Upstream elements present in the 3’UTR of collagen genes … · The efficiency of 3’ end processing is a level at which regulation can occur. Since most pre-mRNAs in the cell

Upstream elements present in the 3’UTR of collagen genes influence the processing

efficiency of overlapping polyadenylation signals

Barbara J. Natalizio, Luis C. Muñiz, George K. Arhin+, Jeffrey Wilusz+ and Carol S. Lutz*

Department of Biochemistry and Molecular Biology, + Department of Microbiology and

Molecular Genetics, UMDNJ-New Jersey Medical School, Newark, NJ 07103

Running title: Regulation of human collagen pre-mRNA polyadenylation

* Corresponding Author

MSB E671, 185 S. Orange Ave. UMDNJ-NJMS Newark, NJ 07103 973/972-0899 973/972-5594 FAX [email protected] Key words: polyadenylation, collagen, upstream element, pre-mRNA processing

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on August 27, 2002 as Manuscript M208070200 by guest on M

ay 15, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

2

Abstract

3’ untranslated regions (UTRs) of genes often contain key regulatory elements involved in

gene expression control. A high degree of evolutionary conservation in regions of the 3’UTR

suggests important, conserved elements. In particular, we are interested in those elements

involved in regulation of 3’ end formation. In addition to canonical sequence elements,

auxiliary sequences likely play an important role in determining the polyadenylation efficiency

of mammalian pre-mRNAs. We identified highly conserved sequence elements upstream of the

AAUAAA in three human collagen genes, COL1A1, COL1A2, and COL2A1, and demonstrate

that these upstream sequence elements (USEs) influence polyadenylation efficiency. Mutation

of the USEs decreases polyadenylation efficiency both in vitro and in vivo, and inclusion of

competitor oligoribonucleotides representing the USEs specifically inhibit polyadenylation. We

have also shown that insertion of a USE into a weak polyadenylation signal can enhance 3’ end

formation. Close inspection of the COL1A2 3’UTR reveals an unusual feature of two closely

spaced, competing polyadenylation signals. Taken together, these data demonstrate that USEs

are important auxiliary polyadenylation elements in mammalian genes.

by guest on May 15, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3

Introduction

Poly(A) tails are found on the 3’ end of nearly every fully processed eukaryotic mRNA.

The poly(A) tail has been suggested to influence mRNA stability, translation, and transport

(reviewed in 1-4). Polyadenylation is a two-step process that first involves specific

endonucleolytic cleavage at a site determined by binding of polyadenylation factors (reviewed

in 5-10). The second step involves polymerization of an adenosine tail to an average length of

approximately 200 residues. These steps are tightly coupled processes since reaction

intermediates are not detectable under normal conditions.

The vast majority of eukaryotic polyadenylation signals contain the consensus sequence

AAUAAA between 10 and 35 nucleotides upstream of the actual cleavage and polyadenylation

site. In addition, sequences 10-30 nucleotides downstream of the cleavage site are known to be

involved in directing polyadenylation (11-13 and references therein). These downstream

elements (DSEs) can be characterized as a block containing 4 out of 5 uracil (U) residues.

These two sequence elements recruit CPSF (cleavage and polyadenylation specificity factor)

and CstF (cleavage stimulatory factor) respectively in order to define the cleavage site;

therefore mutations within these sequences abolish polyadenylation.

The intricate nature of this process implies that polyadenylation might be a useful

mechanism to regulate gene expression. The efficiency of 3’ end processing is a level at which

regulation can occur. Since most pre-mRNAs in the cell are not efficiently processed, even

small changes in the overall processing efficiency of a particular pre-mRNA may have a

substantial effect on gene expression. Experimental evidence has demonstrated that poly(A)

signal strength directly influences the amount of mature, exported mRNA (14, 15). Poly(A)

signal strength is also directly correlated with the rapid assembly of the polyadenylation

machinery on the nascent transcript (16) and with transcription termination efficiency (17).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4

Detailed mechanistic studies on regulation of polyadenylation are now emerging, revealing

both cis- and trans-acting factors (reviewed in 5, 9, 18).

In addition to the sequence elements previously described, elements upstream of the

AAUAAA sequence (see below), and downstream of the DSE (see 19, 20 and references

therein), have been identified as auxiliary cis-acting polyadenylation efficiency elements. Such

elements may play an important role in modulating the overall processing efficiency. Upstream

elements (USEs) have been characterized in viral and cellular systems, including SV40 (21),

HIV (22-27), adenovirus major late region (28, 29), cauliflower mosaic virus (30), ground

squirrel hepatitis virus (31, 32), and human C2 complement (33, 34). Spacing between the

AAUAAA and the USEs plays a significant role in that the USEs closest to the AAUAAA are

most important (21). Studies on HIV suggest that definition of the polyadenylation site involves

the recognition of multiple sequence elements, including the USE, in the context of the

AAUAAA (27).

Comparisons between the polyadenylation signals of the SV40 late mRNA and other

cellular mRNAs revealed that three human collagen genes, COL1A1, COL1A2, and COL2A1,

each possess elements similar in sequence (USE consensus UAU2-5GUNA) and position

relative to the AAUAAA to the SV40 late USEs (21; C.S.L., unpublished data). Collagens are

extracellular proteins that are responsible for the strength and flexibility of connective tissue.

They account for 25-30% of all proteins present in animals, and are the major fibrous element

of skin, bone, tendon, cartilage, blood vessels, and teeth (see 35 and references therein). In

addition to their structural role, collagens have a directive role in tissue development. The basic

structural unit of collagen consists of three polypeptide chains that are extensively covalently

cross-linked to each other. The composition of the chains depends on the type of collagen. Type


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

5

I collagen consists of 2 COL1A1 chains and 1 COL1A2 chain, whereas type II collagen

consists of 3 COL2A1 chains.

Interestingly, COL1A1, COL1A2, and COL2A1 each possess 3’ UTRs that are

extremely conserved between human and other vertebrates, including mice, cows, chickens and

pufferfish (36-43, see also GenBank and Table 1). For example, human COL1A1 has a 3’UTR

~1.5 kb in length with 2 polyadenylation signals. The first ~ 500 bases, containing the first

polyadenylation signal, are 86.5% identical in mouse, followed by a ~600 base block of little

conservation, and the final ~400 bases, including the second polyadenylation signal, are 71.1%

identical (44). This high degree of evolutionary conservation suggests important regulatory

functions of the collagen 3’UTRs. It is important to note that the use of one polyadenylation

signal over another will shorten the 3UTR, and this shortening could potentially remove

important regulatory elements. When the sequences surrounding the polyadenylation signal are

carefully examined, the percent identity is even higher, especially in the case of the final

polyadenylation signal (see Table 1). Mechanisms for alternative polyadenylation have been

extensively studied for the calcitonin and IgM genes (45-47), however, it is not mechanistically

understood how one collagen polyadenylation signal is chosen from among several.

