Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
Direct Multiple Shoot Regeneration from Shoot Tip and Nodal Explants of Solanum NigrumL. A Medicinal Herb........................................................................................................................65
M.S. Kavitha, E.G. Wesely and P. Mehalingam.
The Effect of Hot Water Treatments on Gray Mold and Physicochemical Quality of Kiwi
fruit During Storage................................................................................................................................73
J. Fattahi Moghadam and H. Ebadi.
Molecular Cloning and Analysis of Two Flowering Related Genes from Apple (Malus ×domestica)................................................................................................................................................83
N. Mahna and B. Baghban Kohneh Rouz.
Copper Effects on Growth Parameters of Hollyhock (Althaea rosea L.)...........................................95
M. Kamali, M. Sarcheshme Pour and A.A. Maghsoudi Moud.
Controlling Ornamental Cabbage and Kale (Brassica oleracea) Growth via Cycocel .....................103
A. Gholampour, D. Hashemabadi, Sh. Sedaghathoor and B. Kaviani.
Susceptibility Assessments of Tomato Genotypes to Root-Knot Nematodes, Meloidogynejavanica.....................................................................................................................................................113
M. Nasr Esfahani, A.R. Ahmadi and K. Shirazi.
Effect of Pre-Treated Chemicals on Keeping Quality and Vase Life of Cut Rose (Rosa hybridacv.‘ Yellow Island’)........................................................................................................................123
M.B. Hoseinzadeh Liavali and M. Zarchini.
Evaluation of Antipyretic Activity of Pedalium murex Against Brewer’s Yeast-Induced
Pyrexiain Rats.................................................................................................................................................131
V. Siva, N.J. Jeffrey Bose, P. Mehalingam and A. Thanga Thirupathi.
Vol 2(2), June 2012
Journal of
Ornamental and Horticultural Plants
It is approved publication of Journal of Ornamental and Horticultural Plants (JOHP) based on
approbation of 61st session of "Survey and Confirmation Commission for Scientific Journals" at
Islamic Azad University dated on 01/25/2010.
Publisher: Islamic Azad University, Rasht, Iran.
Executive Director: Dr. Ali Mohammadi Torkashvand
Editor-in-Chief: Dr. Davood Hashemabadi
Executive Manager: Dr. Shahram Sedaghat Hoor
Editorial Board:
Professor Ramin, A., Isfahan University of Technology, Iran
Associated Professor Naderi, R., University of Tehran, Iran
Professor Aytekin, P., Ataturk University, Antakya, Turkey
Professor Honarnejad, R., Islamic Azad University-Varamin Branch, Iran
Professor Peyvast, G., University of Guilan, Iran
Professor Nagar, P.K., Institute of Himalayan Bio-Resource Technology, India
Assistant Professor YU,W., The Chinese University of Hongkong
Associated Professor Hokmabadi, H., Pistachio Research Institute, IranProfessor Salah El Deen, M.M., Al Azhr University, EgyptAssociate Professor Qureshi, R., Pir Mehr Ali Shah Arid Agriculture University, Pakistan
Assistant Editor: Zahra Bagher Amiri
Abstracting/Indexing
SID, Index Copernicous, Islamic World Science Citation Center (ISC), Open-J-Gate, Magiran,
EBSCO.
Journal of Ornamental and Horticultural Plants (JOHP) is an international journal devoted to the
publication of original papers and reviews in the ornamental and horticultural fields. Articles in the
journal deal with Floriculture, Olericulture, Pomology, Medicinal and Aromatic Plants and Landscape.
The scope JOHP includes all ornamental and horticultural crops even medicinal plants. All articles
published in JOHP are peer-reviewed. The journal is concerned with ornamental, vegetables and
fruits crops, and covers all aspects of physiology, molecular biology, biotechnology, protected
cultivation, and environmental areas of plants.
Publication schedule: The journal publishes: (i) article on original research in ornamental and
horticultural plants and related fields that contain new information for solving ornamental and
horticultural problems, of world, (ii) invitational papers and review article which concentrate on
particular subject of interest to horticultural science.
Submission of article: Typescripts should be submitted in Journal of Ornamental and Horticultural
Plants (IAU-Rasht Branch, Rasht, Iran) by email: [email protected]. Authors are urged to
refer to “Instruction to Authors” (published in all issues before submission of their typescripts).
Address: Islamic Azad University, Rasht, Iran.
Telfax: 0131- 4224069, email: [email protected]
Web Site: www. jornamental.com
Direct Multiple Shoot Regeneration from Shoot Tip and Nodal Explants of Solanum Nigrum L. A
Medicinal Herb..................................................................................................................................65
The Effect of Hot Water Treatments on Gray Mold and Physicochemical Quality of Kiwi fruit
During Storage...............................................................................................................................................73
Molecular Cloning and Analysis of Two Flowering Related Genes from Apple (Malus ×domestica).......................................................................................................................................................83
Copper Effects on Growth Parameters of Hollyhock (Althaea rosea L.)...........................................95
Controlling Ornamental Cabbage and Kale (Brassica oleracea) Growth via Cycocel .....................103
Susceptibility Assessments of Tomato Genotypes to Root-Knot Nematodes, Meloidogynejavanica...............................................................................................................................................................113
Effect of Pre-Treated Chemicals on Keeping Quality and Vase Life of Cut Rose (Rosa hybrida cv.‘
Yellow Island’)...................................................................................................................................123
Evaluation of Antipyretic Activity of Pedalium murex Against Brewer’s Yeast-Induced Pyrexiain
Rats....................................................................................................................................................131
Content Page
www.jornamental.com
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 2012 65
Direct Multiple Shoot Regeneration from Shoot Tip and
Nodal Explants of Solanum Nigrum L. A Medicinal Herb
In vitro multiple shoot regeneration of Solanum nigrum L., an Indian
medicinal plant was accomplished on MS medium utilizing shoot tip and
nodal explants. Direct multiple shoots differentiated within 6 weeks when
explants were cultured on MS medium containing BAP (1.0 – 5.0 mg/l) and
KIN (1.0 – 5.0 mg/l) individually. Among various concentrations of cytokinins
tested, maximum number of multiple shoots was obtained on MS medium
supplemented with BAP (1.0 mg/l) from shoot tip (20.4 ± 0.22) and MS
medium supplemented with BAP (3.0 mg/l) from nodal explants (8.4 ± 0.22).
The in vitro regenerated shoots were rooted (8.4 ± 0.16 roots per shoot) on MS
medium supplemented with NAA (1.0 mg/l) within 2-3 weeks of culture and
the regenerated plantlets could be successfully established in soil where they
grow normally.
Keywords: BAP, Black nightshade, Micropropagation, NAA, Solanaceae.
M.S. Kavitha1, E.G. Wesely2 and P. Mehalingam3
1Centre for Biotechnology, Muthayammal College of Arts & Science, Rasipuram-637408, Tamil Nadu,
India. 2PG Department of Botany, A.A. Government Arts College, Namakkal, Tamil Nadu, India.3Research Centre in Botany, V.H.N. Senthikumara Nadar College, Virudhunagar, Tamil Nadu India.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 201266
INTRODUCTION
Solanum nigrum L. (Family: Solanaceae) commonly known as black nightshade is an herba-
ceous annual plant. It has been utilized as a general promoter of health in medicine (Jain et al.,2011). The plant is effective in the treatment of cirrhosis of the liver (Lin et al., 2008). The plant
is also credited with emollient, diuretic, antiseptic and laxative properties (Kiritikar and Basu,
1935, Jain, 1968). Solanum nigrum was found to possess lot of medicinal properties including
anti-tumour, liverfibrosis inhibitory activity, hepatoprotective activity, antiulcer activity, etc., (Jian
Lia et al., 2008, Jain et al., 2011). This can be also utilized for bioremediation of land having heavy
metal contamination (Shuhe Wei et al., 2006).
Micropropagation via shoot culture, often utilized to maintain clonal fiedility, would be a
special advantage in this case (Franca et al., 1995). Most of the secondary metabolites start to ac-
cumulate when the proper organs are regenerated from the cultured cells. Production of these com-
pounds in cultured cells requires decoupling of biochemical differentiation from morphological
differentiation, which has so far been successful. This situation makes organ cultures a favored
option. Shoot cultures have been considered appropriate when the target secondary metabolites
are produced in aerial parts of the plant (Saito and Mizukami, 2002). Hence, the purpose of this
study was to develop in vitro propagation methods from shoot tip and nodal explants of Solanumnigrum. Few preliminary studies on Solanum nigrum, with a limited success, have been reported
on in vitro regeneration of the plants. Amzad Basha Kolar et al., (2008) reported that highest fre-
quency of multiple shoots was obtained from nodal explants on MS containing 6.0 mg/l BAP and
0.5 mg/l IAA. Direct organogenesis and in vitro flowering was obtained in Solanum nigrum by
Venugopal et al., (2005). The highest frequency and number of multiple shoots were obtained from
leaf and nodal explants on MS medium supplemented with benzyladenine and IAA. Sathish et al.,(2010) reported the production of synthetic seeds from Solanum nigrum by using in vitro proliferated
shoot tip explants. In vitro regeneration of Solonum nigrum with enhanced solasodine production
was achieved by using leaf explants on MS medium fortified with BAP (2.0 mg/l) and KN (1.5
mg/l) (Bhat et al., 2010). In vitro regeneration of Solanum nigrum with a high power of alkaloid
accumulation was achieved on MS-basal medium containing BA and NAA (0.5 mg/ml each). A se-
ries of in vitro and in vivo plants were successfully produced and chemical analysis revealed contents
of glycoalkaloids higher than those reported for intact field plants (Hanan et al., 2010).
The regeneration technique has to be improved in order to use this system for effective
clonal propagation; supplying these plants for phytopharamceutical industries for the production
of phytopharmaceuticals at large scale level and genetic improvement of the plant through trans-
formation. As a first step towards establishing a system to achieve this goal, we report a reliable
and efficient protocol for shoot regeneration of Solanum nigrum using different explants such as
shoot tip and node.
MATERIALS AND METHODS
The plantlets were collected from Botanical Garden of Muthayammal College of Arts and
Science, Rasipuram. The shoot tip and nodal explants were washed thoroughly under running tap
water for 10 min followed by treatment with solution of 0.1% bavistin (fungicide) for 1 min and
thereafter washed thoroughly under running tap water for 15 min to completely remove the fun-
gicide. The explants were then transferred to the sterile hood and surface disinfected with
0.1%(w/v) HgCl2 for different time intervals (3-8 min) and finally rinsed with sterile distilled
water for 3-4 times. The explants were blotted dry before inoculation. The explants were then
trimmed at both the ends prior to inoculation. MS medium fortified with various concentrations
of cytokinins such as BAP (1.0 mg/l - 5.0 mg/l) and KIN (1.0 mg/l - 5.0 mg/l) were investigated
for to optimize hormonal requirements for multiple shoot induction from shoot tip and nodal ex-
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 2012 67
plants. The effect of auxins on multiple shoot induction was tested by using BAP (1.0 mg/l) and
NAA, IAA (0.1 – 1.0 mg/l) individually. Single disinfected explants were culture on MS media
(Murashige and Skoog, 1962) basal medium supplemented with 100 mg/l myo-inositol and 3%
w/v sucrose. The pH of the medium (supplemented with respective growth regulators) was adjusted
to 5.7±0.1 using 1N HCl or 1N NaOH before adding 0.8 % agar (Himedia Mumbai). The medium
was dispensed into culture tubes and was subsequently autoclaved under 105 kPa at a temperature
at 121°C for 15 min. The explants were implanted vertically on the culture medium (test tubes
[150 cm x 25 mm] containing 15 ml medium) and plugged tightly with non-absorbent cotton. All
the cultures were incubated at 25±2°C under 16 h photoperiod of 45-50 µmol m-2 S-1 irradiance
provided by cool white fluorescent tubes (Philips, India) and with 55-60% relative humidity. All
subsequent subculture was done at 4 week intervals. For rooting, single shoot was excised and
transferred individually to MS medium containing NAA (0.1-1.0 mg/l). Each and every experiment
was performed with 10 replicates and repeated twice. For hardening, the rooted plants were trans-
ferred to plastic vessels containing sterilized sand and vermiculture (1:1) and maintained in the
same culture conditions. They were covered with polythene bags. After 12 days polythene bags
were removed and these plantlets were placed under shade in the laboratory for 3 weeks and finally
established in the field.
RESULTS
Multiple shoot development was observed directly from shoot tip and nodal explants on
MS medium fortified with different concentrations (1.0 – 5.0 mg/l) of BAP and KIN individually.
Of the various concentrations (1.0 – 5.0 mg/l) of BAP tested for multiple shoot induction from
shoot tip, 1.0 mg/l produced the maximum number (20.4 ± 0.22) of shoots per explants with the
maximum percentage of response (79.8%). Shoot tip explants cultured on MS medium supple-
mented with KIN (3.0 mg/l) produced the maximum number of shoots (12.6 ± 0.68) per explants
(Table 1, Fig. 1). The nodal explants produced the maximum number (8.4 ± 0.22 per explants) of
shoots on MS medium fortified with BAP (3.0 mg/l). Nodal explants cultured on MS medium sup-
plemented with 5.0 mg/l of KIN produced 7.0 ± 0.83 shoots per explants (Table 1, Fig. 1). The ex-
plants cultured on MS medium supplemented with BAP (1.0 mg/l) and different concentrations
(0.1 – 1.0 mg/l) of auxins (NAA, IAA) individually showed only callus formation. The regenerated
shoots transferred individually into MS solid medium containing NAA (0.1- 1.0 mg/l) for rooting.
The root initiation was observed from 0.3 to 1.0 mg/l concentration. The maximum number of
roots (8.4 ± 0.16) was observed in MS medium supplemented with NAA (1.0 mg/l) (Fig. 1, Table
2). In vitro raised plantlets resumed normal growth was transferred to plastic cups filled with sand
and soil (1:1) and developed healthy leaves 2 weeks after transplantation. The plantlets transferred
to the field where they grew normally.
DISCUSSION
Raising the demand for wild source herbal source, herbal drugs has abetted over the ex-
ploitation of medicinal plants, leading to cumulative and sustainable use of forest wealth. The im-
portance of conservation of genetic resources cannot be over emphasized. The maintenance of
living material by traditional method is expensive, laborious and risky. Clonal propagation through
tissue cultures offers an alternative to vegetative practices used in the past and has the potential to
provide high multiplication of uniform genotypes, resulting in short term gains (Sacha L. Beck etal., 1998). Beta 2-solamargine , solamargine , solanoside and degalactotigonin are the important
secondary metabolites of Solanum nigrum. The shoot tip and nodal culture could be a valuable
technique for the production of these secondary metabolites in large scale (Sen and Sharma, 1999).
In the present study on MS basal medium the explants (shoot tip and node) shriveled within
3 weeks after emergence of 2-3 leaves without forming the multiple shoot. Similar results have
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 201268
also reported in Ocimum sanctum (Girija et al., 2006). These findings suggested that endogenous
levels of hormones present in these explants are not sufficient to sustain their growth in the basal
medium. MS medium supplemented with BAP or Kin induced multiple shoots from both the shoot
tip and nodal explants. However, MS medium supplemented with BAP (1.0 mg/l) was found to
produce the maximum number multiple shoots than the KIN or BAP in combination with NAA or
2,4-D individually. The BAP is the most efficient cytokinin in promoting adventitious shoot for-
mation in many plants (Pirek, 1987). BA was superior to KIN in inducing high frequency shoot
regeneration in many numbers of plants (Devendra et al., 2010; Malek et al., 2010; Johnson and
Manickam, 2003; Johnson et al., 2004; Johsnon et al., 2007). Combination of auxin and cytokinin
favored shoot bud differentiation in many plants (Sudha et al., 2005; Sanjaya Rathore et al., 2005).
In contrast in the present study, when the explants cultured on MS medium supplemented with
BAP and NAA/2, 4-D individually showed only callus formation without multiple shoot induction.
This may be due to the fact that requirement of cytokinin and auxin depends on the endogenous
levels these substances in the tissues used for the culture (Gupta, 1998). Shoot tip explants were
found to be an excellent explants source to induce direct organogenesis than nodal explants in
Solanum nigrum. The shoot tips are better than nodal segment for multiple shoot production be-
cause of the higher cytokinin to auxin ratio present in the shoot tip. Similarly the shoot tip was
found to be the superior explants for micropropagation in many number of plants, for example
Cannabis sativa (Ren Wang et al., 2009); Boehmeria nivea (L) Gaud (Sut et al., 2004), Ocimum
sanctum (Girija et al., 2006), Alternanthera sessils (Wesely et al., 2011), Lippia nodiflora (Evelyne
Priya, S and Ravindhran, R., 2011), Cicer arietinum (Islam et al., 1995) and Stevia rebaudiana
Bert., (Arpita Das et al., 2011). The percentage of shoots forming roots and the number of roots
per shoot significantly varied depending on concentrations of NAA. The maximum number of
roots was obtained in medium containing 1.0 mg/ l NAA. Root development was; however, slow
at lower concentrations of NAA. Jabeen et al., (2005) reported that NAA was a more effective
rooting agent for Solanum nigrum. On the other hand Sundari et al. (2010) observed only 3-4 roots
on MS medium supplemented with combination of IAA (5.58 μM) IBA (4.92 μM). NAA was also
found to promote rooting in many numbers of plants (Gyana Ranjan Rout, 2004; Mohammad Anis
et al., 2003; Kambaska Kumar Behera and Santilata Sahoo, 2009; Andrew Riseman and Siva
Chennareddy, 2004).
In the present study the effective multiple shoot regeneration for maximum number of
shoots was accomplished on MS medium supplemented with BAP (1.0 mg/l) from shoot tip ex-
plants of Solanum nigrum and using this procedure the plants can be regenerated on a large scale
under in vitro conditions in a short span of time. The protocol standardized here could be used to
isolate medicinally important secondary metabolite from the multiple shoots and this protocol
would also have importance in genetic transformation of this medicinally important plant.
Literature Cited
Anis, M., Faisal, M. and Singh, S. K. 2003. Micropropagation of mulberry (Morus alba L.) through in
vitro culture of shoot tip and nodal explants. Plant Tissue Cult. 13(1): 47-51.
Bhat, M.A., Mujib, A., Junaid, A. and Mohamooduafar, M. 2010. In vitro regeneration of Solanumnigrum with enhanced solasodine production. Biologia Plantarum. 54(4): 757-760.
Das, A., Gantait, S., and Mandal, N. 2011. Micropropagation of an elite medicinal plant: Stevia rebaudianaBert. International Journal of Agricultural Research. 6: 40-48.
Devendra, N.K., Rajanna, L., Sheetal, C. and Seetharam, Y.N. 2008. In vitro clonal propagation of
Trichosanthes cucumerinaL.var. cucumerina. Plant Tissue Culture and Biotechnology. 18(2): 103-111.
Evelyne Priya, S. and Ravindhran, R. 2011. Micropropagation of Lippia nodiflora using shoot tip and
nodal explants under in vitro conditions. International Journal of Current Research. 3(10): 043-047.
Franca, S.C., Bertoni, B.W. and Dereirea, M.S. 1995. Antihepatotoxic agent in micropropagated plantlets
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 2012 69
of Eclipta alba. Plant Cell Tissue and Organ Culture. 40: 297-299.
Girija, S., Kavitha, S. and Deepavathi, S. 2006. Direct multiple shoot regeneration from shoot tip and
nodal explants of Ocimum sanctum L. (Tulsi): a medicinal herb. Plant cell Biotechnology and
Molecular Biology. 7: 23-28.
Gupta, P.K. 1998. Elements of biotechnology, Rastogi publications, India.
Gyana Ranjan, R. 2004. Effect of cytokinins and auxins on micropropagation of Clitoria ternatea L.
Biol. Lett. 41(1): 21.26.
Hanan, Abd, Al-Hay and Al-Ashaal, A. 2010. Regeneration, in vitro glycoalkaloids production and
evaluation of bioactivity of callus methanolic extract of Solanum tuberosum L. Fitoterapia. 81(6):
600-606
Islam, R., Riazuddin, S. and Farooqui, H. 1995. Clonal propagation from seedling nodes and shoot apices
of chickpea (Cicer arietinum L.). Plant Tissue Culture. 5(1): 53-57.
Jabeen, F.T.Z., Venugopal, R.B., Kiran, G., Kaviraj, C.P. and Rao, S. 2005. Plant regeneration and in vitro flowering from leaf and nodal explants of Solanum nigrum (L). - An important medicinal
plant. Plant Cell Biotechnology and Molecular Biology. 6(1&2): 17-22.
Jain, R., Sharma, A., Gupta, S., Sarethy, I.P. and Gabrani, R. 2011. Solanum nigrum: current perspectives
on therapeutic properties. Alternative Medicine Review. 16(1): 78-85.
Jain, S.K. 1968. Medicinal plants. Thomson Press Ltd, India.
Jian, L., Qingwang, L., Tao, F. and Kun, L. 2008. Aqueous extract of Solanum nigrum inhibit growth of
cervical carcinoma (U14) via modulating immune response of tumor bearing mice and inducing
apoptosis of tumor cells. Fitoterapia. 79: 548-556.
Johnson, M. and Manickam, V.S. 2003. In vitro micropropagation of Baliospermum montanum (Willd.)
muell-arg-a medicinal plant. Indian Journal of Experimental Biol. 41: 1349-1351.
Johnson, M., Manickam, V.S., Nikhat, Y., Sonali, D. and Andal, N. 2004. In vitro multiplication of two
economically important and endangered medicinal plants - justicia gebdarussa brum and adenia
hondala (gaertn) de wilde. Malaysian J. Sci. 23: 49-53.
Johnson, M., Yasmin, N., Sonali, D. and Rajasekarapandian, M. 2007. The role of cytokinin and auxin
in organogenesis of Passiflora mollissima and evaluation of biochemical changes using isozyme.
Eth. J. Sci. Technol. 4: 27-36.
Kambaska, B. H. and Santilata, S. 2009. Rapid in vitro micropropagation of sugarcane (Saccharum officinarum L. cv-Nayana) through callus culture. Nature and Science. 7(4): 1-10.
Kolar Basha, A., Vivekanandan, L. and Ghouse Basha, M. 2008. In vitro regeneration and flower
induction on Solanum nigrum L. from pachamalai hills of eastern ghats. Plant Tissue Culture and
Biotechnology. 18(1): 43-48.
Kritikar, K. R. and Basu, B. D. 1935. Indian medicinal plants. M/S Bishen Singh Mahendrapal, New
Delhi, India.
Lin, H.M., Tseng, H.C., Wang, C.J., Lin, J.J., Lo, C.W. and Chou, F.P. 2008. Hepatoprotective effects of
Solanum nigrum Linn. extract against CCl(4)-induced oxidative damage in rats. Chem. Biol.
Interact. 171: 283-293.
Malek, M.A., Mannan, M.A., Khanam, D., Khantun, M. and Molla, M.H. 2010. In vitro culture of pointed
gourd (Trichosanthes dioica Roxb.). J. Agril. Res. 35(1): 135-142.
Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassay with tobacco tissue
culture. Physiologia Plant. 15: 473-497.
Pirek, P.L.M. 1987. In vitro culture of higher plants. Martinus Nijhoff Publishers, Dordrect.
Riseman, A. and Chennareddy, S. 2004. Genotypic variation in the micropropagation of Sri Lankan
Exacum hybrids. Journal of the American Society for Horticultural Science. 129(5): 698-703.
Sascha, L., Beck Dunlop, R. and Van Staden. J. 1998. Micropropagation of Acacia mearnsii for ex vivo
material. Plant Growth Regulation. 26: 143-148.
Saito, K. and Mizukami, H. 2002. Plant cell cultures as producers of secondary metabolites. p.77-108.
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 201270
In: Kirsi Majra, C., Wolfang, H.B. (eds.), Plant biotechnology and transgenic plants. Marcel
Dekker Inc, New York.
Sanjaya Rathore, T.S. and Ravishankar Rai, V. 2005. Micropropagation of Pseudoxytenanthera stocksii Munro. In vitro Cell. Dev. Biol. – Plant. 41: 333-337.
Satish, K., Verma, M. K., Rai, P.A., Jaiswal, V.S. and Jaiswal, U. 2010. In vitro plantlets from
alginate-encapsulated shoot tips of Solanumnigrum L. Scientia Horticulturae. 124(4): 517-521
Sen, J. and Sharma, A.K. 1999. Micropropagation of Withania somnifera from germinating seeds and
shoot tips. Plant Cell Tiss. Org. Cult. 9: 96-698.
Sudha, C.C., Krishnan P.N., Pushpangadan, P. and Seeni, S. 2005. In vitro propagation of Decalepisarayalpathra, a critically endangered ethnomedicinal plant. In vitro Cell. Dev. Biol. – Plant.
41: 648-654.
Sundari, M.S., Benniamin, A. and Manickam, V.S. 2010. Micropropagation and in vitro flowering in
Solanum nigrumLinn. A medicinal plant. International Journal of Biological Technology. 1(1): 29-32.
Sut, D., Talukdar, P. and Singh, S. 2004. Micropropagation of ramie (Boehmeria nivea (L) Gaud) through
shoot-tip and nodal segment culture. Indian J. Agric. Res. 38 (2): 131 – 134.
Venugopal, R. B., Kaviraj, C. P., Rao, S., Jabeen, F. T. Z. and Kiran, G. 2005. Plant regeneration and in vitro flowering from leaf and nodal explants of Solanum nigrum (L.), an important medicinal
plant. Plant Cell Biotechnology and Molecular Biology. 6 (1/2): 17-22.
