) Enlarged view of a circular box (and its dimensions) showing the placement of the

seedling box within, and the points where each radiation dose was measured. (C) The actual photograph of the experimental plot

showing the 3 circular boxes used in the experiment. (D) The measured radiation dose data in each box (1, 2, and 3) at the bottom(B), center (C), and top (T) as indicated by the crossed lines, and at each direction (South, S; North, N; East, E; and West, W)

including in the center of the box, indicated by black lled circles. Details are mentioned in the text.
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


5/16


727

La Jolla, CA). First-strand cDNA was then synthesized in a20-L reaction mixture with an AffinityScript QPCR cDNASynthesis Kit (Stratagene) according to the protocol providedby the manufacturer using 1 g of total RNA. The reactionconditions were 25 C for 5 min, 42 C for 5 min, 55 C for40 min, and 95 C for 5 min. The synthesized cDNA wasmade up to a volume of 50 L with sterile water supplied inthe kit. The reaction mixture contained 0.6 L of the first-strand cDNA, 7 pmols of each primer set, and 6.0 L of theEmerald Amp PCR Master Mix (2 premix) (TaKaRa Shuzo,Shiga, Japan) in a total volume of 12 L. Thermal cycling(Applied Biosystems, Tokyo, Japan) parameters were as fol-lows: After an initial denaturation at 97 C for 5 min, samples

were subjected to a cycling regime of 2040 cycles at 95 Cfor 45 s, 55 C for 45 s, and 72 C for 1 min. At the end of thefinal cycle, an additional extension step was carried out for10 min at 72 C. After completion of the PCR, the total reac-tion mixture was spun down and mixed (3 L), before beingloaded into the wells of a 1.2/1.8% agarose (Agarose [finepowder] Cat no. 02468-95, Nacalai Tesque, Kyoto, Japan) gel.Electrophoresis was then performed for ~22 min at 100 Vin 1 TAE buffer using a Mupid-ex electrophoresis system(ADVANCE, Tokyo, Japan). The gels were stained (8 L of10 mg/mL ethidium bromide in 200 mL 1 TAE buffer)for ~7 min, and the stained bands were visualized with theChemiDoc XRS+ imaging system (Bio-Rad) (SupplementaryFigure 6). RT-PCR analysis was also carried out on selectedgenes based on previous experiments (Kimura et al. 2008;Rakwal et al. 2008, 2009) and unpublished data (Rakwal R)and are listed inTable 1. Each gene candidate was analyzedby RT-PCR more than once to confirm and reconfirm thedata on expression change, and finally, a representative dataset from each analysis is shown as the relative abundance of

mRNA. Moreover, based on the RT-PCR data, the middledose sample was selected for global gene expression analysis.

Whole-Genome DNA Microarray Analysis and GEOAccession

A rice 4 44K custom (eARRAY, AMAdid-017845) oligo-DNA microarray chip (G2514F, Agilent Technologies, Palo

Alto, CA) was used for genomewide gene profiling of expres-sions of early (6 h) and late (72 h) genes, as described previ-ously (Satoh et al. 2010; Cho et al. 2012, 2013). Total RNA(900 ng) was labeled with either Cy3 or Cy5 using a LowRNA Input Fluorescent Linear Amplification Kit (Agilent).

Fluorescently labeled targets of control (0 h at ITF and atNIES greenhouse, prior to transport to ITF) and treated (riceexposed to gamma rays for 6 and 72 h, middle dose) sam-ples were hybridized to the same microarray slide contain-ing 60-mer probes. Supplementary Figure 7shows the chipdesign used here. A flip-labeling (dye swap or reverse labeling

with Cy3 and Cy5 dyes) procedure was followed in order tonullify the dye bias associated with unequal incorporation of

the 2 Cy dyes into cDNA. To select differentially expressedgenes by the dye-swap approach, we considered genes that

were upregulated in chip 1 (Cy3 and Cy5 label for control andtreatment, respectively) but downregulated in chip 2 (Cy3

and Cy5 label for treatment and control, respectively). Theuse of a dye-swap approach has 2 benefits. First and mostimportantly, it provides a highly stringent selection conditionfor changed gene expression profiling over use of a single/2-color approach (Rosenzweig et al. 2004; Altman 2005).Second, it provides 2 technical chip replicates on the sameslide for 1 sample set (Supplementary Figure 7). Additionally,it avoids the prohibitively high cost of a DNA microarraychip in such an experiment, where statistically significant 78replications using 78 individual chips are impractical.

Hybridization and wash processes were performedaccording to the manufacturers instructions (Agilent), andhybridized microarray slides were scanned using an Agilentmicroarray scanner G2505C. For detection of significantlydifferentially expressed genes between control and treatment,

each slide image was processed by Agilent Feature ExtractionSoftware (version 11.0.1.1). The program measures Cy3 andCy5 signal intensities of whole probes. Dye bias tends to bedependent on signal intensity; therefore, the software selectsprobes using a set by rank consistency filter for dye normali-zation. The said normalization was performed by LOWESS(locally weighted linear regression) that calculates the logratio of dye-normalized Cy3 and Cy5 signals, as well as thefinal error of log ratio. The significance (P) value is basedon the propagated error and universal error models. In thisanalysis, the threshold of significant differentially expressedgenes was < 0.01 (for the confidence that the feature was notdifferentially expressed). In addition, erroneous data gener-ated due to artifacts were eliminated prior to data analysisusing the software. The gamma radiationresponsive up- anddownregulated gene lists (2.0-fold, 0.5-fold) are detailedin Supplementary Tables 1 (6 h up), 2 (6 h down), 3 (72 hdown), 4 (72 h down), 5 (0 h ITF up), 6 (0 h ITF down), 7

(72 h NIES up), and 8 (72 h NIES down).The data discussed in this publication have been depos-ited in NCBIs Gene Expression Omnibus (GEO) and areaccessible through GEO Series accession number GSE53055(http://www.ncbi.nlm.nih.gov/geo/info/linking.html).

