clincancerres.aacrjournals.org · Web viewIn a preclinical study using hepatocellular carcinoma cell lines, sorafenib was shown to inhibit Wnt/β-catenin signaling (S51). In addition,

Supplemental Table 1. Selected ongoing clinical trials targeting RET aberrations Drug Phase

of the study

Types of RET aberrations being targeted

Types of cancer being enrolled

NCT identifier*

Cabozantinib II Fusion/Rearrangement Non-small cell lung cancer NCT01639508Apatinib II Fusion/Rearrangement Non-small cell lung cancer NCT02540824Vandetanib II Fusion/Rearrangement Non-small cell lung cancer NCT01823068Ponatinib II Fusion/Rearrangement Non-small cell lung cancer NCT01813734Lenvatinib II Fusion/Rearrangement Lung adenocarcinoma NCT01877083Sunitinib II Fusion/Rearrangement Lung adenocarcinoma NCT01829217Sunitinib II Fusion/Rearrangement Advanced solid tumors NCT02450123Sunitinib II Fusion/Rearrangement Advanced solid tumors NCT02691793Ponatinib II Any activating aberrations Advanced solid tumors NCT02272998MGCD516 I Fusion/Rearrangement Advanced solid tumors NCT02219711Regorafenib II Mutation or amplification Advanced solid tumors NCT02693535Vandetanib plus everolimus

I Any activating aberrations Advanced solid tumors NCT01582191

RXDX-105 I Mutation or Fusion/Rearrangement

Advanced solid tumors NCT01877811

* Please see http://clinicaltrials.gov for further detail. Last accessed 5/18/2016.

1

http://clinicaltrials.gov/

Supplemental Table 2. Cancer diagnosis that were negative for RET aberration (included cases with N ≥10).

Diagnosis Number of cases sequenced

Cholangiocarcinoma 159

Neuroendocrine carcinoma * 97

Renal cell carcinoma § 92

Glioblastoma 84

Head and neck adenoid cystic carcinoma 49

Astrocytoma 45

Small cell lung carcinoma 43

Mesothelioma 36

Squamous cell carcinoma (unknown primary) 35

Large cell lung carcinoma 30

Neuroblastoma 28

Head and neck carcinoma (histology unspecified) 24

Anal squamous cell carcinoma 23

Appendix adenocarcinoma 23

Cervical squamous cell carcinoma 22

Salivary gland carcinoma (histology unspecified) 22

Esophageal squamous cell carcinoma 21

Renal pelvis urothelial carcinoma 21

B-cell lymphoma 20

Peritoneal carcinoma 19

Metaplastic breast carcinoma 17

Oligodendroglioma 17

Small bowel adenocarcinoma 17

Thymic carcinoma 16

Malignant peripheral nerve sheath tumor 15

Chordoma 13

Glioma 13

Ovarian sex cord stromal tumor 12

Carcinoid tumor 11

Lung adenosquamous carcinoma 11

Mucoepidermoid carcinoma 11

Testis germ cell tumor (non-seminoma) 10

2

* Neuroendocrine carcinoma include neuroendocrine carcinoma (location unspecified) (N=44), neuroendocrine tumor of pancreas (N=22), cervical (N=7), head and neck (N=5), bladder (N=4), colorectal (N=4), prostate (N=4), ovarian (N=3), breast (N=2), gastric (N=1) and uterine (N=1).

§ Renal cell carcinoma include renal cell carcinoma (histology unspecified) (N=58), clear cell (N=23), papillary (N=8), collecting duct (N=2) and medullary (N=1).

3

Supplemental Table 3. Complete list of RET aberration with cancer diagnosis and co-occurring aberrations. ID

Diagnosis RET aberrations

Molecular effect of mutation Co-occurring aberrations

1 Medullary thyroid carcinoma

RET C634R Activating (S1) Not detected

2 Breast carcinoma RET C634R Activating (S1) Not detected

3 Endometrial adenocarcinoma

RET E511K Activating (S2) ARID1A F2141fs*59, Q1519fs*8NOTCH1 S2486fs*71+, S2329fs*7NRAS Q61RPIK3CA E545KPTEN D268fs*30, W274fs*2TP53 V157A, P152LTSC1 L203fs*7

4 Merkel cell carcinoma

RET E511K Activating (S2) ALK F1174C

5 Anaplastic thyroid carcinoma

RET E511K Activating (S2) ARID1A Q1334_R1335insQ BRAF V600ECDKN2A/B lossEMSY amplificationJAK2 amplificationPIK3CA H1047LTP53 R306*

6 Paraganglioma RET M918T Activating (S3) Not detected


RET M918T Activating (S3) ATM S978fs*12, L804fs*4


RET M918T Activating (S3) Not detected

9 Atypical lung carcinoid



RET M918T Activating (S3) DDR2 R806Q

11 Pheochromocytoma


12 Papillary thyroid carcinoma


13 Colorectal adenocarcinoma

RET V804M Activating (S4) APC D1033fs*4, R1450*ATM C1045fs*3, Q2277*KRAS G12C MCL1 amplificationMYC amplificationSMAD2 S464*

14 Meningioma RET V804M Activating (S4) CDKN2A/B lossCDKN2C lossNF2 L117fs*6

15 GIST (Gastrointestinal

RET V804M Activating (S4) CDKN2A/B lossKIT S501_A502insAY

4

stromal tumor)16 Hepatocellular

carcinomaRET V804M Activating (S4) MYC amplification

17 Lung adenocarcinoma

RET R114H Unknown - predicted inactivating (S5).According to PolyPhen-2 (S6), it is predicted to be benign mutation.

ARID1A P1325fs*146EPHB1 amplificationMSH6 K1358fs*2NF2 Q410*

18 Uterine carcinosarcoma


KRAS amplificationPIK3CA amplificationSOX2 amplificationTP53 R248W

19 Gastric adenocarcinoma


FBXW7 R689Q

20 Hemangiopericytoma


Not detected

21 Ovarian epithelial carcinoma


CDKN2A A76fs*70KRAS G12D PTCH1 T416STP53 Y220C

22 Adrenal carcinoma


CTNNB1 T41A RB1 R73fs*36TP53 R337fs*4

23 Basal cell carcinoma

RET A756V Unknown. However, according to PolyPhen-2 (S6), it is predicted to be probably damaging mutation.

KDR G1145E PDGFRA E459KPIK3R1 G45*PTCH1 E237K, R770*TP53 R342*, S241P, R196*, Q317fs*21XPO1 E383K

24 Melanoma RET M1109I Unknown. CDKN2A R80*, T79T

5

According to PolyPhen-2 (S6), it is predicted to be benign mutation.

ERBB2 S310FFGFR3 F384LNF1 A1670fs*11 TP53 S241F, P60fs*63

25 Anaplastic thyroid carcinoma

RET M1109T Unknown (S7).According to PolyPhen-2 (S6), it is predicted to be benign mutation.

PTEN E40*, K267fs*9TP53 I254V


RET M255I Unknown.According to PolyPhen-2 (S6), it is predicted to be benign mutation.

CCNE1 amplification MCL1 amplificationMYC amplificationTP53 L206fs*3, K132_A138del, loss exon 2


RET R163Q Unknown.According to PolyPhen-2 (S6), it is predicted to be benign mutation.

CDKN2A P11fs*15CEBPA L155fs*10KRAS G12DTP53 R158L



PIK3CA H1047RSMARCA4 splice site 760+1G>A

29 Ureter urothelial carcinoma


BCL2L2 amplificationCCND1 amplificationCCND2 G268RCDKN2A/B lossFGFR1 amplificationFGFR3 amplificationMDM2 amplificationMYC amplificationTP53 R280T, M246I

30 Sarcoma RET R600Q Unknown (S8).According to PolyPhen-2 (S6), it is predicted to be benign mutation.

RB1 loss


RET R600Q Unknown (S8).According to PolyPhen-2 (S6), it is predicted to be benign mutation.

APC S1214fs*51ARID1A Q1334_R1335insQ TP53 C176F

32 Pancreatic ductal adenocarcinoma

RET T636M Unknown, however preclinical data showed transforming potential including cell proliferation (S9).

KRAS G12RTP53 M237I

33 Cervical adenocarcinoma

RET V706M Unknown. However,

PIK3CA E545K, amplificationSOX2 amplification

6

according to PolyPhen-2 (S6), it is predicted to be probably damaging mutation.

34 Esophageal adenocarcinoma

RET V706M Unknown.However, according to PolyPhen-2 (S6), it is predicted to be probably damaging mutation.