Wang, R., He, L. S., Xia, B., Tong, J.F., Li, N. and Peng, F. 2009. A micropropagation system for
cloning of hemp (Cannabis sativa L.) by shoot tip culture. Pak. J. Bot., 41(2): 603-608.
Wei, S., Zhou, Q. and Koval, P.V. 2006. Flowering stage characteristics of cadmium hyperaccumulator
Solanum nigrum L. and their significance to phytoremediation. Science of the Total Environment.
369: 441-446.
Wesely E.G., Antonisamy, J.M.A., Kavitha Marappampalayam Subramanian, K. and Nallyan, S. 2011.
Micropropagation of Alternanthera sessilis (L.) using shoot tip and nodal segments. Iranian
Journal of Biotechnology. 9(3): 206.
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 2012 71
Table 1. Effect of various concentrations of BAP and kinetin individually on multiple shoot induction from
shoot tip and node.
Tables
MS medium + Cytokinin Concentration
(mg/l)
Number of multiple shoots from shoot
tip ± SE
Number of multiple shoots from
node ± SE
MS alone
MS + BAP (1.0 mg/l)
MS + BAP (3.0 mg/l)
MS + BAP (5.0 mg/l)
MS + KN (1.0 mg/l)
MS + KN (3.0 mg/l)
MS + KN (5.0 mg/l)
0.0 ± 0.00
20.4 ± 0.22
14.2 ± 0.32
10.6 ± 0.47
6.7 ± 0.39
12.6 ± 0.68
2.4 ± 0.45
0.0 ± 0.00
5.6 ± 0.30
8.4 ± 0.22
3.2 ± 0.24
2.0 ± 0.25
3.4 ± 0.45
7.0 ± 0.83
Table 2. Effect of NAA on rooting on in vitro derived shootlets of
Solanum nigrum
Concentration of NAA No. of roots per shoot ± SE
0.1 mg/l
0.2 mg/l
0.3 mg/l
0.4 mg/l
0.5 mg/l
0.6 mg/l
0.7 mg/l
0.8 mg/l
0.9 mg/l
1.0 mg/l
0.0 ± 0.00
0.0 ± 0.00
0.5 ± 0.22
1.5 ± 0.40
2.5 ± 0.45
3.6 ± 0.70
4.3 ± 0.26
5.3 ± 0.61
6.0 ± 0.69
8.4 ± 0.16
Journal of Ornamental and Horticultural Plants, 2 (2): 65-72, June, 201272
Figures
Fig. 1. Micropropagation of Solanum nigruma. Multiple shoot induction from shoot tip explant,
b. Multiple shoot induction from nodal explant,
c. Multiple shoot proliferation from shoot tip explant,
d. Multiple shoot proliferation from nodal explant,
e. Rooting
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 2012 73
The Effect of Hot Water Treatments on Gray Mold and
Physicochemical Quality of Kiwifruit During Storage
Decline in postharvest losses of kiwifruit depended to maintain of
quality characteristics during storage and transportation. Storage losses caused
serious economic losses in kiwifruit. This study was conducted to inhibition of
pathogen infection and increasing fruit quality of Kiwifruit. Hayward kiwifruits
inoculated by B.cinerea conidia through pore wounds which formed by
removal of the pedicels. Fruits treated through immersion in hot water (45, 50
and 55 oC) for 2, 4 and 8 minutes after 3 weeks. All fruits stored at 0.5oC and
85-90 RH for 18 weeks. The samples had taken at 6th, 12th and 18th weeks and
measured some characters including weight loss, peel and pulp color indices
(L* and chroma), decay numbers, firmness, decay depth, SSC, TA, SSC/TA,
pH, EC, Ascorbic acid, compared with the control. Results showed that weight
loss rate increased about 2 fold of control but decay depth and losses prevented
at 6th and 12th weeks of storage period significantly. Firmness was higher than
control at 12th storage week in hot water treatments but had not significant
differences with control until end of storage period. Generally, L* parameter
had a positive relationship with firmness. Ascorbic acid increased specially in
control treatment during cool storage period. EC, pH, and TA parameters had
constant changes during of storage.
Keywords: Color, Cool storage, Gray mold, Hayward, Hot water, Physicochemical.
J. Fattahi Moghadam1* and H. Ebadi2
1Assistant Professor. Department of Technical and Engineering. Iran Citrus Research Institute, Ramsar,
Iran.2PhD student. Department of Technical and Engineering. Iran Citrus Research Institute, Ramsar, Iran.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 201274
INTRODUCTION
Kiwifruit with the scientific name of Actinidia deliciosa cv. Hayward is most famous fruit
in the Iran and other countries. In recent years, there is a trend to increase kiwi cultivation especially
in the north of Iran. Globally and in some countries like New Zealand, during seventy decades,
the kiwifruit considered as commercial and important products. Therefore, the more researches
have studied on various aspects of cultivation, production and protective of Kiwi (Debersaques
and Mekers, 2007). Although in the recent years, kiwi product development has been remarkable,
but less research done on the problems of harvesting and storage of kiwifruit.
An irreparable damage occurred during storage due to the lack of a specific pattern or meth-
ods derived from scientific research. Meanwhile among different storage fungi, gray mold are the
main factor limiting of kiwifruit storage life. All new harvested products need to be without from
pathogens, insects, and synthetic chemicals and contamination. Not certain fungicides have been
registered for controlling corruption agents in the storage while not harmful to human health as
well. On the other hand, consumer knowledge has increased about consumption effects of chemical
agents to control diseases, pests and physiological damage. Therefore, we need to develop effective
materials without any damages to health maintenance of horticulture products.
Kiwifruit had excellent storage properties among other subtropical fruits. Moreover, its
quality could maintain more than eight months in controlled conditions. Base on study revealed
that high CO2 atmosphere can slow the growth of B. cinerea on apples (Janisiewicz et al., 2003).
Botrytis diseases are very common and widely distributed on vegetables, ornamentals, fruits, and
field crops throughout the world. They commonly appear as blossom blights and fruit rots (Ku-
lakiotu et al., 2004).In this case, due to fungus activity, fruit began to watery from the tip and then
gradually extends to other fruit parts.
It has reported that spores of this fungus needs to ethylene for germination and followed eth-
ylene produced by defected fruits. Ethylene production by fungi caused fruit softening even in the
before maturity and thus can reduce the storage life (Hardan et al., 2005). Also recognized that eth-
ylene was produced by B. cinerea when grown on PDA medium (Chague et al., 2002). According to
Wurms et al., (1999) report, the more conidia produced in pericarp comparison to stem end of fruit,
because of this site contains growth inhibitor agents of gray mold. Fruit age also influenced on con-
tamination levels and the fruits with early harvesting are more sensitive than lasted harvesting fruit.
Using of hot water treatments to control decay occurred for the first time in 1992 on citrus
fruit (Fallik, 2004). Paull and Chen (2000) reported the beneficial effect of immersion in hot water
to control postharvest diseases for kiwifruit. Some researchers found that by applying a moderate
heat treatment, ripening could be delayed and fungal decay reduced without major changes in fruit
quality (Kou et al., 2007). According to a study on grapes found that 45°C for 8 mm was the best
hot water treatments for table grapes (Kou et al., 2006).
Application of hot water treatment before short-term storage (few minutes) only is effective
on pathogens that exist in the outer layers of fruit peel. This treatments commonly done by several
methods such as immersion in hot water, hot steam, hot and dry air, hot shower-brush technique.
Among these treatments, hot water method used (short time) commercially (Fallik, 2004).
Various studies showed that the cause of ethylene decline by hot water is due to decreasing
of EFE (Ethylen Forming Enzyme) activity. Furthermore, the heat treatments used to prevent chilling
injury and peel damage during storage and marketing. In avocado fruits, using of hot water through
38◦C for one hour caused a significant decreasing in peel damages (Fallik, 2004; Lurie, 1998).
In relation to temperature effects on fruit quality properties, Irving et al., (1991) reported that
fruit firmness, taste, respiration rate and ethylene production not affected during optimum temperature
conditions. Ippolito et al., (1994) were used another method to reduce storage rot. In their experiments,
the kiwi fruit before transferring to cold storage placed at 5-30°C and 95-98 RH for 24-96 hours. Based
on their results, the thermal treatment at 15°C and 98-95 RH for 48 hours had the best confirmed of
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 2012 75
decay control. Immersion of inoculated, freshly harvested table grapes for 3 min at 30, 40, or 50 °C
reduced decay to 20.7, 6.7, and 0.1 berries/kg after 30 days of storage at 1 °C, while decay after im-
mersion in water at these temperatures was 35.9, 17.6, and 1.7 berries/kg, respectively (Karabulut etal., 2004). The aim of this experiment was the studying of the effect of different hot water temperatures
on physicochemical changes and gray mold control in kiwi fruit during cold storage.
MATERIALS AND METHODS
Fruit materials
Fruits were harvested at commercial maturity stage (TSS=7%) from an experiment orchard
at the Iran Citrus Research Institute (Ramsar). Fruits transferred to laboratory subsequently and
sorted based on size and the absence of physical injuries or infections.
Treatments
The fungal colonies cultured on PDA medium to produce single-spore. Then these spores
used to prepared suspension of solution. Hayward fruits inoculated firstly by applying Botrytis
cinerea conidia on wounds formed by removal of the pedicels. Then fruits divided into 12 groups
randomly, each group containing 120 fruits in three replicates and immersed into hot distilled water
with 45, 50, 55◦C for 2, 4 and 8 min. Fruits were then dried for 24 h and then stored at 0.5oC and
85-90 RH for 18 weeks. After weeks 6, 12 and 18, fruit samples (30 numbers) were obtained from
each treatment to measure the fruit quality characteristics.
Physicochemical analysis
Firmness was determined by measuring compression using a hand-held Effegi penetrometer
with a 7.9 mm probe after removal of skin to a vertical depth of 1 mm on two sides of the fruit.
The firmness considered as an average peak force of 10 fruits and expressed as kg/7.9 mm2. More-
over, three fruits per replicate were weighed at the beginning of storage and throughout storage
period to calculate weigh loss percentage.
Titratable acidity (TA) was determined using 5 ml of fruit puree from five fruits mixed with
25 ml of distilled water, with two drops of phenolphthalein (1%) as indicator, titrated with 0.1N
NaOH to an endpoint pink (pH 8.2). The results expressed as percent anhydrous citric acid since
it is the dominant acid in kiwifruit (Fisk et al., 2008).
Soluble solids content (SSC) were then measured using an ATC-1E ATAGO hand-held re-
fractometer on the translucent part of the juice. The pH of the samples were measured by a pH
meters (Inolab pH 720, WTW, Germany).
The peel and pulp color was evaluated with a Minolta chromometer CR-400, which pro-
vided measurements of Hunters L*, a*, b* and chroma. L* measures lightness and varies from
100 for perfect white to zero for black. a* measures redness when its value is positive, gray when
zero, and greenness when negative, and b* measures yellowness when positive, gray when zero,
and blueness when negative.
Ascorbic acid was determined using the Dye method (Ranganna, 1977). The kiwifruit puree
samples (30 g) homogenized with 30 ml of 3% metaphosphoric acid (HPO3). Five ml of aliquot
was titrated with a standard dye solution (2, 6-dichlorophenol-indophenol) to a pink color that per-
sisted for 15 seconds using an autotitrator calibrated using standard ascorbic acid. The ascorbic
acid content (Vitamin C) expressed as mg/100g FW.
Statistical analysis
Physicochemical data analyzed with MSTAT–C statistical software (Michigan State Uni-
versity, USA). Treatments arranged in completely randomized design, and Tukey’s test (p< 0.5)
used to reveal any differences.
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 201276
RESULTS AND DISCUSSION
The results of initial assessment showed that the rate of fruit TSS, firmness and TA were 9-
10 %, 2.3-kg.7.9mm-3 and 0.9 % at the time of harvest respectively. Peel color values was meas-
ured as L* (41.07), a* (6.63) and b* (21.54). Pulp color values also were recorded as well as L*
(54.99), a* (-15.51) and b* (36.01). In fact, these characteristics indicated for better evaluated the
fruit quality changes before treatment applying and transfer them to cold storage.
Weight loss
The analysis of data showed that the use of hot water increased weight loss comparison to
control. The highest weight loss observed when the fruits immersed in 55°C. The lowest weight
loss belongs to control that was nearly half of hot water treatments (Fig. 1). Hayward kiwi fruit
placed in cool storage with zero temperature. Weight loss rate decreased from 0.34% (3 days after
storage) to 0.93 % (6 weeks storage) and finally achieved to 1.54 % at the end of 12 weeks storage
(Bautista-Banos et al., 1997). Although storage temperature is higher in this experiment, but the
process of fruit weight loss is in accordance with the above report results during storage. Fruit
weight loss can be occurs due to increasing of respiration rate during storage (Aghdam et al., 2011).
Conversely, low temperature decreased fruit respiration. For this reason, hot water treatments in-
creased respiration rate comparison to control. Therefore, it is resulted to enhanced weight loss
during storage.
Decay rate
In general, all treatments had most impact to control of gray mold between 6 to 8 weeks.
In this case, the amount of contamination is less than one percent. Later on (12 and 18 weeks sam-
pling), it was increased to 2.2 and 3.2 numbers (equal to 10 %) respectively (Fig. 2)., Low tem-
perature storage reduced fungal activity in the storage (Bautista-Banos et al., 1997) besides water
temperature. In another study, with inoculated the picked wound of four trees by Botrytis and then
maintained at 0°C, it observed that the extent of pollution in 1 to 4 trees were 21.3, 17.1, 41.6 and
2.1 percent, respectively (Poole and McLeod, 1994). Our results revealed that fruit rot reduction
was due to decline of Botrytis spores in hot temperatures compared to other reports.
Fruit color changes
The peel color and chroma rate decreased during storage (Fig. 3). This value affected by
storage time mostly and water temperature had no significant effect on chroma.
The L* value of peel was maximum (average 55) in fruits which were exposed for 2 minutes
in all three temperature and control (Table 1). It is thought that immersion time had more effective
on L* value than different water temperatures.
There are not a report about influences of hot water on peel lightness changes but suggested
that the L* value was 66.6 at the harvesting time and then decreased during storage (Amodio etal., 2007). In this experiment, it was 52.09 at harvesting time but decreased to 44 (45 °C for 8
minutes) at the end of storage. Although, L* value had not significant changes at 50 and 55°C
treatments.
Based on the table 1, fruits treated with hot water and control, had high levels of chroma
at the primary sampling (6th weeks) from storage. In fact, chroma expressed saturation of green
color and associated with fruit firmness. With longer periods of fruit storage, pulp chroma de-
creased due to pulp color was darker than beginning of storage period. It reported that the chroma
value in soft and firm ripened fruits were 15.69 and 36.77, respectively. At this form, pulp had
high level of green pigment content (Costa et al., 2006). In this experiment, chroma value at all
treatments and control decreased because of fruit softening at the end of storage. This phenomenon
almost affected by storage period.
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 2012 77
Fruit firmness
The firmness of fruit pulp was 2.3 kg.7.9 mm-3 at harvesting time. Fruit firmness was
changed between 0.6 (samples taken at 18th week) to 1.6 kg.7.9 mm-3 (weeks 6 and 12) during
storage (Table 1). In this experiment, the fruit firmness of control decreased during storage. Fruit
softening in control occurred earlier and severity than other treatments. The decreasing of firmness
in this study is consistent with results of other researchers. It has reported that Botrytis conidia
needs to ethylene for germination or he can produced ethylene itself. Ethylene production by fungi
caused fruit softening even before maturity, so can reduce the storage life (Poole and McLeod,
1994; Qadir et al., 1997). Application of hot water may be destroyed the conidia that led to prevent
of ethylene production by fruit tissue. It can be delayed fruit over ripening and softening.
Depth of contamination
According to table 1, the amount of fruit and depth contamination were zero (mm) in six
weeks of cold storage. Most expansion of decay observed in the 12th weeks of storage with 2.11
cm in the control treatment, which had not significant differences with other temperatures. Maxi-
mum progress in fruit contamination depth (6.42 cm) was in fruits, which treated by water at 45°C
and stored for 12 and 18 weeks. Not only the control treatment has shown the greatest amount of
contamination in 12th week but also were occurred the maximum development of Botrytis infection
in fruit tissue. The 45 and 50°C treatments decreased development of decay until the 12th week
firstly, but increased in the last six weeks of storage. Moreover, hot water (55°C) well prevented
botrytis development during storage. Chardonnet et al., (2003) used grapes volatile oils to control
gray mold and measured contamination depth. They found that the contamination depth in treated
fruit was 2.5 mm, which was less than comparison of control (15 mm) during 7-11 days storage.
pH changes
Overall, the range of pH changes was between 3.5 and 3.7 during storage. Only the control
treatment had high pH value (3.7) in the sixth weeks of sampling date (Table 1). When kiwifruit
kept in storage at 2°C for 70 days, it was found that pH indicator increased gradual and steady
from 3.61 to 3.75 (Fisk et al., 2008). The results of this experiment were fully consistent with this
report. It seems that heat treatments had not effect on pH level significantly.
SSC, TA and SSC/TA changes
Results (Table 1) indicated that the TA levels increased in all treatments to the 12th weeks
and then decreased until the end of storage. No significant differences observed about SSC during
storage. The amount of TA was 0.85 % at harvesting time and then decreased to 0.69 % after 6
weeks. Therefore, it seems TA had more influence on SSC/TA ratio than SSC percent (Table 1).
Similarly, Marsh et al, (2004) found that the amount of fruit acid reduced from 1.5 % to 1.37 %
but had constant changes until the end of storage. In addition, TA did not influenced by hot water,
however increased firstly and then declined during storage. The decreasing trend of TA was similar
to the results of Fisk et al., (2008), that reported amount of TA reduced from 1.26% to less than
1% during 70 days of kiwifruit storage.
Electrical conductivity (EC) changes
Generally, the amount of EC had a direct relationship with time of cold storage. However,
rate of EC has increased between weeks 6 to 12 and then almost was constant in the six weeks be-
fore the end of storage (Table 2). It is seems that the heat exogenesis from hot water caused an
ionic phase in fruit tissue. In fact, EC of fruit juice represent the amount of passing electricity. En-
hancing of EC by hot temperatures depended to nature of ions and ionic concentrations. In contrast,
EC decreased with increasing of solid content and particle size, which showed there are non-ionic
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 201278
parts such oils and sugars in fruit juice. In addition, EC enhanced when the acidity increased during
storage (Esteve et al., 2007).
Ascorbic acid changes
Ascorbic acid content enhanced during storage and reached to maximum (especially in con-
trol) in the end of storage. Generally, hot water treatments and time of exposure had not significant
impact on ascorbic acid content (Table 3). Some reports referred to decreasing and others to in-
creasing of ascorbic acid in kiwifruit during storage (Amodio et al., 2007). About other acids,
Marsh et al., (2004) found the amount of citric acid was decreased but it was higher in 0◦C. In this
experiment, ascorbic acid changes did not match even with the results of citric acid.
CONCLUSION
Based on the results, fruit peel sensed to water loss by applying of hot water. In contrast, it
well controlled infection rate of Botrytis between 6 and 8 weeks (less than 1%). Due to the spread
of fungi, it is important to control of molds in early weeks. Therefore, hot water treatments well
have done this duty. Moreover, it inhibited from early fruit softening via destroyed of Botrytis. On
the other hand, SSC/TA ratio decreased because of reducing of ethylene production. Ascorbic acid
and EC levels increased with greater slope between 6th to 12th weeks. If kiwi growers monitored
suspected trees to Botrytis or other fungus, they can harvest the infected fruits separately and
dipped to hot water (50°C) for 4 minutes. After that, dried fruits could place in a cold storage.
ACKNOWLEDGEMENTS
This work is part of the kiwifruit project No. 2-023-240000-14-0000-85002 funded by Iran-
ian Citrus Research Institute. We greatly thank Dr. S. Aghajanzadeh for critical supported.
Literature Cited
Aghdam, M.S., Mostofi Y., Motallebiazar A., Fattahi Moghaddam. J. and Ghasemnezhad, M. 2011.
Methyl salicylate affects the quality of hayward kiwifruits during storage at low temperature.
Journal of Agricultural Science. 3 (2): 149-156
Amodio, M.L., Colelli, G., Hasey, J.K. and Kader, A.A. 2007. A comparative study of composition
and postharvest performance of organically and conventionally grown kiwifruits. Juornal
of the Science of Food and Agriculture. 87: 1228-1236.
Bautista-Banos, S., Long, P.G. and Ganesh S. 1997. Curing of kiwifruit for control of postharvest
infection by Botrytis cinerea. Postharvest Biology and Technology. 12: 137-145
Chague V., Elad, Y., Barakat, R., Tudzynski, P. and Sharon, A. 2002. Ethylene biosynthesis in
Botrytis cinerea. Microbiology Ecology. 40:143-149.
Chardonnet, C.O., Charron C.S., Sams, C.E. and William, S. 2003. Conway chemical changes in
the cortical tissue and cell walls of calcium-infiltrated ‘Golden Delicious’ apples during
storage. Postharvest Biology and Technology. 28: 97-111
Costa, S.B., Steiner, A., Correia, L.C., Empis, J. and Martins, M.M. 2006. Effects of maturity stage
and mild heat treatments on quality of minimally processed kiwifruit. Journal of Food
Engineering. 76: 616–625
Debersaques, F. and Mekers, O. 2007. Growing and production of kiwifruit and kiwiberry. Soils,
Plant Growth and Crop Production. (Abstract).
Esteve, M.J., Frigola, A., Rodrigo, C. and Rodrigo, D. 2005. Effect of storage period under variable
conditions on the chemical and physical composition and colour of spanish refrigerated orange
juices. Food and Chemical Toxicology. 43: 1413–1422.
Fallik, E. 2004. Prestorage hot water treatments (immersion, rinsing and brushing). Postharvest
Biology and Technology. 32: 125–134
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 2012 79
Fisk, C.L., Silver, A.M., Strik, B.C. and Zhao, Y. 2008. Postharvest quality of hardy kiwifruit
(Actinidia arguta Ananasnaya) associated with packaging and storage conditions. Postharvest
Biology and Technology. 47: 338-345.
Hardan, K., Al-Masri, M. and Barakat, R. 2005. Ethylene production by Botrytis cinerea (causal
organism of gray mold disease) and influence of the exogenously applied growth regulators
and thier inhibitor on disease development. Hebron University Research Journal. 2: 1-5.
Ippolito, A. 1994. Improvement of kiwifruit resistance to Botrytis storage rot by curing. Phytopathologia
Mediterranea. 33, 2: 132-136. (Abs).
Irving, D.E., Pallesen, J.C. and Cheah, L.H. 1991. Respiration and ethylene production in kiwifruit
following hot water dips. Postharvest Biology and Technology 1: 137-142.
Janisiewicz, W.J., Leverentz, B., Conway, W.S., Saftner, R.A., Reed, A. and Camp, M. 2003. Control
of bitter rot and blue mold of apples by integrated heat and antagonist treatment on 1-MCP
treated fruit stored under control atmosphere conditions. Postharvest Technology. 29 (2):
129-143.
Karabulut, O.A., Gabler, F.M., Mansour, M. and Smilanick, J.L. 2004. Postharvest ethanol and
hot water treatment of table grapes to control gray mold. Postharvest Biology and Tecnology.
34 (2): 169-177.
Kou, L., Liu, X., Zhang, C. and Geng, X. 2006. Effects of respiratory intensity and storage quality
of fresh-cut 'Kyoho' grape in hot water treatment. Food Fermentation Industries. 32: 143-146
(Abstract).
Kou, U., Lao, Y., Ding, W. and Liu, X. 2007. Effects of mild heal treatment on microbial growth
and product quality of packaged fresh-cut table grapes. Journal of Food Sciences. 72:5567-5573.
Kulakiotu, E., Constantine, K., Thanassoulopoulos, C., Evangelos, M. and Sfakiotakis, S. 2004.
Postharvest biological control of Botrytis cinerea on kiwifruit by volatiles of ‘Isabella’
grapes. Vol. 94, No. 12.
Lurie S. 1998. Postharvest treatment. Postharvest Biology and Technology. 14: 257-269.
Marsh, K., Attanayake, S., Walker, S., Gunson, A., Boldingh, H. and MacRae, E. 2004. Acidity
and taste in kiwifruit. Postharvest Biology and Technology. 32: 159-168.
Paull, R.E. and Chen N.J. 2000. Heat treatment and fruit ripening. Postharvest Biology and Technology.
21: 21-37.
Poole, P.R. and McLeod, L.C. 1994. Development of resistance to picking wound entry Botrytis cinerea storage rots in kiwifruit. 22: 387-392.
Qadir, A., Hewett, E.W. and Long, P.G. 1997. Ethylene production by Botrytis cinerea. Postharvest
Biology and Technology. 11: 85-91.
Ranganna, S. 1977. Manual of analysis of fruit and vegetable products. McGrawHill, New Delhi.
Wurms, K.V., Long, P.G., Sharrock, K.R. and Greenwood, D.R. 1999. The potential for resistance
to Botrytis cinerea by kiwifruit. Crop Protection. 18: 427-435.
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 201280
Table 1. Interaction effects of dipping time and water temperature on some quality parameters of kiwifruit.