Functional Classification of DifferentiallyExpressed Genes

Due to the large number of differentially expressed genes,we further selected the highly up- and downregulated genesbased on simple criteria highlighting those genes that were

only differentially expressed after exposure to gamma radia-

tion (middle dose) at ITF for 6 and 72 h. This implies thatthose genes that were expressed between the time period of5 AM (NIES 0-h greenhouse sample) to 10 AM (ITF 0-hsample) and after 3 days (NIES 72-h greenhouse sample),that is, time- and growth-dependent gene expressions, weresubtracted from the total number of genes up- and down-regulated using data from chips 1 and 2 (SupplementaryFigure 8). These genes are listed in Supplementary Tables 9(highly up at 6 h), 10(up at 6 h), 11(highly down at 6 h), 12(down at 6 h),13(highly up at 72 h), 14(up at 72 h), 15(highlydown at 72 h), and 16 (down at 72 h). The nonredundantgamma radiationhighly responsive up- and down-regulated
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://www.ncbi.nlm.nih.gov/geo/info/linking.htmlhttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://www.ncbi.nlm.nih.gov/geo/info/linking.htmlhttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


6/16


7/16


729

genes listed in Supplementary Tables 9, 11, 13, and 15werefurther considered candidate genes for specific bioinformat-ics analysis using the MapMan program, version 3.1.1, at theMax Plant Institute of Molecular Plant Physiology, Germany(Thimm et al. 2004; Usadel et al. 2009). Gene expression fold

values were transformed to Log2(fold), and then their meanswere calculated. These nonredundant genes were classifiedinto MapMan BINs, and their annotated functions were

visualized using the MapMan program, based on a newlyconstructed rice mapping file for all the genes on Agilent4 44K rice DNA chip. The mapping file was establishedby automated searches using the systematic names (as locusidentifiers) of all the genes on the DNA chip released fromthe GeneSpring program (version GX 10, Agilent) and aMapCave tool (http://mapman.gabipd.org/web/guest/mapcave), which is linked with 6 different databases, suchas Arabidopsis thaliana TAIR8, Arabidopsis thaliana TAIR9,Hordeum vulgare, Oryza sativa TIGR5, SwissProt/PPAP, andVitis viniferaGene Index R5.

Results and Discussion

Rationale and Experimental Strategy

On the basis of previously conducted experiments, the effectof ultralow, low, and high doses of ionizing radiation in riceplants was apparent at the morphological and moleculargenetic levels (Kimura et al. 2008; Rakwal et al. 2008, 2009;Rakwal R, unpublished data). In the case of gamma radia-tionour main focusthe effects of ultralow- and low-levelgamma rays were examined in cut leaf segments obtained

from 2-week-old rice seedlings, whereby the experimentcould be considered in vitro, that is, Petri dish experiments.

Considering the fact that it was not feasible to conduct sucha low radiation dose experiment in the laboratory and thisbeing what we wished to examine at the whole plant levelor in vivo, the ill-fated FDNPP accident in March 2011 pro-

vided such an unexpected opportunity. Being able to visit,see, and meet up with physicist colleagues at Iitate village(Fukushima) was a starting point for the ongoing projectunder the Iitate-mura (=village) Society for Radioecology(http://iitate-sora.net/). The experimental site was cho-sen at ITF based on the continuous emission of gammarays (~5 Sv/h; 100 times greater than natural backgroundlevel) from the highly contaminated soil there (Imanakaet al. 2012). The radiation dose was similar to the previously

conducted in-house experiment with fabricated gamma rayemitting sources (Rakwal et al. 2009) and formed the basisfor a 3-dose (~1.5/2.5/4.5 Sv/h) experiment to confirmprevious findings and provide new information on gammaradiationexposed whole rice plants. As diagrammaticallydepicted in Figure 2A, there was no direct contact betweenthe seedlings and the contaminated soil, thus ensuring that

we primarily observed the effects of gamma radiation alone.The 3rd leaf was used as the experimental sample. Eachdoselow, middle, and highwas determined as describedin the Materials and Methods, and the data are graphically

presented in Figure 3 for the months of July, August, and

September 2012. The experimental strategy from the designof the experiment to the sampling, methodology, and analy-ses steps that led to the list of identified gamma radiationresponsive molecular factors is presented in Figure 4.

Selection of July 2012 Experiment for DownstreamAnalysis Based on Climate Parameters and Leaf

MorphologyThree independent experiments were carried out in the

months of July, August, and September 2012. On the basisof the ground (field) conditions of temperature, humidity,light, and rain, along with observations of the leaf mor-phology after 3-day exposure to gamma radiation, the Julyexperiment was selected for further molecular analyses. Theground and interior (boxes containing seedlings) tempera-tures (C), humidity (%), and light intensity (lux) are graphi-cally shown in Supplementary Figure 9for the time periodsof the experiment. In the month of July, the temperaturein Iitate village hovered around 26 C for the month of

July, except for day 1, when the temperature was measuredas being around 33.5 C in the experimental field at ITF.Similar readings were obtained for the temperature insidethe sample boxes. Additionally, the July sky was clear andsunny, and there was no rain. On the other hand, the tem-perature increased to around 40.8 C at the maximum onday 1 and decreased to 31.8 C on day 2 in August, anddue to rain, the boxes were placed under a greenhouse with

only the top cover with open sides. In September, the tem-perature dropped down to around 19 C, and there washeavy rain, resulting in use of an almost fully closed-typegreenhouse during the final 2 days. The humidity also varied

with each month, and compared with the levels in July and

August, the humidity peaked in September due to the use ofthe greenhouse. For light intensity, similar lux readings wereobtained in July and August compared with the relatively lowintensity measured in September. In addition, the optimumtemperature, humidity, and light conditions in the control

greenhouse (NIES, Tsukuba), where a part of the seedlingswere left to grow, were almost similar to that of the Julyexperimental period.