CCND1 amplificationCDH1 R63*CDKN2A lossKRAS amplificationMITF amplificationMYC amplificationNKX2-1 amplificationTP53 C176Y


TRIM33-RET fusion

Activating (S10). CDKN2A/B loss CTNNB1 S33C

36 Salivary gland adenocarcinoma

NCOA4-RET fusion

Activating (S11). ARID1A truncation, exon EGFR amplificationFBXW7 W446fs*25MSH2 N924fs*1TP53 R209fs*6

37 Carcinoma unknown primary

NCOA4-RET fusion

Activating (S11). Not detected


NCOA4-RET fusion


39 Non-small cell lung carcinoma (NSCLC)

KIF5B-RET fusion

Activating (S12). RB1 deletion, exons 13-21STK11 lossTP53 R248L


KIF5B-RET fusion

Activating (S12). MCL1 amplification RB1 deletion, exons 13-21TP53 R248L


KIF5B-RET fusion

Activating (S12). RB1 lossSTK11 lossTP53 R248L


KIF5B-RET fusion

Activating (S12). RPTOR amplificationTP53 E68*


KIF5B-RET fusion

Activating (S12). CDKN2A/B loss FGFR1 amplificationMDM2 amplificationPIK3CA amplification


KIF5B-RET fusion

Activating (S12). MDM2 amplification


KIF5B-RET fusion

Activating (S12). RB1 deletion, intron 12-exon 21STK11 lossTP53 R248L


KIF5B-RET fusion

Activating (S12). BRCA2 T1354MMYC amplification


KIF5B-RET fusion

Activating (S12). CDKN2A/B loss

48 Non-small cell lung carcinoma

KIF5B-RET fusion

Activating (S12). NOTCH1 lossTP53 E68*

7

(NSCLC)49 Lung

adenocarcinomaKIF5B-RET fusion

Activating (S12). APC truncation, exon 6ARFRP1 amplificationAURKA amplificationCDKN2A/B lossTP53 Q165*


KIF5B-RET fusion

Activating (S12). APC I1307KCDKN2A/B lossTP53 S241T, C135F


KIF5B-RET fusion

Activating (S12). CDKN2A/B lossMDM2 amplification


KIF5B-RET fusion

Activating (S12). NFKBIA amplificationNKX2-1 amplification


KIF5B-RET fusion

Activating (S12). CDKN2A/B lossRICTOR amplificationTSC1 Q763*

54 Lung carcinosarcoma

KIF5B-RET fusion

Activating (S12). CDKN2A/B lossMYC amplificationTP53 I251N, S241Y


KIF5B-RET fusion

Activating (S12). STK11 K84*


KIF5B-RET fusion

Activating (S12). TP53 R181C


CCDC6-RET fusion



CCDC6-RET fusion



CCDC6-RET fusion

Activating (S13). BRCA2 K3326*CDKN2A/B lossTP53 C242fs*5


CCDC6-RET fusion



SQSTM1-RET fusion

Unknown. Not detected

62 Sarcoma RET amplification

Activating. Not detected


RET amplification

Activating. BRAF N486_P490del JUN amplificationMCL1 amplificationTP53 C176G

64 Melanoma RET amplification

Activating. BRAF G469VCDKN2A R58*NF1 Q1070*RICTOR R1075QTP53 V218M

65 Breast carcinoma RET amplification

Activating. AURKA amplificationIRS2 amplificationMCL1 amplificationMYC amplificationPIK3CA amplificationSOX2 amplificationTP53 splice site 673-2A>G

66 Ovarian epithelial RET Activating. AURKA amplification8

carcinoma amplification BRCA1 S1253fs*10CCND2 amplificationCCNE1 amplificationCDK6 amplificationEGFR amplificationESR1 amplificationKDR amplificationKIT amplificationKRAS amplificationMCL1 amplificationMYC amplificationNRAS amplificationPDGFRA amplificationPIK3CA amplificationTP53 R273H


RET amplification

Activating. ATM R1150*, E277fs*37KRAS G13D MCL1 amplificationNFKBIA amplificationNKX2-1 amplification

68 Breast carcinoma RET amplification

Activating. CCNE1 amplificationLRP1B Q4392*PIK3CA H1047R PTEN LossTP53 A74fs*74

69 Fallopian tube adenocarcinoma

RET amplification

Activating. ESR1 amplificationFGFR3 amplificationTP53 S94*

70 Sarcoma RET amplification

Activating. CCNE1 amplificationNF1 L190*RB1 R251*TET2 R544*TP53 R248W, R175H


RET amplification

Activating. FGFR2 N549K, amplificationNRAS amplificationTP53 C141Y

72 Head and neck squamous cell carcinoma (HNSCC)

RET amplification

Activating. LRP1B S1687*NF1 splice site 288+1G>T, splice site 1642-1G>TPTEN lossTET2 E81*TP53 splice site 560-1delG


RET amplification

Activating. JAK2 amplificationMCL1 amplificationMYC amplificationTP53 splice site 993+1G>A

74 Gastroesophageal junction carcinoma

RET amplification

Activating. CCNE1 amplificationCRKL amplificationSMAD4 lossTP53 C176F

75 Ovarian serous carcinoma

RET amplification

Activating. CRKL amplificationFGFR2 amplification

76 Salivary gland RET Activating. CDKN2A/B loss

9

adenocarcinoma amplification ERBB2 amplificationFANCA Y843*TP53 A84fs*39


RET amplification

Activating. APC R232*, E1295fs*8AURKA amplificationBRCA2 K3326*CCND1 amplificationCCND2 amplificationCCNE1 amplificationEMSY amplificationSRC amplificationTOP1 amplification TP53 splice site 782+1G>A

78 Prostate adenocarcinoma

RET amplification

Activating. ATM splice site 7933_8010+29delATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAAGATGTTGTTGTCCCTACTATGGAAATTAAGGTAATTTGCAATTAACTCTTGATTTTTTTBRAF-NUB1 fusionCDK6 amplificationCREBBP truncation, exon 31KMT2D rearrangement, intron 47PTEN lossTP53 Y220C

79 Duodenal adenocarcinoma

RET amplification

Activating. AKT2 amplificationCDKN2A M1fs*5MYC amplificationSMAD4 splice site 1308+1G>T TP53 H193L

80 Ovarian serous carcinoma

RET amplification

Activating. PTCH1 R571W TP53 R342*TSC2 truncation, exon 38

81 Bladder urothelial (transitional cell) carcinoma

RET amplification

Activating. CDKN2A/B lossFGFR1 amplificationMDM2 amplificationTP53 G105fs*18

82 Lung squamous cell carcinoma

RET amplification

Activating. FLT3 splice site 1310-1G>TNF1 H819fs*2NOTCH1 Y625*TP53 R249S


RET partial amplification

Unknown, possibly activating.

FGFR4 amplificationFLT4 amplificationPDGFRB amplification RICTOR amplification


RET rearrangement, intergenic

Unknown. BRCA1 G275D MCL1 amplificationMTOR L1460P


RET rearrangeme

Unknown. Not detected

10

nt, intron 1186 Lung

adenocarcinomaRET rearrangement, exon 11

Unknown. CDKN2A/B loss NF1 R1276Q


RET duplication, intron 9-exon 17

Unknown. KRAS G12D TP53 V274F

88 Cutaneous squamous cell carcinoma

RET loss Inactivating. CDKN2A R58*TP53 F270L, Q192*TSC2 S1799*

11

Supplemental Table 4. List of 182 and 236 cancer-related genes.

Supplemental Table 4.A. List of 182 cancer-related genes (N=16).

12

Supplemental Table 4.B. List of 236 cancer-related genes (N=72).

13

Supplemental Table 5. RET aberrations reported in cBioPortal database (http://cbioportal.org)

cBioPortal Diagnosis

Number of cases reported

Any aberrations

N (%)

Fusion§

N (%)Mutation

N (%)Amplification

N (%)LossN (%)

All cBioPortal data 6011 181 (3.0) 28 (0.5) 109 (1.8) 23 (0.4) 19 (0.3)Cutaneous squamous cell carcinoma (DFCI, Clin Cancer Res 2015)

29 3 (10.3) 0 3 (10.3) 0 0

Skin Cutaneous Melanoma (TCGA, Provisional)

278 21 (7.6) 0 16 (5.8) 0 5 (1.8)

Bladder Urothelial Carcinoma (TCGA, Nature 2014)

127 9 (7.1) 0 5 (3.9) 3 (2.4) 1 (0.8)

Papillary Thyroid Carcinoma (TCGA, Cell 2014) ¶

399 23 (5.8) 21 (5.3) 0 0 0

Cholangiocarcinoma (TCGA, Provisional)

35 2 (5.7) 0 1 (2.9) 1 (2.9) 0

Uterine Corpus Endometrioid Carcinoma (TCGA, Nature 2013)

240 11 (4.6) 0 11 (4.6) 0 0

Small Cell Lung Cancer (U Cologne, Nature 2015) *

110 5 (4.5) 0 5 (4.5) 0 0

Lung Adenocarcinoma (TCGA, Nature 2014)

230 10 (4.3) 2 (0.9) 7 (3.0) 0 1 (0.4)

Poorly-Differentiated and Anaplastic Thyroid Cancers (MSKCC, JCI 2016)

117 5 (4.3) 5 (4.3) 0 0 0

Stomach Adenocarcinoma (TCGA, Nature 2014)

287 12 (4.2) 0 12 (4.2) 0 0

Pancreatic Adenocarcinoma (TCGA, Provisional)

145 6 (4.1) 0 5 (3.4) 1 (0.7) 0

Colorectal Adenocarcinoma (TCGA, Nature 2012)

212 8 (3.8) 0 8 (3.8) 0 0

Pheochromocytoma and Paraganglioma (TCGA, Provisional)

161 6 (3.7) 0 6 (3.7) 0 0

Head and Neck Squamous Cell Carcinoma (TCGA, Nature 2015)

279 10 (3.6) 0 8 (2.9) 1 (0.4) 1 (0.4)

Sarcoma (TCGA, Provisional)

240 7 (2.9) 0 2 (0.8) 2 (0.8) 3 (1.3)

Lung Squamous Cell Carcinoma (TCGA,

178 5 (2.8) 0 3 (1.7) 2 (1.1) 0

14

Nature 2012)Adrenocortical Carcinoma (TCGA, Provisional)

88 2 (2.3) 0 2 (2.3) 0 0

Esophageal Carcinoma (TCGA, Provisional)

184 4 (2.2) 0 0 3 (1.6) 1 (0.5)

Breast Invasive Carcinoma (TCGA, Cell 2015)

974 20 (2.1) 0 11 (1.1) 7 (0.7) 2 (0.2)

Prostate Adenocarcinoma (TCGA, Cell 2015)

333 6 (1.8) 0 1 (0.3) 1 (0.3) 4 (1.2)

Mesothelioma (TCGA, Provisional)

87 1 (1.1) 0 0 1 (1.1) 0

Liver Hepatocellular Carcinoma (TCGA, Provisional)

193 2 (1.0) 0 1 (0.5) 1 (0.5) 0

Glioblastoma (TCGA, Cell 2013)

281 2 (0.7) 0 1 (0.4) 0 1 (0.4)

Ovarian Serous Cystadenocarcinoma (TCGA, Nature 2011)

316 1 (0.3) 0 1 (0.3) 0 0

Uterine Carcinosarcoma (TCGA, Provisional)

56 0 0 0 0 0

Adenoid Cystic Carcinoma (MSKCC, Nat Genet 2013)

60 0 0 0 0 0

Clear Cell Renal Cell Carcinoma (U Tokyo, Nat Genet 2013) *

106 0 0 0 0 0

Esophageal Squamous Cell Carcinoma (UCLA, Nat Genet 2014) *

137 0 0 0 0 0

Gallbladder Carcinoma (Shanghai, Nat Genet 2014) *

32 0 0 0 0 0

Neuroblastoma (AMC Amsterdam, Nature 2012) *

87 0 0 0 0 0

Pancreatic Neuroendocrine Tumors (Johns Hopkins University, Science 2011) *

10 0 0 0 0 0

There was no reported case with duplication or rearrangement.§ Fusions without known fusion partner were also reported as fusion in cBioPortal. ¶ Among papillary Thyroid Carcinoma (TCGA, Cell 2014), there were 2 cases harboring both RET loss and fusion.* Data were available for mutation only.

