DNA AND CELL BIOLOGYVolume 14, Number 8, 1995Mary Ann Liebert, Inc.Pp. 731-739

Laboratory Methods

Use of Reverse Ligation-PCR to Identify Transcriptional StartSites in GC-Rich TATA-Less Genes: Application to the Rat

IGFBP-2 Gene

YVES R. BOISCLAIR and ALEXANDRA L. BROWN

ABSTRACT

TATA-less genes are often GC-rich in the region of transcriptional initiation and the corresponding mRNAsare prone to the formation of secondary structure. These properties have made it difficult to determine un-

ambiguously the start sites of transcription for some of these genes by conventional assays such as primer ex-tension and nuclease protection. Using the TATA-less rat IGFBP-2 gene, we demonstrate that tobacco acidpyrophosphatase-reverse ligation polymerase chain reaction (TAP-RLPCR), a novel and sensitive assay, canbe used to map the start sites of these genes. First, the validity of TAP-RLPCR was demonstrated by map-ping the transcription start site of the rat insulin-like growth factor 1 (IGFBP-1) gene to the correct position(nucleotides —173 relative to ATG, +1). Using total RNA obtained from the rat liver cell line BRL-3A, thetranscription start sites of the rat IGFBP-2 gene were mapped to a narrow cluster extending from nucleotides—86 to —90 (ATG, +1), 39 bp downstream of three adjacent GC boxes that are essential to the transcrip-tional activity of the gene. The assay was also used to map the start sites of a luciferase reporter gene drivenby the fragment —1,295 to —32 of the rat IGFBP-2 promoter after transfection in the human embryonic kid-ney cell line 293. The hybrid gene utilized the same transcription start sites as the rat IGFBP-2 gene, indi-cating that the elements required for positioning of the transcription initiation complex are contained withinthe 3' end terminating at nucleotide —32. These studies demonstrate the usefulness of the TAP-RLPCR as-

say for verifying the authenticity of ambiguous start sites, and definitively map the start sites of the rat IGFBP-2 gene.

IINTRODUCTION lating (inhibiting or potentiating) the response of tissues to IGFs

(Clemmons, 1992; Rechler, 1993).NSULiN-LiKE growth factor i and n (IGFs) are peptide IGFBP-2 is the predominant circulating IGFBP during fetalgrowth factors that are essential for normal growth and de- Ufe in the rat (Brown et al, 1989). It is expressed in many tis-

velopment ofmammals (DeChiara etal, 1991; Liu etal, 1993). sues with liver displaying the highest mRNA level (Brown etIn vivo, IGFs are always found complexed to one of a family al, 1989). After birth, mRNA expression decreases rapidly inof six specific binding proteins called insulin-like growth fac- most tissues, but can be induced in liver by fasting, and by de-tor binding proteins (IGFBPs) (Rechler, 1993). Many roles have ficiencies in the energy or protein content of the diet (Ooi etbeen postulated for these IGFBPs, including providing a reser- al, 1990; Orlowski et al, 1990a; Straus and Takemoto, 1990,voir for IGFs, delivery of IGFs across capillaries, and modu- 1991). Because these changes in IGFBP-2 mRNA abundance

Growth and Development Section, Molecular and Cellular Endocrinology Branch, National Institute of Diabetes and Digestive and KidneyDiseases, National Institutes of Health, Bethesda, MD 20892.

731

732 BOISCLAIR AND BROWN

with development and fasting reflect, at least in part, alterationsin the rate of transcription initiation (Tseng et al., 1992), we

have characterized the 5'-flanking region of the gene (Brownand Rechler, 1990; Boisclair et al, 1993). Primer extensionanalysis suggested that the start site of transcription of the ratIGFBP-2 gene was located at either nucleotide —88 or at nu-

cleotide —151 relative to the ATG, neither of which were pre-ceded by a TATA element. However, ribonuclease protectionassays appeared to corroborate the nucleotide —151 site lead-ing us to attribute the nucleotide —88 to premature terminationof reverse transcription (Brown and Rechler, 1990). These dif-ficulties in mapping the transcription start sites may be a func-tion of the high GC content of the gene in this region.

Recent developments have prompted us to re-examine thisassignment. First, nucleotide —151 is located within the sec-

ond of three clustered GC boxes that are critical to promoterfunction (Boisclair et al, 1993). This arrangement would beunusual for a mammalian gene. Second, Schwander and col-leagues mapped the transcription start site of human and mouse

IGFBP-2 mRNAs to a unique position corresponding, respec-tively, to nucleotide —97 and nucleotide —84 of the rat IGFBP-2 gene (Binkert et al, 1992; Landwehr et al, 1993). Finally,Fromont-Racine et al, (1993) proposed recently a novel, poly-merase chain reaction (PCR)-based assay to locate transcrip-tion start sites. In the present report, we demonstrate the use-

fulness of this novel procedure to map the transcriptioninitiation site of GC-rich genes, and in particular show that tran-

scription of the rat IGFBP-2 gene initiates within a narrow clus-ter of nucleotides located between nucleotides -90 and -86.

MATERIALS AND METHODS

ReagentsMost tissue culture reagents, RNase H and Superscript II

RNase H~ reverse transcriptase were purchased from LifeTechnologies Inc. (Gaithersburgh, MD); RNase- and DNase-free bovine serum albumin (BSA), deoxynucleotides (dNTPs),and T4 RNA ligase from Pharmacia LKB Biotechnology Inc.(Piscataway, NJ); tobacco acid pyrophosphatase (TAP) fromEpicentre Technologies (Madison, WI); calf intestinal alkalinephosphatase from New England Biolabs (Beverly, MA);RNase-free DNase I, Taq DNA polymerase and AMV reverse

transcriptase from Boehringer Mannheim (Indianapolis, IN);RNasin and the <b\\lAIHinï I molecular weight marker fromPromega Corp. (Madison, WI). Radionucleotides were obtainedfrom Amersham Corp (Arlington Heights, IL). PCRs were per-formed on a DNA thermal cycler (Perkin-Elmer, Norwalk, CT).The Circumvent PCR sequencing kit was purchased from NewEngland Biolabs.