*Means followed by a different letter are significantly different (p <0.05)
Tables
dipping
time (min.)
water tempera-
ture (◦C)
L* value
(peel)
L* value
(pulp)
Chroma
(pulp)
Firmness Depth of con-
tamination
pH TSS/TA
2
4
8
45
50
55
control
45
50
55
control
45
50
55
control
32.4 bcd*
34.0 abc
35.0 a
32.0 cd
33.4 abcd
32.8 d
34.1 abc
35.1 a
34.5 ab
34.2 ab
34.2 ab
34.2 ab
55.7 a
55.0 a
56.0 a
54.0 a
44.2 c
43.3 c
42.9 c
45.2 bc
42.5 c
42.6 c
44.2 c
47.7 b
34.7 a
34.6 a
33.6 a
31.3 b
19.0 cde
18.0 de
17.6 e
18.7 de
19.3 cde
19.7 cd
19.7 cd
20.8 c
1.3 a
1.6 a
1.4 a
0.9 a
1.6 a
1.0 a
1.6 a
0.6 a
0.7 a
0.6 a
0.6 a
0.5 a
0.0 b
0.0 b
0.0 b
1.2 b
0.4 b
0.7 b
0.2 b
2.1 b
3.0 a
1.6 b
0.0 b
6.4 b
3.6 b
3.6 b
3.6 b
3.6 b
3.6 b
3.6 b
3.6 b
3.7 a
3.5 b
3.6 b
3.6 b
3.5 b
20.9 b
21.4 ab
26.5 a
22.2 ab
20.5 b
21.0 b
19.6 b
20.3 b
22.8 ab
22.8 ab
22.1 ab
22.8 ab
Table 2. Interaction effects of dipping time, water temperature and storage time on electrical conductivity of kiwifruit
juice in cool storage.
*Means followed by a different letter are significantly different (p <0.05)
Storage
time
(Week)
Water
temper-
ature
(◦C)
Dipping
time
(min.)
EC
(ms)
Storage
time
(Week)
Water
temper-
ature
(◦C)
Dipping
time
(min.)
EC (ms) Storage
time
(Week)
Water
tempera-
ture (◦C)
Dipping
time
(min.)
EC (ms)
6 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
3.4 f*
3.21 f
3.36 f
3.52 f
3.34 f
3.14 f
3.21 f
3.36 f
2.95 f
2.8 f
3.05 f
3.25 f
12 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
10.84 bcde
9.86 e
10.35 bcde
10.07 de
10.04 de
10.2 de
10.24 cde
10.57 bcde
9.91 e
8.85 e
9.7 e
9.83 e
18 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
12.01 bcd
12.27 bc
11.5 bcde
10.81 bcde
12.34 b
10.82 bcde
10.01 de
11.78 bcde
14.46 a
10.8 bcde
11.25 bcde
11.4 bcde
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 2012 81
Table 3. Interaction effects of dipping time, water temperature and storage time on ascorbic acid of kiwifruit juice in
cool storage.
*Means followed by a different letter are significantly different (p <0.05)
Storage
time
(Week)
Water
temper-
ature
(◦C)
Dipping
time
(min.)
Ascorbic
acid
(mg/100g
FW)
Storage
time
(Week)
Water
temper-
ature
(◦C)
Dipping
time
(min.)
Ascorbic
acid
(mg/100g
FW)
Storage
time
(Week)
Water
tempera-
ture (◦C)
Dipping
time
(min.)
Ascorbic
acid
(mg/100g
FW)
6 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
27.95 hij*
26.06 ijk
25.18 ijk
26.8 ijk
24.89 ijkl
23.32 ijkl
28.61 ghij
22.06 jkl
24.4 ijkl
25.5 ijk
26.36 ijk
25.76 ijk
12 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
33.87 fgh
27.04 ijk
20.27 kl
49.09 bc
29.77 fghi
25.59 ijk
35.18 efg
34.87 efg
35.63 ef
42.7 de
40.72 de
39. 6 de
18 45
50
55
control
2
4
8
2
4
8
2
4
8
2
4
8
66.13 a
54.43 b
36.23 def
18.16 l
42.81 cd
53.44 b
54.48 b
48.73 bc
54.53 b
52.09 b
52.29 b
51.69 b
Journal of Ornamental and Horticultural Plants, 2 (2): 73-82, June, 201282
Figures
Fig. 1. Effects of different water temperature on weight loss rate.
Fig. 2. Effects of different storage time on decay rate.
Fig. 3. Effects of different storage time on peel chroma.
Fig. 4. Effects of different storage time on titratable acidity.
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 83
Molecular Cloning and Analysis of Two Flowering
Related Genes from Apple (Malus × domestica)
Apple (Malus × domestica Borkh.) is the fourth fruit in importance and
Iran ranks fifth in apple production in the world. Longevity of juvenility in
apple extends breeding cycles and makes its breeding a tough job. To alleviate
this barrier via genetic engineering, the genes involved in flowering and floral
development of apple and their function must be identified and characterized.
Most of these genes fall in a class of transcription factors named MADS-box
genes. In the present research, we cloned and analysed the sequences and
features of two of these genes, MdMADS1 and MdMADS3, from apple ‘Golden
Delicious’ for a deeper functional analysis in the near future. They were found
to be homologs of SEP genes belonging to the class E genes involved in
flower development and lied in the AGL2 clade of MADS-box genes in the
phylogenetic tree made for apple and Arabidopsis MADS-box proteins. Insilico studies exemplified that both genes had eight exons and seven introns
with a long first intron of about 4 Kb and 3 Kb for MdMADS1 and MdMADS3,respectively. The results showed that the structure of both genes has noticeably
differed from other SEP-like genes in evolution.
Keywords: Flowering genes, Gene isolation, MADS-box genes, Malus × domestica, Phylogenetic tree.
N. Mahna1* and B. Baghban Kohneh Rouz 2
1Department of Horticultural Sciences, Faculty of Agriculture, University of Tabriz, 5166614761
Tabriz, Iran.2Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Tabriz,
5166614761, Tabriz, Iran.
*Corresponding author,s email: [email protected]
Abstract
Abbreviations: AG, AGAMOUS; AGL, AGAMOUS-LIKE; AP1, APETALA1; bp, base pair; CAL,CAULIFLOWER; EST, expressed sequence tag; FBP, FLORAL BINDING PROTEIN; FLC, FLOW-ERING LOCUS C; FUL, FRUITFULL; Md-, Malus × domestica; PI, PISTILLATA; SEP, SEPALATA;SHP, SHATTERPROOF; STK, SEEDSTICK; SOC1, SUPRESSOR OF CONSTANS 1; TM5, TomatoMADS-box gene 5.
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201284
INTRODUCTION
Apple (Malus × domestica Borkh.) is the fourth fruit in importance after citrus, bananas
and grapes and Iran with a production of 2.43 million metric tons ranks fifth after China, the United
States, Turkey and Poland (FAO, 2012). Improvement of this plant is a difficult job due to the
longevity of its juvenility which extends breeding cycles up to decades. To alleviate this major
breeding barrier, genetic manipulation of the juvenility can be a prominent alternative to classic
methods; however, it requires the genes controlling the transition from vegetative phase to repro-
ductive phase to be identified and functionally characterized. Most of these genes and also the ma-
jority of the genes active in the determination of meristem identity and the development of floral
organs lie in a class of transcription factors named MADS-box genes. Although a few studies have
demonstrated that the MADS domain of MADS-box proteins in fruit trees plays a similar role as in
grasses (Sundstrom and Engstrom, 2002), there is little information about the features of this domain
in trees (Sung and An, 1997). Moreover, SEP genes functioning as members of the class E genes in
the ABCDE model of flower development are among MADS-box genes. It has been demonstrated
that SEP genes have expression in all floral whorls (Sun and An, 1997; Sung et al., 2000; Ditta etal., 2004). The overexpression of one of SEP homologs in apple, MdMADS1, has not caused any
change in the flowering time of tobacco (Sung and An, 1997); nevertheless, it seems that the function
of the gene can be further investigated through antisense or co-suppression methods.
In the present research, our aim was to clone and characterize the sequences and the features
of two homologs of SEP genes from the ‘Golden Delicious’ cultivar of apple namely, MdMADS1and MdMADS3 to further analyse their function via gene knockdown approaches.
MATERIALS AND METHODS
Plant tissues needed for RNA extraction were collected from the leaves of five–year old
apple ‘Golden Delicious’ trees and frozen using liquid nitrogen. RNA extraction was performed
from buds and leaves using LiCl method. The quantity and quality of extracted RNA was verified
using spectrophotometer and agarose gel electrophoresis. All solutions were DEPC-treated. Suit-
able amount of RNA used in RT reaction by means of the enzyme SuperScript II® (Invitrogen)
using manufacturer’s protocols. The forward and reverse primers employed to clone these genes
are listed in table 1. From RT reaction, 1 µl was added to the PCR mixture (Table 2) to amplify the
fragments. The thermal program for PCR reaction was as table 3.
To clone the RT-PCR fragments, pGEM-T Easy kit (Promega) was exploited using manu-
facturer’s protocols. Sequencing was carried out through sequencing facilities of VIB-UGent (Bel-
gium). Sequence analysis and alignments were performed via Mega 5 (Tamura et al., 2011). The
sequences were downloaded from diverse databases and used for constructing a phylogenetic tree
(Table 4) using neighbour-joining algorithm (Saitou and Nei, 1987).
RESULTS AND DISCUSSION
In this study, we provide the report of two MADS-box genes, MdMADS1 and MdMADS3,
which were isolated from Malus domestica based on RT-PCR. The genes found to be homologous
to Arabidopsis SEP-like genes. The isolated sequences for MdMADS1 and MdMADS3 were cloned
in pGEM-T Easy vector and the resulted vectors designated pNM101 and pNM102, respectively.
The RT-PCR and colony-PCR results of the isolated genes have been demonstrated in Fig.1.
MdMADS1 gene was first isolated and cloned by Sung and An (1997) from apple cv. Fuji.
The cDNA of this gene being 992 bp has an ORF which is 738 bp, a 5’-UTR of 29 bp long and a
3’-UTR with a length of 222 bp. In the present study, the coding region of the gene with a length
of 741 bp was isolated and cloned. This region encodes a 246 amino acid long polypeptide which
belongs to MADS-box family. The gene MdMADS1 isolated in this research had a 99.9% similarity
to the original MdMADS1 with the only difference in the nucleotide position 218 being G in Md-
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 85
MADS1 and T in MdMADS1 from ‘Golden Delicious’ which makes a shift in amino acid 63 re-
placing Methionine with Isoleucine. This little difference makes the isolated MdMADS1 gene iden-
tical to MdMADS8 instead of the original MdAMDS1. Another possible explanation can be the
error of Taq DNA polymerase in RT-PCR reaction which might have replaced G with T in the iso-
lated MdMADS1. This sequence was isolated using RNA extracted from the buds, while it has
been reported that this gene expresses in the floral organs (Sung and An, 1997). The amino acid
sequence of this protein had a similarity of 93% with MdMADS9, 79% with SEP1/AGL2 and 74%
with SEP2/AGL4 (Sung et al., 1999). Therefore, it lied in the AGL2 clade of MADS-box proteins
(Fig. 2). Furthermore, the expression pattern of MdMADS1 is comparable to that of AGL2. During
first and middle stages of flower development, AGL2 shows a high expression in all floral whorls.
While the flower development continues, AGL2 expression undergoes a dramatic decrease. The
expression of AGL2 in ovules, embryos and seed coat has been also high (Flanagan and Ma, 1994).
AGL2 expression has been recognized in the leaves (Ma et al., 1991); however, MdMADS1 tran-
scripts have not been detected in the vegetative organs (Sung and An, 1997).
MdMADS3 was first isolated from ‘Fuji’ apple (Sung et al., 2000), the cDNA of which has
a length of 1104 bp and contains an ORF encoding a protein with 248 amino acids, a 5’-UTR of
81 bp long and a 3’-UTR of 276 bp long. It was isolated in this research from ‘Golden Delicious’
being 98.9% similar to MdMADS3 from ‘Fuji’. The 5’-UTR of the former had 6 times less repe-
tition of GA than that of the latter. Perhaps, this type of dissimilarity can be used in distinguishing
of the two cultivars through SSR marker development. The amino acid sequence of this gene was
as 99% similar as that of MdMADS7 (Yao et al., 1999). In the amino acid 181, there is substitution
of histidine in MdMADS7 for glycine in MdMADS3. Further analysis revealed that MdMADS3 had
83% similarity with MdMADS6. Upon drawing phylogenetic tree, MdMADS3 stood along with
AGL2 (Fig. 2). In comparison with Arabidopsis genes, it showed the highest similarities with
SEP1/AGL2 (63%), SEP2/AGL4 (61%) and SEP3/AGL9 (59%).
Plant MADS box genes were realized to be transcription factors that regulate floral organ
identity; nevertheless, several reports have since been issued about their regulation of other devel-
opmental processes, such as flowering time, fruit ripening, root growth, dehiscence, ovule and fe-
male gametophyte development and the determination of meristem identity of vegetative,
inflorescence, and floral meristems (Zhang and Forde, 1998; Ng and Yanofsky, 2001; Giovannoni,
2004; Whipple et al., 2004; L. Colombo et al., 2008; Liu et al., 2009). Researches on model species
such as Antirrhinum majus, Arabidopsis thaliana, Petunia hybrida, Oryza sativa, and Zea mays
have been shown that these functions are mostly conserved among angiosperms (Schwarz-Sommer
et al., 2003; Vandenbussche et al., 2003; Kater et al., 2006).
Genetic researches have also exemplified that closely related family members MADS-box
genes have redundant or overlapping functions. For example, the closely related SEPALLATA
(SEP) genes, SEP1, SEP2, and SEP3, act redundantly to specify petal, stamen, and carpel identity.
Single sep mutants have no phenotype, and a sep1 sep2 sep3 triple mutant was required to establish
the developmental role of these genes (Pelaz et al., 2000). The closely related SHATTERPROOF1
(SHP1) and SHP2 genes act redundantly to regulate the formation of the silique dehiscence zone
(Liljegren et al., 2000). Furthermore, SHP1 and SHP2 act redundantly with AGAMOUS (AG),
which specifies stamen and carpel identity, and SEEDSTICK (STK), which controls the develop-
ment of the funiculus, to specify ovule identity (Pinyopich et al., 2003). Moreover, several phylo-
genetic studies of the MADS domain family have revealed that related genes within a phylogenetic
clade tend to share similar expression patterns (Purugganan et al., 1995; TheiBen et al., 1996;
Riechmann and Meyerowitz, 1997; Alvarez-Buylla et al., 2000b). These findings suggest that re-
dundant functions might be a noticeable characteristic of closely related members in the MADS-
box gene family.
SEP-like genes are generally encoded by multigene families and it has been supposed that
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201286
the gene duplications occurred along angiosperm evolution, and that the number of SEP-like genes
was diverse in different species (Theissen et al., 2000; Becker et al., 2000; Zahn et al., 2005). Four
genes in the A. thaliana genome (Ma et al., 1991; TheiBen; 2001 and Ditta et al., 2004), six in
both petunia (Zahn et al., 2005) and wheat (Paolacci et al., 2007), five in both rice (Nam et al.,2004) and oil palm (Adam et al., 2006), three in Asparagus sp. (Kanno et al., 2006), two in peach
(Tani et al., 2009) and one in Alpinia hainanensis (Song et al., 2010), Zostera japonica (Kakinuma
et al., 2011) and Fragaria ananassa (Seymour et al., 2011) are derived from cDNA or gDNA se-
quences. Genome-wide analysis indicates that the M. domestica genome contains several MADS-
box genes including at least seven SEP-like genes (Fig. 2), suggesting that the process of floral
specification in M. domestica could be similar to its relatives.
Based on in silico studies performed in this research, the genomic locus of MdMADS1 was
5748 bp long at about 5 Mb from the beginning of the chromosome 17 and that of MdMADS3 was
5260 bp at about 27 Mb from the beginning of the chromosome 14 of apple. Both genes had eight
exons and seven introns with a long first intron of about 4 Kb and 3 Kb for MdMADS1 and Md-MADS3, respectively. The exon–intron structure of MIKC-type MADS-box genes is well con-
served (Henschel et al., 2002; Tanabe et al., 2005). In the plants studied, the ORF of the MIKC-type
MADS-box genes is interrupted by six (e.g., A. thaliana SEP1 and SEP2 in SEP1/2 subclade) to
seven (e.g., SEP3 and SEP4 in AGL2 clade, AGL6 and AGL13 in AGL6 clade, and AP1, CAL, and
FUL in FUL clade) introns. In the former type, lengths of ORF coding region in Es1–7 are 185,
82, 62, 100, 84, 146–149, and 94–127 bp, respectively, and those in Es1–8 in the later type are
182–185, 73–85, 62–71, 100, 42, 36–42, 128–173, and 34–115 bp, respectively (Johansen et al.,2002). The exon–intron structure of MdMADS1 and MdMADS3 genes is more similar to those of
the SEP3 and SEP4 than those of the SEP1 and SEP2 in the AGL2 clade; while in terms of amino
acid sequence, MdMADS1 protein was more similar to SEP1/2 subclade and MdMADS3 found to
be a little different from SEP1, SEP2, SEP3 and SEP4 (Fig. 2). These results exemplify that the
structure of both genes has noticeably differed from other SEP-like genes in evolution.
According to the ABCDE model proposed to explain floral organ formation, the individual
and combined activities of five classes (A, B, C, D, and E) of homeotic genes (Theiβen, 2001,
Becker and Theiβen, 2003, Ditta et al., 2004, Adam et al., 2007a, Adam et al., 2007b and Liu etal., 2010). In A. thaliana, A-function is provided by the AP1 and AP2 genes, B-function by the
AP3 and PI genes, C-function by the AG gene, D-function by the STK gene, and E-function by
the SEP genes (i.e., SEP1, SEP2, SEP3, and SEP4). The four SEP genes in A. thaliana, SEP1–SEP4, are well characterized, all of which play important roles for specifying the identity of all
four whorls of the floral organ and for floral meristem identity (Ditta et al., 2004), and the similar
functions of SEP-like genes have been shown not only in other dicot species (Vandenbussche etal., 2003b and Rijpkema et al., 2009) but also in monocot species (Adam et al., 2007b, Paolacci
et al., 2007 and Song et al., 2010). In the case of M. domestica, the expression of the MdMADS1gene, which is a member of SEP1/2 subclade (Fig. 2), was in all floral organs and young fruits but
not in leaves. The expression was higher at the early stages of flower and fruit development, sug-
gesting that MdMADSl plays a major role in the initiation of reproductive organ developments.
The MdMADS1 gene expression pattern is similar to that of AGL2 of Arabidopsis. During the early
and intermediate stages of flower development, AGL2 is expressed at a high level in all four whorls
of the flower. As the flower organs undergo the final elongation and maturation phase of develop-
ment, AGL2 expression is dramatically reduced. Reduction of the AGL2 expression occurs first in
the sepals and then in stamen and the petals of mature flowers. AGL2 expression is also high in
developing ovules, embryos and seed coats (Flanagan and Ma, 1994). However, the AGL2 tran-
script was detectable in leaves (Ma et al., 1991) whereas the MdMADS1 transcript was not found
in the vegetative organ. Unfortunately, the exact role of AGL2 genes are not elucidated yet, but,
the studies on their homologs in petunia and tomato have revealed a role for these genes as medi-
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 87
ators between floral meristem identity genes and floral organ identity genes (Angenent et al., 1992;
Pnueli et al., 1994).
Taken together, it appears that MdMADS1 is a member of the AGL2 subfamily. Unfortu-
nately, the function of the AGL2 subfamily is largely unknown, transgenic phenotypes of FBP2
and TM5 deficient plants suggest a role in mediating between meristem and organ identity genes
(Angenent et al., 1994; Pnueli et al. 1991). Ectopically expressed MdMADS1 gene under the con-
trol of 35S promoter in tobacco did not cause any alteration of flower or seed development (Sung
and An, 1997). In order to reveal the functional role of MdMADS1, it may be necessary to employ
either antisense or co-suppression approaches in the homologous apple plant to achieve reduction
of the gene expression. The expression of MdMADS3 was first detected at the stage 3 in three in-
ternal whorls of floral primordia; nevertheless, no expression was observed in the younger floral
primordia and/or in the inflorescence meristem (Sung et al., 1999).The expression pattern of Md-MADS3 is similar to those of FBP2 from petunia, TM5 from tomato, and AGL9 from Arabidopsis,
which are expressed in petals, carpels, and stamens (Angenent et al., 1992; Pnueli et al., 1994;
Mandel and Yanofsky, 1998). The genes FBP2, TM5, and AGL9 are expressed after the onset of
the meristem-identity genes, but before the activation of organ-identity genes, suggesting a possible
role as mediators between the floral meristem and floral organ-identity genes. The egm1 and egm3
genes from eucalypt and the DEFH49 gene from Antirrhinum majus are also expressed in the inner
three whorls of the flower (Davies et al., 1996; Southerton et al., 1998).
With complementation of genome sequencing and expressed sequence tag (EST) assem-
bling in some model plants such as Arabidopsis, rice, and wheat, 107, 73, and 45 MADS-box genes
have been annotated, respectively (Kofuji et al., 2003, Pařenicová et al., 2003, Nam et al., 2004,
Zhao et al., 2006a and Paolacci et al., 2007), demonstrating that the MADS-box genes in plants
form a large family that plays distinct roles in flower development and organ differentiation, and
that fully understanding the molecular mechanisms for M. domestica reproductive organ formation,
in which MADS-box genes may be involved, will be needed. Recently, EST databases for apple
have been provided and its genome has been fully sequenced (Velasco et al., 2010). Further ex-
periments for isolation and functionally characterization of apple MADS-box genes related to its
flowering time and reproductive organs development are currently being carried out.
ACKNOWLEDGEMENTS
We would like to acknowledge the Ministry of Science, Research and Technology of Iran
for providing a visiting research scholarship for NM.
Literature Cited
Adam, H., Jouannic, S., Morcillo, F., Richaud, F., Duval, Y. and Tregear, J.W. 2006. MADS box
genes in oil palm (Elaeis guineensis): patterns in the evolution of the SQUAMOSA,
DEFICIENS, GLOBOSA, AGAMOUS, and SEPALLATA subfamilies. J. Mol. Evol. 62:
15–31.
Adam, H., Jouannic, S., Morcillo, F., Verdeil, J.L., Duval, Y. and Tregear, J.W. 2007a. Determination
of flower structure in Elaeis guineensis: do palms use the same homeotic genes as other
species? Ann. Bot. 100: 1-12.
Adam, H., Jouannic, S., Orieux, Y., Morcillo, F., Richaud, F., Duval, Y. and Tregear, J.W. 2007b.
Functional characterization of MADS box genes involved in the determination of oil palm
flower structure. J. Exp. Bot. 58: 1245-1259.
Alvarez-Buylla, E.R., Pelaz, S., Liljegren, S.J., Gold, S.E., Burgeff, C., Ditta, G.S., Ribas de Pouplana,
L., Martı´nez-Castilla, L., and Yanofsky, M.F. 2000. An ancestral MADS-box gene duplication
occurred before the divergence of plants and animals. Proc. Natl. Acad. Sci. USA 97: 528–5333.
Alvarez-Buylla , E.R., Liljegren , S.J., Pelaz, S., Gold , S.E., Burgeff, C., Ditta, G.S., Vergara-Silva,
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201288
F. and Yanofsky, M.F. 2000b. MADS-box gene evolution beyond flowers: expression in
pollen, endosperm, guard cells, roots and trichomes. Plant J. 24: 457–466.
Angenent, G.C., Busscher, M., Franken, J., Mol, J.N. and Van Tunen, A.J. 1992. Differential
expression of two MADS box genes in wild-type and mutant Petunia flowers. Plant Cell 4:
983-993.
Angenent, G.C., Franken, J., Busscher, M., Weiss, D. and van Tunen, A.J. 1994. Co-suppression
of the Petunia homeotic gene fbp2 affects the identity of the generative meristem. Plant J. 5: 33-44.
Becker, A. and Theissen, G. 2003. The major clades of MADS-box genes and their role in the
development and evolution of flowering plants. Mol. Phylogenet. Evol. 29: 464-489.
Becker, A., Winter, K.U., Meyer, B., Saedler, H. and Theiβen, G. 2000. MADS-box gene diversity
in seed plants 300 million years ago. Mol. Biol. Evol. 17: 1425–1434.
Borner, R., Kampmann, G., Chandler, J., Gleißner, R., Wisman, E., Apel, K. and Melzer, S. 2000.
A MADS domain gene involved in the transition to flowering in Arabidopsis. Plant J. 24: 591–599.
Colombo, M., Masiero, S., Vanzulli, S., Lardelli, P., Kater, M.M. and Colombo, L. 2008. AGL23,
a type I MADS-box gene that controls female gametophyte and embryo development in
Arabidopsis. Plant J. 54: 1037–1048.
Cseke, L.J. and Podila, G.K. 2004. MADS-box genes in dioecious aspen II: a review of MADS-box
genes from trees and their potential in forest biotechnology. Physiol. Mol. Biol. Plants 10(1): 7-28.
Davies, B., Di Rosa, A., Eneva, T., Saedler, H. and Sommer, H. 1996. Alteration of tobacco floral
organ identity by expression of combinations of Antirrhinum MADS-box genes. Plant J.
10: 663-677.
de Folter, S., Immink, R.G., Kieffer, M., Parenicova´ , L., Henz, S.R., Weigel, D., Busscher, M.,
Kooiker, M., Colombo, L., Kater, M.M., Davies, B., and Angenent, G.C. 2005. Comprehensive
interaction map of the Arabidopsis MADS Box transcription factors. Plant Cell 17: 1424–1433.
Ditta G., Pinyopich A., Robles P., Pelaz S., and Yanofsky, M.F. 2004. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr. Biol. 14: 1935–1940.