15

Supplemental Table 6. Co-aberrant oncogenic pathways and the type of RET aberrations.

The term fusion was used when RET was rearranged with known fusion partner (e.g. KIF5B-RET).

16

RETAll

(N=88)Mutations

(N=34)Fusions *

(N=27)Amplification

(N=22)Cell cycle associated genes 35 (39.8%) 10 (29.4%) 13 (48.1%) 10 (45.5%)TP53-associated genes 52 (59.1%) 16 (47.1%) 15 (55.6%) 19 (86.4%)Tyrosine kinase families 19 (21.6%) 7 (20.6%) 2 (7.4%) 10 (45.5%)MAPK signaling pathway 20 (22.7%) 9 (26.5%) 0 (0%) 9 (40.9%)PI3K signaling pathway 27 (30.7%) 9 (26.5%) 7 (25.9%) 9 (40.9%)

Supplemental Table 7. Co-occurring aberrations associated with RET aberrations and examples of possible targeted therapies.

ID Co-occurring aberrations Possible targeted therapies 1 Not detected Not applicable.

2 Not detected Not applicable.

3 ARID1A F2141fs*59, Q1519fs*8NOTCH1 S2486fs*71+, S2329fs*7NRAS Q61RPIK3CA E545KPTEN D268fs*30, W274fs*2TP53 V157A, P152LTSC1 L203fs*7

ARID1A may be targetable with EZH2 inhibitor (EPZ-6438 *, NCT01897571) through a synthetic lethal mechanism (S14).

NOTCH1 may be targetable with a gamma-secretase inhibitor * (S15, 16).

RAS aberrations, including NRAS, have been challenging to target (S17). However, NRAS mutations are potentially targetable with a MEK inhibitor such as trametinib (S18).

PIK3CA and PTEN aberrations may be targetable with mTOR inhibitors such as everolimus (S19, 20).

TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21). Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).

TSC1 aberrations are potentially targetable with mTOR inhibitors such as everolimus (S24).

4 ALK F1174C The ALK F1174C aberration has been associated with resistance to ALK inhibitors including crizotinib, ceritinib and alectinib. However, trials with third-generation ALK inhibitor such as lorlatinib (PF-06463922, NCT01970865) * are ongoing (S25).

5 ARID1A Q1334_R1335insQ BRAF V600ECDKN2A/B lossEMSY amplificationJAK2 amplificationPIK3CA H1047LTP53 R306*


BRAF V600 mutation is targetable with vemurafenib and dabrafenib (S26, 27).

CDKN2A/B loss is theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this

17

aberration was not predictive of response (S29).

EMSY amplification abrogates BRCA2 function;, thus, it is potentially targetable with a PARP inhibitor (such as olaparib) or platinum (S30, 31).

JAK2 is targetable with ruxolitinib (S32).

PIK3CA may be targetable with mTOR inhibitors such as everolimus (S19, 20), or with PI3K inhibitors in clinical trials.



7 ATM S978fs*12, L804fs*4 ATM aberrations are associated with defects in DNA double strand break repair. Thus, they are potentially targetable with a PARP inhibitor such as olaparib (S33).



10 DDR2 R806Q DDR2 aberration is targetable with dasatinib (S34).



13 APC D1033fs*4, R1450*ATM C1045fs*3, Q2277*KRAS G12C MCL1 amplificationMYC amplificationSMAD2 S464*

A preclinical study using an APC-mutated intestinal polyposis mouse model showed that treatment with a COX-2 inhibitor reduced the number of polyps (S35). Further investigation in a randomized clinical trial demonstrated that targeting COX-2 with celecoxib was effective for the prevention of colorectal adenomas (S36). Thus, APC aberration is potentially targetable with celecoxib.

ATM aberrations are associated with defects in DNA double strand break repair. Thus, they are potentially targetable with a PARP inhibitor such as olaparib (S33).

18

RAS mutations, including KRAS, have been challenging to target (S17). However, KRAS mutations are potentially targetable with a MEK inhibitor such as trametinib (S18).

In a preclinical model, sorafenib downregulated phospho-STAT3 and subsequently reduced the expression of MCL1, which led to the inhibition of tumor growth. Thus MCL1 amplification may be targetable with sorefenib (S37).

There is no therapy that directly targets MYC alterations. However, cell cycle checkpoints are associated with MYC synthetic lethal interactions and it is potentially targetable with an aurora kinase inhibitor (e.g. MLN8237 *) (S38) or CDK1 inhibitor (dinaciclib * [CDK1/2/5/9 inhibitor]) (S39). MYC is also known to induce a rapid increase in CDK4 and thus potentially targetable with CDK4/6 inhibitor, palbociclib. Additionally, BET inhibitors * are capable of downregulating MYC transcription (S40) (NCT01943851).

SMAD proteins are signal transducers and transcriptional modulators mediating multiple signaling pathways (S41). To our knowledge, there is no targeted therapy for SMAD2 aberrations.

14 CDKN2A/B lossCDKN2C lossNF2 L117fs*6

CDKN2A/B loss and CDKN2C loss are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).

NF2 is a negative regulator of mTOR. Thus, it is potentially targetable with an mTOR inhibitor such as everolimus (S42, 43).

15 CDKN2A/B lossKIT S501_A502insAY

CDKN2A/B loss is theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this aberration was not predictive of response (S29).

KIT aberrations may be targetable with imatinib (S44).

16 MYC amplification There is no therapy that directly targets MYC alterations. However, cell cycle checkpoints are associated with MYC synthetic lethal interactions and it is potentially targetable with an aurora kinase inhibitor (e.g. MLN8237 *) (S38) or CDK1 inhibitor (dinaciclib * [CDK1/2/5/9 inhibitor]) (S39). MYC is also known to induce a rapid increase in CDK4 and thus potentially targetable with CDK4/6 inhibitor, palbociclib. Additionally, BET inhibitors * are capable of downregulating MYC transcription (S40) (NCT01943851).

19

17 ARID1A P1325fs*146EPHB1 amplificationMSH6 K1358fs*2NF2 Q410*


EPH is associated with tumor growth and progression (S45). EPH families may be targetable with a multi-kinase inhibitor that includes EPH inhibition such as MGCD516 * (NCT02219711).

Aberrations in mismatch repair machinery, including MSH6, result in high-level microsatellite instability which has been associated with significant response to anti-PD1 inhibitors such as pembrolizumab (S46).

NF2 is a negative regulator of mTOR. Thus, it is potentially targetable with an mTOR inhibitor such as everolimus (S42, 43).

18 KRAS amplificationPIK3CA amplificationSOX2 amplificationTP53 R248W

RAS mutations, including KRAS, have been challenging to target (S17). However, KRAS aberrations are potentially targetable with a MEK inhibitor such as trametinib (S18).


SOX2 is a transcription factor associated with tumor initiation and progression (S47). To our knowledge, there is no targeted therapy for SOX2 aberrations.


19 FBXW7 R689Q Since FBXW7 targets mTOR for degradation, FBXW7 mutation may lead to increased mTOR signaling, which may be targetable with everolimus (S48).


21 CDKN2A A76fs*70KRAS G12D PTCH1 T416STP53 Y220C

CDKN2A aberrations are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).

20


PTCH1 aberrations may be targetable with SMO inhibitors such as vismodegib (S49) or sonidegib (S50).


22 CTNNB1 T41A RB1 R73fs*36TP53 R337fs*4

In a preclinical study using hepatocellular carcinoma cell lines, sorafenib was shown to inhibit Wnt/β-catenin signaling (S51). In addition, sulindac (NSAID) has been shown to suppress Wnt/β-catenin signaling in colon cancer cell line (S52). Since Notch is downstream of Wnt/β-catenin, Notch has also been implicated as a target for β-catenin dependent tumorigenesis (S53). Consistent with these preclinical data, sorafenib (S54), sulindac (S55) and a gamma-secretase inhibitor (PF-03084014 *) (S15) were all shown to have anti-tumor activity against patients with desmoid tumor, which is commonly associated with CTNNB1 mutation (S56). Moreover, CTNNB1 aberrations are potentially targetable with a β-catenin antagonist * that is currently in early phase clinical trial (CT02413853, NCT01764477).

RB1 is a tumor suppressor that regulates cell cycle progression. To our knowledge, there is no targeted therapy for RB1 aberrations.


23 KDR G1145E KDR aberration may be targeted with a VEGFR-2

21

PDGFRA E459KPIK3R1 G45*PTCH1 E237K, R770*TP53 R342*, S241P, R196*, Q317fs*21XPO1 E383K

inhibitor such as cabozantinib (S57).

PDGFR aberrations may be targeted with various multikinase inhibitors including imatinib (S58), dasatinib (S59) and sorafenib (S60).

PIK3R1 aberration is potentially targetable with an mTOR inhibitor such as everolimus (S61).



XPO1 mediates the nuclear export of specific molecules including small nuclear RNA. To our knowledge, there is no targeted therapy for XPO1 aberrations.

24 CDKN2A R80*, T79TERBB2 S310FFGFR3 F384LNF1 A1670fs*11 TP53 S241F, P60fs*63

CDKN2A aberrations are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).