Cell cultivationCells were grown as monolayer cultures in a humidified at-

mosphere of 95% air 5% CO2 at 37°C under conditions we de-scribed previously. The rat hepatoma cell line, H4-II-E, whichpredominantly expresses rat IGFBP-1 (Yang et al, 1990), was

expanded in RPMI-1640 (Life Technologies) in the presence of10% fetal bovine serum (HyClone, Logan, UT). For experi-ments, the steady-state levels of IGFBP-1 mRNA were in-

creased by incubating confluent H4-II-E cells in serum-freeRPMI-1640 for 12-16 hr, followed by 16 hr in serum-freemedium supplemented with dexamethasone (1 pM final con-

centration) (Orlowski et al, 1990b).The BRL-3A cell line derived from rat liver produces only

IGFBP-2 (Yang et al, 1990). It was propagated in modifiedHam's F-12 medium (Biofluids, Rockville, MD) supplementedwith 5% fetal calf serum (HyClone). Under these conditions,Northern analysis of 15 /xg of BRL-3A total RNA yielded a

strong IGFBP-2 signal.The adenovirus-transformed human embryonic kidney cell

line 293 expresses IGFBP-2 as the predominant IGFBP(Boisclair et al, 1994). Cells were grown in MEM medium withEarle's salts containing 10% fetal calf serum (HyClone).Confluent 293 cells were seeded at 6 X 106 cells/100-mm dishand transfected 24 hr later with luciferase reporter plasmids (10jag/dish) using the calcium phosphate method (Boisclair et al,1993). Plasmids used included pA3Luc, a promoterless plas-mid (kindly provided by Dr. William M. Wood, University ofColorado), or the derivative pHNLuc, in which the luciferasegene is driven by the Hind lll-Nhe I promoter fragment of therat IGFBP-2 gene (-1,295 to -32, ATG + 1) (Brown andRechler, 1990). Forty-eight hours after transfection, cells were

lysed to prepare total RNA, or to assay for luciferase activity(Brown and Rechler, 1990).

OligonucleotidesOligonucleotides were synthesized using a 380B DNA syn-

thesizer from Applied Biosystems (Foster City, CA). The nu-

cleotide sequence of the RNA linker and of the correspondingDNA primer (DNA Pr-1) are respectively: 5'-CGAC-ÇACJJAGUAGGGCAUAGGCUGACCCUCGCUGAAA-3 '

and 5'-GGGCATAGGCTGACCCTCGCTGAAA-3' (the un-

derlined nucleotides in the RNA linker are not present in DNAPr-1). The oligoribonucleotide was sequentially deprotected inethanol/ammonia (3:1 mixture of 30% aqueous ammonia andabsolute ethanol) and in tetra-n-butylammonium fluoride dis-solved in tetrahydrofuran as recommended by the manufacturer.Oligonucleotides were purified by polyacrylamide-urea gelelectrophoresis.

Sequences of the gene-specific oligodeoxyribonucleotidesused in this study are given in Table 1.

Primer extension

Total RNA was prepared by the guanidine thiocyanatemethod (Chomczynski and Sacchi, 1987) and quantified by ab-sorbance at 260 nm. Staining of ribosomal RNA with ethidiumbromide after electrophoresis on agarose/formaldehyde gelsconfirmed the integrity of total RNA. Primer-extended reverse

transcription was performed using 50 pg of total BRL-3A RNAhybridized to the antisense oligonucleotide Pr-22. Labeling ofthe oligonucleotides, hybridization, and reverse transcriptionwere carried out as described previously (Brown and Rechler,1990).

TAP-reverse ligation PCR

TAP-reverse ligation PCR (TAP-RLPCR) was modifiedfrom the original report of Fromont-Racine et al ( 1993) to mea-

REVERSE LIGATION-PCR 733

Table 1. Nucleotide Sequences of Oligodeoxyribonucleotide Used

IGFBP-1 genePr-6 -101/-117 5'-AGCTCTCTGGGCAGATG-3'Pr-5 —115/—135 5'-ATGGCCGTGTGCAGTGTTCAA-3'

IGFBP-2 genePr-14 +60/+44 5'-CAGCAAGAGCAGCGACG-3'Pr-15 +5/-17 5'-AGCATGTTGGCTAGTGGGAAAC-3'Pr-4 -31/-52 5'-GCTAGCGGGCAGGTGGCACGGC-3'Pr-22 -76/-99 5'-CCTTGCCTTCTTTCTCCTCCCCCG-3'Pr-27 -65/-104 5'-GGGAGACGCCTCCTTGCCTTCTTTCTCCTCCCCCGCTGCT-3'

IGFBP-2-luciferase genePr-20 +84/+6Ó 5'-CTTATGCAGTTGCTCTCCA-3'Pr-2 +12/-10 5'-GGCGTCTTCCATTTTACCAACA-3'Pr-23 +7/-23 5'-CTTCCATTTTACCAACAGTACCGGAATGCC-3'Pr-17 -15/-36 5'-CGGAATGCCAAGCTTGCTAGCG-3'

Sequences of the oligodeoxyribonucleotides specific for the rat IGFBP-1, IGFBP-2, or IGFBP-2-lu-ciferase genes are given above. The positions of the 5' and 3' nucleotides of the non-coding strand of therespective genes are given relative to the ATG.

sure the start site of the rat IGFBP-1, IGFBP-2, and IGFBP-2-luciferase genes.