Upregulation of collagen gene expression takes place in a variety of diseases,

including osteoarthritis and scleroderma, but it is unclear how this regulation of expression is

accomplished (48-51). Some studies have suggested in scleroderma that collagen production

may be upregulated by increased mRNA transcription (47, 52) but the altered expression may

not be fully explainable by changes in transcription rates and may additionally be

accomplished by regulated post-transcriptional mechanisms, such as polyadenylation.

This study examines the regulation of 3’ end formation in human collagen genes. The

strong evolutionary conservation of the 3’ UTRs, particularly around polyadenylation signals,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

6

led us to believe that these regions contained key regulatory elements. We asked whether cis-

acting USEs function as auxiliary elements to influence polyadenylation of the collagen

mRNAs, whether these elements acted in a similar fashion to other defined USEs, and how

these elements affect utilization of overlapping polyadenylation signals. We determined that

the USEs present in these collagen genes do influence 3’ end formation efficiency in these

genes. Furthermore, the organization of alternative poly(A) signals in the COL1A2 gene

suggests that assembly of 3’ end processing factors on the distal signal prohibits assembly of

the processing complex on the proximal signal. This suggests that protein-RNA interactions

between core polyadenylation signal elements may represent a novel method of downregulating

polyadenylation signal usage.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

7

Materials and Methods

In vitro transcription of RNA substrates

RNA transcripts for in vitro polyadenylation and cleavage reactions were synthesized

by use of SP6 RNA polymerase according to the supplier (Promega) in the presence of 50µCi

of [32P] UTP (Amersham Pharmacia Biosciences or Perkin Elmer Biosciences). Transcription

of COL1A2 yielded a 311 base RNA, of COL2A1 a 323 base RNA, and of COL1A1 a 274

base RNA. RNAs were gel-purified from 5% polyacrylamide-8M urea gels by overnight crush

elution in high salt buffer (0.4 M NaCl, 50 mM Tris at pH 8.0, 0.1% SDS) prior to use in

reactions. Eluted RNAs were ethanol precipitated and resuspended in water.

Nuclear extracts and in vitro polyadenylation and cleavage reactions

HeLa cell nuclear extracts were prepared as described previously (53). In vitro

polyadenylation reactions contained a final concentration of 58% v/v HeLa nuclear extract,

16mM phosphocreatine (Sigma), 0.8mM ATP (Amersham Pharmacia), 2.6% polyvinylalcohol,

and 1 x 105 cpm of 32P-labeled substrate RNA (approximately 50 fmol) in a reaction volume of

12.5µl (54, 55). Reactions were allowed to incubate at 30°C for 1 hour. Reaction products were

then extracted with phenol/chloroform/isoamyl alcohol, precipitated with ethanol, and analyzed

on (19:1) 5% polyacrylamide gels containing 8M urea. Typical in vitro cleavage reactions

contained a final concentration of 58% v/v HeLa nuclear extract, 1mM cordycepin (Sigma),

0.5mM ATP, 20mM phosphocreatine, 2.6% polyvinylalcohol, and 1 x 105 cpm of [32P]-labeled

substrate RNA in a reaction volume of 12.5µl (56). Cleavage reactions were allowed to

incubate at 30°C for 1 hour. Products were then processed and analyzed as described for

polyadenylation products. Competition reactions were performed by adding increased

concentrations of specific or nonspecific oligoribonucleotides as indicated into the typical


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

8

polyadenylation reaction mixtures and were allowed to proceed as described above. Reactions

were quantitated using a Molecular Dynamics PhosphorImager and ImageQuant software.

Oligonucleotides

Oligonucleotides were synthesized on the Applied Biosystems 392 and 394 DNA/RNA

synthesizers in the New Jersey Medical School Molecular Resource Facility (Newark, NJ). A list of

the primers used in PCR reactions and cloning is found in Table 1. An oligoribonucleotide

representing the putative USE motifs of COL1A2 had the sequence

AUUAAAUUGUACCUAUUUUG. A nonspecific oligoribonucleotide was also synthesized and had

the sequence GUCACGUGUCACC.

Transfection and RNase protection

Human 293T and HeLa cells were maintained in Dulbecco’s Modified Eagles Medium

(DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Sigma) and

1% penicillin-streptomycin (P/S; Life Technologies). Cells were seeded in 100mm plates

approximately 12hrs prior to transfection. When cells reached 80% confluency, they were

transfected using the Quantum Prep Cytofectene reagent (Bio-Rad). Plasmid DNA (8.4 ug)

was diluted in 700ul of serum-free medium to which 40 ul of Cytofectene was added and the

mixture was incubated at room temperature for 20min. Following the addition of 6.3ml of

medium (plus FBS) to the mixture, the medium on the cells was removed and replaced with

the entire transfection cocktail. The Cytofectene-DNA mixture was removed 6 hrs after

transfection and replaced with fresh medium. After 24 hrs, cells were washed with once with

phosphate-buffered saline (PBS). Cells were scraped and collected into 1ml PBS and

transferred into microfuge tubes. Cells were then centrifuged at 1000 RPM for 5min. The

PBS was aspirated and pellets were stored at -80oC for no more than 2 days.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9

Total RNA was extracted from the cell pellet using the RNeasy Mini Kit (Qiagen)

according to the manufacturer’s spin protocol for isolation of total RNA from animal cells.

Probe RNA was prepared as described above, using T7 polymerase and generating the

antisense of the CßS-COL1A2 construct. The reporter RNA levels were determined by RNase

protection using the RPAIII kit (Ambion Inc., Austin, Tex.) for 1 hr at 37?C. DNA templates

were then removed by DNase I digestion and the RNA was phenol extracted, ethanol

precipitated, and analyzed on 5% polyacrylamide 8M urea gels as described above.