Ferra´ ndiz, C., Liljegren, S.J. and Yanofsky, M.F. 2000. Negative regulation of the SHATTERPROOF
genes by FRUITFULL during Arabidopsis fruit development. Science 289: 436–438.
Flanagan, C.A. and Ma, H. 1994. Spatially and temporally regulated expression of the MADS-box
gene AGL2 in wild-type and mutant Arabidopsis flowers. Plant Mol. Biol. 26: 581-595.
Food and Agricultural Organization. 2012. < http://faostat.fao.org/>
Giovannoni, J.J. 2004. Genetic regulation of fruit development and ripening. Plant Cell 16 (suppl.):
S170–S180.
Gu, Q., Ferra´ ndiz, C., Yanofsky, M.F. and Martienssen, R. 1998. The FRUITFULL MADS-box
gene mediates cell differentiation during Arabidopsis fruit development. Development 125:
1509–1517.
Hartmann, U., Hohmann, S., Nettesheim, K., Wisman, I., Saedler, H. and Huijser, P. 2000. Molecular
cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J. 21: 351–360.
Henschel, K., Kofuji, R., Hasebe, M., Saedler, H., Munster, T. and Theissen, G. 2002. Two ancient
classes of MIKC-type MADS-box genes are present in the moss Physcomitrella patens.
Mol. Biol. Evol. 19: 801-814.
Jack T. 2001. Relearning our ABCs: new twists on an old model. Trends Plant Sci. 6(7): 310-316.
Johansen, B., Pedersen, L.B., Skipper, M. and Frederiksen, S. 2002. MADS-box gene evolution-structure
and transcription patterns. Mol. Phylogenet. Evol. 23: 458-480.
Kakinuma, M., Inoue, M., Morita, T., Tominaga, H., Maegawa, M., Coury, D.A. and Amano, H.
2011. Isolation and characterization of a SEPALLATA-like gene, ZjMADS1, from marine
angiosperm Zostera japonica. Mar. Environ. Res.
Kanno, A., Hienuki, H., Ito, T., Nakamura, T., Fukuda, T., Yun, P.Y., Song, I.J., Kamimura, T.,
Ochiai, T., Yokoyama, J., Maki, M. and Kameya, T. 2006. The structure and expression of
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 89
SEPALLATA-like genes in Asparagus species (Asparagaceae). Sex. Plant Reprod. 19: 133–144.
Kater, M.M., Dreni, L. and Colombo, L. 2006. Functional conservation of MADS-box factors
controlling floral organ identity in rice and Arabidopsis. J. Exp. Bot. 57: 3433–3444.
Kofuji, R., Sumikawa, N., Yamasaki, M., Kondo, K., Ueda, K., Ito, M. and Hasebe, M. 2003.
Evolution and divergence of the MADS-box gene family based on genome-wide expression
analyses. Mol. Biol. Evol. 20: 1963-1977.
Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M. and Lee, I. 2000.
The AGAMOUSLIKE 20 MADS domain protein integrates floral inductive pathways in
Arabidopsis. Genes Dev. 14: 2366–2376.
Liljegren, S.J., Ditta, G.S., Eshed, Y., Savidge, B., Bowman, J.L. and Yanofsky, M.F. 2000.
SHATTERPROOF MADSbox genes control seed dispersal in Arabidopsis. Nature 404:
766–770.
Liu, C., Thong, Z., and Yu, H. 2009. Coming into bloom: The specification of floral meristems.
Development 136: 3379–3391.
Liu, C., Zhang, J., Zhang, N., Shan, H., Su, K., Meng, Z., Kong, H. and Chen, Z. 2010. Interactions
among proteins of floral MADS-box genes in basal eudicots: implications for evolution of
the regulatory network for flower development. Mol. Biol. Evol. 27: 1598-1611.
Ma, H., Yanofsky, M.F. and Meyerowitz, E.M. 1991. AGL1-AGL6, an Arabidopsis gene family
with similarity to floral homeotic and transcription factor genes. Genes Dev. 5: 484-495.
Mandel, M.A. and Yanofsky, M.F. 1998. The Arabidopsis AGL9 MADS box gene is expressed in
young flower primordial. Sexual Plant Reproduction 11: 22-28.
Michaels, S.D, Amasino, R.M. 1999. FLOWERING LOCUS C encodes a novel MADS domain
protein that acts as a repressor of flowering. Plant Cell 11:949–956.
Michaels, S.D., Ditta, G., Gustafson-Brown, C., Pelaz, S., Yanofsky, M. and Amasino, R.M. 2003.
AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization.
Plant J. 33: 867–874.
Nam, J., Kim, J., Lee, S., An, G., Ma, H., and Nei, M. 2004. Type I MADS-box genes have experienced
faster birth-and-death evolution than type II MADS-box genes in angiosperms. Proc. Natl.
Acad. Sci. USA 101: 1910–1915.
Nesi, N., Debeaujon, I., Jond, C., Stewart, A.J., Jenkins, G.I., Caboche, M. and Lepiniec, L. 2002.
The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADSdomain
protein and is required for proper development and pigmentation of the seed coat. Plant
Cell 14: 2463–2479.
Ng, M., and Yanofsky, M.F. 2001. Function and evolution of the plant MADS-box gene family.
Nat. Rev. Genet. 2: 186–195.
Paolacci, A.R., Tanzarella, O.A., Porceddu, E., Varotto, S. and Ciaffi, M. 2007. Molecular phylogenetic
analysis of MADS-box genes of MIKC type and chromosome location of SEP-like genes
in wheat (Triticum aestivum L.). Mol. Genet. Genomics 278: 689–708.
Parenicova´ , L., de Folter, S., Kieffer, M., Horner, D.S., Favalli, C., Busscher, J., Cook, H.E., Ingram,
R.M., Kater, M.M., Davies, B., Angenent, G.C., and Colombo, L. 2003. Molecular and
phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis:
New openings to the MADS world. Plant Cell 15: 1538–1551.
Pelaz, S., Ditta, G.S., Baumann, E., Wisman, E. and Yanofsky, M.F. 2000. B and C floral organ
identity functions require SEPALLATA MADS-box genes. Nature 405: 200–203.
Pinyopich, A., Ditta, G.S., Savidge, B., Liljegren, S.J., Baumann, E., Wisman, E. and Yanofsky,
M.F. 2003. Assessing the redundancy of MADS-box genes during carpel and ovule
development. Nature 424: 85–88.
Pnueli, L., Abu-Abeid, M., Zamir, D., Nacken, W., Schwarz-Sommer, Z. and Lifschitz, E. 1991.
The MADS box gene family in tomato: temporal expression during floral development,
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201290
conserved secondary structures and homology with homeotic genes from Antirrhinum and
Arabidopsis. Plant J. 1: 255-266.
Pnueli, L., Hareven, D., Rounsley, S.D., Yanofsky, M.F. and Lifschitz, E. 1994. Isolation of the
tomato AGAMOUS gene TAG1 and analysis of its homeotic role in transgenic plants. Plant
Cell 6(2): 163–173.
Purugganan, M.D., Rounsley, S.D., Schmidt, R.J. and Yanofsky, M.F. 1995. Molecular evolution
of flower development: diversification of the plant MADS-box regulatory gene family.
Genetics 140: 345–356.
Ratcliffe, O.J., Kumimoto, R.W., Wong, B.J. and Riechmann, J.L. 2003. Analysis of the Arabidopsis MADS AFFECTING FLOWERING Gene Family: MAF2 prevents vernalization by short
periods of cold. Plant Cell 15: 1159–1169.
Riechmann, J.L. and Meyerowitz, E.M. 1997. MADS-domain protein in plant deveiopment. Biol.
Chem. 378:1079–1101.
Rijpkema, A.S., Zethof, J., Gerats, T. and Vandenbussche, M. 2009. The petunia AGL6 gene has
a SEPALLATA-like function in floral patterning. Plant J. 60: 1-9.
Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing guide
trees. Mol. Biol. Evol. 4: 406-425.
Schwarz-Sommer, Z., Davies, B., and Hudson, A. 2003. An everlasting pioneer: The story of
Antirrhinum research. Nat. Rev. Genet. 4: 657–666.
Scortecci, K.C., Michaels, S.D. and Amasino, R.M. 2001. Identification of a MADS-box gene,
FLOWERING LOCUS M, that represses flowering. Plant J. 26: 229–236.
Seymour, G.B., Ryder, C.D., Cevik, V., Hammond, J.P., Popovich, A., King, G.J., Vrebalov, J.,
Giovannoni, J.J. and Manning, K. 2011. A SEPALLATA gene is involved in the development
and ripening of strawberry (Fragaria x ananassa Duch.) fruit, a non-climacteric tissue. J.
Exp. Bot. 62: 1179-1188.
Shore, P., and Sharrocks, A.D. 1995. The ETS-domain transcription factors Elk-1 and SAP-1 exhibit
differential DNA binding specificities. Nucleic Acids Res. 23: 4698–4706.
Song, J., Chen, Z. and Liao, J. 2010. Isolation and characterization of a SEP- like gene from Alpiniahainanensis (Zingiberaceae). Mol. Biol. Rep. 37: 917-922.
Sommer, H., Beltra´ n, J.P., Huijser, P., Pape, H., Lo¨ nnig, W.E., Saedler, H., and Schwarz-Sommer,
Z. 1990. Deficiens, a homeotic gene involved in the control of flower morphogenesis in
Antirrhinum majus: The protein shows homology to transcription factors. EMBO J. 9: 605–613.
Southerton, S.G., Marshall, H., Mouradov, A. and Teasdale, R.D. 1998. Eucalypt MADS-box genes
expressed in developing flowers. Plant Physiol. 118: 365-372.
Sundstrom, J. and Engstrom, P. 2002. Conifer reproductive development involves B-type MADS-box
genes with distinct and different activities in male organ primordial. Plant J. 31: 161-169.
Sung, S.K. and An, G. 1997. Molecular cloning and characterization of a MADS-box cDNA clone
of the ‘Fuji’ apple. Plant Cell Physiol. 38(4): 484-9.
Sung, S.K., Yu, G.H. and An, G. 1999. Characterization of MdMADS2 a member of the
SQUAMOSA subfamily of genes, in apple. Plant Physiol. 120: 969-978.
Sung, S.K., Yu, G.H., Nam, J., Jeong, D.H. and An, G. 2000. Developmentally regulated expression
of two MADS-box genes, MdMADS3 and MdMADS4, in the morphogenesis of flower buds
and fruits in apple. Planta 210(4): 519-28.
Tanabe, Y., Hasebe, M., Sekimoto, H., Nishiyama, T., Kitani, M., Henschel, K., Munster, T., Theissen,
G., Nozaki, H. and Ito, M. 2005. Characterization of MADS-box genes in charophycean
green algae and its implication for the evolution of MADS-box genes. Proc. Natl. Acad.
Sci. USA. 102: 2436-2441.
Tani, E., Polidoros, A.N., Flemetakis, E., Stedel, C., Kalloniati, C., Demetriou, K., Katinakis, P.
and Tsaftaris, A.S. 2009. Characterization and expression analysis of AGAMOUS-like,
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 91
SEEDSTICK-like, and SEPALLATA-like MADS-box genes in peach (Prunus persica) fruit.
Plant Physiol. Biochem. 47: 690-700.
Tamura K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. 2011. MEGA5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Mol. Biol. Evol. (In Press). doi: 10.1093/molbev/msr121.
Theiβen, G. 2001. Development of floral organ identity: stories from the MADS house. Curr. Opin.
Plant Biol. 4: 75–85.
Theißen,G., Becker, A., Rosa, A.D., Kanno, A., Kim, J.T., Münster, T., Winter, K.U. and Saedler,
H. 2000. A short history of MADS-box genes in plants. Plant Mol. Biol. 42: 115–149.
Theißen, G., Kim, J.T. and Saedler, H. 1996. Classification and phylogeny of the MADS-box multigene
family suggest defined roles of MADS-box gene subfamilies in the morphological evolution
of eukaryotes. J. Mol. Evol. 43: 484–516.
Vandenbussche, M., Theissen, G., Van de Peer, Y. and Gerats, T. 2003. Structural diversification
and neo-functionalization during floral MADS-box gene evolution by C-terminal frameshift
mutations. Nucleic Acids Res. 31: 4401-4409.
Vandenbussche, M., Zethof, J., Souer, E., Koes, R., Tornielli, G.B., Pezzotti, M., Ferrario, S.,
Angenent, G.C., and Gerats, T. 2003. Toward the analysis of the Petunia MADS box gene
family by reverse and forward transposon insertion mutagenesis approaches: B, C, and D
floral organ identity functions require SEPALLATA-like MADS box genes in petunia. Plant
Cell, 15, 2680-2693.
Velasco, R., Zharkikh, A., Affourtit, J., Dhingra, A., Cestaro, A., Kalyana-raman, A., Fontana, P.,
Bhatnagar, S.K., Troggio, M. and Pruss, D. 2010. The genome of the domesticated apple
(Malus x domestica Borkh.). Nat Genet, 42, 833-839.
Whipple, C.J., Ciceri, P., Padilla, C.M., Ambrose, B.A., Bandong, S.L., and Schmidt, R.J. 2004.
Conservation of B-class floral homeotic gene function between maize and Arabidopsis.
Development 131: 6083–6091.
Yao, J.L., Dong, Y.H., Kvarnheden, A. and Morris, B. 1999. Seven MADS-box genes in apple are
expressed in different parts of the fruit. J. Amer. Hort. Sci. 124: 8-13.
Zhang, H. and Forde, B.G 1998. An Arabidopsis MADS-box gene that controls nutrient-induced
changes in root architecture. Science 279:407–409.
Zhao, T., Ni, Z., Dai, Y., Yao, Y., Nie, X. and Sun, Q. 2006. Characterization and expression of 42
MADS-box genes in wheat (Triticum aestivum L.). Mol. Genet. Genomics, 276: 334-350.
Zahn, L.M., Kong, H., Leebens-Mack, J.H., Kim, S., Soltis, P.S., Landherr, L.L., Soltis, D.E., de
Pamphilis, C.W. and Ma, H. 2005. The evolution of the SEPALLATA subfamily of MADS-box
genes: a preangiosperm origin with multiple duplications throughout angiosperm history.
Genetics, 169: 2209–2223.
Zuckerkandl, E. and Pauling, L. 1965. Evolutionary divergence and convergence in proteins.
Edited in Evolving Genes and Proteins by V. Bryson and H.J. Vogel, pp. 97-166. Academic
Press, New York.
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201292
Table 1. Forward and reverse primers used for cloning MADS-box genes in RT-PCR reaction.
Tables
Gene Forward primer Reverse primer
MdMADS1MdMADS3
GGCGGATCCATGGGGAGAGGAAGAGTG
GCAGGATCCCAGTTTGTCTACCTCTGA
CGCATGGATCCTCAAAGCATCCATCCAG
CGCGGATCCGTATATACAAATTGGTCTC
Ingredients Amount
PCR water
Forward primer of the gene of interest (20 uM)
Reverse primer of the gene of interest (20 uM)
Actin-5P primer (20 uM)
Actin-3P primer (20 uM)
10 mM dNTPs
10x Platinum buffer
Platinum Taq DNA Polymerase
38.5 µl
1 µl
1 µl
1 µl
1 µl
1 µl
5 µl
0.5 µl
Table 2. Polymerase chain reaction mixture for amplification of the genes from RT reaction.
Temperature Time duration
94 °C
32 cycles:
94 °C
Taa (50/55/60°C)
72 °C
Final extension:
72 °C
2 min
30 sec
30 sec
30 sec per 0.5 kb
10 min
Table 3. Thermal programming of the PCR reaction.
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 2012 93
Malus × domesticaGene name GI number
Arabidopsis thalianaGene name GI number
MdMADS3
MdMADS1
MdMADS2
MdMADS4
MdMADS5
MdMADS6
MdMADS7
MdMADS8
MdMADS9
MdMADS10
MdMADS11
MdMADS11.1
MdMADS12
MdMADS13
MdMADS14.1
MdMADS14
MdMADS15
MdMADS16
MdMADS16.1
MdMADS17
MdMADS18
MdMADS19
MdMADS20
MdMADS21
MdJOINTLESS
MdPI
MdAGL
MdSOC1a
MdSOC1ak
MdSOC1c
5777904
3290209
3947985
5777906
110681903
351602211
302398909
3646334
3646336
3646326
3646340
302398915
32452882
16973294
302398885
16973296
16973298
189339107
302398887
302398889
302398891
302398893
302398897
302398899
122056647
12666535
33308109
114386386
268327050
295684203
SEP1/AGL2
SEP2/AGL4
SEP3/AGL9
SEP4/AGL3
AP1/AGL7
AP3
AG
FLC
PI
AGL8/FUL
AGL1/SHP1
AGL5/SHP2
AGL6
CAL/AGL10
AGL11/STK
AGL12
AGL13
AGL14
AGL15
AGL16
AGL17
AGL18
AGL19
SOC1/AGL20
AGL24
AGL71
AGL72
AGL79
52548008
52548054
334182820
330250646
332196766
332645695
3915597
332004118
332005434
1004365
113511
113515
330255488
259016368
12229648
332197095
332646637
332657662
332004558
332646109
330252237
332646129
332659284
17433202
332659522
332008757
32402406
32402440
Table 4. The genes (proteins) used in this research in making phylogenetic tree and their gi-numbers in the public
databases GeneBank/EMBL/DDJB.
Journal of Ornamental and Horticultural Plants, 2 (2): 83-94, June, 201294
Figures
Fig. 1. Agarose (1%) gel electrophoresis of RT-PCR and colony-
PCR of the isolated genes. A. RT-PCR of MdMADS1-Golden, B.
Colony-PCR of MdMADS1-Golden, C. RT-PCR of MdMADS3-
Golden, D. Colony-PCR of MdMADS3-Golden.
Fig. 2. Evolutionary relationships of apple and Arabidopsis MADS-
box genes. AGL2 clade of MADS-box genes comprises Md-
MADS1 and MdMADS3 genes isolated in this research. The genes
with “Md-“ prefix are from apple and the others are from Arabidop-
sis. The evolutionary history was inferred using the Neighbor-Join-
ing method (Saitou and Nei, 1987). The optimal tree with the sum
of branch length = 10.01153205 is shown. The tree is drawn to
scale, with branch lengths in the same units as those of the evolu-
tionary distances used to infer the phylogenetic tree. The evolu-
tionary distances were computed using the Poisson correction
method (Zuckerkandl and Pauling, 1965) and are in the units of
the number of amino acid substitutions per site. The analysis in-
volved 55 amino acid sequences. All positions containing gaps and
missing data were eliminated. There were a total of 122 positions
in the final dataset. Evolutionary analyses were conducted in
MEGA5 (Tamura et al., 2011).
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 2012 95
Copper Effects on Growth Parameters of Hollyhock
(Althaea rosea L.)
Copper is an essential micronutrient for plant growth which is involved
in many metabolic processes. However excessive amounts of copper may
cause environmental pollution. With an increase in the contamination of urban
areas with heavy metals, more attention should be paid to the role of ornamental
plants in removing pollutants from the soils. The effects of heavy metals on
the growth parameters of plants also should be determined. In this research the
effects of four levels of Cu (CuSO4.5 H2O) including 0, 20, 40 and 80mg Cu
kg soil on growth parameters of hollyhock plants were investigated. Results
showed that in treated plants root and shoot elongation, root dry weight and
shoot fresh weight were not significantly differentiate from control. However,
a significant decrease in Chl.a, Chl.b and total chlorophyll content was
observed by increasing the cu level in the soil. Proline content in the leaf
tissues reached to the highest values when plants were treated with 80 mg Cu
kg soil. Electrolyte leakage of treated plant with 20 mg Cu kg soil was not sig-
nificant differentiate from control. The concentration of Cu in the shoots and
roots significantly increased with increasing the Cu level in the soil. Translocation
factor at all Cu concentrations significantly decreased in compared to the
control. Generally, results showed that A.rosea is a suitable alternative for
phytoremediation of copper contaminated area.
Keywords: Althaea rosea, Copper, Growth parameter.
M. Kamali1*, M. Sarcheshme Pour2 and A.A. Maghsoudi Moud3
1Graduate Student, Department of Horticultural Sciences, Factually of Agriculture, Shahid Bahonar
University, Kerman, Iran.2Assistant Professor, Department of Soil Science, Factually of Agriculture, Shahid Bahonar University,
Kerman, Iran.3 Associate Professor, Department of Agronomy and Plant Breeding, Factually of Agriculture, Shahid
Bahonar University, Kerman, Iran.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 201296
INTRODUCTION
Soil and irrigation water contamination with heavy metals is one of the most serious envi-
ronmental problems to limit plant production and threat human health. The major sources of con-
tamination in urban areas are industrial wastes, home applications which are disposed in correctly
and municipal sewage sludge (Prabha et al., 2007;Qian et al., 2005).
For plants, copper (Cu) is an essential micronutrient. It plays a structural and catalytic role
as it is a component of several proteins and enzymes involved in electron transfer chain, oxidation
and reduction reactions, charge accumulations and for phytosystem II activity(Ducic and Polle.,
2005). Cu is normally present in plant tissues at 10 µg g-1 plant dry weight (Ducic and Polle.,
2005). However, excessive amount of Cu affects nitrogen and protein metabolism, causes chlorosis
of leaves, inhibits photosynthesis and disturbs mineral uptake (Wei et al., 2008). Cu interferes with
the biosynthesis of photosynthetic machinery and decreases net photosynthetic rate (Qian et al.,2005). In the nature, Cu contamination usually results from human activities, such as mining,
smelting, industrial waste disposal, sewage sludge application to agricultural soils, and the use of
some types of fertilizers and pesticides (Ducic and Polle., 2005; Wei et al., 2008).
Up to now, many plants have been found as remediation plants, but there was little report
about ornamental plants that can remedy contaminated soils. In fact, ornamental resources are very
abundant, and they can indicate and monitor atmospheric pollutants. Especially for urban areas,
ornamentals can beautify the environment and also resolve heavy metal pollution at the same time.
Phytoremediation has received more attentions in recent years since it has been shown to be cost
effective and more easy to apply than other conventional technologies for removing contaminates
from the soils (Moteshare zadeh et al., 2008). Generally, phytoremediation is the use of green
plants to remove contaminants from soils (Moteshare zadeh et al., 2008). There are many plants
species currently used in phytoremediation, such as Ammania baccifere which can accumulate up
to 1000 mg cu kg root dry weight(Mukhopadhyay and Maiti., 2010).
To our knowledge, there are few reports about ornamental plants that can absorb Cu from
contaminated soils. The aim of this study was to identify the capability of A. rosea to remove Cu
from contaminated soils by application of a concentration gradient of Cu, and also to evaluate the
effects of different concentration levels of copper on growth parameters of A. rosea.
MATERIAL AND METHODS
An experiment was conducted in Shahid Bahonar University of Kerman Agricultural re-
search station in 2010. Seeds of A.rosaea were sterilized in 0.5% (w/v) NaClO3 for 5 min and
rinsed four times in deionized water. In April 2010, soil samples were collected from the 0-30 cm
depth of university landscape and were analyzed to determine the level of Cu. The samples without
contamination were selected and sieved through a 4 mm sieve and filled into 1:2000 wagner pots.
Copperic sulfate (CuSO4.5H2O) solution was added to the soil in each experimental pot at 20, 40
and 80 mg Cu kg soil. Soils were then completely mixed and rested to be completely equilibrated
for 40 days. Seedlings of A.rosea all at similar growth stage were transplanted into the pots. Pots
were then arranged in a completely randomized design with four replications. Number of seedlings
per pots was reduced to 3 as one experimental plot and pots were replicated 3 times to minimize
the experimental errors. Growing conditions was adjusted as follows: light intensity 150 µmol
photon m-2 s-1; maximum temperature 35 ̊C, minimum temperature 15 ̊C, photoperiod 16h/8h
light/night and 60% relative humidity. Water lost by each pot was measured regularly by weighing
out the pots every other days and sufficient amount of water applied to maintain soil water content
at 85% of soil water holding capacity. Plants were harvested after 120 days.
Estimation of chlorophyll content
Chlorophyll content in the leaf tissues was determined according to the method described
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 2012 97
by Arnone (1949). Briefly 0.1 g of fresh leaf samples were extracted with 10 ml of ethanol and
then absorbance of the extract was measured by spectrophotometer (SPUV-26) at 663 and 645 nm
(Arnone, 1949).
Estimation of proline content
Proline content was determined by the method of Bates et al. (1973). Leaf samples were
homogenized in 3% aqueous sulfosalicylic acid, and the homogenate was centrifuged (Universal
320R) at 10,000 rpm. The supernatant was used for estimation of the proline content. The ab-
sorbance was read by a Spectrophotometer (SPUV-26 ) at 520 nm (Bates et al., 1973).
Estimation of electrolyte leakage
One gram of tissue was cut to in 2cm segments, rinsed in deionized water for 24 h at 24 ̊C.
The electrical conductivity of the solution was determined using a conductivity meter (Winlab).
Tubs were then air thighted and placed in boiling water bath for 20 min to disrupt the tissues and
cells, and then cooled to 24 ̊C. The electrical conductivity was again measured. Membrane ion
leakage was calculated as the ratio of the conductivity after 12 h to the conductivity after boiling
(Pang et al., 2003).
Estimation of copper content
Plants were rinsed, cut and separated into the shoots and roots. Each part was dried in an
oven at 65 ̊C for 72 h. Samples dry weight were recorded. All dried parts were grounded using a
morter and pistel , mixed thoroughly and digested with HCl (0.1 N). After filtration extracts were
analyzed for copper content by an ICP set (AAS varian BV model) (Rothery, 1988).