ERBB2 aberrations may be targetable with lapatinib, trastuzumab, or afatinib (S62).

FGFR3 aberration is potentially targetable with pazopanib and ponatinib (S63).

NF1 encodes neurofibromin, which is a RAS-GTPase activating protein. Therefore, NF1 aberration is associated with RAS activation leading to MEK dependency. Thus, it may be targetable with MEK inhibitors including trametinib (S64).

TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21). Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-bevacizumab-containing regimens (median 11.0

22

versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).

25 PTEN E40*, K267fs*9TP53 I254V

PTEN aberrations may be targetable with mTOR inhibitors such as everolimus (S19, 20).


26 CCNE1 amplification MCL1 amplificationMYC amplificationTP53 L206fs*3, K132_A138del, loss exon 2

A synthetic lethal screen showed that CCNE1 amplified cells required the ubiquitin pathway and were sensitive to the proteasome inhibitor bortezomib (S65).




27 CDKN2A P11fs*15CEBPA L155fs*10

CDKN2A aberrations are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28);

23

KRAS G12DTP53 R158L

however, some publications indicate that these aberrations were not predictive of response (S29).

CEBPA encodes CCAAT/enhancer-binding protein-alpha, which functions as a tumor suppressor (S66). To our knowledge, there is no targeted therapy for CEBPA aberrations.



28 PIK3CA H1047RSMARCA4 splice site 760+1G>A


SMARCA4 encodes a subunit of the SWI/SNF chromatin-remodeling complex. A preclinical study suggests BRM as a candidate target for synthetic lethal therapy (S67). However, to our knowledge, there is no direct targeted therapy for SMARCA4 aberrations.

29 BCL2L2 amplificationCCND1 amplificationCCND2 G268RCDKN2A/B lossFGFR1 amplificationFGFR3 amplificationMDM2 amplificationMYC amplificationTP53 R280T, M246I

BCL2L2 amplification may be targetable with a BCL-2 family inhibitor such as ABT-263 * (navitoclax) that is in clinical development (NCT02143401) (S68) or venetoclax (approved in CLL).

CCND1/2 aberrations as well as CDKN2A/B loss are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).

FGFR aberrations are potentially targetable with pazopanib and ponatinib (S63).

MDM2 amplification may be targetable with an MDM2 inhibitor that is currently in clinical trials (DS-3032b *: NCT01877382 and ALRN-6924 *: NCT02264613).

24



30 RB1 loss RB1 is a tumor suppressor that regulates cell cycle progression. To our knowledge, there is no targeted therapy for RB1 aberrations.

31 APC S1214fs*51ARID1A Q1334_R1335insQ TP53 C176F

A preclinical study using an APC-mutated intestinal polyposis mouse model showed that treatment with a COX-2 inhibitor reduced the number of polyps (S35). Further investigation in a randomized clinical trial demonstrated that targeting COX-2 with celecoxib was effective for the prevention of colorectal adenomas (S36). Thus, APC aberration is potentially targetable with celecoxib. ARID1A may be targetable with EZH2 inhibitor (EPZ-6438 *, NCT01897571) through a synthetic lethal mechanism (S14).


32 KRAS G12RTP53 M237I


25


33 PIK3CA E545K, amplificationSOX2 amplification



34 CCND1 amplificationCDH1 R63*CDKN2A lossKRAS amplificationMITF amplificationMYC amplificationNKX2-1 amplificationTP53 C176Y

CCND1 amplification and CDKN2A loss are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).

CDH1 aberration is associated with hereditary diffuse gastric cancer (S69). However, to our knowledge, there is no therapy targeting CDH1 aberrations.

RAS aberrations, including KRAS, have been challenging to target (S17). However, KRAS aberrations are potentially targetable with a MEK inhibitor such as trametinib (S18).

MITF is a transcription factor that regulates cell differentiation and development (S70). To our knowledge, there is no targeted therapy for MITF amplification.


NKX2-1 is a transcription factor that can have both

26

oncogenic and tumor suppressive functions in cancer (S71). To our knowledge, there is no targeted therapy for NKX2-1 amplification.


35 CDKN2A/B loss CTNNB1 S33C


In a preclinical study using hepatocellular carcinoma cell lines, sorafenib was shown to inhibit Wnt/β-catenin signaling (S51). In addition, sulindac (NSAID) has been shown to suppress Wnt/β-catenin signaling in colon cancer cell line (S52). Since Notch is downstream of Wnt/β-catenin, Notch has also been implicated as a target for β-catenin dependent tumorigenesis (S53). Consistent with these preclinical data, sorafenib (S54), sulindac (S55) and a gamma-secretase inhibitor (PF-03084014 *) (S15) were all shown to have anti-tumor activity against patients with desmoid tumor, which is commonly associated with CTNNB1 mutation (S56). Moreover, CTNNB1 aberrations are potentially targetable with a β-catenin antagonist * that is currently in early phase clinical trial (CT02413853, NCT01764477).

36 ARID1A truncation, exon EGFR amplificationFBXW7 W446fs*25MSH2 N924fs*1TP53 R209fs*6


EGFR amplification may be targetable with anti-EGFR therapy such as cetuximab or panitumumab (S72).

Since FBXW7 targets mTOR for degradation, FBXW7 mutation may lead to increased mTOR signaling, which may be targetable with everolimus (S48).

Aberrations in mismatch repair machinery, including MSH2, result in high-level microsatellite instability which has been associated with significant response to anti-PD1 inhibitors such as

27

pembrolizumab (S46).




39 RB1 deletion, exons 13-21STK11 lossTP53 R248L


STK11 activates adenine monophosphate (AMP)-activation protein kinase which leads to inhibition of mTOR. Thus, loss of STK11 leads to increased mTOR signaling and may be targetable with everolimus (S73).


40 MCL1 amplification RB1 deletion, exons 13-21TP53 R248L



TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21). Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-

28

bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).

41 RB1 lossSTK11 lossTP53 R248L




42 RPTOR amplificationTP53 E68*

Raptor is potentially targetable with everolimus (mTORC1 inhibitor). However, mTORC1 inhibition alone can lead to increased AKT signaling through rictor (part of mTORC2) (S74). Thus inhibition of both mTORC1/2 with a dual inhibitor such as MLN0128 * that is currently in clinical trial may be suitable for targeting RPTOR amplification (NCT01899053).


43 CDKN2A/B loss FGFR1 amplificationMDM2 amplificationPIK3CA amplification


FGFR1 amplification is potentially targetable with pazopanib and ponatinib (S63).

29



44 MDM2 amplification MDM2 amplification may be targetable with an MDM2 inhibitor that is currently in clinical trials (DS-3032b *: NCT01877382 and ALRN-6924 *: NCT02264613).

45 RB1 deletion, intron 12-exon 21STK11 lossTP53 R248L




46 BRCA2 T1354MMYC amplification

BRCA2 mutations may be targetable with a PARP inhibitor, such as olaparib (S75).


47 CDKN2A/B loss CDKN2A/B loss is theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this aberration was not predictive of response (S29).

48 NOTCH1 lossTP53 E68*

Although NOTCH1 may be targetable with gamma-secretase inhibitor * (S15, 16), to our knowledge, loss of NOTCH1 is not targetable.

30


49 APC truncation, exon 6ARFRP1 amplificationAURKA amplificationCDKN2A/B lossTP53 Q165*


ADP-ribosylation factor related protein 1 (ARFRP1) encodes a protein that functions as a GTP-ase. To our knowledge, there is no targeted therapy for ARFRP1 amplification.

AURKA amplification may be targetable with aurora kinase inhibitors, such as alisertib, * that are in clinical trials (NCT02187991) (S76).



50 APC I1307KCDKN2A/B lossTP53 S241T, C135F


31



51 CDKN2A/B lossMDM2 amplification



52 NFKBIA amplificationNKX2-1 amplification

NFKBIA amplification is potentially targetable with a proteasome inhibitor, such as bortezomib (S77).

NKX2-1 is a transcription factor that can have both oncogenic and tumor suppressive functions in cancer (S71). To our knowledge, there is no targeted therapy for NKX2-1 amplification.

53 CDKN2A/B lossRICTOR amplificationTSC1 Q763*


Rictor, which is a part of mTORC2, is targetable with a dual mTORC1/2 inhibitor such as MLN0128 *, which is currently in clinical trials (NCT01899053).


54 CDKN2A/B lossMYC amplificationTP53 I251N, S241Y


There is no therapy that directly targets MYC alterations. However, cell cycle checkpoints are associated with MYC synthetic lethal interactions and it is potentially targetable with an aurora

32

kinase inhibitor (e.g. MLN8237 *) (S38) or CDK1 inhibitor (dinaciclib * [CDK1/2/5/9 inhibitor]) (S39). MYC is also known to induce a rapid increase in CDK4 and thus potentially targetable with CDK4/6 inhibitor, palbociclib. Additionally, BET inhibitors * are capable of downregulating MYC transcription (S40) (NCT01943851).


55 STK11 K84* STK11 activates adenine monophosphate (AMP)-activation protein kinase which leads to inhibition of mTOR. Thus, loss of STK11 leads to increased mTOR signaling and may be targetable with everolimus (S73).

56 TP53 R181C TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21). Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).



59 BRCA2 K3326*CDKN2A/B lossTP53 C242fs*5




33





63 BRAF N486_P490del JUN amplificationMCL1 amplificationTP53 C176G

Although BRAF V600 mutations are targetable with BRAF inhibitors (e.g. vemurafenib) (S78), the functional effect of BRAF N486_P490del is unknown. Low-activity BRAF mutations may activate the MEK pathway via RAF1 activation, and may therefore be targetable with MEK inhibitors. Although the functional significance of BRAF N486_P490del is unknown (S79), it is worth targeting in the clinical trial setting.

c-JUN is a component of a transcription factor that plays an important role in carcinogenesis and cancer progression (S80). However, to our knowledge, there is no targeted therapy for JUN amplification.