Plasmids

COL1A2, COL2A1, COL1A1 inserts were generated by PCR using complementary

primers (Table 1). The COL2A1 and COL1A1 primers contained Bam HI (forward) and

Hind III (reverse) recognition sites to allow insertion into appropriately digested vectors;

whereas, the COL1A2 primers contained Bam HI (forward) and Pst I (reverse) recognition

sites. Gel purified and appropriately digested PCR fragme nts were ligated into appropriately

digested pGEM4 with T4 DNA ligase (Invitrogen) at 17°C overnight. The constructs were

then transformed into E. coli XL1-Blue cells. Positive clones were both sequenced and

assayed for expression of appropriately sized clones. Sequencing was completed by the New

Jersey Medical School Molecular Resource Facility using the Applied Biosystems 373 DNA

Sequencer, and resulting sequences were analyzed by BLAST computer programs for

accuracy. Amplification reactions were performed using Platinum Taq Polymerase

(Invitrogen) in a total volume of 50µl using standard reaction mixtures for 35 cycles of 95°C

(1 min), 55°C (30 sec), and 72°C (45 sec) with an initial denaturation step of 95°C (5 min).

PCR products were purified on a 1% agarose gel prior to use. Primers used in individual PCR

reactions are referred to in Table 1.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

The COL1A2 double mutant 1,2 and the triple mutant 1,2,3 were prepared via the

Stratagene Quick-Change Kit. Amplification reactions using Pfu Polymerase were for 20

cycles of 95°C (30 sec), 55°C (1 min), and 68°C (8 min) with a 95°C (5 min) initial

denaturation step. To remove the remaining template following amplification, a Dpn I

digestion was performed for 90 minutes at 37°C. The PCR product was then transformed into

E. coli XL-1 Blue cells. Positive clones were isolated and sequenced to determine correct

expression before use in polyadenylation reactions.

The PA2-G mutant COL1A2, the single USE mutants, and the double mutant 1,3 were

created by the use of the me ga-primer method of PCR mutagenesis as described previously

(57). Briefly, a mutant PCR product was generated using an internal upstream primer

containing the mutant, such as the PA2-G mutant COL1A2, and the wild-type COL1A2

downstream primer. This product containing the mutant sequence was then gel purified and

used as the downstream mega-primer for the second PCR. The COL1A2 wild type upstream

primer was used for the second PCR. A third PCR was then performed using the gel purified

second PCR product as the template and COL1A2 wild type upstream and downstream

primers. This final PCR amplified the inefficient product resulting from the second PCR. This

final product was gel-purified, cloned into pGEM4, and transformed into E. coli XL-1 Blue

cells.

The construction of pIVA2 was described in Wilusz et al. (58). Briefly, the 155 base Bam

HI to Pvu II fragment of pAd5-E1B (which contains adenovirus type 5 sequences from 3943-

4122) was cloned into pGem4 at the Hinc II and Bam HI sites. Linearization with Bgl I

yields a 158 base RNA containing the IVA2 poly(A) signal. The DNA template to generate

IVA2-USE RNA, which contains a USE 5' of the AAUAAA, was constructed by a two step


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

PCR reaction using the megaprimer approach (57). The first PCR reaction used a standard

SP6 primer and

5'-TATTTAGGGGTTTTGCGGGTTACAAATAAAGCCGCGCGGTAGGCCGG to generate

a megaprimer that contained a USE insertion 13 bases upstream of the AAUAAA element.

The second PCR reaction contained the megaprimer and the primer

5'-AGCTTGCATGCCTGCAGGTCGACTC. The product of this PCR reaction was then cut

with Bgl II and used as a template to generate IVA2-USE RNA using SP6 RNA polymerase.

For transfection assays, all COL1A2 constructs were cloned into the Bam HI-Pst I

sites of vector pCßS (gift of David Fritz, UMDNJ) downstream of a CMV promoter and

upstream of a bovine growth hormone polyadenylation signal. This vector also includes intron

1 of the rabbit ß-globin gene accompanied by the splice donor and acceptor sites. Constructs

were verified by sequencing.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

Results

USEs can stimulate in vitro 3’ end processing of a weak polyadenylation signal.

Previously, auxiliary polyadenylation elements known as upstream efficiency elements

(USEs) have been described and characterized in the SV40 late polyadenylation signal (21). It

was determined that these elements functioned as efficiency elements in the SV40 system since

their disruption resulted in reduced polyadenylation function (21). It has also been shown that a

USE from the SV40 signal can replace the HIV USE in mediating efficient 3’ end formation in

transient transfection assays (23). Both SV40 and HIV have very strong polyadenylation

signals. However, it has not previously been determined if USEs could be added to a weak

polyadenylation signal, such as the adenovirus IVA2 polyadenylation signal, to enhance 3’

processing efficiency. A USE motif from SV40 having the sequence

GCUUUAUUUGUAACC was inserted upstream of the AAUAAA in the IVA2

polyadenylation signal to create IVA2-USE, substrate RNAs were prepared from both pIVA2

and pIVA2-USE, and the RNAs were added to in vitro polyadenylation reactions. Figure 1

shows that the presence of a USE in IVA2-USE enhanced polyadenylation efficiency

approximately four-fold as compared to IVA2 alone. These data indicate insertion of a USE can

increase polyadenylation efficiency of a weak processing signal, suggest that USEs can

modulate poly(A) site definition, and suggest that USEs may be commonly found in cellular,

not only viral, genes. It is important, therefore, to evaluate mammalian polyadenylation signals

for USE elements.

USEs can be found in collagen genes.

A survey of numerous cellular polyadenylation signals revealed that elements

resembling the USE motifs present in SV40 can also be found in many 3’UTRs; that is, similar


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

to the consensus UAU2-5GUNA and within 75 bases of the AAUAAA (CSL, unpublished

data). We chose to focus on three collagen genes since their 3’ UTRs are highly conserved

through evolution, suggesting regulatory function. Figure 2A shows the comparison of the

SV40 late polyadenylation signal to three human collagen genes for type I (COL1A1 and

COL1A2) and type II (COL2A1) collagens. The polyadenylation signals AAUAAA/

AUUAAA and the putative USE elements are highlighted. We next wanted to determine if

these putative USEs present in the collagen 3’ UTRs could stimulate 3’ end processing

efficiency like the SV40 USEs. Previously it was shown that polyadenylation reactions

containing an SV40 substrate RNA could be inhibited specifically by oligoribonucleotides

representing the USE motifs (54). Plasmids encoding a portion of each collagen gene 3’UTR

containing the polyadenylation signals were created by PCR of human genomic DNA.