Estimation of number and length of stomat
Leaf samples imprints prepared by nail polish and used to estimate of number and length
stomata. Epidermis were viewed with a light microscope (40X Objective, 10X ocular,). Observa-
tions were made on an average of 10 fields. Measurements were made with a calibrated eyepiece
micrometer. All data were then converted to μm.
Estimation of translocation factor
The ratio of metal concentrations in shoot to root is defined as translocation factor (TF)
which refers to the ability of plant to translocate metals from the root to the shoot. (Roongtanakiat,
2009).
All data were subjected to the analysis of variance using one-way ANOVA model (SAS
program version 9 for Windows) and tested at 1% level of significance.
RESULTS AND DISCUSSION
Morphological parameters
Values of stem length, stem fresh weight and root dry weight of plants treated with different
levels of Cu were not significantly different from what were found in untreated ones. Even though
the highest values of root fresh weight and shoot dry weight were found in plants treated with 20
mg Cu kg soil, these values were significantly different from those of untreated plants. Increasing
levels of Cu in the soil significantly increased the stomatal number and length. However, root
length significantly decreased in treated Cu compared to the control plants (Table 1).
It has been shown that root growth of Elsholtzia haichowensis had more sensitive to high
Cu levels than shoot growth (Qian et al., 2005). Root elongation and biomass reduction were re-
ported to be the most sensitive parameter in plants exposed to heavy metals (Wei et al., 2008). The
inhibitory effect of Cu on root growth supposed to be due to reduction in cell division and retar-
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 201298
dation of normal root cell growth (Wei et al., 2008).
Chlorophyll content
Increasing the Cu levels in the soil significantly decreased chl.a, chl.b and total chlorophyll
content of plant leaves. Lowest amount of photosynthetic pigments was found in plants grown in
the soil containing 80 mg Cu kg soil (Table 2).
It has been shown that at lower Cu concentrations, the central Mg2+ ion of the chlorophyll
is replaced by Cu2+(Singh et al., 2010). The loss of photosynthetic pigment content is generally
due to the direct peroxidative breakdown of pigments and chloroplast membrane lipids by the re-
active oxygen species (Singh et al., 2010). Chlorophyll content in Chrysanthemum coronarium L.
has shown to decrease with increasing the level of Cu, significantly (Wei et al., 2008).
Proline content
Highest level of proline content was found in plants treated with 80 mg Cu kg soil. The
amount of Cu absorbed by plants treated with different levels of Cu was significantly higher than
that of untreated ones (Table 2). Proline can play an important protective role against heavy metal
stress. Proline has shown to improve Cu tolerance of chickpea genotypes effectively by controlling
oxidative stress, an important cause of copper toxicity(Singh et al., 2010).
Electrolyte leakage
Ion leakage in plants treated with 20 mg Cu kg soil was not significantly different from
untreated plants. However, increasing the level of Cu in the soil to 40 and 80 mg Cu kg soil, sig-
nificantly increased ion leakage of the leaf tissues (Table 2).
The accumulation of Cu2+ ions may induce the formation of reactive oxygen species (ROS),
H2O2 and HO and a subsequent decrease of antioxidants to avoid cell damages due to ROS accu-
mulation. Additionally, Cu2+ ions can interact with S and N groups in cell proteins and cause an
alteration of the ionic channels of the membrane, which promotes a higher flow of ions in the leaf
cells (Bakor et al., 2007). Cu-induced stress has been shown to causes membrane damage in Azolla
accession during the first hours after exposure (Sanchez- viveros et al., 2010).
Cu content in A.roseaIncreasing the concentration of the Cu in the soil, increasing the Cu absorbed by roots and
shoot parts. The maximum concentration of Cu in the roots and shoot parts of plants were 152 and
85 ppm in experimental pots with 80 mg Cu kg-1 soil, respectively. Generally the amount of Cu
was higher in the roots compared to the shoot parts (Fig. 1 and 2).
The level of Cu in the cell wall fractions in roots and shoots of Chrysanthemum coronariumL. also showed an increasing trend with the increase of Cu concentration in nutrient solution (Wei
et al., 2008). It was suggested that Cu transportation over the tonolplast and final storing in the
vacuole plays a roll in the detoxification process (Wei et al., 2008).
It is obvious that copper accumulation may also be affected by soil properties such soil pH
and soil moisture and the changing environmental individual genotypic variability and varying de-
grees of soil contamination affected Cu accumulation in plants (Ariyakanon and Winaipanich.,
2006 ).
Translocation factor
Translocation factor was found to be highest in untreated plants. Increasing the Cu level to
20, 40 and 80 mg-1Cu kg soil significantly decreased the Cu translocation factor compared to the
control plants. However, the difference among all treated plants were not significant (Table 2).
The heavy metal translocation ability of vetiver grass grown in industrial wastewaters varied
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 2012 99
depending on the characteristic of growth media and metal types (Roongtanakiat, 2009). This
factor in amaranthus was much better than that in sunflower and amaranthus had more successful
phytoremediation (Ducic and Polle., 2005).
CONCLUSION
The results from the present investigation show that this plant could not be classified as a
Cu hyperaccumulator because the Cu concentration in the roots was greater than that in the shoots,
it was tolerant to Cu because it grew well in soils with 80 mg kg-1 Cu. Thus A. rosea has great po-
tential to be used for phytostabilization remediation of contaminated soils by Cu. What was more
significant was A. rosea could remedy contaminated soils while beautifying the environment at
the same time, especially in urban areas this has an important and practical significance.
Literature Cited
Ariyakanon, N. and Winaipanich, B. 2006. Phytoremediation of copper contaminated soil by Brassicajuncea L. and Bidens alba L. Dc. var. Radiate. J. Sci. Res. Chula. Univ. 31(1):49-56.
Arnone, D. I. 1949. Copper enzymes in isolated chloroplasts polyphenol oxidase in beta vulgalisL. Plant Physiol. 24: 1-15.
Bakor, M., Vaczi, P., Bartak, M., Budova, J. and Dzubaj, A. 2007. Uptake, photosynthetic characteristics
and membrane lipid peroxidation levels in the lichen photobiont Trebouxia erici exposed
to copper and cadmium. Bryologist. 110: 100-107.
Bates, L.S., Waldren, R.P. and Tears, I.D. 1973. Rapid determination of free proline for water stress
studies. Plant Soil. 39: 205-207.
Ducic, T. and Polle, A. 2005. Transport and detoxification of manganese and copper in plants.
Braz. J. Plant Physiol. 17(1):103-112.
Moteshare Zadeh, B., Firozabadi, G.R., Alikhani, H.A. and Mirseyed Hosseini, H. 2008. Effect of
sunflower and Amaranthus culture and application of inoculants on phytoremediation of
the soil contaminated with cadmium. American-Eurasian J. Agric. Environ. Sci.4(1): 93-103.
Mukhopadhyay, S. and Maiti, S.K. 2010. Phytoremediation of metal mine waste. Appl. Ecol.
Environ. Res. 8(3): 207-222.
Pang, J. G., Chan, S. Y., Zhang, J., Liang, J. and Wong, M.H. 2003. Physiological aspects of vitiver
grass for rehabilitation in abandoned metalliferous mine wastes. Chemosphera. 52:1559-1570.
Prabha, K., Marathiamma, P. and Li, L. 2007. Phytoremediation technology: hyper-accumulation
metals in plant. Water Air Soil Pollut. 184: 105-126.
Qian, M., Li, X. and Shen, Z. 2005. Adaptive copper tolerance in Elsholtzia haichowensis involves
production of Cu- induced thiol peptides. Plant Growth Regul. 47:66-73.
Roongtanakiat, N. 2009. Vitiver phytoremediation for heavy metal decontamination. Tech. B. 1-20.
Rothery, E. 1988. Analatical methods for graphite tube atomizer, Pty Ltd. Mulgrave, Victor. 99-102.
Sanchez-Viveros, G., Gonzales Mendoza, D., Alarcon, A. and Ferrera Crrato, R. 2010. Copper effects
on photosynthetic activity and membrane leakage of Azolla filiculoides and A. caroliniania.
Int. J. Agr. Biol. 12(3):365-368.
Singh, V., Bhatt, I., Aggarwal, A., Tripathi, B. N., Munjal, A. K. and Sharma, V. 2010. Proline improves
copper tolerance in chickpea (Cicer arieyinum). Protoplasma. 245: 173-181.
Wei, L., Luo, C., Li, X and Shen, Z. 2008. Copper accumulation and tolerance in Chrysanthemum coronarium L. and Sorghum sudanense L. Arch. Environ. Contam. Toxical. 55:238- 246.
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 2012100
Cu level
(mg/kg)
Stomata
length
(µm)
stomata
number
Root dry
weight(g)
Shoot dry
weight (g)
Root fresh
weight (g)
Shoot
fresh
weight (g)
Root
length
(cm)
Shoot
length(cm)
0
20
40
80
15.75d
18.93c
22.12b
24.31a
11.75c
14.5b
17.33a
18.6a
5.68a
5.87a
5.91a
5.67a
6.1b
7.24a
6.61ab
6.31ab
14.16b
16.74a
15.28ab
14.58ab
13.12a
13.56a
13.63a
13.09a
20.59a
18.63ab
15.34bc
13.06c
20.29a
20.71a
21.83a
19.25a
Table 1. Mean values of growth characteristics of hollyhock plants treated with different levels of copper con-
centrations.
Differences between means which are followed by the same letter are not significantly different at 1% level
of significance.
Cu
level(mg/kg)
Translocation
factor(Tf)
Proline
(µm/l)
Electrolyt
leakage (ds)
Total
chlorophyll
Chlorophyll b
(mg/g fresh weight)
Chlorophyll a (mg/g
fresh weight)
0
20
40
80
0.85a
0.59b
0.56b
0.55b
65.71c
76.68c
119.97b
172.95a
26.63b
26.85b
36.85a
37.16a
42.26a
36.77b
35.13cb
31.66c
19.04a
15.4b
14.37cb
11.92c
23.22a
21.07ab
20.76ab
19.90b
Table 2. Mean values of physiological characteristics of hollyhock plants treated with different levels of copper
concentrations.
Differences between means which are followed by the same letter are not significantly different at 1% level
of significance.
Tables
Journal of Ornamental and Horticultural Plants, 2 (2): 95-101, June, 2012 101
Figures
Fig.1. Effect of Cu concentration on the accumulation of Cu in the
roots of A. rosea
Fig.2. Effect of Cu concentration on the accumulation of Cu in the
shoots of A. rosea
www.jornamental.com
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012 103
Controlling Ornamental Cabbage and Kale (Brassicaoleracea) Growth via Cycocel
Chlormequat (cycocel or CCC), the plant growth retardant, was evaluated
for its ability to control plant height in Brassica oleracea cultivar ‘Kamome
White’ and ‘Nagoya Red’. Different concentrations of CCC (0, 500, 1000 and
1500 mg/L) were sprayed and drenched on plants 40 days after transplanting.
Data were recorded the 60 and 90 days after transplanting. The 1500 mg/L of
CCC resulted in about 50 and 20% shorter plants than the control plants, 60
and 90 days after transplant, respectively. The growth of Brassica oleraceacultivar ‘Kamome White’ and ‘Nagoya Red’ decreased with increasing the
concentration of CCC. Foliar sprays of CCC controlled plant height of both
cultivars. The least record of plant height was obtained by application of 1500
mg/L CCC via spraying method in cultivar ‘Kamome White’ after 60 and 90
days (9.94 and 11.59 cm, respectively). The effect of cultivar type has been
significant at p≤0.01 level on all measured traits.
Keywords: Brassicaceae, Chlormequat, Drench, Plant height, Spray.
A. Gholampour1, D. Hashemabadi2*, Sh. Sedaghathoor2 and B. Kaviani2
1MSc. Student, Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht,
Iran. 2Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht, Iran.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012104
INTRODUCTION
Ornamental cabbage and kale (Brassica oleracea) (Brassicaceae) is an important landscape
plant for fall, winter and spring gardens and parks. This attractive plant is resistant to the cold.
Due to excessive stem elongation of ornamental cabbage and kale in the fall and early winter, there
is a challenge for maintaining a short, yet robust plant that will look proportional to the proper
size. Shorter plants are more attractive and easier to handle during marketing and planting. Com-
mercial value of ornamental cabbage and kale depends on its height.
Plant growth regulators are commonly applied to limit stem elongation and produce a more
compact plant (Tayama et al., 1992). To counteract excessive stem elongation, plant growth retar-
dants like CCC are usually used (Messinger and Holcomb, 1986; Sachs and Hackett, 1972). These
compounds can delay cell division and elongation of plant aerial parts as well restrict gibberellins
biosynthesis, resulted in reduces internodes length and vegetative growth (Cosgrove and Sovon-
ick-Dunford, 1989; Catchey, 1964; Sanderson, 1973; Magnitskiy et al., 2006). Gibberellins play
an important role in the growth and development of plants. Type of species and cultivar, time and
method of application, concentration, and type of target organ as well physiological and environ-
mental conditions are some important factors affecting on the influence of growth retardants on
plants (Hojjati et al., 2009; Khangoli, 2001; Holcomb and White, 1970; James et al., 1999; Pobud-
kiewicz and Nowak, 1994). CCC is applied as foliar spray and drench (Shekari et al., 2004). De-
termining the optimal CCC foliar spray or drench rates would offer other options for controlling
ornamental cabbage and kale plant growth (Gibson and Whipker, 2000). Proper doses need to be
assessed because they can either inhibit or promote growth and development depending on amount.
Recommended stage and doses for CCC application are 3-4 true leaf and 500-3000 mg/L (Shekari
et al., 2004). Adding CCC has also proven to be effective in controlling growth of some other
plants (Holcomb and White, 1970; Al-Khassawneh et al., 2006; Leclerc et al., 2006; Hojjati et al.,2009; Karlovic et al., 2004; Rossini Pinto et al., 2005).
The purpose of this study was to evaluate the effect of different concentrations of CCC on
some growth characters especially plant height in Brassica oleracea cultivars ‘Kamome White’
and ‘Nagoya Red’.
MATERIALS AND METHODS
Seeds of ornamental cabbage and kale (Brassica oleracea) cultivars ‘Kamome White’ and
‘Nagoya Red’ were prepared from Takii and Sakata Company (Japan), respectively. Investigation
was carried out on experimental field in Rudesar city located in the northern part of Iran (N 38.8°
and S 50.19°; altitude, -22 m above sea level; mean annual rainfall, 958.6 mm; mean annual tem-
perature, 17.3°C; mean annual relative humidity, 78%; mean annual evaporation, 1044.2 mm;
mean annual sunlight radiation, 2146.0 h). Seeds were sown in pots filled with 50% cocopeat, 30%
perlite and 20% sand on August 23 2010. Uniform size seedlings (approximately 3-4 true leaf)
were potted 40 days after seeding in plastic pots filled with clay, manure, compost and sand
(1:1:1:1). Plants were treated with a foliar and drench application at rate of 500, 1000 and 1500
mg/L CCC, 40 days after potting. Control plants were sprayed and drenched only with 6 mL/pot
and 60 mL/plant water, respectively. First data were calculated the 60 days after transplanting.
Then plants were transferred to the same pots and same soils. Second data were calculated the 90
days after transplanting. Plant height, stem length (measured from crown to the first leaf), leaf
chlorophyll content and leaf brix degree (°B) were recorded the 60 days after potting. Plant height,
stem length, leaf chlorophyll content, leaf brix degree (°B), leaf number and diameter, and plant
dry weight were recorded the 90 days after potting. Plant height, stem length and leaf diameter by
ruler, brix degree by refractometer Atago (N-1α) and plant dry weight by digital balance were
measured. To obtain the plant dry weight, they were cut from crown and dried at 105°C for 24 h.
The experimental design was a randomized completely blocks design (RCBD) with a factorial
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012 105
arrangement of treatments containing of four CCC concentrations × two treatments methods (spray
and drench) × two cultivars (‘Kamome White’ and ‘Nagoya Red’) × sixteen treatments totally ×
four replications, 64 plots and 256 pots). Data were subjected to analysis of variance (ANOVA)
using MSTATC statistical software. Mean comparison were carried out by employing Duncan’s
Multiple Range test at α = 5%.
RESULTS
The overall results of the effect of different concentrations of CCC on plant height stem
length, leaf chlorophyll content and leaf brix degree (°B) in Brassica oleracea cultivars ‘Kamome
White’ and ‘Nagoya Red’ after 60 and 90 days are summarized in Table 2.
Plant height
Based on analysis of variance (Table 3), the effect of different treatments and their interac-
tion on the plant height after 60 and 90 days was significant at 0.01 level of probability. There is
no significant difference in the effect of cultivar + kind of method on plant height after 60 days
but was significant after 90 days. The interaction effect of cultivar + method + concentration on
the plant height after 60 and 90 days was significant at 0.01 and 0.05 level of probability, respec-
tively. The effect of cultivar on the plant height was significant after 60 and 90 days (Table 3), and
‘Kamome White’ was better than ‘Nagoya Red’. Also, spray method had better effect on the plant
height after 60 and 90 days and caused shorter plant height than drench method. Plant height de-
creased linearly with increasing the CCC concentration (Fig. 1). The effect of CCC concentration
on plant height in both time of measurement (60 and 90 days was significant). Brassica oleraceacultivars ‘Kamome White’ and ‘Nagoya Red’ plants treated with CCC were shorter than the control
plants (Table 1). 1500 mg/L CCC treatment produced the shortest plants (10.79 cm after 60 days
and 12.56 cm after 90 days) than the control plants (15.20 cm after 60 days and 16.66 cm after 90
days). Among all treatments, interaction effects of ‘Kamome White’ + spray method + 1500 mg/L
of CCC had the least plant height (9.94 cm after 60 days and 11.59 after 90 days) (Table 1, Fig. 1).
Stem length
The effect of different treatments on the stem length after 60 days was no significant, but
the effect of cultivar, method, different concentrations of CCC, interaction between cultivars +
concentration and method + concentration on the stem length after 90 days was significant at 0.01
level of probability (Table 3). ‘Kamome White’ cultivar with 2.32 cm length was better than
‘Nagoya Red’ with 2.62 cm (Table 2). Also, spray method with 2.41 cm had better effect on the
stem length than drench method with 2.53 cm. Like plant height, stem length decreased linearly
to increasing the CCC concentration. 1500 mg/L CCC treatment produced the shortest stem length
(2.03 cm) than the control plants (2.85 cm). Interaction effect of cultivar and method with concen-
tration on stem length was significant (Table 3). Among all treatments, least stem length (1.90 cm)
and highest stem length (3.07 cm) were obtained in treatment of drench method + concentration
of 1500 mg/L of CCC and control, respectively (Table 2).
Leaf chlorophyll content
The effect of cultivar, as well as interaction effect of cultivar with method and concentration
was significant. Based on analysis of variance (Table 3), the effect of cultivar on the leaf chloro-
phyll content after 60 and 90 days was significant at 0.01 level of probability. Chlorophyll index
in ‘Nagoya Red’ showed significant superiority than that of ‘Kamome White’ after 60 and 90 days
(Tables 1 and 2). Interaction effect of cultivar + method, cultivar + CCC concentration and cultivar
+ method + CCC concentration on chlorophyll index was significant based on mean comparison
not based on analysis of variance (Tables 1, 2 and 3). The most chlorophyll index was calculated
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012106
in treatments of ‘Kamome White’ + drench method + 1000 mg/L CCC (18.50) after 60 days and
‘Nagoya Red’ + drench method + 1500 mg/L CCC (20.14) after 90 days (Tables 1 and 2).
Leaf brix degree (°B)
The effect of cultivar, as well as interaction effect of cultivar with method and concen-
tration was significant on leaf brix degree after 60 and 90 days (Table 3). Reciprocity of cultivar
in interaction effect with concentration and method was no significant but its difference was sig-
nificant (Table 3). Leaf brix degree of ‘Nagoya Red’ (7.39) had significant superiority than that of
‘Kamome White’ (6.00) after 90 days (Table 2). Interaction effect of cultivar + method, cultivar +
concentration and cultivar + method + concentration had better effect in ‘Nagoya Red’ than
‘Kamome White’. Totally, leaf brix degree after 90 days was more than that of 60 days (Tables 1
and 2). After 90 days, the most leaf brix degree (7.45) and the least of that (5.86) was obtained in
treatments of ‘Nagoya Red’ + spray method + 1500 mg/L CCC and ‘Kamome White’ + drench
method + 500 mg/L CCC, respectively (Table 2).
DISCUSSION
One of the most important applications of plant growth retardant is elevation of plant qual-
ity, especially ornamental plant by reduction of vegetative growth. Plant growth retardants decrease
the internodes length and eliminate the apical dominance (Khangoli, 2001; Lee et al., 1999). CCC
is an important plant growth retardant. CCC caused transport of carbohydrates to the roots via de-
creasing shoot length (Leclerc et al., 2006). Study of Hojjati et al. (2009) on Zinnia showed that
the 2000 mg/L CCC caused the least amount of shoot carbohydrate. Plant growth retardants in-
crease cytokinins which resulted in enhance the amount of leaf chlorophyll (Dole and Wilkins,
2005; Rossini Pinto et al., 2005). Some of the most important factors concerning plant growth re-
tardants are type, time, number, application method and concentration of growth retardant (Cramer
and Bridgen, 1998). In current study, CCC caused decreasing of plant height in ornamental cabbage
and kale (Brassica oleracea) cultivars ‘Kamome White’ and ‘Nagoya Red’. Decreasing the plant
height by CCC was observed in many species (Olivera and Browning, 1993; Garner, 2004;
Karlovic et al., 2004; Rossini Pinto et al., 2005; Hashemabadi and Zarchini, 2010). Karlovic et al.
(2004) reported decreasing height in Chrysanthemum by 2000, 3000 and 4000 mg/L CCC.
Hashemabadi and Zarchini (2010) showed that the least stem length (29.93 cm) was obtained
by using 1500 mg/L CCC in rose, poison. The stem length was 35.7 cm in control plant. These
researchers showed a significant decrease in stem length under CCC application. Saffari et al.
(2004) sprayed the Rosa damascena with CCC and revealed that 3000 mg/L CCC decreased
stem length about 5 cm relative to control. Studies of Karlsson et al. (1992) on Begonia × tuber-
hybrida showed that the CCC (500 mg/L) resulted in 23% shorter plants than the control plants
15 weeks after transplanting. Increased application rates did not positively impact plant devel-
opment when compared to the lower rates used in the study. CCC (1000 and 2000 mg/L) de-
creased Zinnia plant height (Hojjati et al., 2009). Studies on several ornamental plants revealed
that the maximum concentration of CCC for reduction of plant height is 1500 mg/L (Cathey,
1975; Schwartz et al., 1985; Hedayat, 2001; Joyce et al., 2004). Current study conforms to these
studies. This growth retardant, also, reduced plant height in Euphorbia and Bougeinvillia
(Shekari et al., 2004), Rosa (Saffari et al., 2004) and Pelargonium (Latimor and Beden, 1994).
In ornamental cabbage and kale and many ornamental plants, spraying was the better than
drenching for decreasing the plant height (Schwartz et al., 1985; Garner, 2004; Hedayat, 2001).
These results are consistent with our findings. Other plant growth retardants such as prohexa-
dione-Ca, uniconazole, paclobutrazol, bayleton and daminozide are applied for decreasing the
plants growth as spray or drench (Karlsson et al., 1992; Gibson and Whipker, 2000; Bazzocchi
and Giorgioni, 2003; Hojjati et al., 2009).
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012 107
ACKNOWLEDGEMENTS
The authors would like to thank the Islamic Azad University, Rasht Branch, especially Dr.
Amirteimouri for their financial supports.
Literature Cited
Al-Khassawneh, N.M., Karam, N.S. and Shibli, R.A. 2006. Growth and flowering of black iris
(Iris nigricans Dinsm.) following treatment with plant growth regulators. Sci. Hort. 107:
187-193.
Bazzocchi, R. and Giorgioni, M.E. 2003. Effect of prohexadione-Ca, uniconazole and paclobutrazol
on ornamental kale growth and performance under high temperature. Acta Hort. 614: 499-505.
Catchey, H.M. 1964. Physiology of growth retarding chemicals. Ann. Rev. Plant Physiol. 15: 271-302.
Cathey, H.M. 1975. Comparative plant growth retarding activites of ancymidol with ACPC, phosphon,
chlormequat and SADH on ornamental plant species. Hort. Sci. 10: 204-216.
Cosgrove, D.L. and Sovonick-Dunford, S.A. 1989. Mechanism of gibberellin dependent stems
elongation in peas. Plant Physiol. 89: 184-191.
Garner, W. 2004. PGR general uses and overview. Technical Service, 800: 4556-4647.
Gibson, B. and Whipker, B.E. 2000. Research progress report: the effect of B9, bonzi and sumagic
on the growth of ornamental cabbage and kale. North Carolina Flower Growers Bulletin,
44: 6-9.
Hashemabadi, D. and Zarchini, M. 2010. Effect of some plant growth regulators on growth and
flowering of Rosa hybrida "Poison". Plant Omics J. 3 (6): 167-171.
Hedayat, M. 2001. Application of growth retardants in greenhouse. First National Scientific and
Practical Symposium on Flowers and Ornamental Plants of Iran. Jahad-e-Keshavarzi, Iran
(In Persian).