64 BRAF G469VCDKN2A R58*NF1 Q1070*RICTOR R1075QTP53 V218M

Although BRAF V600 mutations are targetable with BRAF inhibitors (e.g. vemurafenib) (S78), the functional effect of BRAF G469V is unknown. Low-activity BRAF mutations may activate the MEK pathway via RAF1 activation, and may therefore be targetable with MEK inhibitors. Although the functional significance of BRAF G469V is unknown (S79), it is worth targeting in the clinical trial setting.

CDKN2A aberrations are theoretically targetable

34

with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).




65 AURKA amplificationIRS2 amplificationMCL1 amplificationMYC amplificationPIK3CA amplificationSOX2 amplificationTP53 splice site 673-2A>G


IRS2 is a cytoplasmic adapter protein that docks to IGFR and is capable of activating the phosphoinositide 3-kinase (PI3K) pathway (S81). Consistent with this functional role of IRS2, one patient with advanced breast cancer harboring IRS2 amplification experienced a complete response with everolimus containing regimen (S82).


There is no therapy that directly targets MYC alterations. However, cell cycle checkpoints are associated with MYC synthetic lethal interactions and it is potentially targetable with an aurora kinase inhibitor (e.g. MLN8237 *) (S38) or CDK1 inhibitor (dinaciclib * [CDK1/2/5/9 inhibitor]) (S39). MYC is also known to induce a rapid increase in CDK4 and thus potentially targetable with CDK4/6

35

inhibitor, palbociclib. Additionally, BET inhibitors * are capable of downregulating MYC transcription (S40) (NCT01943851).




66 AURKA amplificationBRCA1 S1253fs*10CCND2 amplificationCCNE1 amplificationCDK6 amplificationEGFR amplificationESR1 amplificationKDR amplificationKIT amplificationKRAS amplificationMCL1 amplificationMYC amplificationNRAS amplificationPDGFRA amplificationPIK3CA amplificationTP53 R273H



CCND2 and CDK6 amplification are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).


EGFR amplification may be targetable with anti-EGFR therapy such as cetuximab or panitumumab (S72).

ESR1 amplification may be targetable with anti-estrogen such as tamoxifen (S83).

KDR amplification may be targeted with a VEGFR-2 inhibitor such as cabozantinib (S57).

KIT amplification may be targetable with imatinib (S44).

36

RAS mutations, including NRAS and KRAS, have been challenging to target (S17). However, NRAS and KRAS mutations are potentially targetable with a MEK inhibitor such as trametinib (S18).



PDGFR aberrations may be targeted with various multikinase inhibitors including imatinib (S58), dasatinib (S59) and sorafenib (S60).



Hypermutated tumors, as in this case with 17 aberrations (including RET), may benefit from immune checkpoint inhibitors such as pembrolizumab (S84).

67 ATM R1150*, E277fs*37KRAS G13D MCL1 amplificationNFKBIA amplificationNKX2-1 amplification


RAS mutations, including KRAS, have been

37

challenging to target (S17). However, KRAS mutations are potentially targetable with a MEK inhibitor such as trametinib (S18).


NFKBIA amplification is potentially targetable with a proteasome inhibitor, such as bortezomib (S77).

NKX2-1 is a transcription factor that can have both oncogenic and tumor suppressive functions in cancer (S71). To our knowledge, there is no targeted therapy for NKX2-1 amplification.

68 CCNE1 amplificationLRP1B Q4392*PIK3CA H1047R PTEN LossTP53 A74fs*74


LRP1B is a tumor suppressor that is associated with chemotherapy resistance (S85). However, to our knowledge, there is no targeted therapy for LRP1B aberrations.

PIK3CA mutations and PTEN loss may be targetable with mTOR inhibitors such as everolimus (S19, 20), or with PI3K inhibitors in clinical trials.


69 ESR1 amplificationFGFR3 amplificationTP53 S94*

ESR1 amplification may be targetable with anti-estrogen such as tamoxifen (S83).

FGFR3 amplification is potentially targetable with pazopanib and ponatinib (S63).

TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21). Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-

38

containing regimens as compared to non-bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).

70 CCNE1 amplificationNF1 L190*RB1 R251*TET2 R544*TP53 R248W, R175H




TET2 is a tumor suppressor gene that is associated with myeloid cancers (S86). The use of DNA methyltransferase (DNMT) inhibitors is one strategy under investigation to address inactivating mutation or loss of TET2 in human cancer (S86).


71 FGFR2 N549K, amplificationNRAS amplificationTP53 C141Y

FGFR2 aberrations are potentially targetable with pazopanib and ponatinib (S63).

RAS aberrations, including NRAS, have been challenging to target (S17). However, NRAS mutations are potentially targetable with a MEK inhibitor such as trametinib (S18).


39


72 LRP1B S1687*NF1 splice site 288+1G>T, splice site 1642-1G>TPTEN lossTET2 E81*TP53 splice site 560-1delG

LRP1B is a tumor suppressor that is associated with chemotherapy resistance (S85). However, to our knowledge, there is no targeted therapy for LRP1B aberrations.



TET2 is a tumor suppressor gene that is associated with myeloid cancers (S86). The use of DNA methyltransferase (DNMT) inhibitors is one strategy under investigation to address inactivating mutation or loss of TET2 in human cancer (S86).


73 JAK2 amplificationMCL1 amplificationMYC amplificationTP53 splice site 993+1G>A

JAK2 is targetable with ruxolitinib (S32).


There is no therapy that directly targets MYC alterations. However, cell cycle checkpoints are associated with MYC synthetic lethal interactions and it is potentially targetable with an aurora kinase inhibitor (e.g. MLN8237 *) (S38) or CDK1 inhibitor (dinaciclib * [CDK1/2/5/9 inhibitor]) (S39). MYC is also known to induce a rapid increase in CDK4 and thus potentially targetable with CDK4/6 inhibitor, palbociclib. Additionally, BET inhibitors * are capable of downregulating MYC transcription

40

(S40) (NCT01943851).


74 CCNE1 amplificationCRKL amplificationSMAD4 lossTP53 C176F


CRKL encodes an adaptor protein of BCR-ABL kinase, functioning in signaling transduction (S87). However, to our knowledge, there is no targeted therapy for CRKL aberration.



75 CRKL amplificationFGFR2 amplification

CRKL encodes an adaptor protein of BCR-ABL kinase, functioning in signaling transduction (S87). However, to our knowledge, there is no targeted therapy for CRKL aberration.

FGFR2 aberrations are potentially targetable with pazopanib and ponatinib (S63).

76 CDKN2A/B lossERBB2 amplificationFANCA Y843*TP53 A84fs*39


ERBB2 aberrations may be targetable with lapatinib, trastuzumab, or afatinib (S62).

41

FANCA is a Fanconi’s anemia gene, which functions in DNA repair. FANCA aberrations are potentially targetable with PARP inhibitors such as olaparib (S88).


77 APC R232*, E1295fs*8AURKA amplificationBRCA2 K3326*CCND1 amplificationCCND2 amplificationCCNE1 amplificationEMSY amplificationSRC amplificationTOP1 amplification TP53 splice site 782+1G>A




CCND1/2 amplification are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that these aberrations were not predictive of response (S29).


EMSY amplification abrogates BRCA2 function;, thus, it is potentially targetable with a PARP inhibitor (such as olaparib) or platinum (S30, 31).

SRC amplification may be targetable with dasatinib (S89).

TPO1 amplification is potentially targetable with a topoisomerase I inhibitor such as topotecan (S90).

TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21).

42

Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).

Hypermutated tumors, as in this case with 12 aberrations (including RET), may benefit from immune checkpoint inhibitors such as pembrolizumab (S84).

78 ATM splice site 7933_8010+29delATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAAGATGTTGTTGTCCCTACTATGGAAATTAAGGTAATTTGCAATTAACTCTTGATTTTTTTBRAF-NUB1 fusionCDK6 amplificationCREBBP truncation, exon 31KMT2D rearrangement, intron 47PTEN lossTP53 Y220C


BRAF fusions may be targetable with a MEK inhibitor such as trametinib (S91).

CDK6 amplification is theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this aberration was not predictive of response (S29).

CREB binding protein has histone acetyltransferase activity. CREBBP aberration is potentially targetable with histone deacetylase inhibitors such as vorinostat (S92).

KMT2D encodes a lysine-specific methyltransferase 2D that functions as a histone methyltransferase. To our knowledge, there is no targeted therapy for KMT2D aberration.



79 AKT2 amplificationCDKN2A M1fs*5MYC amplification

AKT amplification may be targetable with mTOR inhibitors such as everolimus or with Akt inhibitors in clinical trials (S19, 20).

43

SMAD4 splice site 1308+1G>T TP53 H193L CDKN2A aberrations are theoretically targetable

with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this aberration was not predictive of response (S29).




80 PTCH1 R571W TP53 R342*TSC2 truncation, exon 38




81 CDKN2A/B lossFGFR1 amplification

CDKN2A/B loss is theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28);

44

MDM2 amplificationTP53 G105fs*18

however, some publications indicate that this aberration was not predictive of response (S29).

FGFR aberrations are potentially targetable with pazopanib and ponatinib (S63).



82 FLT3 splice site 1310-1G>TNF1 H819fs*2NOTCH1 Y625*TP53 R249S

FLT3 aberration is potentially targetable with sorafenib (S93).


NOTCH1 may be targetable with a gamma-secretase inhibitor * (S15, 16).


83 FGFR4 amplificationFLT4 amplificationPDGFRB amplification RICTOR amplification

FGFR4 aberration is potentially targetable with ponatinib (S63).

FLT4 amplification is potentially targetable with VEGFR3 inhibitors such as sorafenib, pazopanib and sunitinib (S94).

PDGFRB amplification may be targetable with

45

imatinib (S95), dasatinib (S96) and sorafenib (S97).


84 BRCA1 G275D MCL1 amplificationMTOR L1460P



MTOR aberration is targetable with everolimus (S98).