Substrate RNAs for the polyadenylation reactions were prepared by in vitro transcription using

SP6 polymerase in the presence of [32P] UTP. In vitro coupled cleavage and polyadenylation

reactions were performed using HeLa nuclear extract and COL1A2 (Figure 2B) substrate

RNA. Oligoribonucleotides representing a putative USE corresponding to COL1A2 or a non-

specific oligoribonucleotide were also added to the reactions. The results for COL1A2 are

shown as an autoradiogram of a typical in vitro polyadenylation reaction. The second lane in

Figure 2B, marked “0”, represents a reaction performed in the absence of competitor

oligoribonucleotides and demonstrates that the COL1A2 substrate RNA was efficiently

polyadenylated in our in vitro system. Similar results were found with COL1A1 and COL2A1

substrate RNAs and their specific oligoribonucleotides (data not shown). In each case, the

specific USE oligoribonucleotide inhibited polyadenylation, while the non-specific had no

effect on polyadenylation (see Figure 2B and data not shown). No effect was also noted when a

different non-specific oligoribonucleotide was used for each substrate RNA (data not shown).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

Quantitation of the percent polyadenylated product is indicated below the autoradiogram of the

gel in Figure 2B. Additionally, oligoribonucleotides representing the collagen USEs can cross-

compete in this assay (i.e. a COL1A1 oligo can compete with a COL1A2 substrate RNA; data

not shown). Taken together, these data suggest that the oligoribonucleotides specifically bind

and sequester common factor(s) important for polyadenylation, and suggest that the similarity

to the SV40 motifs identified in the collagen 3’ UTR is functionally significant.

COL1A2 USEs act as auxiliary polyadenylation elements in vitro.

Because of the strong processing efficiency observed using the COL1A2 substrate RNA, we

chose to focus our attention on that polyadenylation signal (diagrammed in Figure 3A). We

were also intrigued by the high degree of sequence conservation of this signal from diverse

organisms (see Figure 3A). We next made a series of substitutions replacing the COL1A2

USEs with Bgl II linkers in order to assess the contribution of the USEs to in vitro

polyadenylation (diagrammed in Figure 3B). USEs were replaced individually, as well as two

at a time and three at a time. A non-specific mutation was created by introducing a Bgl II linker

in a non-USE containing region upstream of the polyadenylation signal. RNAs were prepared

from each construct by in vitro transcription in the presence of [32P] UTP, were gel purified,

and were added to in vitro polyadenylation reactions using HeLa nuclear extract. Reaction

products were analyzed on 5% polyacrylamide 8M urea gels. The data were quantitated from

multiple in vitro reactions and are presented in Figure 3. Mutation of either USE 1, 2 or 3 alone

had little effect on polyadenylation. Mutation of both USEs 1 and 3 simultaneously also had

only a slight effect but co-mutation of USEs 1 and 2 or USEs 1, 2, and 3 diminished

polyadenylation efficiency to approximately half of wild type levels. A non-specific mutation

outside the USE region (NS mut) had no effect on polyadenylation. We conclude that none of


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

the USEs are absolutely required for COL1A2 polyadenylation, but that mutation of USE 2 in

conjunction with at least one other USE led to the most dramatic decreases in polyadenylation.

COL1A2 USE mutations are more deleterious in in vivo assays.

Since all of our experiments so far have been performed in vitro, we found it important to

verify our results in in vivo assays. We next cloned our COL1A2 wild type and mutant

constructs into pCßS downstream of a CMV promotor and upstream of a BGH poly(A) signal.

Tandem polyadenylation signals have been used previously to examine requirements for a

different type of auxiliary sequences in the lamin B2 gene (59). A T7 promoter on the opposite

strand downstream of the BGH poly(A) signal was also present for ease in making antisense

probes. The constructs were then transfected into HeLa or 293T cells, and after 24 hours, total

RNA was harvested. This RNA was added to RNase protection assays (using an antisense

transcript from the T7 promoter as a probe). Representative RNase protection assays are shown

in Figure 4A, and the results of all our experiments were quantitated and are shown in Figure

4B. The results show that use of the COL1A2 polyadenylation signal prevailed over use of the

BGH polyadenylation site when the COL1A2 signal was wild type (lane 2) or had a non-

specific mutation (lane 7) but the USE mutations altered this ratio (lanes 4-6, 8-10). The

quantitated results were analyzed as the ratio of the protected RNA fragment corresponding to

RNA polyadenylated at the COL1A2 site relative to those polyadenylated at the BGH poly(A)

site (Figure 4B). A large number means that the COL1A2 polyadenylation signals were

preferentially used rather than the BGH polyadenylation signal, while a small number means

that the BGH polyadenylation signal was preferentially used. The overall trends in the in vivo

data correlate with the in vitro data; however, the USE mutants are more deleterious in varying

degrees in vivo as compared to in vitro. USE 1 and 3 mutations alone had little effect on use of


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

the COL1A2 polyadenylation signal, whereas USE 2 mutation decreased polyadenylation

efficiency to approximately half of wild type. Mutation of the USEs in duplicate or triplicate

also reduced polyadenylation efficiency to approximately half of wild type.

COL1A2 has unusual, overlapping, competing polyadenylation signals.

Close examination of the COL1A2 mRNA sequence revealed an unusual feature, that

there are in fact two polyadenylation signals within 15 bases of each other (see Figure 3A).

Based upon the composition and spacing of the downstream CstF binding site (also known as

the DSE) relative to the AAUAAA, it might seem that poly(A) signal 1 would be preferentially

used instead of poly(A) signal 2. In order to formally investigate the question of which poly(A)

signal was the major site of polyadenylation, we turned to cleavage assays using cordycepin, a

non-hydrolyzable analog of ATP. It turns out that poly(A) signal 2 is the major site of

polyadenylation, while poly(A) signal 1 is the minor site (Figure 5A). When a non-usable

mutant of poly(A) signal 2 was created (AAUAAA to AAGAAA; PA-2 G), polyadenylation

now switched to poly(A) signal 1 (5A). This suggested that perhaps something more than

USEs and sequence spacing of the AAUAAA relative to the DSE is influencing poly(A) signal

choice in this system.