After exposure to gamma radiation, the 3rd leaves wereexamined for changes in morphology. As seen in Figure 5,the tips of the 3rd leaves (fully formed) showed drying/

withering at the dose (~241 Sv/3 days) in the unshieldedbox (Figure 5A). Following removal of the seedlings from

ITF and placement back in the greenhouse in Tsukuba, thetips further withered, as seen in Figure 5B. In comparison,healthy seedlings (Figure 5C) showed no such damage on theleaves, suggesting that the drying at the tips could be due toradiation exposure. The observed leaf tip damage was alsoseen in the case of high-dose gamma ray and ionizing radia-tion in previous experiments (Rakwal et al. 2008; Rakwal R,unpublished data). Unfortunately, we could not observe suchsymptoms on leaves during August and September. Onereason might be the changes in temperature, humidity, andlight/rain, due to which we had to cover the seedlings byenclosing within a greenhouse.
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://mapman.gabipd.org/web/guest/mapcavehttp://mapman.gabipd.org/web/guest/mapcavehttp://iitate-sora.net/http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://iitate-sora.net/http://mapman.gabipd.org/web/guest/mapcavehttp://mapman.gabipd.org/web/guest/mapcavehttp://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


8/16

Journal of Heredity

730

Figure 3. Accumulated radiation dose for each day of the experimental periods in July, August, and September of 2012. Ineach month, the values indicated at the right-hand side of each point line indicate the maximum accumulated dose that was

measured at the last time point sampled. Details are mentioned in the text.


9/16


731

Prior to downstream molecular analysis using RT-PCRand DNA microarray, the leaves were ground in liquid nitro-gen to yield fine powders (Figure 4). In the following sec-tions, the results of these gene expression analyses using 2

different approaches are presented and discussed.

RT-PCR Analysis of Selected Candidate Genes

On the basis of previously conducted experiments, we had ageneral idea of the genes that might be differentially affectedby ionizing radiation (Kimura et al. 2008; Rakwal et al. 2008,2009; Rakwal R, unpublished data). Therefore, we first exam-ined whether these genes indeed are affected by gammaradiation exposure using RT-PCR. The gene names andprimers are described in Table 1. The RT-PCR experimentwas conducted using blind samples, and once the results wereobtained, the data were reformatted to the time-course seriesfrom 0 to 72 h. The gene expression results are graphically

presented in Figure 6. Five groups of gene functions wereexamined: Genes related to DNA replication/repair, oxi-dative stress, photosynthesis, secondary metabolism, anddefense/stress (seeTable 1). Although for most of the genes,a correlation with the dose (low, middle, and high) was found,

we are not able to discuss that feature (dose dependency)

in detail in this article. Therefore, we will mainly discuss theincrease or decrease in gene expression following gammaradiation exposure relative to the 0-h start at ITF using someexamples from each above-mentioned functional category.

In the DNA replication/repair category, the clearestchange/increase in abundance of gene expression was seenat the early time points for OsCSB, OsPCNA, CDP photolyase,OsFEN-1a, OsRPA70a, OsRPA70b, OsRPA32, and OsORC1(Kimura et al. 2004). This is also in line with previous experi-ments, wherein high-dose gamma radiation and ionizingradiation increased their expressions (Rakwal et al. 2008;Rakwal R, unpublished data). In particular, we identified

Figure 4. Experimental design and strategy for measuring the effect of low-level dose of gamma radiation on rice plants.A 2-week-old seedling model system was used. Briey, the upper panel shows the rice plants at the start of the experiment before

transporting the rice seedlings from Tsukuba to ITF in Iitate village. The middle panel shows a representative sampling photoof rice leaf cutting and storage in dry ice and a deep freezer. The lower set of photographs shows ground rice leaf powder ina mortar and pestle in liquid nitrogen; lled area in the 3 microtubes represents the amount of powdered sample just above the

triangular base. Further details are in the text.


10/16

Journal of Heredity

732

Figure 5. Gamma radiation affects the tips of rice seedling leaves. (A) Leaf tips at 3 days after exposure to gamma radiation;

3rd leaves are marked by arrows. (B) 3-day-exposed seedlings showing the progression of the drying of the leaf (3rd) tips (markedby arrows) at 30 days postgermination, in the control greenhouse (NIES, Tsukuba). (C) Healthy seedlings show no such damageto the 3rd leaf or any other leaf.

Figure 6. Gene expression analysis of 22 selected genes. Beta-actin gene was used to check the quality of cDNA and as apositive control. Relative abundance of gene expression calculated from the bands on agarose gels (see Materials and methods and

Supplementary Figure 6for further details) were plotted against treatment (gamma radiation) time and dose. Details are mentionedin the text.
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


11/16


733

that the OsPCNAgene expression was very high only duringthe early time period (6, 12, and 24 h) of gamma radiationexposure (Figure 6). Interestingly, OsPCNAis the only well-studied and reported gene in rice among other DNA rep-lication/repair genes (Kimura et al. 2001, 2004; Yamamotoet al. 2005; Strzalka and Ziemienowicz 2011). In rice plants,PCNA has been shown to interact with DnaJ that is inducedunder DNA damage (Yamamoto et al. 2005) and recentlyalso with X-ray repair cross-complementing 1 (XRCC1), a

well-known base excision repair protein (Uchiyama et al.2008). Although we could not find the previously reportedDnaJ gene (Yamamoto et al. 2005) from among the 163probes corresponding to numerous DnaJ-related genes in therice genome, we found that theXRCC1gene was induced inthe 6-h sample but suppressed in the 72-h sample used formicroarray analysis (data are available under the GEO seriesaccession number GSE53055) described below. Similarly, theOsPCNAgene was found to be induced and suppressed at6 and 72 h, respectively, based on the obtained DNA micro-array data (GSE53055). This shows a preconfirmation ofthe gene expressionprofiling data obtained using DNAmicroarray chip discussed below. On the basis of our pre-sent finding, it can be suggested that OsPCNA is involvedin DNA repair processes in gamma rayexposed cells in therice leaves. On the other hand, the OsUV-DDB1gene did notshow any strong change in expression. To date, the OsUV-DDB1 gene, along with OsUV-DDB2, has been shown tobe responsive to treatment with ultraviolet radiation in riceseedlings (Ishibashi et al. 2003). The expression of OsUV-DDB genes was correlated with cell proliferation, and itsexpression might be necessary for predominantly undergo-ing DNA repair during DNA replication. These results sug-gest that gamma radiation specifically alters the expression

of certain known genes involved in DNA replication/repair,which might be accelerated due to the gamma rays penetrat-ing the cells. Moreover, this response is early, within 624 h,and not late, again suggesting the specificity of the observedeffect (radiation).