86 CDKN2A/B loss NF1 R1276Q



87 KRAS G12D TP53 V274F



88 CDKN2A R58*TP53 F270L, Q192*TSC2 S1799*

CDKN2A aberrations are theoretically targetable with a CDK4/6 inhibitor such as palbociclib (S28); however, some publications indicate that this aberration was not predictive of response (S29).

TP53 mutations are reported to be associated with higher VEGF-A expression (p = 0.006) (S21).

46

Consistent with this association, retrospective data suggest that patients with TP53 mutations had longer progression-free survival with bevacizumab-containing regimens as compared to non-bevacizumab-containing regimens (median 11.0 versus 4.0 months [p < 0.0001]) (S22). In addition, TP53 may be targetable with a WEE1 inhibitor that is currently under clinical investigation (AZ1775 *, NCT01748825) (S23).


* Therapies currently on clinical trial.

47

SUPPLEMENTAL FIGURE LEGEND

Supplemental Figure 1. Comparison of RET aberrations between current report and cBioPortal.

From current report, diagnoses with RET aberrations were included in figure when RET was aberrant in ≥ 5% of cases and if at least 5 cancer diagnosis were tested for the aberration (Table 1).

From cBioPortal, all diagnoses with RET aberrations were included in the figure when RET was aberrant in ≥ 5% of cases (Supplemental Table 4).

In addition, when available, corresponding cancer diagnoses from both reports were included for comparison.

Cancer diagnosis with uterine carcinosarcoma, papillary thyroid carcinoma, ovarian epithelial carcinoma, lung adenocarcinoma, cutaneous squamous cell carcinoma, melanoma, bladder urothelial carcinoma and cholangiocarcinoma were available for direct comparison between current report and cBioPortal.

The following diagnoses were not available from cBioPortal dataset for the direct comparison with current report;

Medullary thyroid carcinoma Anaplastic thyroid carcinoma Lung carcinosarcoma Ureter urothelial carcinoma Basal cell carcinoma Merkel cell carcinoma Atypical lung carcinoid Fallopian tube adenocarcinoma Salivary gland adenocarcinoma Meningioma Duodenal adenocarcinoma

Papillary thyroid carcinoma from cBioPortal had N=2 with multiple RET aberrations (both cases had loss and fusion) which was not described in the figure.

SCC; squamous cell carcinoma.

48

Supplemental Figure 1. Comparison of RET aberrations between current report and cBioPortal.

49

Supplemental References: S1. Cuccuru G, Lanzi C, Cassinelli G, Pratesi G, Tortoreto M, Petrangolini G, et al. Cellular effects and antitumor activity of RET inhibitor RPI-1 on MEN2A-associated medullary thyroid carcinoma. J Natl Cancer Inst. 2004;96:1006-14.S2. Muzza M, Cordella D, Bombled J, Bressac-de Paillerets B, Guizzardi F, Francis Z, et al. Four novel RET germline variants in exons 8 and 11 display an oncogenic potential in vitro. Eur J Endocrinol. 2010;162:771-7.S3. Santoro M, Carlomagno F, Romano A, Bottaro DP, Dathan NA, Grieco M, et al. Activation of RET as a dominant transforming gene by germline mutations of MEN2A and MEN2B. Science. 1995;267:381-3.S4. Houvras Y. Completing the Arc: targeted inhibition of RET in medullary thyroid cancer. J Clin Oncol. 2012;30:200-2.S5. Garcia-Barcelo M, Sham MH, Lee WS, Lui VC, Chen BL, Wong KK, et al. Highly recurrent RET mutations and novel mutations in genes of the receptor tyrosine kinase and endothelin receptor B pathways in Chinese patients with sporadic Hirschsprung disease. Clin Chem. 2004;50:93-100.S6. Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet. 2013;Chapter 7:Unit7 20.S7. Starr JS, Attia S, Joseph RW, Menke D, Casler J, Smallridge RC. Follicular Dendritic Cell Sarcoma Presenting As a Thyroid Mass. J Clin Oncol. 2015;33:e74-6.S8. Saez ME, Ruiz A, Cebrian A, Morales F, Robledo M, Antinolo G, et al. A new germline mutation, R600Q, within the coding region of RET proto-oncogene: a rare polymorphism or a MEN 2 causing mutation? Hum Mutat. 2000;15:122.S9. Silva AL, Carmo F, Moura MM, Domingues R, Espadinha C, Leite V, et al. Identification and characterization of two novel germline RET variants associated with medullary thyroid carcinoma. Endocrine. 2015;49:366-72.S10. Kohno T, Tsuta K, Tsuchihara K, Nakaoku T, Yoh K, Goto K. RET fusion gene: translation to personalized lung cancer therapy. Cancer Sci. 2013;104:1396-400.S11. Wang R, Hu H, Pan Y, Li Y, Ye T, Li C, et al. RET fusions define a unique molecular and clinicopathologic subtype of non-small-cell lung cancer. J Clin Oncol. 2012;30:4352-9.S12. Kohno T, Ichikawa H, Totoki Y, Yasuda K, Hiramoto M, Nammo T, et al. KIF5B-RET fusions in lung adenocarcinoma. Nat Med. 2012;18:375-7.S13. Matsubara D, Kanai Y, Ishikawa S, Ohara S, Yoshimoto T, Sakatani T, et al. Identification of CCDC6-RET fusion in the human lung adenocarcinoma cell line, LC-2/ad. J Thorac Oncol. 2012;7:1872-6.S14. Bitler BG, Aird KM, Garipov A, Li H, Amatangelo M, Kossenkov AV, et al. Synthetic lethality by targeting EZH2 methyltransferase activity in ARID1A-mutated cancers. Nat Med. 2015;21:231-8.S15. Messersmith WA, Shapiro GI, Cleary JM, Jimeno A, Dasari A, Huang B, et al. A Phase I, dose-finding study in patients with advanced solid malignancies of the oral gamma-secretase inhibitor PF-03084014. Clin Cancer Res. 2015;21:60-7.S16. Tolcher AW, Messersmith WA, Mikulski SM, Papadopoulos KP, Kwak EL, Gibbon DG, et al. Phase I study of RO4929097, a gamma secretase inhibitor of Notch signaling, in patients with refractory metastatic or locally advanced solid tumors. J Clin Oncol. 2012;30:2348-53.S17. Bryant KL, Mancias JD, Kimmelman AC, Der CJ. KRAS: feeding pancreatic cancer proliferation. Trends Biochem Sci. 2014;39:91-100.S18. Infante JR, Fecher LA, Falchook GS, Nallapareddy S, Gordon MS, Becerra C, et al. Safety, pharmacokinetic, pharmacodynamic, and efficacy data for the oral MEK inhibitor trametinib: a phase 1 dose-escalation trial. Lancet Oncol. 2012;13:773-81.S19. Janku F, Hong DS, Fu S, Piha-Paul SA, Naing A, Falchook GS, et al. Assessing PIK3CA and PTEN in early-phase trials with PI3K/AKT/mTOR inhibitors. Cell Rep. 2014;6:377-87.S20. Janku F, Wheler JJ, Westin SN, Moulder SL, Naing A, Tsimberidou AM, et al. PI3K/AKT/mTOR inhibitors in patients with breast and gynecologic malignancies harboring PIK3CA mutations. J Clin Oncol. 2012;30:777-82.S21. Schwaederle M, Lazar V, Validire P, Hansson J, Lacroix L, Soria JC, et al. VEGF-A Expression Correlates with TP53 Mutations in Non-Small Cell Lung Cancer: Implications for Antiangiogenesis Therapy. Cancer Res. 2015;75:1187-90.S22. Said R, Hong DS, Warneke CL, Lee JJ, Wheler JJ, Janku F, et al. P53 mutations in advanced cancers: clinical characteristics, outcomes, and correlation between progression-free survival and bevacizumab-containing therapy. Oncotarget. 2013;4:705-14.S23. Mueller S, Haas-Kogan DA. WEE1 Kinase As a Target for Cancer Therapy. J Clin Oncol. 2015;33:3485-7.

