Supplementary data

Analysis of DNA methylation in single circulating tumor cells

Constantin F. Pixberg1, Katharina Raba2, Fabienne Müller1, Bianca Behrens1, Ellen Honisch3, Dieter

Niederacher3, Hans Neubauer3, Tanja Fehm3, Wolfgang Goering4, Wolfgang A. Schulz4, Penny Flohr5,

Gunther Boysen5, Maryou Lambros5, Johann S. De Bono5, Wolfram T. Knoefel1, Christoph Sproll6,

Nikolas H. Stoecklein1,7,* and Rui P. L. Neves1,7

1Department of General, Visceral and Pediatric Surgery, University Hospital and Medical Faculty of the

Heinrich-Heine University Düsseldorf, Düsseldorf, 40225, Germany2Institute for Transplantation Diagnostics and Cell Therapeutics, University Hospital and Medical

Faculty of the Heinrich-Heine University Düsseldorf, Düsseldorf, 40225, Germany3Department of Obstetrics and Gynecology, University Hospital and Medical Faculty of the Heinrich-

Heine University Düsseldorf, Düsseldorf, 40225, Germany4Department of Urology, University Hospital and Medical Faculty of the Heinrich-Heine University

Düsseldorf, Düsseldorf, 40225, Germany5Division of Cancer Therapeutics and Division of Clinical Studies, The Institute of Cancer Research,

London, SM2 5NG, United Kingdom; Drug Development Unit, The Royal Marsden NHS Foundation

Trust, London, SW3 6JJ, United Kingdom.6Department of Oral, Maxillo- and Plastic Facial Surgery, University Hospital and Medical Faculty of

the Heinrich-Heine University Düsseldorf, Düsseldorf, 40225, Germany7The authors contributed equally to this manuscript

* To whom correspondence should be addressed.

1

Supplementary Table S1 – Number of CTCs detected with the CellSearch system in the different patient samples and number of CTCs analyzed for methylation

Patient ID Number of CTCs detected in 7.5ml blood

Number of CTC analyzed for DNA methylation

1 2913 102 92 53 206 104 520 55 223 106 18 47 127 58 30 59 6700 10

10 392 2011 3723 10

Note: Enriched CTCs in the CellSearch cartridges were independently identified and enumerated by two trained operators.

Supplementary Table S2 - Primersusedinthe single and multiplex-PCRs

Locus ID Orientation Sequence Amplicon length

miR-200c/141forward GGGATGAGGGTGGGTAAAT

134bpsreverse RAAACCCAAATTACAATCCAAAC

miR-200b/a/429forward ATTTGTGTAGGTTTGAATTGATTTTTTGTGTTAGGG

130bpsreverse TAAATACTCTACCTCAACCAAAATCAAACCTCAAAAC

CDH1 forward GTYGGAATTGTAAAGTATTTGTGAGTTTG 143bpsreverse AAAAACTACRACTCCAAAAACCCATAACTAACC

Supplementary Table S3 – Primers usedforSanger sequencing

Locus ID Orientation Sequence

miR-200c/141forward GGGATGAGGGTGGGTAAATreverse RAAACCCAAATTACAATCC

miR-200b/a/429forward ATTTGTGTAGGTTTGAATTGreverse TAAATACTCTACCTCAACCA

CDH1forward GTYGGAATTGTAAAGTATTTGreverse AAAAACTACRACTCCAAAAA

2

Supplementary Table S4 – Degree of methylation previously reported for miR-200c/141, miR-200b/a/429 and CDH1 loci in MDA-MB-231 and MCF-7 cell lines

Cell line miR-200c/141 miR-200b/a/429 CDH1

MDA-MB-231

90.9%(Davalos et al. 2011)

71,5%(Neves et al. 2010)

41.7%(Davalos et al. 2011)

23%(Farias et al. 2010)

MCF-70%

(Davalos et al. 2011;Neves et al. 2010)

5.5%(Davalos et al. 2011)

0.0%(Brambert et al. 2015)