Elimination of Sources of 5'-Phosphate Other Than theHydrolyzed Cap Structure of mRNA: Residual DNA was re-

moved by treating total RNA (10 pg) with DNase I (10 units,30 min at 37°C) in 50 pX of 50 mAi Tris-HCl pH 7.5, 10 ltiMMgCl2. Calf intestinal alkaline phosphatase (50 units in 150 pXof 10 mM Tris-HCl pH 7.9, 50 mM NaCl, 10 mAi MgCl2, and1 mM DTT) was added and incubation continued for 2 hr at50°C. Samples were extracted with phenol/chloroform andchloroform, and ethanol-precipitated. They were resolubilizedin 9 pX of 50 mM sodium acetate pH 6.0, 10 mM /3-mercap-toethanol, 1 mM EDTA, and 0.01% Triton X-100. The capstructure (5'-5' phosphodiester linkage at the 5' end of themRNA) was hydrolyzed by adding 1 pX of TAP (5 units, 1 hrat 37°C). In the report of Fromont-Racine et al (1993), thisstep was performed in the presence of 2 mM ATP, a competi-tive substrate of TAP. We found that omission of ATP improvesthe sensitivity and reproducibility of the TAP-RLPCR assay.Reactions were terminated by ethanol precipitation and totalRNA reconstituted in 10 pX of TE buffer (10 mM Tris-HCl, 1mM EDTA).

Ligation ofmRNA to the RNA Linker: The 5' phosphate endsof mRNA present in 1 pg of total RNA were ligated to 100 ngof the RNA linker with T4 RNA ligase (3 units, 16 hr at 17°C)in a 10-ju.l volume of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2,20 mM DTT, 1 mM ATP, supplemented with 1 pg of BSA and20 units of RNasin.

Reverse Transcription-PCR Amplification: In general, totalRNA (100-300 ng) was denatured (95°C for 5 min) in 10 pXof 65 mM Tris-HCl pH 8.8, 16.5 mM (NH^SO^ 60 mMMgCl2, 10 mM /3-mercaptoethanol, and 0.5 mM dNTPs in thepresence of a gene-specific primer (1-10 ng). Because we

wanted to minimize the opportunity for mRNAs, particularlyIGFBP-2 mRNAs, to adopt secondary structures, we usedhigher annealing and reverse-transcription temperatures thanthe 42°C used by Fromont-Racine et al (1993). After anneal-ing (45 min at 48-52°C), AMV reverse transcriptase (5 units)was added (at 0 and 45 min), and the incubation continued atthe same temperature for 90 min. Reverse transcription was

stopped by heating (95CC for 10 min), and 10 pX of a PCR mix(65 mM Tris-HCl pH 8.8, 16.5 mM (NH4)2S04, 10 mM /3-mer-captoethanol, 0.5 mM dNTPs, 4 pg BSA, 100-500 ng of DNAPr-1, and 10-100 ng of a second gene-specific primer) was

added to each reaction mixture. After an initial denaturationstep (5 min at 95°C), PCR was initiated by adding 1 units ofTaq DNA polymerase. Reactions were cycled for 1 min at 94°C,3 min at the annealing temperature (55-68 depending on thegene-specific primer), and 1 min at 74°C for 9-30 cycles. Forthe IGFBP-2 gene, a single PCR step did not yield any de-tectable products. Therefore, the original procedure was modi-fied to include a second nested PCR in which 10% of the pri-mary PCR incubation mixture was reamplified as above inpresence of the DNA Pr-1 and a third gene-specific primer.

To maximize the yield of full-length cDNAs in some ex-

periments, Superscript II RNase H~ reverse transcriptase was

used instead of AMV reverse transcriptase. mRNAs were re-

verse-transcribed with a single addition of Superscript II RNaseH" reverse transcriptase (200 units/reaction) in a XQ-pX volumeof 20 mM Tris-HCl pH 8.4, 50 mM KC1, 2.5 mM MgCl2, 10mM DTT, 0.5 mM dNTPs supplemented with 1 pg BSA. Afterheat inactivation of the reverse transcriptase, reactions were

treated with RNase H (2.7 units, 20 min at 37°C). PCR ampli-fications were performed as described above except that theywere performed in Superscript II RNase H~ reverse transcrip-tase buffer (20 mM Tris-HCl, pH 8.4, 50 mM KC1, 2.5 mMMgCl2, 1 pg of BSA//-.1).

Details specific to individual genes are given in the figurelegends.

Detection of PCR Product: DNA primers were labeled us-

ing [-y-32P]ATP (>5,000 Ci/mmole) and T4 polynucleotide ki-nase. For most experiments, PCR products were directly end-labeled by using labeled primers in the last PCR reaction exactlyas described above. For the IGFBP-2-luciferase gene, linearamplification was also used. Briefly, 5 pX of the primary PCRreaction was mixed with a 5-pX volume of 20 mM Tris-HCl,pH 8.4, 50 mM KC1, 2.5 mM MgCl2, and 0.250 mM dNTPscontaining 0.5 pg BSA and 12.5 ng of gene specific primer(added in the ratio of 1:3 labeled:unlabeled). After 5 min at95°C, 0.5 unit of Taq DNA polymerase was added and the re-

734 BOISCLAIR AND BROWN

actions were cycled five times (1 min at 94°C, 3 min at 76°C).PCR reactions (2 pA) were resolved on 6% polyacrylamide, 7M urea gels alongside the d>xl74///mf I molecular weightmarker labeled with [y-32P]ATP, or dideoxy chain-terminationsequencing reactions for accurate size determination. Productswere visualized after autoradiography at -70°C in cassetteswith intensifying screens.

Sequencing ofprimer extended and PCR productsProducts were resolved on 6 or 8 % polyacrylamide, 7 M

urea gels. After localization by autoradiography, areas of thegel containing the products of interest were cut out and elutedin a buffer containing 500 mM ammoniun acetate, 10 mM mag-nesium acetate, 1 mM EDTA, and 0.1% NaDodS04. The elu-

IGFBP-1 Gene

Reversetranscription

H Pr-6

mRNA

cDNA

PCR

(25 bp)

t;ite

-1 Pr-5 "I"-135 -115

85 bp product

start site (-173)

CCGAGCCAGCCCTTr>TAAt3GCCCTGGGTATGGCCAGCCAGCATGGTCCACTGCCCGCCGAGACAI I I I

"

I I I-210 -190 -170 -150

IGFBP-2 Gene

Reversetranscription

.///\/N

ATG, +1

mRNA

cDNA

PCR

-rl Pr-15 1.-17 +5

(25 bp)

products of 82 to 86 bp

start sites (-90 to -86)