In the category of oxidative stressrelated genes, thegenes encoding ascorbate peroxidases (APX), catalase(CAT), peroxidases (POX), and glutathione peroxidase(GPX) were found to be differentially expressed, indicatingtheir individual time-dependent responses to the gammaradiation (Figure 6). In particular, OsAPX1/2genes showeda slight increase in expression from 0 to 72 h, peaking around24 and 48 h postexposure. The OsAPX1/2 genes are the

most well characterized among the genes examined hereinand have been shown to be responsive to oxidative and abi-otic stresses in rice (Morita et al. 1997, 2011; Lu et al. 2005).The OsCATcgene showed a downregulation at 24 and 48 h,followed by a recovery at 72 h postexposure. Interesting, theOsPOX8.1/22.3genes showed a strong decrease in expres-sion, except for a peak at 12 h, compared with the 0-h controlfor OsPOX8.1. The OsGPX1 gene was induced relative tothe 0-h control prominently at 6 and 24 h postexposure. TheOsGPXgene family has been recently shown to be inducedin response to exogenous hydrogen peroxide (H2O2) andcold stress (Passaia et al. 2013). These results suggest that the

exposed leaves have oxidative stress response mechanisms,resulting in the differential expression of the genes encod-ing the antioxidant enzymes. From these data, it is clear thatboth induction (OsAPX1/2 and OsGPX) and suppression(OsCATc and OsPOZ8.1/22.3) of gene expression occurin cells and that the effect may depend on the variety andamount of free radicals being generated. In future studies,the production of free radicals, such as H

2

O2

, would haveto be examined along with the activities of the antioxidantenzymes in the gamma-irradiated leaves.

For the photosynthesis-related genes, OsRBS (ribulosebisphosphate carboxylase/oxygenase) encoding the largesubunit (LSU) and small subunit (SSU), no clear differences

were observed until 24 h, but at 48 and 72 h, an increase ingene expression was seen (Figure 6). In general, climatic fac-tors cause variation in RuBisCO content and activity (Galmeset al. 2013). It is difficult to explain the results obtained here,but under field conditions, multiple environmental factorsare working together. Thus, the increased transcription ofRuBisCO observed at late time periods may be due to theplants response to the low-level stress being perceived,but with no major damage to the chloroplastic apparatus,

which is a major cause of reduced RuBisCO transcription,translation, and activity. Compared with other major abioticstresses, wherein the general trend is reduction of RuBisCO,a major effect is on depression of photosynthesis (Galmeset al. 2013), which may not be the case in the current stresscondition of gamma ray exposure because the leaves arehealthy except for the symptom of drying at the extremetip (Figure 5). As a next step, we are conducting proteom-ics analysis to see how the proteins, especially the RuBisCOsubunits, behave under gamma irradiation.

Both the secondary metabolismrelated genes OsPAL2

and OsCHS1 examined here showed a strong increase inexpression after exposure to gamma radiation (Figure 6),which is expected under both abiotic and biotic stresses. TheOsPAL2gene has been reported to be both developmentallyregulated and stress inducible (Zhu et al. 1995; Hyun et al.2011). The OsCHS1gene expression was below the detect-able limit of the RT-PCR experiment at 0 h, but it showed astrong increase at 6 h and thereafter, making it an interestingcandidate for further investigation as a specific gamma rayresponsive gene. DNA microarray analysis (see below) alsorevealed the high fold induction of 15 and 9 and 8 and 11OsPALand OsCHSgenes at 6 and 72 h, respectively, againproviding preconfirmation of PAL and CHSgene expres-

sion at the whole-genome level. Chalcone synthase (CHS)is a key enzyme of the flavonoid/isoflavonoid biosynthe-sis pathway, and in addition to being developmentally regu-lated similar to the PAL genes, it is known to be inducedin response to stress conditions, including ultraviolet lightand pathogen attack (Dao et al. 2011). OsCHS1 (Scheffleret al. 1995) encodes a naringenin CHS, which is mostly likelybehind the production of antimicrobial phytoalexins includ-ing sakuranetin; we also previously identified this gene in riceleaves exposed to ultralow-level dose of gamma radiationemitted from contaminated soil obtained from the exclusionzone around the Chernobyl reactor site (Rakwal et al. 2009).


12/16

Journal of Heredity

734

It would also be interesting to identify the proteins catalyzingthese reactions toward phytoalexin production in rice leavesin our ongoing proteomics analysis. Nonetheless, differentialinduction of secondary metabolismrelated genes by gammaradiation indicates activation of the self-defense mechanismin rice leaves.

Finally, 2 genes related to the biotic and abiotic stressresponses were examined. The OsPR1bgene is a pathogen-esis-related gene induced by pathogens and numerous otherelicitors (Jwa et al. 2006). However, we could only observean induction in its mRNA level predominantly at 12 h, and atother time points, there was a general decrease in expression

(Figure 6). On the other hand, OsPR10a(also known as theprobenazole-inducible protein, PBZ1) was strongly inducedstarting at 6 h, followed by a decline at 12 h, but thereaftershowing a strong increase until 72 h. The PBZ1gene has pre-

viously been shown to be strongly induced in response toultralow-level dose of gamma radiation (Rakwal et al. 2009)and by other stresses (Jwa et al. 2006). Recently, the PBZ1protein having RNase activity was suggested to play a keyrole in cell death in plants (Kim et al. 2011).