Hojjati, M., Etemadi, N. and Baninasab, B. 2009. Effect of paclobutrazol and cycocel on vegetative
growth and flowering of Zinnia elegans. Agricultural Sciences and Technologies and
Natural Resources. 47: 649-656 (In Persian).
Holcomb, E.J. and White, J.W. 1970. A technique for soil application of growth retardant. HortSci.
5: 16-17.
James, L., Gibson, B. and Whipker, E. 1999. The effect of B9 + cycocel on the growth of Brassica juncea var. ‘Rugosa Red Giant’. SNA Research Conference, 44: 284-287.
Joyce, G., Latimer, H., Scoggins, L. and Thomas, J. 2004. Using plant growth regulators on containerized
herbaceous perennials. Virginia State University.
Karlovic, K., Vrsek, I., Sindrak, Z. and Zidovec, V. 2004. Influence of growth regulators on the
height and number of inflorescence shoots in the chrysanthemum cultivar Revert. Agric.
Conspec. Sci. 69: 63-66.
Karlsson, M.G., Werner, J.W. and Hanscom, J.T. 1992. Growth regulator effect in seed propagated
Begonia × tuberhybrida. University of Alaska Fairbank. Circular, 90. July 1992.
Khangoli, S. 2001. Potential of growth regulators on height and flowering control in ornamental
plants. First National Scientific and Practical Symposium on Flowers and Ornamental Plants
of Iran. Jahad-e-Keshavarzi, Iran (In Persian).
Latimer, J.G. and Beden, S.A. 1994. Persistent effect of plant growth regulators on landscape
performance of seed geraniums. J. Environ. Hort. 12 (3): 150-154.
Leclerc, M., Caldwell, C.D. and Lade, R.R. 2006. Effect of plant growth regulators on propagule
formation in Hemerocallis spp. and Hosta spp. HortSci. 47: 651-653.
Lee, J.H., Jin, E.S. and Kim, W.T. 1999. Inhibition of auxin-induced ethylene production by SA in
mungbean hypocotyls. J. Plant Biol. 42: 1-7.
Magnitskiy, S.V., Pasian, C.C., Bennett, M.A. and Metzger, J.D. 2006. Controlling plug height of
verbena, celosia, and pansy by treating seeds with paclobutrazol. HortSci. 47: 158-167.
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012108
Messinger, N.L. and Holcomb, E.J. 1986. The effect of chlormequat chloride, ancymidol, BAS
106 and SD 8339 on selected Dianthus cultivars. HortSci. 21: 1397-1400.
Olivera, C.M. and Browning, G. 1993. Studies on the induction of flowering in juvenile Prunus
avium L. J. Hort. Sci. 68: 731-739.
Pobudkiewicz, A.K. and Nowak, J. 1994. The influence of florprimidol and uniconazole on growth
of the CMM draft Dianthus caryophyllus L. ‘Snowmass’. J. Fruit and Ornamental Plant
Res. 2 (4): 135-142.
Rossini pinto, A.C., Rodrigues, T.D.J.D., Leits, C.I. and Barbosa, J.C. 2005. Growth retardants on
development and ornamental quality of potted. ‘Liliput’ Zinnia elegans JACQ. Sci. Agric.
62: 337-345.
Sachs, R.M. and Hackett, W.P. 1972. Chemical inhibition of plant height. HortSci. 7: 440-447.
Saffari, V.R., Khalighi, A., Lesani, H., Babalar, M. and Obermaier, J.F. 2004. Effect of different
plant growth regulators and time of pruning on yield components of Rosa damascena Hill.
Int. J. Agric. Biol. 6 (6): 1040-1042.
Sanderson, K.C. 1973. Screening chemicals for controlling growth and flowering of Forsythia
intermedia Zabel. HortSci. 8: 477-479.
Schwartz, M.A., Payne, R.N. and Sites, G. 1985. Residual effect of chlormequat on garden
performance in sun and shade of seed and cutting-propagated cultivars of geraniums.
HortSci. 20: 368-370.
Shekari, F., Ebrahimzadeh, A. and Esmaeilpour, B. 2005. Plant growth regulators in agriculture
and horticulture. Zanjan University Press, Iran (In Persian).
Tayama, H.K., Larson, R.A., Hammer, P.A. and Rolls, T.J. (eds.) 1992. Tips on the use of chemical
growth regulators on floriculture crops. Ohio Florists’ Assn., Columbus, Ohio.
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012 109
Traits
Treatment
Plant height (cm) Stem height (cm) Chlorophyll index Brix degree
Kamome White (A1)
Nagoya Red (A2)
Spray (B1)
Drench (B2)
Control (C1)
500 mgL-1 (C2)
1000 mgL-1 (C3)
1500 mgL-1 (C4)
A1B1
A1B2
A2B1
A2B2
A1C1
A1C2
A1C3
A1C4
A2C1
A2C2
A2C3
A2C4
B1C1
B1C2
B1C3
B1C4
B2C1
B2C2
B2C3
B2C4
A1B1C1
A1B1C2
A1B1C3
A1B1C4
A1B2C1
A1B2C2
A1B2C3
A1B2C4
A2B1C1
A2B1C2
A2B1C3
A2B1C4
A2B2C1
A2B2C2
A2B2C3
A2B2C4
12.96b
13.55a
12.99b
13.52a
15.29a
13.88b
13.08c
10.79d
12.73c
13.19b
13.26b
13.85a
15.23a
13.61c
12.46d
10.57f
15.35a
14.15b
13.71c
11.02e
15.29a
13.65c
12.95e
10.11g
15.29a
14.10b
13.22d
11.47f
15.27a
13.52c
12.22e
9.94h
15.19a
13.69c
12.70d
11.19g
15.31a
13.79c
13.68c
10.29h
15.39a
14.50b
13.75c
11.75f
2.05a
2.03a
2.05a
2.03a
2.09a
2.03a
2.03a
2.01a
2.07a
2.04a
2.04a
2.03a
2.12a
2.07a
2.02a
2.00a
2.07a
2.00a
2.04a
2.02a
2.08a
1.97a
2.07a
2.09a
2.11a
2.10a
1.99a
1.93a
2.13a
1.99a
2.06a
2.08a
2.12a
2.14a
1.97a
1.93a
2.04a
1.95a
2.08a
2.09a
2.09a
2.06a
2.01a
1.94a
11.24b
17.75a
14.31a
14.68a
14.37a
14.27a
14.38a
14.96a
10.80b
11.69b
17.83a
17.67a
11.63c
10.93cd
10.72cd
11.69c
17.11ab
17.61ab
18.04a
18.23a
14.23a
14.32a
13.90a
14.79a
14.50a
14.22a
14.86a
15.13a
11.61d
10.18e
10.23e
11.19d
11.64d
11.69d
11.22d
12.19c
16.86b
18.47b
17.58ab
18.39a
17.39ab
16.75b
18.50a
18.07a
5.04b
6.05a
5.55a
5.54a
5.56a
5.53a
5.54a
5.54a
5.05b
5.03b
6.05a
6.04a
5.06b
5.03b
5.01b
5.05b
6.06a
6.03a
6.07a
6.04a
5.61a
5.53a
5.54a
5.52a
5.51a
5.53a
5.53a
5.57a
5.10b
5.05b
5.02b
5.02b
5.03b
5.01b
5.00b
5.08b
6.12a
6.01a
6.07a
6.01a
6.00a
6.04a
6.07a
6.06a
Table 1. Mean comparison of the effect of different concentrations of cycocel, application method and type
of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cabbage and kale
(Brassica oleracea) after 60 days.
Tables
Means sharing same letter in a column are statistically similar not significantly.
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012110
Traits
Treatment
Plant height (cm) Stem height (cm) Chlorophyll index Brix degree
Kamome White (A1)
Nagoya Red (A2)
Spray (B1)
Drench (B2)
Control (C1)
500 mgL-1 (C2)
1000 mgL-1 (C3)
1500 mgL-1 (C4)
A1B1
A1B2
A2B1
A2B2
A1C1
A1C2
A1C3
A1C4
A2C1
A2C2
A2C3
A2C4
B1C1
B1C2
B1C3
B1C4
B2C1
B2C2
B2C3
B2C4
A1B1C1
A1B1C2
A1B1C3
A1B1C4
A1B2C1
A1B2C2
A1B2C3
A1B2C4
A2B1C1
A2B1C2
A2B1C3
A2B1C4
A2B2C1
A2B2C2
A2B2C3
A2B2C4
14.61b
15.41a
14.78b
15.24a
16.66a
15.89b
14.92c
12.56d
14.34d
14.87c
15.21b
15.61a
14.44b
15.40c
14.48d
12.09f
16.89a
16.37b
15.37c
13.02e
16.65a
15.68c
14.70e
12.07g
16.68a
16.09b
15.15d
13.04f
16.41b
15.08d
14.26f
11.59i
16.48b
15.73c
14.70e
12.59h
16.89a
16.29b
15.13d
12.54h
16.88a
16.45b
15.60c
13.49g
2.32b
2.62a
2.41b
2.53a
2.85a
2.63b
2.38c
2.03d
2.28cd
2.37c
2.55b
2.69a
2.65bc
2.52c
2.13d
2.00d
3.04a
2.73b
2.64bc
2.07d
2.86a
2.58b
2.31de
1.90f
2.84a
2.67b
2.45cd
2.17e
2.65b
2.49c
2.08e
1.89f
2.66b
2.54c
2.17d
2.11e
3.07a
2.68b
2.54c
1.91f
3.02a
2.79b
2.73b
2.23c
15.28b
18.23a
16.49a
17.03a
16.90a
16.44a
16.66a
17.02a
14.94b
15.62b
18.04a
18.43a
15.09c
15.11c
15.55c
15.37c
18.72a
17.78ab
17.76ab
18.68a
16.86ab
15.50b
17.48ab
16.11ab
16.95ab
17.37ab
15.83ab
17.94a
14.56g
14.44g
15.76e
15.00g
15.62e
15.78e
15.34f
15.73e
19.16b
16.56e
19.21b
17.22d
18.28c
18.99b
16.32e
20.14a
6.00b
7.39a
6.72a
6.67a
6.71a
6.66a
6.72a
6.71a
6.05b
5.96b
7.39a
7.38a
6.03b
5.94b
6.05b
5.99b
7.38a
7.37a
7.38a
7.42a
6.70a
6.69a
6.76a
6.72a
6.71a
6.62a
6.68a
6.69a
6.08b
6.04b
6.08b
5.99b
5.98b
5.84b
6.03b
5.99b
7.33a
7.35a
7.44a
7.45a
7.44a
7.39a
7.32a
7.39a
Table 2. Mean comparison of the effect of different concentrations of cycocel, application method and type
of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cabbage and kale
(Brassica oleracea) after 90 days.
Means sharing same letter in a column are statistically similar not significantly.
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012 111
Mean square
After 90 days After 60 days
df Source of
variations
30.664**
0.035 ns
0.012 ns
0.023 ns
0.010 ns
0.007 ns
0.028 ns
0.025
-
2.36
139.831**
4.623 ns
1.075 ns
0.316 ns
1.630 ns
11.319*
5.161 ns
3.879
-
11.75
1.433**
0.217**
1.946**
0.012 ns
0.147**
0.059**
0.006 ns
0.007
-
3.42
10.36**
3.446**
50.876**
0.086**
0.232**
0.602**
0.052*
0.013
-
0.77
16.301**
0.003 ns
0.003 ns
0.00 ns
0.005 ns
0.016 ns
0.003 ns
0.006
-
1.37
677.333**
2.141 ns
1.581 ns
4.319 ns
2.308 ns
0.773 ns
2.717 ns
2.102
-
10
0.006 ns
0.007 ns
0.021 ns
0.001 ns
0.009 ns
0.059 ns
0.002 ns
0.035
-
9.13
5.581**
4.332**
56.666**
0.066 ns
0.901**
1.398**
0.158**
0.019
-
1.04
1
1
3
1
3
3
3
45
63
-
Cultivars (A)
Methods (B)
Concentrations (C)
A × B
A × C
B × C
A × B × C
Errors
Total
c.v.
Table 3. Analysis of variance (ANOVA) for the effect of different concentrations of Cycocel, application
method and type of variety on plant height, stem height, chlorophyll index and brix degree of ornamental cab-
bage and kale (Brassica oleracea).
Brix
degree
Stem
height
Plant
height
Chlorophyll
Index
Brix
degree
Stem
height
Plant
height
Chlorophyll
Index
**: Significant at α = 1%, *: Significant at α = 5%, ns=Not significant
Journal of Ornamental and Horticultural Plants, 2 (2): 103-112, June, 2012112
Figures
Fig. 1. The effect of different concentrations of CCC on plant
height of Brassica oleracea cultivar ‘Kamome White’. Left to right;
0, 500, 1000 and 1500 mg/L CCC.
Fig. 2. The effect of different concentrations of CCC on plant
height of Brassica oleracea cultivar ‘Nagoya Red’. Left to right; 0,
500, 1000 and 1500 mg/L CCC.
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012 113
Susceptibility Assessments of Tomato Genotypes to Root-
Knot Nematodes, Meloidogyne javanica
Root-knot nematodes, Meloidogyne spp., are one of the important plant
parasitic nematodes of tomato in the world. The most suitable control method
of plant parasitic nematodes is the use of resistance sources and tolerant
cultivars. In the earlier studies, the results showed thatonly 2% (19 out of 537
varieties) were resistant and tolerant to the root knot nematodes. In the supple-
mentary studies, the susceptibility of these 19 tomato cultivars were reassessed
again, against M. javanica, in the two completely randomized design experiments
in the greenhouse and field conditions for the two continuous years. The
tomato plants were evaluated 70 days after inoculation on the basis of the gall
indexes (GI), final populations (Pf), reproduction factors (Rf) and the root and
or the stem weights. The results showed that, the cultivars No. 136 and 109
with GI=2, Rf=4.68 and GI=2.25, Rf=28.4 are tolerant cultivars to the
nematode, M. javanica in the greenhouse respectively. Also, the cultivar No.
100 was considered to be a susceptible one, with GI= 3.25 and Rf= 0.97.
Whereas, in the field conditions, the cultivars 136 and 109 proved to be
tolerant with GI, 1.9 and 1.6 respectively.
Keywords: Cultivars, Resistance, Root- knot nematode, Tomato, Susceptibility.
M. Nasr Esfahani1*, A.R. Ahmadi2 and K. Shirazi3
1Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,
Isfahan, Iran2Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,
Ahvaz, Iran3Plant Pests and Diseases Research Division, Agriculture and Natural Recourse Research Center,
Isfahan, Iran.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012114
INTRODUCTION
Tomato (Lycopersicon esculentum Miller, 1768) is one of the vegetable crops, which
is used in various ways, such as souse and or etc. Tomatoes are planted in 110,229 hectares in
Iran and have 27 tone/hectare average yields. Root-knot nematodes, Meloidogyne spp., are
the most important tomato parasitic nematodes in Iran and the world. Seven species and five
races of these nematodes have already been identified in Iran. M. javanica is the most and
well distributed one in tomato and other field crops (Akhiyani et al., 1984; Mehdikhani et al.,2003; Janar Dhanan, 2002; Mojtahedi and Santo, 1994; Razaz Hashemi, 2005; Razaz Hashemi,
2006). The infection of the tomato cultivar, Red Cloud VF was reported to be 37% with 20
eggs and larva, as the primary inoculums per gram of soil, in the micro plot in Isfahan. Re-
sistance and susceptible cultivars, offer effective control against these nematodes (Webster,
1972). So, different cultivars of tomatoes were offered to farmer in different countries. Gold
set, Nematex and Small Early cultivars were reported as resistant sources to M. incognita inCanada. In USA VFN-8, Rossel, Patirot, Healani, Atkinson, Anaha, Nemared were resistant
cultivars to M .incognita and M. javanica (Taylor and Sasser, 1978). In Italy Roma VFN,
VFN-77-177-1, VFN-77-92-2, Stumae Ronita were resistant cultivars to root knot nematode
(Vito and Lamberti, 1976). In Egypt, Small Early VFN-8 and Ronita were reported as resistant
cultivars to root knot nematodes (Akhiyani and Mortazavi, 1992). In India, Pusa-120 and CLL
303-BCI were reported as resistant cultivars to M. javanica and race 1 to 4 of M. incognita(Prasad et al., 1964). Pelican cultivar was resistant to race 1, 2 and 4 and was susceptible to
race 3 of M. incognita (Rao et al., 1975). Bush-VFN and VFN-8 were resistant to all races of
M. incognita and M. javanica (Singh and Choudhury, 1974). Kaur et al. (1994) studied the
reaction of 25 F1 generation hybrid of tomato, which were resistant to M. incognita in Lud-
hiana area in India. Hybrid cultivars which were gained from Castly Roch* 1792 and Ronita
* Rio Grande were highly resistant, Ronita* F24-C8 and EC 119192* KF15 was resistant too.
Hybrid of Rio Grand * Ronita and Pujab Chhuhara* Ronita were moderately resistance to M.
incognita. Akhiyani (1981) examined 72 seeds from 1982 to find resistant or moderately re-
sistant tomatoes during 1982-1986. Akhiyani selected 19 lines and collected seed. Also, 91
tomato cultivars were sent by Gene bank. Akhiyani and Mortazavi (1992), evaluated 537 cul-
tivars of tomato in order to find resistant cultivars to M. javanica based on international project
standard of root knot nematodes. Out of these cultivars, 98 % were susceptible, and also some
of the cultivars, which were reported as resistant to M. javanica, were found to be susceptible.
Out of 11 cultivars in final tests, 7 cultivars were determined to be resistant and others were
susceptible.
In the present studies, the reaction of 19 tomato cultivars with the high quantity and quality
properties were evaluated against M. javanica in comparison to the controls, for the two continuous
years in the green house and the field conditions.
MATERIALS AND METHODS
Evaluation of the cultivars reaction to nematode in the greenhouse conditions
The 20 tomato cultivars were planted in plastic pots filled with 1.5 lit of soils, with the mix-
ture of sand and pasteurized peat with 1:2:1 ratio. Cultivars reaction to M. javanica was rated on
each tomato plant, infected with the numbers of 5000 eggs and larva as the primary inoculum.
Pots were placed in greenhouse at about 25°c for 70 days. Plants were uprooted and gall indexes,
number of nematodes per root and soil, reproduction factors and growth conditions of the plant,
including root and stem weights were assessed in the complete block designs, indicating 20 treat-
ments and 4 replicates each. The average means were compared based on Duncan Multiple Test
Ranges (DMRT).
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012 115
Planting tomato seeds in micro plots
Tomato seeds were planted in the micro plots, and after rising of the seedlings, the even
size and strong ones were transferred in to the field.
Selecting infested field to nematode
The fields which were highly infested to M. javanica with the mean numbers of 30 eggs
and larva per gram of soil selected in the regions, Vilashahr, Najafabad, in Isfahan province, which
then, divided into plots, according to the numbers of treatments and replicates.
Evaluation of tomato cultivars reaction to nematode in infested fields
Tomato seedlings were transferred into the infected fields. Sampling was done from 0 to
30 cm depths in order to determine the primary inoculum of nematodes. After, 4 months, all the
plants, 30 plants from each replicates were uprooted and assessed based on 0 to 5 scoring scales
(Tayler and Sasser, 1978). Nematode numbers in the roots and the soils from every plot were cal-
culated, in order to determine reproductive factor (RF) (Oostenbrink, 1966). Evaluation of resist-
ance, tolerance, susceptible and hypersensitive reactions of the tomato cultivars were assessed
based on Canto-Sanz (1983) method. Tolerance cultivars with the RF >1 and GI <2, the resistant
ones RF <1 and GI <2, susceptible cultivars GI>2 and RF >1 and hypersensitive RF<1 and GI>2
(Canto-Saenz, 1983).
Statistical analysis
The experiments were based on the complete block designs with 20 treatments, tomato
cultivars and 4 replicates each. Average mean comparisons were performed based on Duncan
tests. Statistical analysis of variance was done with MSTATC computer software (SAS In-
stitute. 1996).
RESULTS
Evaluation of tomato cultivars reaction to nematode in greenhouse conditions
The means of gall indexes, nematode populations, reproduction factors, root and stem
weights of the 20 tomato cultivars to the root knot nematodes have been presented in table1and 2,
along with the means of statistical grouping, based on Duncan tests.
The means of gall indexes showed 9 different significant groups. Variations in gall indexes
were between 2 (cultivar No. 134) to 5 (control). Dornus X New gaeker and cultivars No. 20, 14,
109 and 178 had gall indexes of 2.5, 2.75, 2, 2.25 and 2.75, respectively. Control cultivar had gall
index 5 (Table 1). Cormello T.M.V.F.N.S. X Tina, Delta X Chef, Delta X Chef and 140 had gall
indexes of over 4. So, these results indicating that, these cultivars are susceptible to the root knot
nematodes in these experiments (Table1).
The nematode populations in the roots and related soils of the 20 tomato cultivar were di-
vided into the six distinct and significant statistical groups. Cultivar No. 100 had the least egg and
second stage of larvae populations. Delta X Chef cultivar had the maximum No. of eggs and second
stage larvae populations. Delta X Chef and Cormellxo T.M.V.F.N.S. X Tina had more nematode
populations in comparison to control treatments (Table1). Means of nematode reproductions also,
showed five significant statistical groups. Cultivar No. 100, Dornus X New gaeker, cultivar No.
136 and Dornus X New gaeker had RF 0.97, 2.32, 4.68 and 4.96, respectively. Cultivar No. 100
had RF <1. This scale in Delta X Chef, Cormello T.M.V.F.N.S. X Tina and cultivar No. 140 was
more than control treatment. So, these results showed that, these cultivars are highly susceptible
to these nematodes.
Means of root weights showed six variable and different statistical groups. Control and
cultivar No. 182, 26 had the most root weights respectively. Whereas, the means of stem weights
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012116
divided the cultivars into eight distinct and significantly different statistical groups. Cultivars No.
182, 27 and 136 had the maximum stem weights respectively (Table1).
Evaluation of tomato cultivars reaction to nematode in infested fields
Gall indexes, nematode populations per root and soil and reproduction factors of 20 tomato
cultivars with the treatments and replications in the field have already been summarized in table
2. Variance analysis showed that, here also the tomato cultivars are significantly different. And,
there are differences when, the cultivars are compared with each others and or with the controls.
Mean comparison of the gall indexes, nematode populations per root and soil and reproduction
factors of the tomato cultivars root and statistical grouping of the means are also presented, based
on Duncan tests. Here, the mean comparison of the gall indexes showed nine different group and
the range of variations in the gall index was 1.6 (cultivar No. 109) and 4.25 (control). Cultivar No.
109 and 136 had the least gall index, 1.6 and 1.9 respectively, whereas control had gall index 4.25
(Table 2).
Mean comparison of reproduction factors showed 4 different and significant groups. Cul-
tivar No. 136 and 26 had the least reproduction factors in comparison to control which had the
most reproduction factors (Table 2).
Reaction of the cultivar No. 100, 136 and 109 in greenhouse and field conditions show
that, the cultivar No. 100 was highly susceptible in greenhouse and susceptible in field. Cultivar
No. 136 was tolerance in greenhouse and field. Cultivar No. 109 was susceptible in greenhouse
and tolerance in field.
DISCUSSION
Resistance in tomato cultivars to root-knot nematodes has the same genetic origins and is
controlled by a dominant gene, Mi, which located on the chromosome No. 6 (Harada, 1996; Gilbert
and McGurive, 1956; Liharska, 1998). This gene was transferred from the wild tomato (L. peruvianum)
to some commercial cultivars, and it can be used efficiently against M. incognita, M .arenaria and
M. javanica (Canto-Saenz, 1983; Canto-Saenz, 1985, Fassuliotis, 1979). In this study, without
considering, Mi genes in view, the reactions of 19 tomato cultivars were evaluated against M. ja-vanica in which, the different characters, such as the potentiality of the reproduction factors were
taken into accounts by several workers (Khan and Khan, 1991; Oostenbrink, 1966). Here also, the
potentiality of the reproduction factors in the tomato cultivars were compared with the potentiality
of the reproduction factors in susceptible ones (Taylor, 1967) and also, egg mass indexes and or
gall indexes (Taylor and Sasser, 1978), complexes of nematode reproductions and crop losses were
taken into considerations (Canto-Saenz 1983; Castagnon-Sereno et al., 1994) . Based on recent
factors in greenhouse tests, about 85% of the cultivars were susceptible to nematode with GI > 2
and R > 1 indexes. Cultivar No.136 with GI= 2 and R= 4.68 was tolerant and cultivar No. 100
with GI= 3.25 and R= 0.97 was hypersensitive. In this cultivar RF < 1 and GI >2, indicating that,
the nematode arrives to the tomato root system, but the resistance of the host prevents the repro-
ductively of the nematodes. Cultivar No. 109 (wild tomato) was comparatively tolerant (Table 1).
Cultivars 136 and 109 were introduced tolerant cultivar in the field conditions. About 85-90% of
the tomato cultivars were susceptible to M. javanica, which is unlike the Akhiyani’s report, that
they were tolerant and resistant cultivars. Probably different factors had already interfered in this
case. Nematode populations influenced the decrease in resistance of the tomato cultivars to root
knot nematodes. Economic threshold level of root knot nematode is 0.005-2 egg and larvae per gr
of soil (Araujo et al., 1982; Barker, 1976; Ferris, 1978). In the field experiments, the limitations
to select the nematode infested soil could be a factor, because the initial population's density of
nematode was 30 eggs and larvae per gr soil. Therefore, reproduction in the large scale caused the
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012 117
breaking of the resistance in some cultivars. Cultivar No. 109 was susceptible in greenhouse and
tolerant in the field conditions. This cultivar is a wild one, and it grows with a well developed root
in the field. So, this character having a great affect on the reaction of this cultivar (Hashemi and
Winstead, 1959).