IGAGAAGCAGGCI I

-130

AGGACCCGGCAGCAGCGGGGGAGGAGAAAGAAGGCAAGGAGGCGTCTCCI I I I I

-110 -90 -70

FIG. 1. Schematic diagram illustrating the TAP-RLPCR strategy. Sequences corresponding to the rat IGFBP-1 (top) or IGFBP-2 (bottom) genes are represented as thin lines or as open boxes. The sequences corresponding to the RNA linker and DNA primer(DNA Pr-1) are shown as thick wavy lines and closed boxes, respectively. The sizes of the amplified products are shown.Transcription initiation sites are deduced from the position of the [y-32P]-labeled primers (shown with asterisks) used for eachgene and from the size of the amplified products after subtracting the length contributed by the DNA Pr-1 (25 bp) plus an extranucleotide to account for the addition of a nontemplated nucleotide at the 3' end of the amplified DNA (Hu, 1993). The nu-

cleotide sequence surrounding the start sites (indicated by bold and underlined nucleotides) is given for each gene. For the IGFBP-1 gene, the TATA element dictating the site of transcription initiation is boxed. Positions of the primers used, and numbering ofsequences is given relative to the ATG of the respective genes.

REVERSE LIGATION-PCR 735

ate was separated from the polyacrylamide matrix by Spin-Xcolumn (Costar, Cambridge, MA), and purified by ethanol-pre-cipitation or by chromatography using G-25 Sephadex column(5 Prime -» 3 Prime, Inc., Boulder, CO). Products were se-

quenced using Maxam Gilbert reactions or PCR sequencing.

RESULTS

Transcription of the rat IGFBP-2 gene does notinitiate at nucleotide —151

Because of the ambiguity associated with its determination,we decided to ascertain whether nucleotide —151 correspondsto a true transcription initiation site of the rat IGFBP-2 gene.The two antisense oligonucleotide primers that previously sug-gested transcription initiation at nucleotide —151 (Pr-22, nu-

cleotides -76 to -99 and Pr-27, nucleotides -65 to -104)were derived from the same region of the gene (Brown andRechler, 1990). Therefore, to investigate whether the presumednucleotide —151 transcript arose from hybridization of theseoligonucleotide primers to an mRNA other than rat IGFBP-2,we reverse-transcribed BRL-3A total RNA with the antisenseoligonucleotide Pr-22 and sequenced the extended product us-

ing Maxam-Gilbert reactions. Unlike the cDNAs terminating atnucleotide —88 that were obtained after reverse transcriptionwith a proximal primer corresponding to nt +5 to —24 (Brownand Rechler, 1990), the sequence of the extended product ob-tained with Pr-22 did not correspond to the genomic sequenceof the rat IGFBP-2 gene (results not shown). Therefore, we con-

clude from these experiments that nucleotide —151 is not an

authentic transcription start site.

Detection of the transcription start site of the ratIGFBP-2 gene using TAP-RLPCR

To map definitively the cap site of the rat IGFBP-2 gene, we

used TAP-RLPCR, a new PCR-based assay designed to am-

plify only cDNAs that are extended to the cap site (Fromont-Racine et al, 1993). The cardinal features of this method are:

pretreatment of total RNA with DNase I (to remove residualDNA) and with calf intestinal alkaline phosphatase (to elimi-nate any preexisting 5' phosphates from partially degradedRNAs), the use of TAP to hydrolyze the cap structure ofmRNAs, and the ligation of an RNA linker of defined sequenceto the exposed 5' phosphates. mRNAs are reverse-transcribedand cDNAs extending to the cap site are amplified using a DNAprimer corresponding to the RNA linker, and one or two gene-specific primers. The strategy is illustrated in Fig. 1 for the ratIGFBP-1 and IGFBP-2 genes.

First, the TAP-RLPCR method was validated using the ratIGFBP-1 gene (Figs. 1 and 2). We and others have shown, byprimer extension analysis, that the rat IGFBP-1 gene initiatestranscription at nucleotide 173 relative to ATG, 24 bp from a

TATA box (Unterman et al, 1992; Suh et al, 1994). H4-B-Ecells were incubated with dexamethasone to induce high ex-

pression of the IGFBP-1 gene, and total RNA was prepared,treated with TAP and the RNA linker ligated to the exposed 5'-phosphates. IGFBP-1 mRNA was reverse-transcribed usingAMV reverse transcriptase with Pr-6 (corresponding to nu-

cleotides -101 to -117 relative to ATG +1), and amplified

IGFBP-1 IGFBP-2 IGFBP-2TAP -++ -++ -++RT +-+ +-+ + - + bp

FIG. 2. Identification of the transcription start sites for therat IGFBP-1 and IGFBP-2 genes. To detect the cap site of therat IGFBP-1 and IGFBP-2 gene, the TAP-RLPCR method was

applied to total RNA obtained from H4-II-E cells treated withdexamethasone (lanes 1-3), or to total RNA from BRL-3A cells(lanes 4-9). The RNA was treated sequentially with DNAse I,calf intestinal alkaline phosphatase, and TAP, and ligated withthe RNA linker as described in Materials and Methods.Reactions were conducted in the absence (—) or presence (+)of TAP and AMV reverse transcriptase (RT) as indicated. ForIGFBP-1, 100 ng of ligated total RNA was annealed to 1 ng ofPr-6, and reverse transcribed with AMV reverse transcriptaseat 48°C. IGFBP-1 cDNAs were amplified with 100 ng of DNAPr-1 and 10 ng of [y-32P]-labeled Pr-5 for 18 cycles (94°C for1 min, 64°C for 3 min, 74°C for 1 min). For IGFBP-2, 100 ngof ligated total RNA was annealed to 1 ng of Pr-14 and reversetranscribed with AMV reverse transcriptase at 52°C. IGFBP-2cDNAs were amplified by nested PCR: first, for 22 cycles us-

ing 100 ng of DNA Pr-1 and 10 ng of Pr-15 (94°C for 1 min,61°C for 3 min, 74°C for 1 min), then for 9 cycles using 10%of the first PCR reaction with 100 ng of DNA Pr-1 and [y-32P]-labeled Pr-4 (94°C for 1 min, 68°C for 3 min, 74°C for 1 min).The reactions were analyzed on a 6% polyacrylamide-urea se-

quencing gel. The base pair ladder (bp) given on the right ofthe figure was obtained by running cpx 174/Hinf I DNA markerlabeled with [y-32P]ATP and dideoxy sequencing reactionsalongside the samples (not shown). The autoradiographic ex-

posure was 2 hr (lanes 1-6) or 60 hours (lanes 7-9).