3

Supplementary Figure S1

Flow cytometry sorting of single cell line cells. Before sorting, cells were stained with Propidium iodide (PI) (3 μM, Molecular Probes™) for 5 min at room temperature and protected from light. Single cell isolation was performed by flow cytometry on a MoFlo XDP sorter (Beckman Coulter) using the instrument settings as previously described (Neves, Raba et al. 2014). In the present work, sorting protocol included the analysis of the height of the Forward and Side Scatter signals (FSC Height and‐ SSC-Height, respectively) to differentiate intact cells from cell debris; the analysis of PI staining to differentiate living from dead cells; and the analysis of the width of the Side Scatter signals (SSC‐Width) to ensure selection of single cells and exclusion of cellular aggregates. (Upper panel) Flow cytometry analysis of the lymphocyte cell line without applying gates. (Lower panel) Flow cytometry analysis of the same sample as in the upper panel showing the gates (R1, R2, and R3) used sequentially to identify intact living single cells, defined as FSC-HeightHigh/PINeg/SSC Width‐ Low events. R3-gated events were sorted into individual empty PCR tubes. The efficiency of the MoFlo XDP flow cytometer to sort and deposit single events under the sorting conditions used had been previously determined and calculated to be 99.3% (137/138) (Neves, Raba et al. 2014).

4

Supplementary Figure S2

PCR strategy used in multiplexed-scAEBS. The PCR strategy consisted of two rounds of amplification: a multiplex pre-amplification containing the primers for all three promoters (miR-200c/141; miR-200b/a/429 and CDH1), and subsequent amplification of each promoter in three individual reactions. Primers were designed using the Bisulfite Primer Seeker 12S software (Zymoresearch) and are listed in Supplementary Table S2. In both rounds of amplification it was used the PyroMark PCR kit (Qiagen). Before the first round of amplification, the agarose bead containing the converted DNA was melted at 75°C, and 17µl of pre-amplification mix (5 pmol of each primer, 12.5 µl of PyroMark PCR Master Mix, 2.5 µl of optimized CoralLoad Concentrate, in water) was added to the melted agarose bead. The final reaction volume was 25 µl. The tube was shortly vortex to avoid re-solidification of the agarose, shortly centrifuged, and transferred to the thermal cycler to start pre-amplification. The thermal cycler conditions are indicated on the text box in the right side. For the second round of amplification, 1 µl of the pre-amplified PCR product was combined with 24 µl of PCR mix (5 pmol of each primer [Supplementary Table S2], 12.5 µl of PyroMark PCR Master Mix, 2.5 µl of optimized CoralLoad Concentrate, in water). The thermal cycler conditions are indicated on the text box in the right side. To confirm amplification success, 5 µl (from 25µl) of PCR-product were run on 1.5% agarose gel. Only experiments showing no amplification products on the two no-template negative controls (NTCs) were considered.

5

Supplementary Figure S3

Promoter fragments analyzed for DNA methylation. Each of three diagrams represents the promoter region of miR-200c/141; miR-200b/a/429 and CDH1 genes, as indicated. In each diagram, the blue lines represent a fragment of their promoter region flanking the transcription starting site (TSS), and which is indicated by the arrows. The green lines represent the fragments investigated in previous publications in epithelial- and mesenchymal-like cells (Farias, Petrie et al. 2010, Neves, Scheel et al. 2010, Davalos, Moutinho et al. 2011, Brambert, Kelpsch et al. 2015). The black lines represent the fragments analyzed in the present work (Pixberg et al. 2016) and amplified by the primers listed in Supplementary Table S2. At the bottom of each diagram, are represented again the analysed regions in a higher scale, indicating the position of CpG dinucleotides (small vertical lines).