Cultivar No. 136, which was tolerant to M. javanica in the field and greenhouse conditions,
could be planted in some regions where, the temperatures reach to and or below 28°C. Usually, in
these regions tomatoes are planted in winter and fall where, the temperatures are less than 28°C
(Araujo, et al., 1982; Dropkin, 1969; Netscher, 1977). Cultivar No. 136 can be introduced as a tol-
erant cultivar.
Involving mechanisms in resistant plants could be the production of toxic from the root ex-
udates, the lack of an attractant or the hatching factor in the exudates, a barrier for penetration or
the failure of nematodes to develop within plant tissues, the production of lignin and synthesis
toxin including phytoalexines (Jenkins and Taylor, 1967; Favery et al., 2001; Jaubert et al., 2002).
Ascorbic acid is generally considered to provide resistance in plants to various pathogens.
Low levels of ascorbic acid in tomato cultivars were associated with their susceptibility to M.incognita attack. The results showed that, ascorbic acid increase production of hydroxy prolin
which lead to increase activity of resistant respiratory Cyanide (Arrigoni et al., 1979; Brueske,
1980). All evidences have shown that, the root cells of resistant plant react against nematode via
increase in NADPH oxidase activity. The production of superoxidase in plant cells directly or in-
directly may cause the death in hypersensitive cells and as a subsequent to these reactions, establish
resistance in plants. Previous studies have indicated that, respiratory resistant cyanide and super-
oxidase induce the phytoalexin synthesis, then establish resistance in plant during infection process
(Favery et al., 2001; Semblat et al., 2001; Semblat and Castagnone-Sereno, 2001).
Literature Cited
Akhiyani, A., 1981. Studies on the root-knot nematode. Annul Report of Plant Pests and Diseases
Research Division of Esfahan Agricultural Research Center. 110-120.
Akhiyani, A., Bagheri, F. and Ahmadi, A.R. 1992. Distribution and identification of root knot
Nematodes in Tomato and Brinjal Fields of Hormozgan Province. Proc. 1 st. Vegetable Research
Seminar, Karaj, Iran: 7-8.
Akhiyani, A., Akhiyani, A., Mojtahedi. H. and Naderi, A. 1984. Speceis and physiological races
of root-knot nematodes in Iran. Iran. J. Plant Pathol. 20: 57-71.
Araujo, M. T., Dickson, D. W., Augustine, J. J. and Bassett, M. J. 1982. Optimum initial inoculum
levels for evaluation of resistance in tomato to Meloidogyne spp. at two different soil temperatures.
J. Nematol. 14: 536-540.
Barker, K. R., Shoemaker, P. B. and Nelson, L. A. 1976. Relationships of initial population densities
of Meloidogyne incognita and Meloidogyne hapla to yield of tomato. J. Nematol. 8: 282.
Brueske, G. H. 1980. Phenlalanine ammonia lyase activity in tomato root infected and resistant to
the root-knot nematode, Meloidogyne incognita. Physiol. Plant Pathol. 16: 409-414.
Canto-Saenz, M. 1983. The nature of resistance to Meloidogyne incognita (Kofoid & White, 1919)
Chitwood. 1949, PP. 160, In proc. Third Res.& Plann. Conf. On Root-Knot Nematodes,
Meloidogyne spp., March 22-26, 1982, ed C.C. Carter. International Meloidogyne Project,
Lima, Peru. 233. Be corrected.
Canto-Saenz, M. 1985. The nature of resistance to Meloidogyne incognita (Kofoid & White, 1919)
Chitwood. 1949, PP. 225-231, In J. N. Sasser and C. C. Carter(eds.). An. Advanced Treatise
on Meloidogyne Vol.1 Biology and Control. North Carolina State University Graphics.
Raleigh, North Carolina. Be corrected.
Castagnon-Sereno, P., Bangiovanni, M. and Dalmasso, A. 1994. Reproduction of virulent isolates
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012118
of Meloidogye incognita on susceptible and Mi-resistant tomato. J. Nematol. 26: 324-328.
Dropkin, V. 1969. The necrotic of tomato and other plants resistant to Meloidogyne reversed by
temperature. Phytopathol. 59: 1632-1637.
Fassuliotis, G. 1979. Plant breeding for root-knot nematode resistance. PP. 425-453, In F. Lamberti
and C. E. Taylor (eds.). Root-knot nematodes (Meloidogyne species). Systemics, biology
and control. Academic Press. New York. USA. Be corrected
Favery, B., Ryan, E., Foreman, J., Linstead, P., Boudonck, K., Shaw, P., Steer, M. and Dolan, L. 2001.
KOJAK is a cellulose synthase-like gene required for root hair cell morphogenesis in Arabidopsis.
Genes Dev. 15: 79-89. Be Corrected
Ferris, H. 1978. Development of nematode damage functions and economic threshold using
Meloidogyne incognita on tomatoes and sweet potatoes. J. Nematol. 10: 286-287.
Gilbert, J. C. and Mcguire, D. C. 1956. Inheritance of resistance to severe root-knot from Meloidogyneincognita in commertial type tomatoes. Proc. Am. Soc. Hort. Sci. 68: 437-442.
Harada, S., Nakata, K., Tanaka, H., Ishiguro, Y., Ito, T., and Takagi, M. 1996. PCR- based selection
for the root—knot nematode resistance in tomato. Breeding Science. 46: 133-136.
Hashemi, S.R.D. and Winstead, N.M. 1959. Studies on resistance in tomato to root-knot nematodes
and/or the occurrence of pathogenic biotypes. Phytopathol. 49: 716- 724.
Janar Dhanan, K. 2002. Diseases of major medicinal plants. Daya Publishing House. Delhi. 202 pp.
Jaubert, S., Ledger, T.N., Piotte, C., Abad, P., and Rosso, M.N. 2002. Direct identification of stylet
secreted proteins from root-knot nematodes by a proteomic approach. Molecular and Biochemical
Parasitology, 121, 205-211.
Kaur, S., Padmanabhan, S. Y. and Kaur, P. 1994. Screening of some F1 hybrids of tomato against
root-knot nematode, Meloidogyne incognita. Pest management and Economic Zoology. 2: 95-96.
Khan, A.A. and Khan M.W. 1991. Response of tomato cultigens to Meloidogyne javanica and
races of Meloidogyne incognita. J. Nematol. 45: 598-603.
Liharska, T.B. 1998. Genetic and molecular analysis of the tomato root-knot nematode resistance
Locas Mi-1. Wageningen Agricultural University, Wageningen, the Netherlands: 95 P.
Mehdikhani, E., Kheiri, A., Eshtiaghi, H. and Okhovvat, M. 2003. Three new records of Meloidogyne
species for Iran. J. Plant Pathol. 39: 69-71.
Mojtahedi, H. and Santo, G.S. 1994. A new host of Meloidogyne chitwoodi from California. Plant
Dis. 18: 1010(Abstr.).
Mortazavi Bac, A. 1992. Resistance sources of tomato varieties to root- knot nematodes in Iran.
Proc.1 st. Vegetable Research Seminar, Karaj, Iran:4.
Netscher, C. 1977. Observation and preliminary studies on the occurrence of resistance breaking
biotypes of Meloidogyne spp. on tomato. Cah ORSTOM Ser. Biol. 11: 173-178.
Oostenbrink, M. 1966. Major characteristics of the relation between nematodes and plants. Medd.
Land Bouwhogesch. Wageningen. 66: 4(Abstr).
Prasad, S.K. and Das Gupta, D.R. 1964. Varietal susceptibility of commercial tomatoes to the
attack of root-knot nematodes, Meloidogyne spp. Indian Journal of Entomology, 26(2):235238.
Rao, V.R. and Tikoo, S.K. 1975. Resistance of tomato cultivars to the root-knot nematode,
Meloidogyne incognita. Current Science 44(8): 282 - 283.
Razaz Hashemi, S.R. 2005. Identification of root-knot nematode from Calendula medicinal plant.
Proc. National Congress in Sustainable Development of Medicinal Plants. 271-272.
Razzaz Hashemi, S.R. 2006. Identification of main parasitic nematodes in Ricinus medicinal plant
in Qazvin Province. Proc. 17 th. Plant Prot. Cong. 276.
SAS Institute. 1996. SAS/STAT user’s guide. Ver.6.4. SAS Inc. Cary, NC.
Semblat, J.P. and Castagnone-Sereno, P. 2001. Lack of correlation between (a) virulence and phylogenetic
relationships in root-knot nematodes (Meloidogyne spp.) as inferred from RAPD and AFLP
analysis. Genet. Sci. Evol. 33: 545-557.
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012 119
Singh, B. and Choudhury, B. 1974. Screening tomato cultivars for resistance to Meloidogynespecies. Pest Articles and News Summaries 20(3):3l9-322.
Taylor, A. L. 1967. Introduction to research on plant nematology. FAO. UN, Pub. No. PL: CP/5.
Taylor, A.L. and Sasser, J.N.1978. Biology, identification and control of root – knot nematodes
(Meloidogne spp.) IMP Publication, Raleigh, North Carolina.
Vito, N.D. and Lamberti, F.1976. Reaction of tomato varieties to populations of Meloidogyne spp.
in the glass-house. Nematologia Mediterranea. 4(2): 21l-2l5.
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012120
Table 1. Means of gall index, nematode population, reproduction factor of M. javanica, root and stem weight of
tomato in greenhouse conditions
Tables
Treatment1 Gall index Nematode popula-
tion per g. of root
& soil
Reproduction
factor2
Stem
weight (g)
Root
weight (g)
Reaction
Ricraude X SP-100
Delta X Chef
Delta X Chef
Cormello T.M.V.F.N.S.X Tina
SP-100 X Castlerd (1-13)
Delta X Chef
Dornus X New geaker
Dornus X New geaker
Dornus X New geaker
20
26
66
100
136
140
170
109
178
182
Control
3.75abcde3
4.75ab
4.25ab
4.5abc
3.5abcd
3.75abcde
3.5abcde
2.5de
3bcde
2.75cde
3.5abcde
3.75abcde
3.25abcde
2e
4.25abcd
3bcde
2.25e
2.75cde
3.5abcde
5a
234920c
246875c
552257a
537960a
127430d
123951d
24826e
11257e
72743de
67144de
123181d
124168d
4861e
23409e
441927b
93056de
142014d
57625de
265503c
326389c
46.98abc
49.37abc
107.95a
107.59a
25.48c
24.79c
4.96c
2.32c
14.45c
12.93c
14.23c
24.83c
0.97c
4.68c
88.38ab
18.61c
28.4bc
15.12c
53.1abc
65.28abc
43.75de
49cde
46.75cde
60abcde
63.5abcde
64.5abcde
42.75de
43.25de
40.5e
54.25bcde
79.5ab
63.75abcde
58.25abcde
75.5ab
69abc
77ab
71abc
67abcd
83a
67.25abcd
20bc
19.5bc
22.25bc
31ab
14.5c
25.25abc
20.5bc
12.75c
23.5bc
18.25bc
26.75abc
25.5abc
23bc
25.75abc
25.25abc
26abc
22.5bc
17.5bc
31.25ab
29a
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Hypersensetive
Tolerant
Susceptible
Susceptible
Tolerant
Susceptible
Susceptible
Susceptible
1 Data are means of four replicates. 2 Initial population was 500 egg & second stage juveniles.3 Means in columns followed by a similar letter are not significantly different at 5% level by DMRT.
Treatment Gall index Nematode population per g. of
root & soil
Reproduction
factor
Reaction
Ricraude X SP-100
Delta X Chef
Delta X Chef
Cormello T.M.V.F.N.S.X Tina
SP-100 X Castlerd (1-13)
Delta X Chef
Dornus X New geaker
Dornus X New geaker
Dornus X New geaker
20
26
66
100
136
140
170
109
178
182
Control
3.85ab
3.9ab
3.45ab
4.02ab
4.02ab
4.1ab
3.92ab
3.47abc
3.7ab
4.07ab
2.93bcd
4ab
4.02ab
1.9de
4.25a
2.42cde
1.6e
3.52abc
3bc
4.25a
4902cd
8669bcd
7669bcd
15458bcd
21745b
8943bcd
12941bcd
16110bcd
7651bcd
8775bcd
2362cd
8061bcd
9626bcd
1588d
23703bc
5088bcd
3162cd
6171bcd
6703bcd
38583a
163c
289bc
256bc
515bc
724b
248bc
431bc
537bc
255bc
293bc
79c
326bc
321bc
53c
378bc
169c
105c
206c
223c
1286a
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Susceptible
Tolerant
Susceptible
Susceptible
Tolerant
Susceptible
Susceptible
Susceptible
1Data are mean of four replicates. 2 Initial population was 30 egg & larvae per gr. of soil.3 Means in columns followed by a similar letter are not significant at 5% level.
Table 2. Means of gall index, nematode population and reproduction factor of M. javanica in the field conditions.
Journal of Ornamental and Horticultural Plants, 2 (2): 113-121, June, 2012 121
Variable sources CV SS MS F Prob
Gall index (G.H)
Reproduction factor (G.H)
Nematode. population * (G.H)
Root weight
Stem weight
Gall index (F)
Repro duction factor (F)
(F) Nematode. population
31.37
10.38
89.69
37.83
24.41
20.22
82.76
24.46
50.638
85679.79
215904.6
2755
13358.8
45.19
5789027.7
5893.01
2.665
4509.46
113634.7
145
703.09
2.38
304685.7
31015.1
2.59**
3.16**
3.15**
1.83**
3.16**
4.69**
3.78**
3.25**
0.01
0.0005
0.001
0.042
0.0004
0.005
0.0001
0.0004
G- Green house. F- Field. *- Nematode population per gr. of root & soil.
- The df, for blocks, treatments and the error are the same for all, i.e. 3, 19 and 52 respectively.
**- Significant at 1% level of probability.
Table 3. Analysis of variance of tomato cultivars to root knot nematodes, M javanica.
www.jornamental.com
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012 123
Effect of Pre-Treated Chemicals on Keeping Quality and
Vase Life of Cut Rose (Rosa hybrida cv.‘ Yellow Island’)
Nanosilver of nanometer-sized silver (Ag+) particles (2-5 nm diam) are
used in various applications as an anti-microbial. Boric acid (H3BO3) is water
soluble (pH=7). Boric acid is ethylene synthese inhibitor and reduce ethylene
production through reducing the ACC synthase and ACC oxidase delays
senescence of flower. In this study of different concentrations of boric acid
and nano-silver was evaluated and vase life, fresh weight loss, flower opening
index and the number of bacteria in preservative solution were measured. The
highest cut rose flower ‘Yellow Island’ longevity was obtained in pulse-treated
flowers with 100 mg l-1 boric acid (4 days).
Keywords: Boric acid, Nanosilver, Rose, Senescence, Vase life.
M. B. Hoseinzadeh Liavali1* and M. Zarchini2
1Department of Horticultural Science, Rasht Branch, Islamic Azad University, Rasht, Iran.2Young Researchers Club, Rasht Branch, Islamic Azad University, Rasht, Iran.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012124
INTRODUCTION
Rose (Rosa hybrida L.) (Rosaceae) is the most exports of the cut flowers in the worlds
(Chamani et al., 2004). A major from of deterioration in cut flowers is the blockage of xylem
vessels by air and microorganisms that cause xylem occlusion (Elgimabi and Ahmed, 2009).
Symptom for end of vase life petal wilting that is more clear in cut rose (Solomos et al.,1997). Hosseina et al., (2005) belived that before senescence in cut roses, abscission and
wilting are two common symptoms. Also, one of most important index for senescence is sig-
nificant reduction in water uptake and fresh weight of petals. Water balance is a major factor
determining quality and longevity of cut flowers. It is influenced by water uptake and tran-
spiration, being the balance between these two processes (Da Silva, 2003). Fructose, glucose
and sucrose were the main soluble carbohydrates in petals and stems of cut roses. Fructose
was the major component in the petals as well as in stems but, generally, its value was higher
than in stems. Sucrose contents in petals and stems were lower than those of glucose (El-
gimabi and Ahmed, 2009). Flower opening in cut roses has also been shown to be dependent
on carbohydrate levels in petals (van Doorn et al., 1991). In senescing petals, carbohydrate
content of petals reduced (Ley-Yee et al., 1992). Ichimura et al., (2003) showed that reduction
in soluble carbohydrate in petals, is more important that stem end blockage in longevity of
cut rose ‘Sonis’.
Nowadays, some of these compounds, such as silver nitrate and silver thiosulfate less
applied because it causes blacking of the flower stem and is dangerous for humans and envi-
ronment (Damunupola and Joyce, 2006). NS is a relatively new antimicrobial compound which
is applied as a pulse and preservative solution treatment for cut flowers (Solgi et al., 2009).
Nanometer-sized silver (Ag+) particles (NS) are considered to more strongly inhibit bacteria and
other microorganisms than Ag in various oxidation states; Ag0, Ag+, Ag2+, Ag3+ (Furno et al.,2004). Boric acid inhibits ethylene production through reducing the ACC synthase and ACC ox-
idase activities. Used to improve vase life of cut flowers carnations, may be a good competitor
as far as price is concerned (Serrano et al., 2001). The present study has investigated the effects
of nano-silver and boric acid on improving the quality and extending the vase life of cut rose
(Rosa hybrida L. cv. ‘Yellow Island’).
MATERIALS AND METHODS
Cut roses (Rosa hybrida L. cv. ‘Yellow Island’) were obtained at their optimum de-
velopmental stage. They were immediately stood in buckets and transported to the posthar-
vest laboratory. At the laboratory, stems were re-cut under deionized water to ~50 cm length.
Re-cutting was to ensure no air blockage of the stem end. The flowers were selected for
uniformity of size, color and freedom from any defects. The upper three leaves were retained
on each stem.
The experimental design was a randomized completely blocks design (RCBD) with a
factorial arrangement of treatments containing four boric acid concentrations (0, 100, 200 and
300 mg/L) × four SNP concentrations (0, 5, 10 and 20 mg/L) × three replications × five cut
flowers per treatment. In each experiment, cut rose stems were weighted and pulse-treated for
24 h with 250 mL of preservative solutions (PS) including aforementioned compounds. Then,
cut roses were placed individually into the vases filled with 500 mL of preservative solutions
containing 3% sucrose and 600 mg/L hydroxy quinoline sulfate. Distilled water was used as a
control. The mouths of the vases were covered with a sheet of low density polyethylene film to
minimize evaporation and to prevent contamination. Re-cutting was carried out each four days.
The flowers were kept in a controlled room under the following conditions: 20 ± 2°C, relative
humidity of 60-70%, 12µmol m-2s-1 light intensity (cool white flourescent tubes) and a daily
light period of 12 h.
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012 125
Vase life
Criterion for the end of vase life was the time that flowers were showing symptoms of petals
wilting or curling. Vase life was the period from the time of putting the cut flowers into the second
preservative solution until the end of vase life.
Fresh weight loss
Loss of fresh weight (ml g-1 F.W.) was calculated by the following equation:
[(initial fresh weight (g) + amount of water uptake (ml)] – [(final fresh weight (g) + weight
of recuts (g)].
Flower opening index
Flower opening was calculated in stage four by digital caliper. For this purpose, the biggest
flower diameter plus vertical diameter was calculated and their mean was obtained. Then, flower
opening index was calculated from the following formula: (stage 4/stage 3) + (stage 3/stage 2) +
(stage 2/stage 1).
Bacterial counts
150 μl of pulse solution culture on nutrient agar plates and bacterial colonies were enumer-
ated after incubation for 24 h at 25°C. All bacteria counts were made on triplicate sub-samples.
Statistical analysis
Data were analyzed by SAS software and means were compared by the Tukey’s test.
RESULTS AND DISCUSSION
Based on analysis of variance, significant (p≤0.01) differences were found among various
concentrations of NS and boric acid in extending vase life, fresh weight loss and the number of
bacteria. NS and boric acid in the preservative solution had a significant (p≤0.05) effect on flower
opening index.
Boric acid at 100 mg/L significantly extended the vase life of cut rose cv. ‘Yellow Island’
(Fig. 1). The NS and boric acid pulse treatment at highest concentration (20 mg/L and 300 mg/L,
respectively) caused the shortest vase life and resulted in a 0.8 day vase life to the control. De-
creasing the vase life of cut flowers held in the highest concentration of NS and boric acid is due
to the toxic effects of these materials. Positive effect of NS on extending of vase life in other
flowers such as rose, gerbera and lily has been demonstrated (Lu et al., 2010; Liu et al., 2009;
Solgi et al., 2009; Kim et al., 2005). Serrano et al., (2001) revealed that a 24-h pulse treatment
with the preservative solution containing 50, 75 or 100 mM boric acid or continuous treatment
with 1 mM boric acid resulted in significantly increasing cut carnation flowers longevity.
In control plants, the reduction of fresh weight is more considerable. The loss fresh weight
is lower in 100 and 200 mg/L boric acid. Interaction between BA and SNP significant on loss of
fresh weight (p≤0.01) and 300 mg/L BA + 10 mg/L SNP had the lowest loss of fresh weight. With
increasing of BA concentration, the loss of fresh weight was slower and 10 mg/L SNP had lower
loss of fresh weight in comparison to 5 and 20 mg/L, SNP reduced stem and blockage ( Fig. 2).
van Doorn (1997) suggested that, loss of fresh weight, is one of the symptoms for scenes-
cence. This feature is more clear in cut rose. Changes in relative fresh weight (RFW) of cut roses
showed similar tends for both control and NS pulse treatments, such that RFW increased until day
3 after harvest and decreased thereafter (Lu et al., 2010).
The lowest rate opening of flowers was showed is control flowers. The most important rea-
son for senescence of flowers before full blooming, was ethylene. The highest rate of flower open-
ing was observed in 100 mg/L BA. Effect of SNP not significant on this (Fig. 3). Totally, full
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012126
blooming of cut flowers needs to carbohydrates to water uptake and turgidity of cells, increasing
of carbohydrate to preservative solutions, improved water uptake and flower blooming and delayed
senescence.
Since flower opening is a process which needs ATP and the required ATP should be pro-
duced through respiration; therefore, each factor that reduced the plant respiration, can delay the
flower opening process (Hashemabadi and Mostofi, 2007).
Numbers of bacteria on the pulse solution decreased significantly with increasing of NS
and boric acid concentration. There were significant differences in numbers of bacteria on the so-
lution between the 20 mg/L NS along with 300 mg/L boric acid pulse treatment and the control
for the duration of assessment.
The highest concentration of NS and boric acid is due to the toxic effects of these materials.
It is important to note that in pulse-treated flowers with the preservative solutions containing NS
and boric acid, vase life was not increased in line with increasing the boric acid and NS concen-
trations (Fig. 4).
Liu et al. (2009) demonstrated that NS inhibited bacteria growth for the first 2 d of vase
life in stem ends of cut gerbera. Ag+ concentrations in tissues rose with an increase in NS concen-
tration in the pulse solution. Ag+ concentrations of basal stem ends were generally higher than
those of upper stem ends, leaves and petals (Lu et al., 2010).
ACKNOWLEDGEMENTS
The authors would like to thank the Islamic Azad University, Rasht Branch, especially Dr.
Amirteimouri for their financial supports.
Litrature Cited
Chamani, E., Khlighi, A., Joyce, D., Irving, D., Zamani, Z., Mostofi, Y. and Kafi, M. 2004. Effect
of silver thiosulfate and 1- methylcyclopropene on physicochemical characteristics of ‘First
Red’ rose cut flowers. (In Persian).
Damunupola, J.W. and Joyce, D.C. 2006. When is a vase life solution biocide not, or not only,
antimicrobial?// J. Jpn. Soc. Hortic. Sci. Vol. 77. P. 1-18.
Da Silva, J. A. T. 2003. The cut flower: Postharvest considerations. Online J. Biol. Sci. 3: 406-442.
Elgimabi, M. N. and Ahmed, O. K. 2009. Effects of bactericides and sucrose-pulsing on vase life
of rosa cut flower ( Rosa hybrida ). Botany Research International. 2(3): 164-168.
Furno, F., Morley, K.S., Wong, B., Sharp, B.L., Arnold, P.L., Howdle, S. M., Bayston, R., Brown,
P.D., Winship, P.D. and Reid, H.J. 2004. Silver nanoparticles and polymeric medical devices,
a new approach to prevention of infection? J. Antimicrob. Chemother. 54: 1019-1024.
Hashemabadi, D. and Mostofi, Y. 2007. Determination of optimum concentration and treatment
time of 1-MCP (1- methylcyclopropene) on vase life of cut carnation ‘Tempo’. Acta Hort.
755. 297-303.
Hossaina, Z., Kalam, A., Mandala, A., Kumar, S., Dattaa, A. and Krishna, B. 2005. Decline in
ascorbate peroxidase activity- prerequisite factor for tepal senescence in Gladiolus. Journal
of Plant Physiology. 163: 186- 194.
Ichimura, K., Kaeabata, Y., Kishimato, M., Goto, R. and Yamada, K. 2003. Shortage of soluble
carbohydrates is largely responsible for about vase life at ‘Sonia’ rose flowers. J. JP. Soc.
Hort. Sci. 72: 292-298.
Kim,J.H., Lee, A.K. and Suh, J.K. 2005. Effect of certain pre-treatment substances on vase life
and physiological character in Lilium spp. Acta Hort. 673: 307-314.
Ley-Yee, M., Stead, A.D. and Reid M.S. 1992. Flower senescence in daylily (Hemerocallis). Physiol.