Taken together, the above results indicate that gammaradiation affects rice by causing the transcriptional activationof genes involved in rice self-defense mechanisms, includinggenes involved in DNA repair, antioxidant defense, photo-synthesis, secondary metabolism, and cell death, in the leaves.It is emphasized that the genes selected above, althoughbased on previous ionizing radiation exposure experiments,are also modulated by other biotic and abiotic stress factors.

Therefore, gamma radiation as an environmental stimulusadds to the growing list of stresses being examined in rice

and therein provides the ability to discern the expressionand regulation of each gene under various differential stress

conditions. Moreover, RT-PCR analysis of gene expressionprovided us with initial confirmatory data showing that theserice plants are uniquely gamma ray stressed.

DNA Microarray Analyses Reveal NumerousDifferentially Expressed Genes Involved in the Earlyand Late Stress Responses

The data on the expression levels of the above-mentionedselected genes clearly revealed that gamma radiation triggersthe differential expression of genes with diverse functions ina time-dependent manner, and these genes can be broadly cat-egorized as early- and late-responsive genes (Figure 6). These

data provided us further confidence to examine in detail thegenomewide expression profiles in the same samples with anaim to unravel the pathways operating downstream in gammaradiationstressed rice. DNA microarray analysis was per-formed as described in Materials and Methods (SupplementaryFigure 7). Two chips were used to generate the lists of dif-ferentially expressed genes at 6 and 72 h time points postex-posure and to also know the changed gene expression levelsat 0 h, the start of the experiment at ITF, relative to the 0-hcontrol at the greenhouse (NIES) in Tsukuba, and after 72 hin the NIES greenhouse (Supplementary Figure 8). The up-and downregulated genes at 6 and 72 h and at 0 h at ITF and

at 72 h at the greenhouse are listed in Supplementary Tables18. These gene inventories revealed that gamma radiationexposure causes the modulation of diverse gene functions.

The gene resources for this experiment are available to thescientific community for study and scrutiny at the GEO data-base with accession number GSE53055.

On the basis of the criteria specified for identifying genesthat were assumed to be more specific to the gamma radia-tion exposure, 4481 (upregulated) and 3740 (downregulated)genes were selected for the early6 hresponse period,compared with the 2291 (upregulated) and 1474 (downreg-ulated) genes selected for the late72 hresponse period(Supplementary Tables 916). Among these, the nonredun-dant highly gamma radiationresponsive up- and downregu-lated genes are listed in Supplementary Table 9 (184 genes),11 (225 genes), 13 (235 genes), and 15 (203 genes). Let uslook at a few examples of the identified highly changed genes.

At 6 h, the LOC_Os01g12440, a gene encoding theAP2 domaincontaining protein was identified at the high-est induction: Average fold value of 87.69 (Supplementary

Table 9). The AP2 (APETALA2) and EREBPs (ethylene-responsive elementbinding proteins) are plant-specifictranscription factors that contain the AP2 DNA-bindingdomain and are key regulators of several developmental pro-cesses and, importantly, part of mechanisms used by plants

to respond to environmental stress factors (Riechmannand Meyerowitz 1998; Gutterson and Reuber 2004). Thisbecomes the first report of an AP2-EREBP family memberto be induced by gamma radiation. Among the highly down-regulated genes, the top hit was a 1,3;1,4-beta glucanase (Gns1;LOC_Os05g31140), which showed the lowest suppres-sion: Average fold value of 0.00 (Supplementary Table 11).The Gns1gene is known to be highly inducible by ethylene,

wounding, salicylic acid, and fungal elicitors (Simmons et al.1992); in transgenic plants that overexpress this gene andare associated with lesions on the leaves and that are underpathogen infection (Nishizawa et al. 2003); and by brownplant hopper attack (Wei et al. 2009). Our results indicatethat for some reason unknown at present, gamma radiationstrongly suppresses Gns1, which is involved in carbohydratemetabolism. At 72 h, the most highly upregulated (averagefold value of 404.11) gene was LOC_Os04g55159, a pro-tease inhibitor/seed storage/LTP family protein precursor(Supplementary Table 13). These are small cysteine peptidesresembling antimicrobial peptides, which have been under-predicted in plants (Silverstein et al. 2007). These are known

to be induced under diverse environmental stresses, but thismay be the first report of its strong induction by gamma ray.The highly downregulated (average fold value of 0.00) geneat 72 h was LOC_Os10g26940 (Supplementary Table 15),which encodes a polygalacturonase, a hydrolase responsiblefor cell wall pectin degradation, organ consenescence, andbiotic stress in plants (Liu et al. 2013, and references therein).Interestingly, the gene OsBURP16 (LOC_Os10g26940)encoding a PG1 subunit precursor was investigated atthe transgenic level, and the results showed that its over-expression caused pectin degradation that affected the cellwall integrity as well as transpiration rate, which decreased
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


13/16


735

tolerance to abiotic stress (Liu et al. 2013). We cannot explainthe reason for OsBURP16gene downregulation, but consid-ering the results obtained above, protecting against possiblecell damage may be a possibility.