736 BOISCLAIR AND BROWN

with DNA Pr-1 and a second IGFBP-1 specific primer labeledwith [-y-32P](Pr-5, nucleotides -115 to -135). A single 85-bpproduct was detected after 18 cycles of amplification (Fig. 2,lane 3). This product represents amplification of cDNA ratherthan genomic DNA as it was detected only when reverse tran-

scriptase was added (lanes 2 vs. 3). The dependence of thisproduct on hydrolysis of the cap structure indicates that itrepresents amplification of cDNAs extending to the 5' end ofIGFBP-1 mRNA (lanes 1 vs. 3). After subtracting the size ofthe DNA Pr-1 (25 bp) plus an extra nucleotide to account forthe addition of a nontemplated nucleotide at the 3' end of theamplified DNA fragment (Hu, 1993), the start site detected byTAP-RLPCR maps to nucleotide -173 of the rat IGFBP-1 gene(Fig. 1), the same site that had been deduced from primer ex-

tension experiments (Unterman et al, 1992; Suh et al., 1994).The nucleotide sequence of this product was identical to thatof the rat IGFBP-1 gene from nucleotides -135 to -173, af-ter which it diverged to correspond to the sequence of DNAPr-1.

Next, the TAP-RLPCR was applied to total RNA obtainedfrom the rat BRL-3A cell line which expresses IGFBP-2. Afterreverse transcription with Pr-14 (nucleotides +60 to +44), spe-cific detection of IGFBP-2 cDNAs required a nested PCR pro-cedure; first with Pr-15 (nucleotides +5 to -17) for 22 cyclesand then with labeled Pr-4 (nucleotides -31 to -52) for 9 cy-cles (Fig. 1). (In preliminary experiments, PCR performed for22 cycles with DNA Pr-1 and iy2P]-labeled Pr-15 did not yieldany detectable products). Two major products of 83 and 84 bpwere detected (Fig. 2, lane 6). After longer exposure, additionalproducts of 82, 85, and 86 bp were seen (lane 9). As before,these products were not detected when either TAP or reverse

transcriptase were omitted from the reactions (lanes 4-5 and7-8). After subtracting the size of the DNA Pr-1 and the non-

templated nucleotides from these products, start sites were

mapped to a narrow cluster extending from nucleotides —90 to-86 (Fig. 1). No other products were detected, even after pro-longed exposure (not shown). Sequencing of the 83-, 85-, and86-bp products in the cluster with Pr-4 confirmed that they cor

IGFBP-2~lucilerasegene

L

relative to IGFBP-2 ATG"/—I-1-

-1295 -90

I 7/--100

-32

IGFBP-2 \X¿itfte<P&:. ::::. ::::::. ::::. :://:.-50 +1 +50

relative to luciferase ATG

1-100-/-

Reverse transcription

66 +84

PCR

(25 bp)

Pr-2 I 'Products of 125 and 126 bp

-10 +12

Linear amplification—I Pr-23 I««-23 +7

Products of 120 and 121 bp

Products of 100 and 101 bp

^T —I Pr-17 I««-36 ,15

Start sites (-90 to -88)

FIG. 3. Schematic diagram of the TAP-RLPCR for the rat IGFBP-2-luciferase gene. The Hind Wl-Nhe I fragment of theIGFBP-2 gene is drawn as an open box, the luciferase gene as a stippled box. Numbering is given relative to the ATG of theIGFBP-2 gene (above the diagram of the hybrid gene) or to the ATG of the luciferase gene (below). Position of each primer isrelative to the ATG of the luciferase gene. When products were detected by direct labeling, PCR amplification was performedwith Pr-2 labeled with [•y-32P] (shown with asterisks). When linear labeling was used, PCR amplification was first performedwith unlabeled Pr-2 followed by linear amplification with Pr-17 or 23 labeled with [y-32P] (shown with asterisks). Sizes of theamplified products are shown. The start site of the IGFBP-2-luciferase gene (shown as an arrow) was calculated by subtractingthe length of DNA Pr-1 (25 bp, shown in black) plus the nontemplated nucleotide from the size of the observed products ob-tained with each labeled primer.

REVERSE LIGATION-PCR 737

responded to IGFBP-2 genomic sequence from nucleotides —52to —87, —89, and —90, respectively. These results indicate thattranscription of the rat IGFBP-2 gene initiates within a narrow

cluster located —90 to -86 nucleotide upstream of the ATG.The clustered initiation sites include the nucleotide —88 sitethat we had mapped previously by primer extension (Brownand Rechler, 1990).

pA3Luc2 2317

pHNLuc2 23 17 bp

-726

Transcription of the IGFBP-2 promoter-luciferasegene initiates at the same sites as the IGFBP-2 gene