Plant. 86: 308-314.
Liu, J., He, S., Zhang, Z., Cao, J., Petaio, L.V., He, S., Cheng, G. and Joyce, D. C. 2009. Nano- silver
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012 127
pulse treatments inhibit stem-end bacteria on cut gerbera cv. Ruikou flowers. Postharvest
Biology and Technology. 54: 59-62.
Lu, P., Cao, J., He, S., Liu, J., Li, H., Cheng, G., Ding, Y. and Joyce, D. C. 2010. Nano-silver pulse
treatments improve water relations of cut rosa cv.‘Movie Star’ flowers. Postharvest Biology
and Technology. 57: 196-202.
Serrano, M., Amoros, A., Teresa, P. M., Concepcion Martinez-Madrid, M. and Romoj, F. 2001.
Preservative solutions containing boric acid delay senescence of carnation flowers. Postharvest
Biology and Technology. 23: 133-142.
Solgi, M., Kafi, M., Taghavi, T. S. and Naderi, R. 2009. Essential oils and silver nanoparticles
(SNP) as novel agents to extend vase life of gerbera (Gerbera jamesonii cv. ‘Dune’) flowers.
Postharvest Biology and Technology. 53: 155-158.
Solomos, T. and Gross, K.C. 1997. Effects of hypoxia on respiration and the onset of senescence
in cut carnation flower (Dianthus caryophyllus L.). Postharvest Biol. Technol. 10: 145- 153.
van Doorn, W. G. 1997. Water relations of cut flowers. Hort. Rev. 18: 1-85.
van Doorn, W.G., Groenewegen, G., Van de Pol, P.A. and Berkholst, C.E.M. 1991. Effects of
carbohydrate and water status on flower opening of cut madelon roses. Postharvest Biol.
Technol. 1: 47-57.
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012128
Table 1. Mean comparison of single different concentrations of boric acid and nanosilver on measured
characteristics.
In each column means followed by the same letters are not significantly different at 5 % level of probability
using DMRT.
Tables
Treatments Vase life
(day)
Fresh weight loss
(g)
Flower opening
index
The number of solution bacteria
(Log10 (CFU) ml-1)
B0 (0 mg l-1)
B1 (100 mg l-1)
B2 (200 mg l-1)
B3 (300 mg l-1)
N0 (0 mg l-1)
N1 (5 mg l-1)
N2 (10 mg l-1)
N3 (20 mg l-1)
7.25ab
8.53a
7.02b
7.10ab
8.17a
7.10b
7.62ab
7.01b
4.41a
3.92ab
3.76ab
3.75b
3.40c
4.11ab
3.95b
4.39a
1.09b
2.04a
1.95ab
1.94ab
2.04a
1.91a
1.96a
1.93a
1.25a
1.18a
0.87b
0.81b
1.81a
1.05b
0.82b
0.42c
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012 129
Figures
Fig. 1. Intraction boric acid and nanosilver on the vase life of cut rose cv. ‘Yellow Island’.
Fig. 2. Intraction boric acid and nanosilver on the fresh weight loss of cut rose cv. ‘Yellow Island’.
Fig. 3. Intraction boric acid and nanosilver on the flower opening index of cut rose cv. ‘Yellow Island’.
Journal of Ornamental and Horticultural Plants, 2 (2): 123-130, June, 2012130
Fig. 4. Intraction boric acid and nanosilver on the number of solution bacteria of cut rose cv. ‘Yellow Island’.
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012 131
Evaluation of Antipyretic Activity of Pedalium murexAgainst Brewer’s Yeast-Induced Pyrexia in Rats
The aqueous and ethanolic extracts of Pedalium murex (Pedaliaceae)
was investigated for antipyretic activity in rats using Brewer’s yeast-induced
pyrexia models. Brewer’s yeast (15%) was used to induce pyrexia in rats. Both
the extract (200 and 400 mg/kg body weight p.o produced a significant
(p<0.05) dose dependent inhibition of temperature elevation compared with
the standard drug Paracetamol (150mg/kg body weight). At doses of 200
mg/kg b.w, the aqueous extract significantly (P<0.001) decreased yeast induced
pyrexia in rats. These results indicate that leaf extracts of Pedalium murex
possesses potent antipyretic effects and thus pharmacologically justifying its
folkloric use in the management of fever.
Keywords: Acute toxicity, Antipyretic, Brewer’s yeast, Prostaglandin, Pedalium murex.
V. Siva1, N.J. Jeffrey Bose1, P. Mehalingam1* and A. Thanga Thirupathi2
1Research Department of Botany, V.H.N.Senthikumara Nadar College, Virudhunagar, Tamil Nadu,
India. Phone: 04562-280154 Fax: 04562-281338.2Department of Pharmacology, SankaralingamBhuvaneswari College of Pharmacy, Sivakasi, Tamil
Nadu, India.
*Corresponding author,s email: [email protected]
Abstract
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012132
INTRODUCTION
Herbal medicines are assumed to be of great importance in the primary health care of indi-
vidual and communities (Sheldon et al., 1997). The World Health Organization has estimated that
80% of the population of developing countries still relies on traditional medicines, mostly plant
drugs, for the primary health care needs. The high degree of efficacy and safety with herbal med-
icines make them more acceptable compared to other therapeutic invention (Chaturvedi et al.,2007). Plant-based traditional knowledge has become a recognized tool in search for new sources
of drugs and neutraceuticals (Ghosh, 2003; Sharma and Mujundar, 2003)
Pedalium murex Linn. (Pedaliaceae) is a diffuse, more or less succulent herb found near
the coastal area of South India (Nadkarani, 1982). Mucilage obtained from leaves, stem as well as
fruits is used to treat gonorrhea (Mhaskar et al., 2000). An infusion or extract prepared from leaves
have diuretic and demulcent properties and also useful in treating disorders of the urinary system
such as odour urine, dysuria, spermatorrhoea and incontinence of urine. As an emmenagogue, the
juice is used in puerperal diseases and also to promote lochial discharge (Chopra et al., 1996). The
mucilage from leaves and young shoots is used as an aphrodisiac in seminal debility (Shukla and
Khanuja, 2004). The aqueous extract of the whole plant has been found to possess analgesic and
anti-inflammatory properties (Muralidharan and Balamurugan, 2008). Pedalium murex is rich in
mucilage (Kirtikar and Basu, 1987), flavonoids (Harborne et al., 1999) and saponin glycosides
(Bhakuni et al., 1992). Extensive phytochemical investigations on the plant have revealed the
presence of Pedalitin and Pedalin (major flavonoids) along with Diosmetin, Dinatin, Dinatin-7-
glucoronide, Quercetin, Quercimeritin and Quercetin-7- glucorhamnoside (Subramanian and Nair,
1972). Triterpenoids such as α amyrin acetate are also reported (Prasad and Thakur, 1983). Steroids
such as β sitosterol (Shukla and Khanuja, 2004), sapogenins (Harvey, 1967) and diosgenin (Mangle
and Jolley, 1998) have also been reported. Lipids (Bhakuni et al., 1992), phenolic acids such as
caffeic acid, ferulic acid, protocathechic acid and vanillic acid (Shukla and Khanuja, 2004) and
amino acids such as aspartic acid, glutamic acid and histidine are other phytoconstituents present
in Pedalium murex (Rastogi et al., 1982).
Fever or pyrexia is the body’s response to the presence of external or internal pyrogen (or-
ganisms causing fever). Pyrexia is caused as a secondary impact of infection, tissue damage, in-
flammation, graft rejection, malignancy or other diseased states. It is the body’s natural defense to
create an environment where infectious agent or damaged tissue cannot survive. Normally the in-
fected or damaged tissue initiates the enhanced formation of pro-inflammatory mediator’s (cy-
tokines like interleukin 1β, α, β and TNF-α), which increase the synthesis of prostaglandin E2 near
preoptic hypothalamus area and thereby triggering the hypothalamus to elevate the body temper-
ature. As the temperature regulatory system is governed by a nervous feedback mechanism, so
when body temperature becomes very high, it dilate the blood vessels and increase sweating to re-
duce the temperature; but when the body temperature becomes very low hypothalamus protect the
internal temperature by vasoconstriction (Chattopadhyay et al., 2005).
The principle rationale behind the use of this plant for the study of antipyretic effects is
that the tribal community of Kumaragiri hills of Salem district of Tamil Nadu has been using the
leaf extract for fever (Alagesboobathy, 2009). However, there is not enough scientific report to
support these supposed antipyretic activities. This has promoted us to study the antipyretic effect
of leaves extract of Pedalium murex to ascertain the authenticity of these important claims of tra-
ditional potency.
MATERIALS AND METHODS
Plant Material
The plant specimen used for the study was collected from their natural habitat in Virudhu-
nagar district, Tamil Nadu, India. The identity of the specimen was confirmed as Pedalium murex
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012 133
using the local flora (Gamble, 1936). A voucher specimen (VHNSNCH A152) was deposited in
the Research Department of Botany, V.H.N.Senthikumara Nadar College, Virudhunagar.
Chemical and drugs
All other chemicals and reagents were procured from authorized suppliers and of analytical
grades.
Preparation of the extract
The fresh leaves of plant were taken and air dried in shade for ten days. Dried materials
were blended into fine powder and extracted by continuous hot extraction process using Soxhlet
apparatus not exceeding 60°C by ethanol. The marc was then extracted with distilled water to ob-
tain aqueous extract. All the extracts were dried at 45°C in rotary evaporator to produce a semisolid
mass. The dried extract was stored at 4°C until use. The aqueous and ethanol extract were dissolved
in normal saline.
Phytochemical analysis
The plant extract was subjected to phytochemical screening through qualitative chemical
analysis for confirmation of the phytoconstituents (Kokate et al., 2004; Odebiyi and Sofowora,
1979).
Animals
In-bred Wistar albino rats weighing 150-200g were procured from the animal house of the
Sangaralingam Bhuvaneswari College of Pharmacy, Sivakasi, Tamil Nadu, India. The animals
were grouped and housed in sanitized polypropylene cages (38 × 23 ×10) containing sterile paddy
husk as bedding with not more than six animals per cage and maintained under standard laboratory
conditions (temperature 25 ± 2°C; RH 60-70% ) with dark and light cycle (12/12 h). The animals
were fed with standard pellet diet supplied by VRK Nutritional Solution, Pune, India and fresh
water ad libitum. All the animals were acclimatized to laboratory condition for a week before com-
mencement of experiment to minimize if any of non-specific stress. All procedures described were
reviewed and approved by the Institutional Animal Ethical Committee of the Sangaralingam Bhu-
vaneswari College of Pharmacy, Sivakasi, Tamil Nadu, India. (Reg. No: 622/02/C/CPCSEA). All
studies were performed in accordance with the guidelines for the care and use of laboratory ani-
mals, as adopted and promulgated by the Institutional Animal Care Committee, CPCSEA, New
Delhi, India.
Acute toxicity study
Albino rats weighting 150-200 g selected by random sampling were used in this study.
Acute oral toxicity was performed as per OECD-423 guidelines (Ecobichon, 1997). The animals
were fasted overnight, provided only with water. Both the aqueous and ethanolic plant extract was
administered orally at the dose level of 5mg/kg body weight by gastric intubations and the drug
treated groups (4 animals each) were observed for 14 days. If mortality was observed in 2 or 3 an-
imals, then the dose administered was identified as a toxic dose. If mortality was observed in one
animal then the same dose was repeated again to confirm the toxic dose. If mortality was not ob-
served, the procedure was repeated for further higher doses such as 50, 300 and 2000 mg/kg body
weight. The animals were observed for toxic symptoms such as behavioral changes, locomotion,
convulsions and mortality for 72 h.
Anti-pyretic activity
Anti-pyretic activity of Pedalium murex was evaluated using Brewer’s yeast-induced
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012134
pyrexia in rats (Loux et al., 1972). Rats were weighed and randomized into six groups of four rats
per group. The baseline body temperatures of the rats were taken by inserting a digital tele-ther-
mometer into their anal cavities for about 2 min. The steady temperature readings obtained were
recorded as the pre-temperatures. Pyrexia was induced in the rats by administering 1 ml/kg b.w of
15% aqueous suspension of Brewer’s yeast in normal saline subcutaneously into the animal’s dor-
sum region and 18 h later of yeast administration, the anal temperatures were measured again.
Rats that did not show a minimum increase of 0.5°C were discarded from the study (Mukherjee etal., 2002). Twenty four rats selected were grouped into six groups and treated as follows: Normal
saline 10 ml/kg b.w were administered to group I, while group II were treated with Paraceta-
mol150mg/kg/b.w. Group III and IV were treated with aqueous extract of leaves of Pedalium murex
(200 mg and 400 mg/kg b.w respectively) and group V and VI were treated with ethanolic extract
of leaves of Pedalium murex (200 mg and 400 mg/kg b.w respectively). All the treatments were
administered orally. Anal temperature was then measured after every sixty minutes interval of drug
administration for each rat up to 4 h.
Statistical analysis
Results were expressed as Mean ± Standard Error of Mean (SEM). The statistical signifi-
cance of differences between groups was analyzed using student’s t-test. Differences of p<0.05
were considered statistically significant.
RESULTS
Phytochemical screening
The aqueous and ethanolic extract of Pedalium murex were subjected to preliminary phy-
tochemical screening revealed the presence of alkaloids, flavonoids, steroids, coumarins, phenols,
saponins, tannins and sugars. (Table1).
Acute oral toxicity study
Both the plant extracts produced no toxic symptoms or mortality up to a dose level of 2000
mg/kg body weight orally in rats, and hence the drug was considered safe for further pharmaco-
logical screening. So 1/10th and 1/5th (200mg and 400mg respectively) of that were selected for
all in vivo experiments as sub maximal and maximal dose.
The percentage yield of the aqueous and ethanolic extract was 5.9% and 3.7% respectively.
Antipyretic study
The effect of aqueous and ethanolic extract of leaves of plant Pedalium murex on Brewer’s
yeast induced pyrexia in rats are depicted (Table 2). Pedalium murex leaf extract produced signif-
icant (P<0.05) antipyretic effect in a dose dependent manner. Both the extract significantly reversed
hyperthermia at either dose (200 & 400 mg/kg body weight). Time of peak effect was obtained
from 2 to 4 h after oral administration of test drugs. The standard drug, Paracetamol suppressed
hyperthermia induced by yeast significantly (p<0.01) during all the observation times when com-
pared with normal saline treated groups. 200 mg/kg of body weight aqueous extract showed ex-
tremely statistically significant (p<0.001) from first hour and extended up to fourth hour after drug
administration and ethanolic extract showed extremely significant (p<0.001) reduction of elevated
body temperature from second hour to consecutive fourth hour. Whereas the normal saline treated
group remained hyperthermia throughout the experimental periods.
DISCUSSION
Search for herbal remedies with potent antipyretic activity received momentum recently
as the available antipyretics, such as Paracetamol, Nimusulide etc. have toxic effect to the various
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012 135
organs of the body (Guyton and Hall., 1998). The reduction in the Brewer’s yeast induced fever
by the extract in this study suggests some influence on the prostaglandin biosynthesis since it is
believed to be a regulator of body temperature (Dascombe, 1985).
Flavonoids are known to inhibit prostaglandin synthetase (Ramaswamy et al., 1985). The
antipyretic activity observed can be attributed to the presence of flavonoids present in the plant
extracts. Generally, plants showing the antipyretic activity also possess analgesic and anti-inflam-
matory activity (Dewan et al., 2000). In our studies, the plant extract shows significant antipyretic
activity, it may be attributed by its analgesic and anti-inflammatory activity.
CONCLUSION
Therefore, the plant extract of Pedalium murex possesses a significant antipyretic effect in
Brewer’s yeast induced elevation of body temperature in rats. These results support the traditional
use of this plant in fever remedies. However, further studies are necessary to examine underlying
mechanisms of antipyretic activities and to isolate the active compound (s) responsible for these
pharmacological activities.
Acknowledgements
Authors are sincerely thankful to University Grants Commission, New Delhi for providing
financial assistance to carry out this work.
Literature Cited
Alagesboobathy, C. 2009. Ethnomedicinal plants and their utilization by villagers in Kumaragiri
hills of Salem districts of Tamiladu, India. Afr. J. Trad. CAM. 6: 222-227.
Bhakuni, R.S., Shukla, Y.N. and Thakur, R.S. 1992. Flavonoids and other constituents from Pedalium
murex Linn. Phytochemistry 31: 2917-2918.
Chattopadhyay, D., Arunachalam, G., Ghosh, L., Rajendran, K., Mandal, A.B. and Bhattacharya,
S.K. 2005. Antipyretic activity of Alstonia macrophylla Wall ex A. DC: An ethnomedicine
of Andaman Island. J. Pharm. Pharmaceut. Sci. 8:558-564.
Chaturvedi, A., Kumar, M.M., Bhawani, G., Chaturvedi, H., Kumar, M. and Goel, K.R. 2007. Effect
of ethanolic extract of Eugenia jambolana seeds on gastric ulceration and secretion in rats.
Indian J. Physiol. Pharmacol. 51: 131-140.
Chopra, R.N., Nayar, S.L. and Chopra, I.C. 1996. Glossary of Indian medicinal plants. National
Institute of Science Communication (CSIR), New Delhi.
Dascombe, M.J. 1985. The Pharmacology of fever. Progr. Neurobiol. 25: 327-373.
Dewan, S., Kumar, S. and Kumar, V.L. 2000. Antipyretic effect of latex of Calotropis procera. Indian
J. Pharmacol. 32: 252.
Ecobichon, D.J. 1997. The basis of toxicology testing. CRC Press, New York.
Gamble, J.S. 1936. Flora of the presidency of madras. Botanical Survey of India, Calcutta.
Ghosh, A. 2003. Herbal folk remedies of Bankura and Medinipur districts, West Bengal (India).
Indian J. Trad. Knowledge 2: 393-396.
Guyton, A.C. and Hall, J.E. 1998. Textbook of medical physiology. W.B. Saunders Company,
Philadelphia.
Harborne, B.J., Baxter, H. and Moss, P.G. 1999. A handbook of bioactive compounds from plants.
Taylor & Francis Ltd, London.
Harvey, S.K. 1967. A brief comparative pharmacognostic study of certain indigenous drugs. Natural
Medicinal Journal 9: 519.
Kirtikar, K.R. and Basu, B.D. 1987. Indian medicinal plants. International Book Distributors,
Dehradun.
Kokate, C.K., Purohit, A.P. and Gokhale, S.B. 2004. Textbook of pharmacognosy. Nirali Prakasan
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012136
Publication, Pune, India.
Loux, J.J., Depalma, P.D. and Yankell, S.L. 1972. Antipyretic testing of aspirin in rats. Toxicol.
Appl. Pharmacol. 22: 672-675.
Mangle, M.S. and Jolley, C.I. 1998. HPTLC studies on Tribulus terrestris (Chota ghokru) and Pedalium
murex (Bada ghokru). Indian Drugs 35: 189-194.
Mhaskar, K.S., Blatter, E. and Caius, J.F. 2000. Kritikar and Basu’s Illustrated Indian Medicinal
Plants, their usage in Ayurveda and Unani medicines. Sri Satguru Publication, Delhi.
Mukherjee, K., Saha, B.P. and Mukherjee, P.K. 2002. Evaluation of antipyretic potential of Leucas
lavandulaefolia (Labiatae) aerial part extract. Phytother. Res. 16:686- 688.
Muralidharan, P. and Balamurugan, G. 2008. Analgesic and anti-inflammatory activities of aqueous
extract of Pedalium murex Linn. Biomedicine 28: 84-87.
Nadkarani, K.M. 1982. Indian materia medica. Popular Prakashan Publications, Bombay.
Odebiyi, O.O. and Sofowora, E.A. 1979. Phytochemical screening of Nigerian medicinal plants.
Lloydia 41: 234-246.
Prasad, T.N.V. and Thakur, R.S. 1983. Heptatriacontan-4-one, tetratriacontanyl octacosanoate and
other constituents from Pedalium murex Linn. Phytochemistry 22: 973-974.
Ramaswamy, S., Pillai, N.P., Gopalkrishnan, V., Parmar, N.S. and Ghosh, M.N. 1985. Analgesic
effect of O (hydroxyl ethyl) rutoside in mice. Indian J. Exp. Biol. 23: 219-220.
Rastogi, J.N., Sharma, O.D. and Loiwal, S.D. 1982. Amino acids in certain medicinal plants. Bull.
Pure Appl. Sci. 1: 11-12.
Sharma, P.P. and Mujundar, A.M. 2003. Traditional knowledge on plants from toranmal plateau
of Maharastra. Indian J. Trad. Knowledge 2: 292-296
Sheldon, J.W., Balick, M.J. and Laird, S.A. 1997. Medicinal plants: can utilization and conservation
coexist? Advances in Economic Botany. Econ. Bot. 12: 1-104.
Shukla, V.N. and Khanuja, S.P.S. 2004. Chemical, pharmacological and botanical studies on Pedalium murex. J. Med. Aromatic Plant Sci. 26: 64-69.
Subramanian, S.S. and Nair, A.G.R. 1972. Flavonoids of the leaves of Pedalium murex Linn.
Phytochemistry 11: 464-465.
Journal of Ornamental and Horticultural Plants, 2 (2): 131-137, June, 2012 137
Table1. Result of phytochemical constituents analysis of the aqueous and ethanol extract of Pedalium murex.
a (+): Presentb (-): Absent
Tables
Plant Extracts Alkaloids Flavonoids Steroids Coumarins Phenols Saponins Tannins
Aqueous
extract
Ethanolic
extract
+a
+
+
+
+
+
+
+
+
+
+
- b
+
-
Table 2. Anti-pyretic activity of leaf extract of Pedalium murex
a n=4 in each group, b Values are measured mean ± S. E. M and compared with control by Student‘t’ testc*P<0.05, d ** P<0.01e *** P<0.001
Groupa Dose (mg/kg) Pretem-
perature
(°C)
Temp. after
induced
pyrexia (°C)
Temperature after drug administration (°C) (mean ± S. E. M)
I
II
III
IV
V
VI
Saline (10ml/kg)
Paracetamol (150mg/kg)
Aqueous (200mg/kg)
Aqueous (400mg/kg)
Ethanol (200mg/kg)
Ethanol (400mg/kg)
36.38±0.253
35.90±0.082b
35.70±0.135
35.73±0.155
35.85±0.150
36.08±0.229
37.20±0.204
36.95±0.065
36.53±0.095
36.45±0.096
36.85±0.065
36.88±0.278
37.20±0.204
36.95±0.065
36.53±0.095
36.45±0.096
36.85±0.065
36.88±0.278
37.68±0.165
36.23±0.075*** e
36.00±0.071***
35.80±0.292**
36.45±0.087***
36.45±0.185**
37.78±0.165
35.90±0.242***
35.85±0.133***
35.93±0.125***
36.20±0.071***
36.23±0.256**
37.68±0.131
35.75±0.240***
35.73±0.132***
35.70±0.147***
36.00±0.204***
36.20±0.252**
1 hour 2 hours 3 hours 4 hours
www.jornamental.com
www.jornamental.comThe Journal of Ornamental and Horticultural Plants (JOHP), is an open access journal that provides
rapid publication of manuscripts on ornamental and horticultural fields. Journal of Ornamental and
Horticultural Plants (JOHP) is published in English, as a printed journal and in electronic form.
All articles published in Journal of Ornamental and Horticultural Plants (JOHP) are peer-reviewed.
All manuscripts should convey important results that have not been published, nor under consideration
anywhere else. Journal of Ornamental and Horticultural Plants (JOHP) will be available online around
the world free of charge at http://www.jornamental.com. In addition, no page charge are required from
the author(s).The Journal of Ornamental and Horticultural Plants (JOHP) is published quarterly by
Islamic Azad University, Rasht Branch, Rasht, Iran.
Manuscript Submission
Please read the “Instructions to Authors” before submitting your manuscript. Submit manuscripts as
e-mail attachment to Dr. Ali Mohammadi Torkashvand, Executive director of Journal of Ornamental
and Horticultural Plants (JOHP), at [email protected]. Electronic submission of manuscripts
is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft
Word 2003 file. A manuscript acknowledgment including manuscript number will be emailed to the
corresponding author within 72 hours.
Please do not hesitate to contact meif you have any questions about the journal. We look forward to
your participation in the Journal of Ornamental and Horticultural Plants (JOHP).
Address: Islamic azad University, Rasht Branch
Horticultural Department,
Agriculture Faculty,
Rasht,
Iran.
P.O.Box 41335-3516
Email: [email protected]
URL: http:// www.jornamental.com
Topics and Types of PaperJournal of Ornamental and Horticultural Plants (JOHP) is an international journal to the publication
of original papers and reviews in the horticultural fields. Articles in the journal deal with Floriculture,
Olericulture, Pomology and Landscape. The scope of JOHP includes all horticultural crops even medicinal
plants. The journal is concerned with vegetables, fruits, and ornamental crops, and covers all aspects
of physiology, molecular biology, biotechnology, protected cultivation, and environmental areas of
plants. the journal welcomes the submission of manuscripts that meet the general criteria of significance
and scientific excellence, and will publish:
● Research articles
● Short Communications
● Review
Papers are welcome reporting studies in all aspects of horticultural science including:
Any Novel Approaches Horticulture
Biotechnology
Divers Area of Horticultural Research
Environmental Stress Physiology
Genetices and Breeding
Photosynthesis, Sources-Sink Physiology
Postharvest Biology
Seed Physiology
Soil-Plant-Water Relationships
Modelling
Published by:Islamic Azad University, Rasht Branch, Iran