General View of Gamma Radiation Response Pathwaysin Rice Cells

The above-mentioned highly changed genes (SupplementaryTables 9, 11, 13, and 15) were analyzed using the MapManprogram and were functionally categorized into 35 groups,wherein the frequency of genes in each class was calculated as

a percentage (Table 2). Looking at the categories that changedat 6 and 72 h, protein functions were abundantly representedat 6 h than at 72 h, followed by RNA and DNA functions thatwere almost similarly represented at both time points but with a

lower percentage for DNA. The stress category was also foundto be highly represented at both 6 and 72 h. In the case of sign-aling function, the genes were more mobile at the 72-h period,indicating the occurrence of secondary stress responses. Onthe other hand, miscellaneous and unassigned functions werehighly represented, suggesting that many rice genes need to

be annotated by further experiments. Understanding thesegene functions will provide greater insight into the mecha-nisms operating behind gamma rayinduced rice self-defensemechanisms. Finally, to understand different gamma radiationresponses in leaves, the expression levels of genes categorizedinto each subBINs were compared and visualized, as shown inFigure 7. A glance of the mapped genes and their expressionson various regulatory events presented major differences inthe presence/absence of fundamental regulatory processes ofhormonal and other signaling pathways, transcription factors,

Table 2 The functional category of highly expressed gamma-responsive rice genes at 6 and 72 h determined by MAPMAN analysis

BIN Functional category

6 h_up 6 h_down 72 h_up 72 h_down

Count % Count % Count % Count %1 PS (photosynthesis) 2 1.1 1 0.4 1 0.4 0 0.02 Major CHO

(carbohydrate)metabolism

0 0.0 3 1.3 3 1.3 0 0.0

3 Minor CHO(carbohydrate)metabolism

1 0.5 5 2.2 1 0.4 1 0.5

4 Glycolysis 1 0.5 0 0.0 1 0.4 0 0.05 Fermentation 1 0.5 0 0.0 0 0.0 1 0.57 OPP (oxidative

pentose phosphatepathway)

0 0.0 1 0.4 0 0.0 0 0.0

8 TCA (tricarboxylic

acid cycle) / org.transformation

1 0.5 1 0.4 0 0.0 3 1.5

10 Cell wall 1 0.5 5 2.2 6 2.6 1 0.511 Lipid metabolism 2 1.1 5 2.2 6 2.6 1 0.512 N-metabolism 1 0.5 0 0.0 0 0.0 0 0.013 Amino acid

metabolism1 0.5 2 0.9 4 1.7 0 0.0

15 Metal handling 0 0.0 1 0.4 1 0.4 2 1.016 Secondary metabolism 2 1.1 3 1.3 11 4.7 4 2.017 Hormone metabolism 4 2.2 2 0.9 10 4.3 12 5.918 Co-factor and vitamine

metabolism0 0.0 1 0.4 1 0.4 1 0.5

19 Tetrapyrrole synthesis 0 0.0 0 0.0 2 0.9 0 0.020 Stress 7 3.8 11 4.9 5 2.1 16 7.921 Redox regulation 2 1.1 0 0.0 3 1.3 1 0.5

22 Polyamine metabolism 1 0.5 0 0.0 0 0.0 0 0.023 Nucleotide metabolism 0 0.0 0 0.0 2 0.9 1 0.526 Miscellaneous 11 6.0 14 6.2 23 9.8 22 10.827 RNA 17 9.2 16 7.1 15 6.4 20 9.928 DNA 3 1.6 2 0.9 2 0.9 0 0.029 Protein 45 24.5 19 8.4 25 10.6 11 5.430 Signaling 3 1.6 22 9.8 15 6.4 19 9.431 Cell 1 0.5 6 2.7 5 2.1 2 1.033 Development 3 1.6 2 0.9 1 0.4 4 2.034 Transport 6 3.3 7 3.1 9 3.8 6 3.035 Not assigned 69 37.5 101 44.9 89 37.9 79 38.9

The number ofnonredundant genes

184 100 225 100 235 100 203 100
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


14/16

Journal of Heredity

736

biotic and abiotic stress, redox reactions, and development atearly (6 h) and late (72 h) periods. Without discussing the detailsof each gene here, we would like to show that first, abioticstressrelated gene processes are more induced at 72 h thanat 6 h, compared with a strongly induced redox process at 6 hrelative to that at 72 h, which correlates well with the strong

expression of glutathione S-transferase early in the exposureperiod. Secondly, hormonal processes are more active at the6-h period compared with the 72-h period. However, othersignaling processes are more widely expressed at 72 h, indicat-ing secondary stress responses at later stages of gamma radia-tion exposure. Thirdly, transcription factors are differentiallyexpressed at 6 h (ERF/MYB strongly up), compared with theexpression of bZIP and WRKY, strongly expressed at 72 h,which might be directly related to the perception of gammaradiation itself. Fourthly, developmental processes are morehighly expressed at 72 h, which may be linked to the later-observed drying of the 3rd leaves (Figure 5). In this context,although the OsBURP16gene shows strongly reduced expres-sion at 72 h, other cell wallrelated genes are highly induced at72 h, which might lead us to speculate on their involvement inthe observed leaf tipdrying phenomenon. Finally, heat shockproteins and secondary metabolites are strongly regulated at

72 h, which can be correlated with the induction of secondarystress responses and the production of phytoalexins in leaves.

Concluding Remarks

The herein-presented results provide an overview of thelow-level gamma radiationresponsive rice transcriptome,

showing both specific and common (to other abiotic stress)modulations of gene expression in the rice plant. Two impor-tant points can be highlighted from this study: 1) The experi-mental design and strategy provide a new way to study theeffects of gamma radiation in cereal model systems, althoughthe effects of dose dependency remain to be clarified, and

2) the large inventory of differentially expressed genes pro-vides a great resource for genes that might be uniquely mod-ulated by ionizing radiation. Considering the large numberof changed genes, it will be possible to clarify the gammaray response completely only by further experimentation and

detailed bioinformatics analysis. Future studies will involveanalyzing the leaf proteome to complement the genomicsdata reported here and to observe the effects of gamma radi-ation from the whole plant to the level of the seed.

Supplementary Material

Supplementary material can be found at http://www.jhered.oxfordjournals.org/.

Funding

There were no external funding sources for this work.

Acknowledgments

Authors appreciate the help of Mr K. Matsumoto (NIES, Tsukuba) for man-

aging the growth of the rice seedlings used in these experiments. Authors

thank the people of Iitate village (Fukushima) and all other people involved

Figure 7. Molecular events and potential components for cellular response against gamma radiation stress in rice leaves.