We have characterized recently the functional region ofthe rat IGFBP-2 promoter using fragments of the 5'-flank-ing region to drive the expression of luciferase reporter genes(Boisclair et al, 1993). Having mapped the start sites of thenative rat IGFBP-2 gene, we wanted to confirm that the same

sites were used in luciferase reporter genes driven by the ratIGFBP-2 promoter. Initial attempts using primer extensionwith a luciferase specific primer gave no specific start siteswith total or poly(A)RNA from transfected BRL-3A or hu-man embryonic kidney 293 cells. To circumvent this prob-lem, we prepared total RNA from 293 cells transfected ei-ther with plasmid pA3Luc, or with plasmid pHNLuc, a

pA3Luc derivative that contains the Hind lll-Nhe I promoterfragment of the rat IGFBP-2 promoter (nucleotides —1,295to —32), and mapped the transcription start sites using TAP-RLPCR. (Transfection efficiency is higher in the 293 cellline than in the BRL-3A cell line, resulting in ~20 timeshigher luciferase activity in 293 cells. As this activity is pre-sumably a reflection of higher mRNA levels, we used the293 cells for mapping the start site of the luciferase reportergene.) After ligation to the RNA linker, total RNA (300 ng)was reverse transcribed with Superscript II reverse tran-

scriptase using a luciferase specific primer (Pr-20, nu-

cleotides + 84 to +66) and amplified for 30 cycles usingDNA Pr-1 and a second gene-specific primer end-labeledwith [y-32P] (Pr-2, nucleotides +12 to -10) (Figs. 3 and 4).A doublet of 125 and 126 bp was detected in 293 cells trans-fected with pHNLuc, but not in cells transfected withpA3Luc (Fig. 4, lane 1 vs. 4). These products map exactlyto the narrow cluster of start sites previously identified forthe rat IGFBP-2 gene (Fig. 3).

To establish further the start site of the hybrid gene, the PCRreactions described above were repeated with unlabeled Pr-2.Then the amplified cDNAs were detected by linear amplifica-tion with the nested end-labeled luciferase primers, Pr-23 or Pr-17. The 5' end of Pr-23 is 5 nucleotides downstream of the 5'end of Pr-2; the 5' end of Pr-17 is 26 bp downstream of the 5'end of Pr-2. In addition, Pr-17 is specific for the IGFBP-2-lu-ciferase cDNA since the first 6 nucleotides at its 3' end are

complementary to the IGFBP-2 insert (Fig. 3). Doublets of120-121 and 100-101 bp were detected with Pr-23 and Pr-17,respectively, in cells transfected with HNLuc but not in cellstransfected with the promoterless pA3Luc (Fig. 4, lanes 2-3 vs.

5-6). These results indicate that the hybrid IGFBP-2-luciferasegene utilizes the same transcription start sites as the endoge-nous IGFBP-2 gene.

i -24

12 3 4 5 6

FIG. 4. Identification of the start sites of the IGFBP-2 lu-ciferase gene. Human embryonic kidney 293 cells were trans-fected by the calcium phosphate method (10 pg plasmid/100-mm dish) with the promoterless luciferase plasmid, pA3Luc(lanes 1-3), or its derivative pHNLuc (lanes 4-6) in which theluciferase gene is under the control of the Hind Ul-Nhe I pro-moter fragment from the rat IGFBP-2 gene (nucleotides -1,295to -32). Total RNA was obtained 48 hr after transfection andprepared for the TAP-RLPCR procedure as before. Total RNA(300 ng) ligated with the RNA linker was annealed to the lu-ciferase oligonucleotide Pr-20 (10 ng) and reverse-transcribedusing Superscript II RNase H~ reverse transcriptase at 48°C.We used Superscript II RNase H~ instead of AMV reverse tran-scriptase in these experiments to maximize the yield of full-length cDNAs. Complementary DNAs corresponding to theIGFBP-2-luciferase mRNAs were then amplified for 30 cycles(94°C for 1 min, 55°C for 2 min, 74°C for 1 min) with 100 ngof DNA Pr-1 and 10 ng of [y-32P]-labeled Pr-2 (lanes 1 and 4).In other reactions, IGFBP-2-luciferase cDNAs were amplifiedunder the same conditions except that five times greater con-centrations of DNA Pr-1 and unlabeled Pr-2 were used.Amplified cDNAs were then detected by linear labeling using[ y-32P]-labeled Pr-23 (lanes 2 and 5) or [y-32P]-labeled Pr-17(lanes 3 and 6). Linear labeling reactions were cycled five times(94°C for 1 min, 76°C for 2 min). The reactions were analyzedon a 6% polyacrylamide-urea sequencing gel. The base pair lad-der (bp) given on the right of the figure was obtained by run-

ning <pxl74/Hinf I DNA markers labeled with [y-32P]ATP anddideoxy sequencing reactions alongside the samples (notshown).

738 BOISCLAIR AND BROWN

DISCUSSION

Using the TAP-RLPCR assay, we have mapped the start siteof the rat IGFBP-2 gene definitively to a narrow region located86-90 nucleotides upstream of the ATG. This finding agreeswith the nucleotide -88 site that we had previously determinedby primer extension, but disagrees with the result of ribonu-clease protection assays (Brown and Rechler, 1990). The arti-factual bands observed in the ribonuclease protection assaymight be related to the ability of the riboprobes used and ofIGFBP-2 mRNA to adopt stable secondary structures (Brownand Rechler, 1990; Ackerman et al, 1993). While these stud-ies were being completed, Kutoh et al. (1993) mapped the startsite of the rat IGFBP-2 gene to nucleotide -90 using SI nu-clease protection assays.

We also have demonstrated that the TAP-RLPCR method isa valid approach to map the transcription initiation site partic-ularly when conventional assays yield conflicting results. Thisis particularly relevant in the case of TATA-less genes such as

the insulin receptor (for review, see McKeon et al, 1990) andthe H-ras oncogene (for review, see Lu et al, 1994) for whichdisagreement exists for some of the multiple start sites that havebeen reported. These genes are often GC-rich in the region oftranscription initiation yielding mRNAs that are prone to theformation of secondary structures that might interfere with con-

ventional assays. For such genes, TAP-RLPCR is superior toother assays that are dependent on complete reverse transcrip-tion of the mRNA. In the TAP-RLPCR assay, any prematurelyterminated cDNAs generated during reverse transcription do notcontain the DNA sequence corresponding to the RNA linker atthe 3' end of their noncoding strand, and therefore, cannot beefficiently amplified in the subsequent PCR reactions. Also, theuse of two or more gene-specific primers confers additionalspecificity to the TAP-RLPCR relative to primer extension.This is particularly important for genes with a high GC contentthat often makes the selection of specific primer difficult.