6

Supplementary Figure S4

Evaluation of the protocols for single-cell agarose embedded bisulfite sequencing. After bisulfite conversion of 3 pools of 100 LCL cells and 10 single LCL cells according to the AEBS, scAEBS pre, and scAEBS protocols, the converted DNA was tested in PCR for amplification of miR-200c/141 (134bps) promoter fragment. The agarose bead containing the converted DNA was melted at 75°C and used directly for PCR. For AEBS, 3/20µl of the agarose bead was used while for scAEBSpre and scAEBS the complete agarose bead was used. 17µl of an amplification mix containing 5 pmol of each primer for miR-200c/141 (Supplementary Table S2), 12.5 µl of PyroMark PCR Master Mix (Qiagen) and 2.5 µl of optimized CoralLoad Concentrate (Qiagen), was added to the melted bead. PCR was carried out as follows: pre incubation at 95°C for 15 min, followed by 50 cycles of denaturation at 94°C for 30 sec,‐ annealing at 58.8°C for 30 sec, and extension at 72°C for 30 sec. Reaction included also a final extension step at 72°C for 10 min. In each experiment two negative controls for the bisulfite conversion (NTCs BC#1 and #2) and one negative control for PCR (NTC PCR) were included. After PCR 5µl/25µl of PCR product were used for gel-electrophoresis.

7

Supplementary Figure S5

Sequencing analysis of miR-200c/141 promoter of a single cell processed with scAEBS protocol. (A) Diagram showing the analyzed region on miR-200c/141 highlighting the investigated eleven CpG spots. (B) (Upper panel) Electropherogram obtained after sequencing the PCR-product with the Forward Primer. (Lower panel) Electropherogram obtained with the Reverse Primer. The sections of the electropherograms confidently used for analysis are shaded in light blue. The individual CpG spots are numbered in accordance to (A). The binding sequence of the primers is indicated.

8

Supplementary Figure S6

Conversion rate obtained with the scAEBS protocol. CpG- and CpH-cytosines at miR-200c/141, miR-200b/a/429 and CDH1 gene promoter fragments analyzed with the scAEBS protocol using 50° or 56° as indicated. Analyses were done for 8 and 20 single LCL cells. Conversion rate was calculated by the ratio between converted CpHs and all CpHs. Hemiconverted CpHs have been valued as 0.5 and fully converted CpHs as 1.

9

Supplementary Figure S7

Methylation in single and patient-derived CTCs and CD45pos cells (A) Methylation patterns of 94 single CTCs isolated from 11 patients with metastatic breast cancer. (B) Methylation patterns of 65 single CTCs isolated from 6 patients with metastatic castration-resistant prostate cancer. (C) Methylation patterns of 20 single CD45pos cells isolated from three patients with metastatic breast cancer. In (A), (B) and (C), white circles represent unmethylated CpG-cytosines, blue circles represent hemimethylated CpG-cytosines, and black circles represent methylated CpG-cytosines.

10

Supplementary References

Brambert, P. R., D. J. Kelpsch, R. Hameed, C. V. Desai, G. Calafiore, L. A. Godley and S. L. Raimondi (2015). "DNMT3B7 expression promotes tumor progression to a more aggressive phenotype in breast cancer cells." PLoS One 10(1): e0117310.

Davalos, V., C. Moutinho, A. Villanueva, R. Boque, P. Silva, F. Carneiro and M. Esteller (2011). "Dynamic epigenetic regulation of the microRNA-200 family mediates epithelial and mesenchymal transitions in human tumorigenesis." Oncogene 31(16): 2062-2074.

Farias, E. F., K. Petrie, B. Leibovitch, J. Murtagh, M. B. Chornet, T. Schenk, A. Zelent and S. Waxman (2010). "Interference with Sin3 function induces epigenetic reprogramming and differentiation in breast cancer cells." Proc Natl Acad Sci U S A 107(26): 11811-11816.

Neves, R., C. Scheel, S. Weinhold, E. Honisch, K. M. Iwaniuk, H. I. Trompeter, D. Niederacher, P. Wernet, S. Santourlidis and M. Uhrberg (2010). "Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells." BMC Res.Notes 3: 219.

Neves, R. P., K. Raba, O. Schmidt, E. Honisch, F. Meier-Stiegen, B. Behrens, B. Mohlendick, T. Fehm, H. Neubauer, C. A. Klein, B. Polzer, C. Sproll, J. C. Fischer, D. Niederacher and N. H. Stoecklein (2014). "Genomic high-resolution profiling of single CKpos/CD45neg flow-sorting purified circulating tumor cells from patients with metastatic breast cancer." Clin Chem 60(10): 1290-1297.

11