Gene expression changes are depicted in MapMan format, version 3.1.1, where (A) 6 h posttreatment and (B) 72 h posttreatment

indicate the early- and late-responsive gene expressions; each square represents a gene. Red and blue colors indicate up- anddownregulation in gene expression, respectively.
http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/esu025/-/DC1


15/16


737

in this study at various parts of the experiment for their support and encour-

agement, without which this work could not have seen light. We also appre-

ciate the support of Iitate-mura Society for Radioecology (IISORA) (http://

iitate-sora.net/).

References

Agrawal GK, Jwa NS, Jung YH, Kim ST, Kim DW, Cho K, Shibato J, Rakwal

R. 2013. Rice proteomic analysis: sample preparation for protein identica-tion. Methods Mol Biol. 956:151184.

Agrawal GK, Rakwal R. 2006. Rice proteomics: a cornerstone for cereal

food crop proteomes. Mass Spectrom Rev. 25:153.

Agrawal GK, Rakwal R. 2011. Rice proteomics: a move toward expanded

proteome coverage to comparative and functional proteomics uncovers the

mysteries of rice and plant biology. Proteomics. 11:16301649.

Altman N. 2005. Replication, variation and normalisation in microarray

experiments. Appl Bioinformatics. 4:3344.

Bertell R. 1985. The problem: nuclear radiation and its biological effects. In:

Bertell R, editor. No immediate danger, prognosis for a radioactive Earth.

Part I. Summertown (TN): The Book Publishing Company. p. 1563.

Cho K, Kubo A, Shibato J, Agrawal GK, Saji H, Rakwal R. 2012. Global

identication of potential gene biomarkers associated with ozone-inducedfoliar injury in rice seedling leaves by correlating their symptom severity with

transcriptome proling. Int J Life Sci. 6:113.

Cho K, Shibato J, Kubo A, Kohno Y, Satoh K, Kikuchi S, Agrawal GK,

Sarkar A, Rakwal R. 2013. Genome-wide mapping of the ozone-responsive

transcriptomes in rice panicle and seed tissues reveals novel insight into their

regulatory events. Biotechnol Lett. 35:647656.

Dao TT, Linthorst HJ, Verpoorte R. 2011. Chalcone synthase and its func-

tions in plant resistance. Phytochem Rev. 10:397412.

Galms J, Aranjuelo I, Medrano H, Flexas J. 2013. Variation in Rubisco

content and activity under variable climatic factors. Photosynth Res.

117:7390.

Goff SA, Ricke D, Lan TH, Presting G, Wang R, Dunn M, Glazebrook

J, Sessions A, Oeller P, Varma H, et al. 2002. A draft sequence of the rice

genome (Oryza sativa L. ssp. japonica). Science. 296:92100.

Gutterson N, Reuber TL. 2004. Regulation of disease resistance pathways by

AP2/ERF transcription factors. Curr Opin Plant Biol. 7:465471.

Hyun MW, Yun YH, Kim JY, Kim SH. 2011. Fungal and plant Phenylalanine

Ammonia-lyase. Mycobiology. 39:257265.

Imanaka T, Endo S, Sugai M, Ozawa S, Shizuma K, Yamamoto M. 2012.

Early radiation survey of Iitate village, which was heavily contaminated

by the Fukushima Daiichi accident, conducted on 28 and 29 March 2011.

Health Phys. 102:680686.

International Rice Genome Sequencing Project. 2005. The map based

sequence of the rice genome. Nature. 436:793800.

Ishibashi T, Kimura S, Yamamoto T, Furukawa T, Takata K, Uchiyama

Y, Hashimoto J, Sakaguchi K. 2003. Rice UV-damaged DNA binding

protein homologues are most abundant in proliferating tissues. Gene.308:7987.

Jwa NS, Agrawal GK, Tamogami S, Yonekura M, Han O, Iwahashi H,

Rakwal R. 2006. Role of defense/stress-related marker genes, proteins

and secondary metabolites in dening rice self-defense mechanisms. Plant

Physiol Biochem. 44:261273.

Kikuchi S. 2008. High-throughput transcriptome analysis in rice from a

genomic perspective. In: Hirano H-Y,Sano Y, Hirai A, Sasaki T, editors. Rice

biology in the genomics era, biotechnology in agriculture and forestry 62.

Berlin (Germany): Springer-Verlag. section 1.5.

Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N,

Yazaki J, Ishikawa M, Yamada H, Ooka H, et al. 2003. Collection, mapping,

and annotation of over 28,000 cDNA clones from japonica rice. Science.

301:376379.

Kim SG, Kim ST, Wang Y, Yu S, Choi IS, Kim YC, Kim WT, Agrawal GK,

Rakwal R, Kang KY. 2011. The RNase activity of rice probenazole-induced

protein1 (PBZ1) plays a key role in cell death in plants. Mol Cells. 31:2531.

Kimura S, Shibato J, Agrawal GK, Kim YK, Nahm BH, Jwa NS, Iwahashi

H, Rakwal R 2008. Microarray analysis of rice leaf response to contaminated

(radioactive) Chernobyl soil. Rice Genet Newsletter (RGN). 24:5254.

Kimura S, Suzuki T, Yanagawa Y, Yamamoto T, Nakagawa H, Tanaka I,Hashimoto J, Sakaguchi K. 2001. Characterization of plant proliferating cell

nuclear antigen (PCNA) and ap endonuclease-1 (FEN-1), and their distri-

bution in mitotic and meiotic cell cycles. Plant J. 28:643653.

Kimura S, Tahira Y, Ishibashi T, Mori Y, Mori T, Hashimoto J, Sakaguchi

K. 2004. DNA repair in higher plants: photoreactivation is the major DNA

repair pathway in non-proliferating cells while excision repair (nucleotide

excision repair and base excision repair) is active in proliferating cells.

Nucleic Acid Res. 28:643653.

Liu H, Ma Y, Chen N, Guo S, Liu H, Guo X, Chong K, Xu Y. 2014.