Another advantage is that the PCR amplification gives ad-ditional sensitivity to the TAP-RLPCR assay. We have beenable to map the start site of the IGFBP-1 and IGFBP-2 geneswith as little as 100 ng of total RNA. In contrast, detection ofthe start site of the rat IGFBP-2 gene using primer extensionnecessitated 50 pg of total or 20 pg of poly(A) RNA (Brownand Rechler, 1990; Kutoh et al, 1993). Moreover, mapping ofthe cap site of the rare transcript produced by the transfectedhybrid IGFBP-2-luciferase gene could not be achieved byprimer extension or nuclease protection assays (results notshown; Kutoh et al, 1993). Therefore, as shown in this study,the TAP-RLPCR assay provides an additional approach to re-

solve authentic transcription start sites and to map the start sitesof genes expressed at low levels.

We also have demonstrated that the hybrid IGFBP-2-lu-ciferase gene utilizes the same transcription start site as theIGFBP-2 gene. This result has important implications. First, itimplies that the rat IGFBP-2 promoter constructs with their 3'end at nucleotide —32 with respect to ATG, which we haveused previously to characterized the 5'-flanking region of thegene, include all the cw-elements necessary for start site selec-tion (Boisclair et al., 1993). The rat IGFBP-2 gene contains nei-ther a TATA box nor the loose consensus initiator sequence,PyPyA+)N(T/A)PyPy (A+i is the cap site) that usually speci-

fies the transcription start site (Kollmar and Farnham, 1993;Javahery et al, 1994). In these TATA-less genes, activator pro-teins like Spl bound to their nearby cw-elements have been pro-posed to attract the TFIID complex (Pugh and Tjian, 1990,1991). Although earlier studies with artificial constructs havesuggested that Spl can only play this role in the presence of an

initiator element (O'Shea-Greenfield and Smale, 1992), thereis now evidence in natural eukaryotic genes that an Spl ele-ment located ~50 nucleotides upstream can dictate the initia-tion site (Faber et al, 1993; Kollmar and Farnham, 1993;Kollmar et al, 1994). We have reported that a cluster of threeSpl binding sites located 39 bp upstream from the start sites isessential for the efficient expression of the IGFBP-2 gene(Boisclair et al., X 993). In contrast, another model proposed thatthe IGFBP-2 belongs to a family of TATA-less genes repre-sented by the murine adenosine deaminase gene in which an

imperfect dyad symmetry dictates the initiation site (Ackermanet al, 1993). The sensitive TAP-RLPCR assay developed forthe artificial IGFBP-2-luciferase gene could be used to decidewhich of the above models apply.

In summary, we have demonstrated that TAP-RLPCR is a

sensitive method for unambiguously determining the transcrip-tion start site of GC-rich genes. For the rat IGFBP-2 gene, we

have shown that transcription initiates at a tight cluster betweennucleotides —90 and —86, and that transcription of the IGFBP-2 promoter-luciferase hybrid gene occurs at the same sites.These strategies and results provide the basis for future studiesdetermining the mechanism by which transcription is initiatedwithin this cluster in the TATA-less IGFBP-2 gene.

ACKNOWLEDGMENTS

We thank M. Rechler and G. Ooi for a critical reading of themanuscript.

REFERENCES

ACKERMAN, S.L., MLNDEN, A.G., and YEUNG, C.Y. (1993). Theminimal self-sufficient element in a murine G+C-rich promoter is a

large element with imperfect dyad symmetry. Proc. Nati. Acad. Sei.USA 90, 11865-11869.

BLNKERT, C, MARGOT, J.B., LANDWEHR, J., HEINRICH, G., andSCHWANDER, J. (1992). Structure of the human insulin-like growthfactor binding protein-2 gene. Mol. Endocrinol. 6, 826-836.

BOISCLAIR, Y.R., BROWN, A.L., CASÓLA, S., and RECHLER,M.M. (1993). Three clustered Spl sites are required for efficient tran-

scription of the TATA-less promoter of the gene for insulin-likegrowth factor-binding protein-2 from the rat. J. Biol. Chem. 268,24892-24901.

BOISCLAIR, Y.R., YANG, Y.W.-H., STEWART, J.M., and RECH-LER, M.M. (1994). Insulin-like growth factor-I and insulin stimu-late the synthesis of IGF-binding protein-2 in a human embryonickidney cell line. Growth Regul. 4, 136-146.

BROWN, A.L., and RECHLER, M.M. (1990). Cloning of the rat in-sulin-like growth factor binding protein-2 gene and identification ofa functional promoter lacking a TATA box. Mol. Endocrinol. 4,2039-2051.

BROWN, A.L., CHIARIOTTI, L., ORLOWSKI, C.C., MEHLMAN,T., BURGESS, W.H., ACKERMAN, E.J., BRUNI, C.B., and RECH-LER, M.M. (1989). Nucleotide sequence and expression of a cDNA

REVERSE LIGATION-PCR 739

clone encoding a fetal rat binding protein for insulin-like growth fac-tors. J. Biol. Chem. 264, 5148-5154.

CHOMCZYNSKI, P., and SACCHI, N. (1987). Single-step method ofRNA isolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal. Biochem. 162, 156-159.

CLEMMONS, D.R. (1992). IGF binding proteins: Regulation of cel-lular actions. Growth Regul. 2, 80-87.

DECHJARA, T.M., ROBERTSON, E.J., and EFSTRATIADIS, A.(1991). Parental imprinting of the mouse insulin-like growth factorJJ gene. Cell 64, 849-859.

FABER, P.W., VAN ROOD, H.C.J., SCHIPPER, HJ., BRINKMANN,A.O., and TRAPMAN, J. (1993). Two different, overlapping path-ways of transcription initiation are active on the TATA-less humanandrogen receptor promoter. J. Biol. Chem. 268, 9296-9301.

FROMONT-RACINE, M., BERTRAND, E„ PICTET, R., andGRANGE, T. (1993). A highly sensitive method for mapping the 5'termini of mRNAs. Nucleic Acids Res. 21, 1683-1684.