We then wanted to know how mutation of the USEs in combination with the poly(A)

signal 2 mutant (PA-2 G) affected 3’ end processing. In our in vitro assays, mutation of the

poly(A) signal 2 consensus hexamer from AAUAAA to AAGAAA did not affect the overall

polyadenylation efficiency (see Figure 3B, PA-G mut). In our in vivo RNase protection assays,

mutation of poly(A) site 2 had no effect on overall polyadenylation, but that mutation in

conjunction with the double and triple USE mutations decreased polyadenylation to

approximately one-fifth of wild type (see Figure 4A, lanes 2-3, 11-12 and Figure 5B). Taken


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

together, these data demonstrate that USEs influence 3’ end formation efficiency in the

COL1A2 gene.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

Discussion

In this study we have identified auxiliary 3’ end processing elements in highly conserved

regions of the 3’ UTRs of human collagen genes. These elements promote efficient

polyadenylation in vitro and in vivo. In addition, COL1A2 has the unusual feature of

overlapping polyadenylation signals, one of which predominates, and suggests a novel

mechanism for poly(A) signal downreuglation (see below). These findings provide initial

insight into regulation of collagen gene expression that will hopefully aid our understanding

of disease initiation.

Human type I and type II collagen genes all have highly evolutionarily conserved 3’UTRs.

Indeed, the functional importance of the collagen 3’ UTRs is implied by their conservation. The

3’ UTRs likely contains important regulatory sequences that influence polyadenylation site

utilization, and may also ultimately influence the cytoplasmic fate of the mRNA. Recognition of

two core cis-acting elements (the AAUAAA and the downstream U-rich element) by the

polyadenylation factors CPSF and CstF is the key determinant of mRNA processing efficiency.

In the case of large 3’ UTRs and/or multiple polyadenylation signals, additional auxiliary

elements may be necessary to ensure proper polyadenylation. The 3’UTRs of these three

collagen genes likely require such auxiliary motifs to support the efficient assembly of

polyadenylation factors. Interestingly, within the evolutionarily conserved regions of these 3’

UTRs exist elements containing close homology with the USE auxiliary polyadenylation

elements of SV40. We show here that these USEs in the collagen 3’UTRs act as auxiliary

polyadenylation efficiency elements, and that these USEs play an important role in an

overlapping polaydenylation signal.

Our in vivo data suggest that the USEs might be most important for poly(A) signal 1

utilization since mutation of the USEs affects polyadenylation at that site more than when both


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

poly(A) signals are intact. Our in vitro data also support this, although the effects are not as

dramatic (data not shown). As has been appreciated more completely in recent years, 3’ end

formation is interconnected both to the other major RNA processing events, splicing and

capping, and also to mRNA transcription (reviewed in 6, 9, 60). This interconnection likely

results in most efficient utilization of cis- and trans-acting signals. Thus, it is reasonable to

expect that the in vivo data most closely mimic regulation at the cellular level, and reflect the

co-transcriptional nature of these processes.

The overlapping polyadenylation signals present in the COL1A2 3’UTR are unusual. Our

data demonstrate that poly(A) signal 2 is the major site of polyadenylation while poly(A) signal

1 is used, but to a lesser extent (see Figure 5A). These data suggest a model, shown in Figure 6.

The configuration of the overlapping signals sets up a competition between CstF binding to

poly(A) signal 1 versus CPSF binding to poly(A) signal 2. Mutation of the AAUAAA in

poly(A) signal 2 activates usage of poly(A) signal 1 (see Figures 5A and 6). These data suggest

that the two polyadenylation signals are in competition with each other. Steric hindrance ma y

not allow the interaction between CPSF and CstF bound at the corresponding sites for poly(A)

signals 1 and 2 simultaneously, or it may suggest that CPSF-RNA interactions are dominant

over CstF interactions at the DSE for poly(A) signal 1. These data demo nstrate a principle that

protein-RNA interactions can interfere with scaffold assembly, suggesting a novel mechanism

for repressing poly(A) signal usage. It remains to be seen whether this arrangement could be

used to decrease polyadenylation efficiency at selected signals.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

Acknowlegements

The authors wish to thank the members of the Lutz, Wilusz, and O’Connor laboratories for helpful

experimental suggestions and comments on the manuscript. This work was funded by American

Cancer Society grant RPG-00-265-01-GMC, an Arthritis Investigator Award 2AI-LUT-A-5, and

an Arthritis Foundation, New Jersey Chapter grant 3AI-LUT-A to C.S.L., and NIH grants

CA80062 and GM63832 to J.W.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

References

1. Lewis, J., S. Gunderson, and I.W. Mattaj. 1995. The influence of 5’ and 3’ end structures on pre-

mRNA metabolism. J Cell Sci (Suppl) 19: 13-19.

2. Jacobson, A., and S.W. Peltz. 1996. Interrelationships of the pathways of mRNA decay and translation in

eukaryotic cells. Ann Rev Biochem 65: 693-739.

3. Sachs, A.B., P. Sarnow, and M.W. Hentze. 1997. Starting at the beginning, middle and end: translation

initiation in eukaryotes. Cell 89: 831-838.

4. Wickens, M., P. Anderson, and R.J. Jackson. 1997. Life and death in the cytoplasm: messages from the

3’ end. Curr Op Genet Dev 7: 220-232.

5. Proudfoot, N. 1996. Ending the message is not so simple. Cell 87: 779-781.

6. Proudfoot, N. 2000. Connecting transcription to messenger RNA processing. Trends Biochem Sci 25:

290-293.

7. Keller, W., and L. Minvielle-Sebastia. 1997. A comparison of mammalian and yeast pre-mRNA 3’ end

processing. Curr Op Cell Biol 9: 329-336.

8. Colgan, D. F., and J.L. Manley. 1997. Mechanism and regulation of mRNA polyadenylation. Genes &

Dev. 11: 2755-2766.

9. Zhao, J., L. Hyman, and C. Moore. 1999. Formation of mRNA 3’ ends in eukaryotes: mechanism,

regulation, and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev 63:

405-445.

10. Shatkin, A.J., and Manley, J.L. 2000. The ends of the affair: capping and polyadenylation. Nature Struct

Biol 7: 838-842.

11. Chen F., C.C. MacDonald, and J. Wilusz. 1995. Cleavage site determinants in the mammalian

polyadenylation signal. Nucleic Acids Res 23:2614-2620.

12. Chou, Z.F., F. Chen, and J. Wilusz. 1994. Sequence and position requirements for uridylate-rich

downstream elements of polyadenylation signals. Nucl Acids Res 22: 2525-2531.

13. Graber J.H., C.R. Cantor, S.C. Mohr, and T.F. Smith. 1999. In silico detection of control signals:

mRNA 3’end processing sequences in diverse species. Proc. Natl. Acad. Sci USA 96: 14055-14060.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

14. Denome, R.M., and C.N. Cole. 1988. Patterns of polyadenylation site selection in gene constructs

containing multiple polyadenylation signals. Mol Cell Biol 8: 4829-4839.