50

S24. Iyer G, Hanrahan AJ, Milowsky MI, Al-Ahmadie H, Scott SN, Janakiraman M, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338:221.S25. Wu J, Savooji J, Liu D. Second- and third-generation ALK inhibitors for non-small cell lung cancer. J Hematol Oncol. 2016;9:19.S26. Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, et al. Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med. 2011;364:2507-16.S27. Falchook GS, Long GV, Kurzrock R, Kim KB, Arkenau TH, Brown MP, et al. Dabrafenib in patients with melanoma, untreated brain metastases, and other solid tumours: a phase 1 dose-escalation trial. Lancet. 2012;379:1893-901.S28. Sherr CJ, Beach D, Shapiro GI. Targeting CDK4 and CDK6: From Discovery to Therapy. Cancer Discov. 2016;6:353-67.S29. DeMichele A, Clark AS, Tan KS, Heitjan DF, Gramlich K, Gallagher M, et al. CDK 4/6 inhibitor palbociclib (PD0332991) in Rb+ advanced breast cancer: phase II activity, safety, and predictive biomarker assessment. Clin Cancer Res. 2015;21:995-1001.S30. Dedes KJ, Wilkerson PM, Wetterskog D, Weigelt B, Ashworth A, Reis-Filho JS. Synthetic lethality of PARP inhibition in cancers lacking BRCA1 and BRCA2 mutations. Cell Cycle. 2011;10:1192-9.S31. Michels J, Vitale I, Saparbaev M, Castedo M, Kroemer G. Predictive biomarkers for cancer therapy with PARP inhibitors. Oncogene. 2014;33:3894-907.S32. Harry BL, Eckhardt SG, Jimeno A. JAK2 inhibition for the treatment of hematologic and solid malignancies. Expert Opin Investig Drugs. 2012;21:637-55.S33. Weston VJ, Oldreive CE, Skowronska A, Oscier DG, Pratt G, Dyer MJ, et al. The PARP inhibitor olaparib induces significant killing of ATM-deficient lymphoid tumor cells in vitro and in vivo. Blood. 2010;116:4578-87.S34. Hammerman PS, Sos ML, Ramos AH, Xu C, Dutt A, Zhou W, et al. Mutations in the DDR2 kinase gene identify a novel therapeutic target in squamous cell lung cancer. Cancer Discov. 2011;1:78-89.S35. Oshima M, Dinchuk JE, Kargman SL, Oshima H, Hancock B, Kwong E, et al. Suppression of intestinal polyposis in Apc delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell. 1996;87:803-9.S36. Bertagnolli MM, Eagle CJ, Zauber AG, Redston M, Solomon SD, Kim K, et al. Celecoxib for the prevention of sporadic colorectal adenomas. N Engl J Med. 2006;355:873-84.S37. Tai WT, Shiau CW, Chen HL, Liu CY, Lin CS, Cheng AL, et al. Mcl-1-dependent activation of Beclin 1 mediates autophagic cell death induced by sorafenib and SC-59 in hepatocellular carcinoma cells. Cell Death Dis. 2013;4:e485.S38. Yang D, Liu H, Goga A, Kim S, Yuneva M, Bishop JM. Therapeutic potential of a synthetic lethal interaction between the MYC proto-oncogene and inhibition of aurora-B kinase. Proc Natl Acad Sci U S A. 2010;107:13836-41.S39. Goga A, Yang D, Tward AD, Morgan DO, Bishop JM. Inhibition of CDK1 as a potential therapy for tumors over-expressing MYC. Nat Med. 2007;13:820-7.S40. Delmore JE, Issa GC, Lemieux ME, Rahl PB, Shi J, Jacobs HM, et al. BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Cell. 2011;146:904-17.S41. Massague J, Seoane J, Wotton D. Smad transcription factors. Genes Dev. 2005;19:2783-810.S42. Moulder S, Helgason T, Janku F, Wheler J, Moroney J, Booser D, et al. Inhibition of the phosphoinositide 3-kinase pathway for the treatment of patients with metastatic metaplastic breast cancer. Ann Oncol. 2015;26:1346-52.S43. Subbiah V, Slopis J, Hong DS, Ketonen LM, Hamilton J, McCutcheon IE, et al. Treatment of patients with advanced neurofibromatosis type 2 with novel molecularly targeted therapies: from bench to bedside. J Clin Oncol. 2012;30:e64-8.S44. Guo J, Si L, Kong Y, Flaherty KT, Xu X, Zhu Y, et al. Phase II, open-label, single-arm trial of imatinib mesylate in patients with metastatic melanoma harboring c-Kit mutation or amplification. J Clin Oncol. 2011;29:2904-9.S45. Boyd AW, Bartlett PF, Lackmann M. Therapeutic targeting of EPH receptors and their ligands. Nat Rev Drug Discov. 2014;13:39-62.S46. Dudley JC, Lin MT, Le DT, Eshleman JR. Microsatellite Instability as a Biomarker for PD-1 Blockade. Clin Cancer Res. 2016;22:813-20.S47. Boumahdi S, Driessens G, Lapouge G, Rorive S, Nassar D, Le Mercier M, et al. SOX2 controls tumour initiation and cancer stem-cell functions in squamous-cell carcinoma. Nature. 2014;511:246-50.S48. Mao JH, Kim IJ, Wu D, Climent J, Kang HC, DelRosario R, et al. FBXW7 targets mTOR for degradation and cooperates with PTEN in tumor suppression. Science. 2008;321:1499-502.

51

S49. LoRusso PM, Rudin CM, Reddy JC, Tibes R, Weiss GJ, Borad MJ, et al. Phase I trial of hedgehog pathway inhibitor vismodegib (GDC-0449) in patients with refractory, locally advanced or metastatic solid tumors. Clin Cancer Res. 2011;17:2502-11.S50. Migden MR, Guminski A, Gutzmer R, Dirix L, Lewis KD, Combemale P, et al. Treatment with two different doses of sonidegib in patients with locally advanced or metastatic basal cell carcinoma (BOLT): a multicentre, randomised, double-blind phase 2 trial. Lancet Oncol. 2015;16:716-28.S51. Lachenmayer A, Alsinet C, Savic R, Cabellos L, Toffanin S, Hoshida Y, et al. Wnt-pathway activation in two molecular classes of hepatocellular carcinoma and experimental modulation by sorafenib. Clin Cancer Res. 2012;18:4997-5007.S52. Li N, Xi Y, Tinsley HN, Gurpinar E, Gary BD, Zhu B, et al. Sulindac selectively inhibits colon tumor cell growth by activating the cGMP/PKG pathway to suppress Wnt/beta-catenin signaling. Mol Cancer Ther. 2013;12:1848-59.S53. Rodilla V, Villanueva A, Obrador-Hevia A, Robert-Moreno A, Fernandez-Majada V, Grilli A, et al. Jagged1 is the pathological link between Wnt and Notch pathways in colorectal cancer. Proc Natl Acad Sci U S A. 2009;106:6315-20.S54. Gounder MM, Lefkowitz RA, Keohan ML, D'Adamo DR, Hameed M, Antonescu CR, et al. Activity of Sorafenib against desmoid tumor/deep fibromatosis. Clin Cancer Res. 2011;17:4082-90.S55. Hansmann A, Adolph C, Vogel T, Unger A, Moeslein G. High-dose tamoxifen and sulindac as first-line treatment for desmoid tumors. Cancer. 2004;100:612-20.S56. Le Guellec S, Soubeyran I, Rochaix P, Filleron T, Neuville A, Hostein I, et al. CTNNB1 mutation analysis is a useful tool for the diagnosis of desmoid tumors: a study of 260 desmoid tumors and 191 potential morphologic mimics. Mod Pathol. 2012;25:1551-8.S57. Yakes FM, Chen J, Tan J, Yamaguchi K, Shi Y, Yu P, et al. Cabozantinib (XL184), a novel MET and VEGFR2 inhibitor, simultaneously suppresses metastasis, angiogenesis, and tumor growth. Mol Cancer Ther. 2011;10:2298-308.S58. Corless CL, Schroeder A, Griffith D, Town A, McGreevey L, Harrell P, et al. PDGFRA mutations in gastrointestinal stromal tumors: frequency, spectrum and in vitro sensitivity to imatinib. J Clin Oncol. 2005;23:5357-64.S59. Dewaele B, Wasag B, Cools J, Sciot R, Prenen H, Vandenberghe P, et al. Activity of dasatinib, a dual SRC/ABL kinase inhibitor, and IPI-504, a heat shock protein 90 inhibitor, against gastrointestinal stromal tumor-associated PDGFRAD842V mutation. Clin Cancer Res. 2008;14:5749-58.S60. Wilhelm SM, Adnane L, Newell P, Villanueva A, Llovet JM, Lynch M. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol Cancer Ther. 2008;7:3129-40.S61. Cheung LW, Hennessy BT, Li J, Yu S, Myers AP, Djordjevic B, et al. High frequency of PIK3R1 and PIK3R2 mutations in endometrial cancer elucidates a novel mechanism for regulation of PTEN protein stability. Cancer Discov. 2011;1:170-85.S62. Greulich H, Kaplan B, Mertins P, Chen TH, Tanaka KE, Yun CH, et al. Functional analysis of receptor tyrosine kinase mutations in lung cancer identifies oncogenic extracellular domain mutations of ERBB2. Proc Natl Acad Sci U S A. 2012;109:14476-81.S63. Shaw AT, Hsu PP, Awad MM, Engelman JA. Tyrosine kinase gene rearrangements in epithelial malignancies. Nat Rev Cancer. 2013;13:772-87.S64. Nissan MH, Pratilas CA, Jones AM, Ramirez R, Won H, Liu C, et al. Loss of NF1 in cutaneous melanoma is associated with RAS activation and MEK dependence. Cancer Res. 2014;74:2340-50.S65. Etemadmoghadam D, Weir BA, Au-Yeung G, Alsop K, Mitchell G, George J, et al. Synthetic lethality between CCNE1 amplification and loss of BRCA1. Proc Natl Acad Sci U S A. 2013;110:19489-94.S66. Tada Y, Brena RM, Hackanson B, Morrison C, Otterson GA, Plass C. Epigenetic modulation of tumor suppressor CCAAT/enhancer binding protein alpha activity in lung cancer. J Natl Cancer Inst. 2006;98:396-406.S67. Oike T, Ogiwara H, Tominaga Y, Ito K, Ando O, Tsuta K, et al. A synthetic lethality-based strategy to treat cancers harboring a genetic deficiency in the chromatin remodeling factor BRG1. Cancer Res. 2013;73:5508-18.S68. Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, et al. ABT-263: a potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res. 2008;68:3421-8.S69. Graziano F, Humar B, Guilford P. The role of the E-cadherin gene (CDH1) in diffuse gastric cancer susceptibility: from the laboratory to clinical practice. Ann Oncol. 2003;14:1705-13.S70. Gray-Schopfer V, Wellbrock C, Marais R. Melanoma biology and new targeted therapy. Nature. 2007;445:851-7.