HU, G. (1993). DNA polymerase-catalyzed addition of nontemplatedextra nucleotides to the 3' end of a DNA fragment. DNA Cell Biol.12, 763-770.

JAVAHERY, R., KHACHI, A., LO, K., ZENZIE-GREGORY, B., andSMALE, ST. (1994). DNA sequence requirements for transcrip-tional initiator activity in mammalian cells. Mol. Cell. Biol. 14,116-127.

KOLLMAR, R., and FARNHAM, P.J. (1993). Site-specific initiationof transcription by RNA polymerase II. Proc. Soc. Exp. Biol. Med.203, 127-139.

KOLLMAR, R., SUKOW, K.A., SPONAGLE, S.K., and FARNHAM,P.J. (1994). Start site selection at the TATA-less carbamoyl-phos-phate synthase (glutamine-hydrolyzing)/aspartate carbamoyltrans-ferase/dihydroorotase promoter. J. Biol. Chem. 269, 2252-2257.

KUTOH, E., MARGOT, J.B., and SCHWANDER, J. (1993). Genomicstructure and regulation of the promoter of the rat insulin-like growthfactor binding protein-2 gene. Mol. Endocrinol. 7, 1205-1216.

LANDWEHR, J., KAUPMANN, K., HEINRICH, G, and SCHWAN-DER, J. (1993). Cloning and characterization of the gene encodingmurine insulin-like growth factor-binding protein-2, mIGFBP-2.Gene 124, 281-286.

LIU, J.-P., BAKER, J., PERKINS, A.S., ROBERTSON, E.J., and EF-STRATIADIS, A. (1993). Mice carrying null mutations of the genesencoding insulin-like growth factor I (Igf-1) and type 1 IGF recep-tor (Igflr). Cell 75, 59-72.

LU, J., LEE, W., JIANG, C, and KELLER, E.B. (1994). Start site se-

lection by Spl in the TATA-less human Ha-ras promoter. J. Biol.Chem. 269, 5391-5402.

MCKEON, C, MONCADA, V., PHAM, T., SALVATORE, P., KAD-OWAKI, T., ACCILI, D., and TAYLOR, S.I. (1990). Structural andfunctional analysis of the insulin receptor promoter. Mol. Endocrinol.4, 647-656.

O'SHEA-GREENFIELD, A., and SMALE, ST. (1992). Roles ofTATA and initiator elements in determining the start site locationand direction of RNA polymerase II transcription. J. Biol. Chem.267, 1391-1402.

OOI, G.T., ORLOWSKI, C.C, BROWN, A.L., BECKER, R.E., UN-TERMAN, T.G., and RECHLER, M.M. (1990). Different tissue dis-tribution and hormonal regulation of mRNAs encoding rat insulin-

like growth factor binding proteins rIGFBP-1 and rIGFBP-2. Mol.Endocrinol. 4, 321-328.

ORLOWSKI, C.C, BROWN, A.L., OOI, G.T., YANG, Y.W-H.,TSENG, L.Y-H., and RECHLER, M.M. (1990a). Tissue, develop-mental and metabolic regulation of mRNA encoding a rat insulin-like growth factor binding protein (rIGFBP-2). Endocrinology 126,644-652.

ORLOWSKI, C.C, OOI, G.T., and RECHLER, M.M. (1990b).Dexamethasone stimulates transcription of the insulin-like growthfactor binding protein-1 (IGFBP-1) gene in H4-II-E rat hepatomacells. Mol. Endocrinol. 4, 1592-1599.

PUGH, B.F., and TJIAN, R. (1990). Mechanism of transcriptional ac-tivation by Spl: evidence for coactivators. Cell 61, 1187-1197.

PUGH, B.F., and TJIAN, R. (1991). Transcription from a TATA-lesspromoter requires a multisubunit TFIID complex. Genes Dev. 5,1935-1945.

RECHLER, M.M. (1993). Insulin-like growth factor binding proteins.Vitamins & Hormones 47, 1-114.

STRAUS, D.S., and TAKEMOTO, CD. (1990). Effect of dietary pro-tein deprivation on insulin-like growth factor (IGF)-I and II, IGFbinding protein-2, and serum albumin gene expression in rat. Endo-crinology 127, 1849-1860.

STRAUS, D.S., and TAKEMOTO, CD. (1991). Specific decrease inliver insulin-like growth factor-I and brain insulin-like growth fac-tor-U gene expression in energy-restricted rats. J. Nutr. 121, 1279-1286.

SUH, D-S., OOI, G.T., and RECHLER, M.M. (1994). Identification ofcis-elements mediating the stimulation of rat insulin-like growth fac-tor binding protein-1 promoter activity by dexamethasone, cyclicAMP and phorbol esters, and the inhibition by insulin. Mol. Endo-crinol. 8, 794-805.

TSENG, L.Y.-H., OOI, G.T., BROWN, A.L., STRAUS, D.S., andRECHLER, M.M. (1992). Transcription of the insulin-like growthfactor binding protein-2 gene is increased in neonatal and fasted adultrat liver. Mol. Endocrinol. 6, 1195-1201.

UNTERMAN, T.G., LACSON, R.G., MCGARY, E., WHALEN, C,PURPLE, C, and GOSWAMI, R.G. (1992). Cloning of the rat in-sulin-like growth factor binding protein-1 gene and analysis of its 5 '

promoter region. Biochem. Biophys. Res. Commun. 185, 993-999.YANG, Y.W-H., BROWN, A.L., ORLOWSKI, C.C, GRAHAM, D.E.,

TSENG, L.Y-H., ROMANUS, J.A., and RECHLER, M.M. (1990).Identification of rat cell lines that preferentially express insulin-likegrowth factor binding proteins rIGFBP-1, 2, or 3. Mol. Endocrinol.4, 29-38.

Address reprint requests to:Dr. Yves R. Boisclair

Growth and Development Section, NIDDKDNational Institutes of Health

Building 10, Room 8D14Bethesda, MD 20892

Received for publication December 15, 1994; accepted March27, 1995.