15. Edwalds-Gilbert, G., J. Prescott, and E. Falck-Pederson. 1993. 3' RNA processing efficiency plays a

primary role in generating termination-competent RNA polymerase II elongation complexes. Mol Cell Biol

13: 3472-3480.

16. Chao, L.C., A. Jamil, S.J. Kim, L. Huang, and H.G. Martinson. 1999. Assembly of the cleavage and

polyadenylation apparatus requires about 10 seconds in vivo and is faster for strong than for weak poly(A)

sites. Mol. Cell. Biol. 19: 5588-5600.

17. Osheim, Y.N., N.J. Proudfoot, and A.L. Beyer. 1999. EM visualization of transciption by RNA

polyermase II: downstream termination requires a poly(A) signal but not transcript cleavage. Mol. Cell 3:

379-387.

18. Edwalds-Gilbert, G., K.L. Veraldi, and C. Milcarek. 1997. Alternative poly(A) site selection in complex

transcription units: means to an end? Nucl Acids Res 25: 2547-2561.

19. Chen F., and J. Wilusz. 1998. Auxiliary downstream elements are required for efficient polyadenylation

of mammalian pre-mRNAs. Nucl Acids Res 26: 2891-2898.

20. Arhin, G.K., M. Boots, P.S. Bagga, C. Milcarek, and J. Wilusz. 2002. Downstream sequence elements

with different affinities for the hnRNPH/H’ protein influence the processing efficiency of mammalian

polyadenylation signals. Nucl Acids Res 30: 1842-1850.

21. Schek, N., C. Cooke, and J.C. Alwine. 1992. Definition of the upstream efficiency element of the simian

virus 40 late polyadenylation signal by using in vitro analyses. Mol. Cell. Biol. 12: 5386-5393.

22. Brown P.H., L.S. Tiley, and B.R. Cullen. 1991. Efficient polyadenylation within the human

immunodeficiency type 1 long terminal repeat inhibits polyadenylation of its own pre-mRNA. J Virol 65:

3340-3343.

23. Valsamakis, A., S. Zeichner, S. Carswell, and J.C. Alwine. 1991. The human immunodeficiency

virus type 1 polyadenylation signal: a long terminal repeat element upstream of the AAUAAA necessary

for efficient polyadenylation. Proc Natl Acad Sci USA 88: 2108-2112.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23

24. Valsamakis, A., N. Schek, and J.C. Alwine. 1992. Elements upstream of the AAUAAA within the

human immunodeficiency viurs polyadenylation signal are required for efficient polyadenylation in vitro.

Mol Cell Biol 12: 3699-3705.

25. DeZazzo, J.D., J.E. Kilpatrick, and M.J. Imperiale. 1991. Involvement of long terminal repeat U3

sequences overlapping the transcriptional control region in human immunodeficiency virus type 1 mRNA

3’ end formation. Mol Cell Biol 11: 1624-1630.

26. Gilmartin, G.M., E.S. Fleming, and J. Oetjen. 1992. Activation of HIV-1 pre-mRNA 3’ processing in

vitro requires both an upstream element and TAR. EMBO J 11: 4419-4428.

27. Gilmartin G.M., E.S. Fleming, J. Oetjen, and B.R. Gravely. 1995. CPSF recognition of and HIV-1

mRNA 3’ processing enhancer: multiple sequence contacts involved in poly(A) site definition. Genes Dev

9: 72-83.

28. DeZazzo, J.D., and M.J. Imperiale. 1989. Sequences upstream of the AAUAAA influence poly(A)

selection in a complex transcriptional unit. Mol Cell Biol 9:4951-4961.

29. Prescott, J. and E. Falck-Pedersen. 1994. Sequence elements upstream of the 3’ cleavage site confer

substrate strength to the adenovirus L1 and L3 polyadenylation sites. Mol. Cell. Biol. 14: 4682-4693.

30. Sanfacon, H., P. Brodmann, and T. Hohn. 1991. A dissection of the cauliflower mosaic virus

polyadenylation signal. Genes Dev. 5: 141-149.

31. Russnak R., and D. Ganem. 1990. Sequences 5’ to the polyadenylation signal mediate differential

poly(A) site use in hepatitis B virus. Genes Dev. 4: 764-776.

32. Russnak, R 1991. Regulation of polyadenylation in hepatitis B viruses: stimulation by the upstream

activating signal PS1 is orientation-dependent, distance-dependent, and additive. Nucl Acids Res 19:

6449-6456.

33. Moreira, A., M. Wollerton, J. Monks, and N.J. Proudfoot. 1995. Upstream sequence elements

enhance poly(A) site efficiency of the C2 complement gene and are phylogenetically conserved. EMBO J

14: 3809-3819.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

24

34. Moreira, A., Y. Takagaki, S. Brackenridge, M. Wollerton, J.L. Manley, and N.J. Proudfoot. 1998.

The upstream sequence element of the C2 complement poly(A) signal activates mRNA 3’ end formation

by two distinct mechanisms. Genes Dev 12: 2522-2534.

35. Persikov, A.V., and B. Brodsky. 2002. Unstable molecules form stable tissues. Proc. Natl. Acad. Sci.

USA 99: 1101-1103.

36. de Wet, W., M. Bernard, V. Benson-Chanda, M.L. Chu, L. Dickson, D. Weil, and F. Ramirez. 1987.

Organization of the human pro-alpha2(I) collagen gene. J. Biol. Chem 262: 16032-16036.

37. Sangiori, F.O., V. Benson-Chanda, W.J. de Wet, M.E. Sobel, and F. Ramirez. 1985. Analysis of cDNA

and genomic clones coding for the pro alpha 1 chain of calf type II collagen. Nucl. Acids Res 13: 2815-

2826.

38. Sandell, L.J., H.L. Prentice, D. Kravis, and W.B. Upholt. 1984. Structure and sequence of the chicken

type II procollagen gene. Characterization of the region encoding the carboxyl-terminal telopeptide and

propeptide. J. Biol. Chem. 259: 7826-7834.

39. Ninomiya, Y., A.M. Showalter, M. van der Rest, N.G. Seidah, M. Chretien, and B. R. Olsen. 1984.

Biochemistry 23: 617-624.

40. Upholt, W.B., C.M. Strom, and L.J. Sandell. 1985. Structure of the type II collagen gene. Ann. NY

Acad. Sci. 460: 130-140.