52

S71. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, et al. Suppression of lung adenocarcinoma progression by Nkx2-1. Nature. 2011;473:101-4.S72. Laurent-Puig P, Cayre A, Manceau G, Buc E, Bachet JB, Lecomte T, et al. Analysis of PTEN, BRAF, and EGFR status in determining benefit from cetuximab therapy in wild-type KRAS metastatic colon cancer. J Clin Oncol. 2009;27:5924-30.S73. Klumpen HJ, Queiroz KC, Spek CA, van Noesel CJ, Brink HC, de Leng WW, et al. mTOR inhibitor treatment of pancreatic cancer in a patient With Peutz-Jeghers syndrome. J Clin Oncol. 2011;29:e150-3.S74. Breuleux M, Klopfenstein M, Stephan C, Doughty CA, Barys L, Maira SM, et al. Increased AKT S473 phosphorylation after mTORC1 inhibition is rictor dependent and does not predict tumor cell response to PI3K/mTOR inhibition. Mol Cancer Ther. 2009;8:742-53.S75. Tutt A, Robson M, Garber JE, Domchek SM, Audeh MW, Weitzel JN, et al. Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet. 2010;376:235-44.S76. Falchook GS, Bastida CC, Kurzrock R. Aurora Kinase Inhibitors in Oncology Clinical Trials: Current State of the Progress. Semin Oncol. 2015;42:832-48.S77. Baud V, Karin M. Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nat Rev Drug Discov. 2009;8:33-40.S78. Hyman DM, Puzanov I, Subbiah V, Faris JE, Chau I, Blay JY, et al. Vemurafenib in Multiple Nonmelanoma Cancers with BRAF V600 Mutations. N Engl J Med. 2015;373:726-36.S79. Zheng G, Tseng LH, Chen G, Haley L, Illei P, Gocke CD, et al. Clinical detection and categorization of uncommon and concomitant mutations involving BRAF. BMC Cancer. 2015;15:779.S80. Vleugel MM, Greijer AE, Bos R, van der Wall E, van Diest PJ. c-Jun activation is associated with proliferation and angiogenesis in invasive breast cancer. Hum Pathol. 2006;37:668-74.S81. Shaw LM. Identification of insulin receptor substrate 1 (IRS-1) and IRS-2 as signaling intermediates in the alpha6beta4 integrin-dependent activation of phosphoinositide 3-OH kinase and promotion of invasion. Mol Cell Biol. 2001;21:5082-93.S82. Wheler JJ, Moulder SL, Naing A, Janku F, Piha-Paul SA, Falchook GS, et al. Anastrozole and everolimus in advanced gynecologic and breast malignancies: activity and molecular alterations in the PI3K/AKT/mTOR pathway. Oncotarget. 2014;5:3029-38.S83. Kim C, Tang G, Pogue-Geile KL, Costantino JP, Baehner FL, Baker J, et al. Estrogen receptor (ESR1) mRNA expression and benefit from tamoxifen in the treatment and prevention of estrogen receptor-positive breast cancer. J Clin Oncol. 2011;29:4160-7.S84. Bouffet E, Larouche V, Campbell BB, Merico D, de Borja R, Aronson M, et al. Immune Checkpoint Inhibition for Hypermutant Glioblastoma Multiforme Resulting From Germline Biallelic Mismatch Repair Deficiency. J Clin Oncol. 2016.S85. Cowin PA, George J, Fereday S, Loehrer E, Van Loo P, Cullinane C, et al. LRP1B deletion in high-grade serous ovarian cancers is associated with acquired chemotherapy resistance to liposomal doxorubicin. Cancer Res. 2012;72:4060-73.S86. Itzykson R, Kosmider O, Cluzeau T, Mansat-De Mas V, Dreyfus F, Beyne-Rauzy O, et al. Impact of TET2 mutations on response rate to azacitidine in myelodysplastic syndromes and low blast count acute myeloid leukemias. Leukemia. 2011;25:1147-52.S87. Kim YH, Kwei KA, Girard L, Salari K, Kao J, Pacyna-Gengelbach M, et al. Genomic and functional analysis identifies CRKL as an oncogene amplified in lung cancer. Oncogene. 2010;29:1421-30.S88. Mateo J, Carreira S, Sandhu S, Miranda S, Mossop H, Perez-Lopez R, et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. N Engl J Med. 2015;373:1697-708.S89. Montero JC, Seoane S, Ocana A, Pandiella A. Inhibition of SRC family kinases and receptor tyrosine kinases by dasatinib: possible combinations in solid tumors. Clin Cancer Res. 2011;17:5546-52.S90. Rasheed ZA, Rubin EH. Mechanisms of resistance to topoisomerase I-targeting drugs. Oncogene. 2003;22:7296-304.S91. Hutchinson KE, Lipson D, Stephens PJ, Otto G, Lehmann BD, Lyle PL, et al. BRAF fusions define a distinct molecular subset of melanomas with potential sensitivity to MEK inhibition. Clin Cancer Res. 2013;19:6696-702.S92. Lunning MA, Green MR. Mutation of chromatin modifiers; an emerging hallmark of germinal center B-cell lymphomas. Blood Cancer J. 2015;5:e361.S93. Zhang W, Konopleva M, Shi YX, McQueen T, Harris D, Ling X, et al. Mutant FLT3: a direct target of sorafenib in acute myelogenous leukemia. J Natl Cancer Inst. 2008;100:184-98.S94. Stacker SA, Williams SP, Karnezis T, Shayan R, Fox SB, Achen MG. Lymphangiogenesis and lymphatic vessel remodelling in cancer. Nat Rev Cancer. 2014;14:159-72.

53

S95. David M, Cross NC, Burgstaller S, Chase A, Curtis C, Dang R, et al. Durable responses to imatinib in patients with PDGFRB fusion gene-positive and BCR-ABL-negative chronic myeloproliferative disorders. Blood. 2007;109:61-4.S96. Giles FJ, O'Dwyer M, Swords R. Class effects of tyrosine kinase inhibitors in the treatment of chronic myeloid leukemia. Leukemia. 2009;23:1698-707.S97. Lierman E, Lahortiga I, Van Miegroet H, Mentens N, Marynen P, Cools J. The ability of sorafenib to inhibit oncogenic PDGFRbeta and FLT3 mutants and overcome resistance to other small molecule inhibitors. Haematologica. 2007;92:27-34.S98. Grabiner BC, Nardi V, Birsoy K, Possemato R, Shen K, Sinha S, et al. A diverse array of cancer-associated MTOR mutations are hyperactivating and can predict rapamycin sensitivity. Cancer Discov. 2014;4:554-63.

54

Supplemental MethodsData from cBio Cancer Genomics Portal (cBioPortal) was obtained from http://cbioportal.org to investigate RET aberrations among diverse cancer type and to compare with current study (accessed on 5/25/2016).

Following datasets from cBioPortal were used with URL listed below:

1.Adenoid Cystic Carcinoma (MSKCC, Nat Genet 2013)http://bit.ly/1WOp4sC

2.Adrenocortical Carcinoma (TCGA, Provisional)http://bit.ly/1WMY9gM

3.Bladder Urothelial Carcinoma (TCGA, Nature 2014)http://bit.ly/1qHM9PZ

4.Breast Invasive Carcinoma (TCGA, Cell 2015)http://bit.ly/1qHN4A1

5.Cholangiocarcinoma (TCGA, Provisional)http://bit.ly/1WOoLya

6.Clear Cell Renal Cell Carcinoma (U Tokyo, Nat Genet 2013) * http://bit.ly/1szPK3O

7.Colorectal Adenocarcinoma (TCGA, Nature 2012)http://bit.ly/1qHMCl6

8.Cutaneous squamous cell carcinoma (DFCI, Clin Cancer Res 2015)http://bit.ly/1qHK0nx

9.Esophageal Carcinoma (TCGA, Provisional)http://bit.ly/1qHLkqm

10. Esophageal Squamous Cell Carcinoma (UCLA, Nat Genet 2014) * http://bit.ly/1WOpfUW

11. Gallbladder Carcinoma (Shanghai, Nat Genet 2014) * http://bit.ly/1szPYYH

12. Glioblastoma (TCGA, Cell 2013)http://bit.ly/1WOpJdC

13. Head and Neck Squamous Cell Carcinoma (TCGA, Nature 2015)http://bit.ly/1qHMWAl

14. Liver Hepatocellular Carcinoma (TCGA, Provisional)http://bit.ly/1qHL2zC

15. Lung Adenocarcinoma (TCGA, Nature 2014)http://bit.ly/1qHJaXF

16. Lung Squamous Cell Carcinoma (TCGA, Nature 2012)

55

http://bit.ly/1szPYYH

http://bit.ly/1WOpfUW

http://bit.ly/1WOoLya

http://bit.ly/1WMZILL

17. Mesothelioma (TCGA, Provisional)http://bit.ly/1szPPEI

18. Neuroblastoma (AMC Amsterdam, Nature 2012) *

http://bit.ly/1WOpY8L

19. Ovarian Serous Cystadenocarcinoma (TCGA, Nature 2011)http://bit.ly/1qHJhm0

20. Pancreatic Adenocarcinoma (TCGA, Provisional)http://bit.ly/1WMYosd

21. Pancreatic Neuroendocrine Tumors (Johns Hopkins University, Science 2011)*

http://bit.ly/1szQ56v

22. Papillary Thyroid Carcinoma (TCGA, Cell 2014)http://bit.ly/1XCRIMY

23. Pheochromocytoma and Paraganglioma (TCGA, Provisional)http://bit.ly/1qx0azV

24. Poorly-Differentiated and Anaplastic Thyroid Cancers (MSKCC, JCI 2016)http://bit.ly/1qx1Glz

25. Prostate Adenocarcinoma (TCGA, Cell 2015)http://bit.ly/1qHKSsa

26. Sarcoma (TCGA, Provisional)http://bit.ly/1WN0oAP

27. Skin Cutaneous Melanoma (TCGA, Provisional)http://bit.ly/1WMZfsW

28. Small Cell Lung Cancer (U Cologne, Nature 2015) * http://bit.ly/1WOqRhi

29. Stomach Adenocarcinoma (TCGA, Nature 2014)http://bit.ly/1WN0c4B

30. Uterine Carcinosarcoma (TCGA, Provisional)http://bit.ly/1qx2syY

31. Uterine Corpus Endometrioid Carcinoma (TCGA, Nature 2013) http://bit.ly/1WMZGUc

* Data were available for mutation only.

56

http://bit.ly/1qx2syY

http://bit.ly/1WN0oAP

http://bit.ly/1qHKSsa

http://bit.ly/1qx1Glz

http://bit.ly/1qx0azV

http://bit.ly/1WMYosd

Documents

clincancerres.aacrjournals.org · Web viewIn a preclinical study using hepatocellular carcinoma cell lines, sorafenib was shown to inhibit Wnt/β-catenin signaling (S51). In addition,