Overexpression of stress-inducible OsBURP16, the beta-subunit of polyga-

lacturonase 1, decreases pectin contents and cell adhesion, and increases abi-

otic stress sensitivity in rice. Plant Cell Environ. 37:11441158.

Lu Z, Takano T, Liu S. 2005. Purication and characterization of two ascor-

bate peroxidases of rice (Oryza sativa L.) expressed in Escherichia coli.Biotechnol Lett. 27:6367.

Morita S, Kaminaka H, Yokoi H, Masumura T, Tanaka K. 1997. Cloning

and characterization of cytosolic ascorbate peroxidase cDNA from rice

(PGR97-012). Plant Physiol. 113:306306.

Morita S, Nakatani S, Koshiba T, Masumura T, Ogihara Y, Tanaka K. 2011.

Differential expression of two cytosolic ascorbate peroxidase and two

superoxide dismutase genes in response to abiotic stress in rice. Rice Sci.

18:157166.

Nishizawa Y, Saruta M, Nakazono K, Nishio Z, Soma M, Yoshida T,

Nakajima E, Hibi T. 2003. Characterization of transgenic rice plants over-

expressing the stress-inducible beta-glucanase gene Gns1. Plant Mol Biol.

51:143152.

Passaia G, Fonini LS, Caverzan A, Jardim-Messeder D, Christoff AP, Gaeta

ML, de Araujo Mariath JE, Margis R, Margis-Pinheiro M. 2013. The mito-

chondrial glutathione peroxidase GPX3 is essential for H2O2 homeostasis

and root and shoot development in rice. Plant Sci. 208:93101.

Rakwal R, Agrawal GK, Shibato J, Imanaka T, Fukutani S, Tamogami S,

Endo S, Sahoo SK, Masuo Y, Kimura S. 2009. Ultra low-dose radiation:

stress responses and impacts using rice as a grass model. Int J Mol Sci.

10:12151225.

Rakwal R, Kimura S, Shibato J, Nojima K, Kim YK, Nahm BH, Jwa NS,

Endo S, Tanaka K, Iwahashi H. 2008. Growth retardation and death of rice

plants irradiated with carbon ion beams is preceded by very early dose- and

time-dependent gene expression changes. Mol Cells. 25:272278.

Riechmann JL, Meyerowitz EM. 1998. The AP2/EREBP family of plant

transcription factors. Biol Chem. 379:633646.

Rosenzweig BA, Pine PS, Domon OE, Morris SM, Chen JJ, Sistare FD.2004. Dye bias correction in dual-labeled cDNA microarray gene expression

measurements. Environ Health Perspect. 112:480487.

Satoh K, Kondoh H, Sasaya T, Shimizu T, Choi IR, Omura T, Kikuchi S.

2010. Selective modication of rice (Oryza sativa) gene expression by rice

stripe virus infection. J Gen Virol. 91(Pt 1):294305.

Schefer BE, Reddy A, Hoffmann I, Wienand U. 1995. Chalcone synthase

cDNA from rice (Oryza sativa). Plant Physiol. 109:722.

Silverstein KA, Moskal WA Jr, Wu HC, Underwood BA, Graham MA,

Town CD, VandenBosch KA. 2007. Small cysteine-rich peptides resem-

bling antimicrobial peptides have been under-predicted in plants. Plant J.

51:262280.
http://iitate-sora.net/http://iitate-sora.net/http://iitate-sora.net/http://iitate-sora.net/


16/16

Journal of Heredity

738

Simmons CR, Litts JC, Huang N, Rodriguez RL. 1992. Structure of a rice

beta-glucanase gene regulated by ethylene, cytokinin, wounding, salicylic

acid and fungal elicitors. Plant Mol Biol. 18:3345.

Smirnova OA. 2010. Environmental radiation effects on mammals.

A dynamic modeling approach. New York: Springer. p. 286.

Strzalka W, Ziemienowicz A. 2011. Proliferating cell nuclear antigen

(PCNA): a key factor in DNA replication and cell cycle regulation. Ann Bot.

107:11271140.

Thimm O, Blsing O, Gibon Y, Nagel A, Meyer S, Krger P, Selbig J, MllerLA, Rhee SY, Stitt M. 2004. MAPMAN: a user-driven tool to display genom-

ics data sets onto diagrams of metabolic pathways and other biological pro-

cesses. Plant J. 37:914939.

Uchiyama Y, Suzuki Y, Sakaguchi K. 2008. Characterization of plant

XRCC1 and its interaction with proliferating cell nuclear antigen. Planta.

227:12331241.

Usadel B, Poree F, Nagel A, Lohse M, Czedik-Eysenberg A, Stitt M. 2009.

A guide to using MapMan to visualize and compare Omics data in plants:

a case study in the crop species, Maize. Plant Cell Environ. 32:12111229.

Wei Z, Hu W, Lin Q, Cheng X, Tong M, Zhu L, Chen R, He G. 2009.

Understanding rice plant resistance to the Brown Planthopper (Nilaparvata

lugens): a proteomic approach. Proteomics. 9:27982808.

Yamamoto T, Mori Y, Ishibashi T, Uchiyama Y, Ueda T, Ando T, Hashimoto

J, Kimura S, Sakaguchi K. 2005. Interaction between proliferating cell

nuclear antigen (PCNA) and a DnaJ induced by DNA damage. J Plant Res.

118:9197.

Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang

X, et al. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp.indica). Science. 296:7992.

Zhu Q, Dabi T, Beeche A, Yamamoto R, Lawton MA, Lamb C. 1995.

Cloning and properties of a rice gene encoding phenylalanine ammonia-

lyase. Plant Mol Biol. 29:535550.

Received December 11, 2013; First decision January 21, 2014;Accepted March 24, 2014

Corresponding editor: Tomoko Steen

Documents

Unraveling Low-Level Gamma Radiation–Responsive Changes in Expression of Early and Late Genes in Leaves of Rice Seedlings at litate Village, Fukushima