41. Metsaranta, M., D. Toman, B. de Crombrugghe, and E. Vuorio. 1991. Mouse type II collagen gene. J.

Biol. Chem. 266: 16862-16869.

42. Myers, J.C., L.A. Dickson, W. de Wet, M.P. Bernard, M.L. Chu, M. Di Liberto, G. Pepe, F.O.

Sangiorgi, and F. Ramirez. 1983. Analysis of the 3’ end of the human pro-alpha 2(I) collagen gene. J. Biol.

Chem. 258: 10128-10135.

43. Elima, K., T. Vuorio, and E. Vuorio. 1987. Determination of the single polyadenylation site of the

human pro-alpha 1 (II) collagen gene. Nucl. Acids Res. 15: 9499-9504.

44. Maatta, A., P. Bornstein, and R.P.K. Penttinen. 1991. Highly conserved sequences in the 3’ untranslated

region of the COL1A1 gene bind cell-specific nuclear proteins. FEBS Letters 279: 9-13.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

25

45. Lou H., K.M Neugebauer, R.F. Gagel, and S.M. Berget. 1998. Regulation of alternative

polyadenylation by U1 snRNPs and SRp20. Mol Cell Biol 18: 4977-4985.

46. Takagaki, Y., R.L. Seipelt, M.L. Peterson, J.L. Manley. 1996. The polyadenylation factor CstF-64

regulates alternative processing of IgM heavy chain pre-mRNA during B cell differentiation. Cell 87: 941-

952.

47. Martincic K., R. Campbell, G. Edwalds-Gilbert, L. Souan, M.T. Lotze, C. Milcarek. 1998. Increase in

the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition.

Proc. Natl. Acad. Sci. USA 95: 11095-11100.

48. Jimenez, S.A., E. Hitraya, and J. Varga. 1996. Rheum Dis. Clin. North Am. 22: 647-674.

49. Fehr, J.E., G.W. Trotter, J.T. Oxford, and D.A. Hart. 2000. Comparison of Northern blot hybridization

and a reverse-transcriptase-polymerase chain reaction technique for measurement of mRNA expression of

metalloproteinases and matrix components in articular cartilage and synovial membrane from horses with

osteoarthritis. Am J Vet Res 61: 900-905

50. Martin I., M. Jakob, D. Schaefer, W. Dick, G. Spagnoli, and M. Heberer. 2001. Quantitative analysis

of gene expression in human articular cartilage from normal and osteoarthritic joints. Osteoarthrit is and

Cartilage 9: 112-118.

51. LeGraverand, M.P.H., J. Eggerer, E. Vignon, I.G. Otterness, L. Barclay, and D.A. Hart. 2002.

Assessment of specific mRNA levels in cartilage regions in a lapine model of osteoarthritis. J. Ortho Res

20: 535-544.

52. Tasanen K, Palatsi R, Oikarinen A. 1998. Demonstration of increased levels of type I collagen mRNA

using quantitative polymerase chain reaction in fibrotic and granulomatous skin diseases. Br. J. Dermatol

139: 23-26.

53. Moore C.L. 1990. Preparation of mammalian extracts active in polyadenylation. Methods Enzymol.

181: 49-74.

54. Lutz C.S., and J.C. Alwine. 1994. Direct interaction of the U1snRNP-A protein with the upstream

efficiency element of the SV40 late polyadenylation signal. Genes & Dev 8: 576-586.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

26

55. Lutz C.S., K.G.K. Murthy, N. Schek, J.P. O'Connor, J.L. Manley, and J.C. Alwine. 1996. Interaction

between the U1snRNP-A protein and the 160-kD subunit of cleavage-polyadenylation specificity factor

increases polyadenylation efficiency in vitro. Genes & Dev 10: 325-337.

56. Lutz, C.S., C. Cooke, J. P. O’Connor, R. Kobayashi, and J.C. Alwine. 1998. The snRNP-free U1A (SF-

A) complexes: identification of the largest subunit as PSF, the polypyrimidine tract binding protein

associated splicing factor. RNA, 4:1493-1499.

57. Aiyar, A., and J. Leis. 1993. Modification of the megaprimer method of PCR mutagenesis: improved

amplification of the final product. Biotechniques. 14:366-369.

58. Wilusz, J., D.I. Feig, and T. Shenk. 1988. The C proteins of heterogeneous nuclear ribonucleoprotein

complexes interact with RNA sequences downstream of polyadenylation cleavage sites. Mol Cell Biol 8:

4477-4483.

59. Brackenridge, S., H.L. Ashe, M. Giacca, and N.J. Proudfoot. 1997. Transcription and polyadenylation in

a short human intergenic region. Nucl. Acids Res. 25: 2326-2335.

60. Proudfoot, N.J., A. Furger, and M.J. Dye. 2002. Integrating mRNA processing with transcription. Cell

108: 501-512.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

27

Figure Legends

Figure 1 Inclusion of a USE stimulates in vitro processing of a weak polyadenylation

signal. Top, schematic of constructs used, including relative positions of the AAUAAA and

upstream element (USE). An arrow marks the cleavage site. Bottom, in vitro polyadenylation

reactions. 0 minutes, unreacted substrate RNA; 30 minutes, reaction products. Polyadenylated

products are noted as poly(A)+ on the right. Quantitation of per cent polyadenylation is noted

at the bottom. Percent polyadenylation was calculated as the quantitation of the

polyadenylated product divided by the total quantitated RNA in the lane.

Figure 2 Competition studies suggest USE-binding factors influence the processing

efficiency of collagen polyadenylation signals.

2A Sequence of SV40 late polyadenylation signal compared to three human collagen genes,

COL1A1, COL1A2, and COL2A1. Canonical AAUAAA or AUUAAA elements are shown in

bold, putative auxiliary upstream elements are underlined and italicized.

2B In vitro polyadenylation reactions using COL1A2 as substrate RNA. COL1A2 specific or

non-specific competitor oligoribonucleotides (see Table 2) were added to the reaction in the

amounts indicated at the top of the lane. Percent polyadenylation was calculated as the

quantitation of the polyadenylated product divided by the total quantitated RNA in the lane.

Figure 3 Substitution of multiple COL1A2 USEs affects polyadenylation efficiency.

3A Schematic of distal (poly(A) signal 1) and proximal (poly(A) signal 2) polyadenylation

signals. USEs are shown in striped boxes; canonical AAUAAA and corresponding

downstream CstF binding sites are shown. Cleavage sites are marked with arrows. Regions of

evolutionary conservation are noted at the bottom.

3B Schematic of COL1A2 USE mutant constructs (left) and percent polyadenylation of each

as observed in in vitro processing reactions (right). Polyadenylation was normalized to 100%

as wild type. Black boxes indicate substitution with a Bgl II linker.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

28

Figure 4 USEs influence in vivo polyadenylation efficiency of the COL1A2 signal.

4A Representative RNase protection assay, using HeLa cells. Bands marked as ? represent

those fragments protected when the BGH polyadenylation signal was used, and therefore

represent polyadenylation at that signal; bands marked as * represent those fragments

protected when the COL1A2 polyadenylation signal was used and therefore represent

polyadenylation at that signal. Because of the mutations created, these fragments were often

different in size and are diagrammed for ease of interpretation on the right side of the figure.

Lanes: 1, marker, pBR322 cut with MspI and 5’ end labeled with ?[32P]-ATP; lanes 2-12,

COL1A2 mutant or wild type constructs cloned into pC?S as indicated above the lane; lane

13, pC?S vector alone; lane 14, probe used for RNase protection.

4B Lighter gray bars, 293T cell transfections; darker gray bars, HeLa cell transfections.

Percent polyadenylation was measured as the ratio of COL1A2 polyadenylation site

utilization to the downstream bovine growth hormone polyadenylation site utilization as

quantitated by RNase protection assays. Large numbers represent COL1A2 polyadenylation

preferentially; small numbers indicate BGH polyadenylation preferentially. Constructs are

indicated on the X axis; see also Figure 3B.

Figure 5 COL1A2 has the unusual feature of two closely spaced, competing

polyadenylation signals.

5A In vitro cleavage assay reveals poly(A) signal 2 is the predominantly used polyadenylation

signal, while poly(A) signal 1 is a minor signal. Mutation of poly(A) signal 2 from AAUAAA

to AAGAAA switches this predominance. Marker lane, transcript prepared from COL1A2

construct that was linearized with Nsp I (cuts between the two cleavage sites).

5B In vivo polyadenylation assays reveal that USE mutants plus mutation of poly(A) signal 2

results in a marked decrease in polyadenylation efficiency. Lighter gray bars, 293T cell

transfections; darker gray bars, HeLa cell transfections. Percent polyadenylation was

measured as the ratio of COL1A2 polyadenylation site utilization to the downstream bovine

growth hormone polyadenylation site utilization as quantitated by RNase protection assays.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29

Figure 6 CPSF binding between the core elements of the proximal polyadenylation signal

of COL1A2 may inhibit complex assembly on the distal polyadenylation signal.

Polyadenylation machinery can successfully assemble on the proximal signal (poly(A) signal

2) but may not support assembly of processing factors on the distal signal (poly(A) signal 1)

due to spacing or steric constraints.

Table 1 Evolutionary conservation of collagen genes

Human COL1A1, COL1A2, and COL2A1 were examined for 3’ UTR size, number of

polyadenylation signals, and searched for evolutionary conservation of the 250-300 bases

surrounding the final polyadenylation signal of the cognate gene by BLAST. Accession numbers are

as follows: COL1A1: M55998, BTA312112, AY083537.1, AL606480.11; COL1A2: NM_000089.2,

AC091773, GGCOLA2C; COL2A1: XM_056481, AF023169, BTCOLII, RNAJ4879. COL1A2 is

listed as having 5 or 6 polyadenylation signals because one signal has the non-consensus sequence

AUUAA (42).

Table 2 Primers used in construct preparation by guest on May 15, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

30

TABLE 1

Gene size of 3’ UTR # polyadenylation signals % sequence identity to final PA signal

COL1A1 ~1.5 kb 2 92% cow, 98% macaque, 92% mouse

COL1A2 ~900 bases 5 or 6 79% pufferfish, 84% chicken

COL2A1 ~400 bases 2 95% dog, 86% cow, 89% rat


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31

TABLE 2

Primers for Cloning

COL1A2:

forward primer: TAGGATCCAAGTATGCAGATTATTTG

reverse primer: TATACTGCAGGGCTGGTAGAGATGC

COL1A1:

forward primer: TAGGATCCGGGTTTCAGAGACAACTTC

reverse primer: TATAAAGCTTGCCCATCACCCCAAG

COL2A1:

forward primer: TAGGATCCGTCAAGGCAGAGGCAGGAAAC

reverse primer: TATAAAGCTTTCCTTAGGACTGCTATTTG

G mutants and truncated transcripts:

Hexamer Mutant COL1A2: TAAATTGTGAAAAAAATGAAAGAAAGCATGTTTGGT

COL1A2-370: TAGGATCCCAAAGTTGTCCTCTTCTTCAG

COL1A2-400: TAGGATCCATTTGTTCTTTGCCAGTCTC

COL1A2-455: TAGGATCCGTTTCTTGGGCAAGCAG

COL1A2-500: TAGGATCCATGTGAGATGTTTAAATAAATTG

Single USE Mutant Primers:

COL1A2 Mutant A: TCAGCATTTGTTCTTTGCCAGATCTCATTTTCATCT

COL1A2 Mutant 1: TTGGGCAAGCAGAAAAACTAAAGATCTCCTATTTTGTATAT

COL1A2 Mutant 2: GCAGAAAAACTAAATTGTACCTAGATCTATATGTGAGATG

COL1A2 Mutant 3: ATATGTGAGATGTTTAAATAAAGATCTAAAAAAATGAAATAAAGCAT

Double USE Mutant Primers:

COL1A2 Double Mutant 1,2:

TTGGGCAAGCAGAAAAACTAAAGATCTCCTAGATCTATATGTGAGATGTTTAAAT

COL1A2 Double Mutant Complement 1,2:

ATTTAAACATCTCACATATAGATCTAGGAGATCTTTAGTTTTTCTGCTTGCCCAA


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Barbara J. Natalizio, Luis C. Muniz, George K. Arhin, Jeffrey Wilusz and Carol S. Lutzefficiency of overlapping polyadenylation signals

Upstream elements present in the 3'UTR of collagen genes influence the processing

published online August 27, 2002J. Biol. Chem.

10.1074/jbc.M208070200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M208070200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M208070200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2002/08/27/jbc.M208070200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2002/08/27/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2002/08/27/jbc.M208070200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

Upstream elements present in the 3’UTR of collagen genes … · The efficiency of 3’ end processing is a level at which regulation can occur. Since most pre-mRNAs in the cell