18
KENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION EXAMINATION SUB.: BIOLOGY CLASS: XII TIME 3 HRS M.M : 70 1. This question paper contains total four (4) pages. 2. There are total 26 questions and 5 sections in the question paper. All questions are compulsory. 3. Section A contains question number 1 to 5 of one mark each. 4. Section B contains question number 6 to 10 of two marks each. 5. Section C contain question number 11 to 22 of three marks each. 6. Section D contain question number 23[VBQ] of four marks. 7. Section E contains question number 24 to 26 of five marks each. 8. There is no overall choice, however internal choice is provided in one question of two marks, one question of three marks and all the three questions of five marks. 9. Wherever necessary, the diagrams drawn should be neat and properly labelled. SECTION-A Q-1. The base sequence of an mRNA is: UAUCUAUCUAUCUAUCUAUCUAUC How many types of amino acid will be coded by the above mRNA? Q-2. How is Agrobacterium tumefaciens considered useful in Biotechnology?

mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

  • Upload
    others

  • View
    11

  • Download
    0

Embed Size (px)

Citation preview

Page 1: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

KENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGIONEXAMINATIONSUB.: BIOLOGY

CLASS: XIITIME 3 HRS M.M : 70

1. This question paper contains total four (4) pages.

2. There are total 26 questions and 5 sections in the question paper. All questions are compulsory.

3. Section A contains question number 1 to 5 of one mark each.

4. Section B contains question number 6 to 10 of two marks each.

5. Section C contain question number 11 to 22 of three marks each.

6. Section D contain question number 23[VBQ] of four marks.

7. Section E contains question number 24 to 26 of five marks each.

8. There is no overall choice, however internal choice is provided in one question of two marks, one question of three marks and all the three questions of five marks.

9. Wherever necessary, the diagrams drawn should be neat and properly labelled.

SECTION-A

Q-1. The base sequence of an mRNA is: UAUCUAUCUAUCUAUCUAUCUAUCHow many types of amino acid will be coded by the above mRNA?

Q-2. How is Agrobacterium tumefaciens considered useful in Biotechnology?

Q-3. In which technique do we use Taq polymerase enzyme and why?

Q-4. Name the bacterium that forms large holes in “swiss cheese”?

Q-5. How is the action of normal endonuclease enzyme different from that of restriction endonuclease?

Page 2: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

SECTION-B

Q-6. Expand MTP. Why are MTPs carried out?

Q-7. Write the names of casual organism of the following: 1] Typhoid [2} Pneumonia [3] Filariasis [4] Amoebiasis

Q-8. A] The flower of brinjal is referred to as Chasmogamous while that of beans is Cleistogamous. How are they different from each other?

B] Mention the reason for difference in ploidy of zygote and primary endosperm nucleus in an angiosperm.

OR

Name the organic materials the exine and intine of an angiosperm pollen grain are made up of. Explain the role of exine?

Q-9. What are exotic species? Explain with the help of two examples, how exotic species disturb the native species of an ecosystem?

Q-10. How did Eli Lilly synthesize the human insulin? Mention one difference between this Insulin and the one produced by human pancreas?

SECTION-CQ-11. What do the following parts form in a fruit: a] Zygote b] Primary endosperm nucleus c] Ovule d] Ovary wall e] Outer integument f] inner integument.

Q-12. When a cross is made between tall plant with yellow seed [heterozyous] and tall plant [heterozyous] with green seeds. What proportion of phenotype in the offspring could be expected to be: a] tall and green [b] dwarf and green. Represent it by a cross.

Q-13. Explain Miller’s experiment to prove the “theory of chemical origin of life” as Proposed by Oparin and Haldane.

Q-14. What is innate and acquired irmnunity? Explain four types of barriers of innate immunity? Q.15. What is population density? What are the factors that contribute to population density?

Q-16. What are the three complexities involved in transcription of Eukaryotic DNA?

Q-17. Microbes play a dual role when used for sewage treatment as they not only help to retrieve usable water but also generate fuel. Explain.

Page 3: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

Q-18. Unambiguous, Universal, Degenarate are some of the features of the genetic code. Explain each of them.

OR

What does the Lac-operon consist of? Draw a schematic labelled illustration of Lac-operon in a “switched on” and “switched off” state.

Q-19. Amniocentesis for sex determination is banned in our country, is this ban necessary. If yes, give reasons.

Q-20. How many sperms and eggs will be formed from 200 spermatogonia and oogonia respectively? Also distinguish between spermiogenesis and spermiationWhat is the role of acrosome in fertilization?

Q-21. A] Describe the characteristics that a cloning vector must possess.

B] Why DNA cannot pass through the cell membrane? How a bacterial cell is made “Competent” to take up recombinant DNA from the medium.

Q-22. Explain Biomagnification of DDT in an aquatic food chain. How does it affect the bird population?

SECTION-D

Q-23. On world population day, Raman and his friend arranged an awareness programme on ‘lmpact of increase in population and methods of population control’ in their locality. Some narrow minded people rebuked the children and asked them not to talk on such things in public. The children convinced the elders the need for the programme and on understanding their point of view, they also joined the campaign.

a] What values did the elderly people and Raman show on the occasion? b] Why is such awareness programme necessary. c] What role has the government played in controlling population explosion.

SECTION-E

Q-24. A) Inheritance pattern of flower colour in garden pea plant and snapdragon differ. Explain the difference with the help of cross. B). Define Pleiotropy with one example.

ORA] How does the Hardy-Weinberg’s expression explain genetic equilibrium? B] List four factors that can disturb the genetic equilibrium. C] How do Darwin’s finches illustrate adaptive radiation?

Page 4: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

Q-25. Plant breeding programme are carried out in a systematic way worldwide. Explain the main steps in plant breeding to create a new variety of crop.

OR A] Write the sources and the effects of the following drugs on human body. 1] Morphine 2] Cocaine 3] Marijuana.

B] i] Cancer is one of the most dreaded disease of human. Explain “contact inhibition and metastasis. ii) Name any two techniques which are useful to detect cancer of internal organs iii) Why are cancer patients often given alpha -interferon?

Q-26. What is Genetic Biodiversity? Describe the different causes of loss of Biodiversity.

OR

A] Explain why ecological succession will be faster in a forest devastated by fire than on a bare rock. Also compare succession in case of an abandoned land alter floods with that of bare rock.

B] Explain primary productivity and the factors that influence it.

Page 5: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

KENDRIYA VlDYALAYA SANGATHANMARKING SCHEME CLASS XII [BIOLOGY]

Q. No.

SUGGESTlVE ANSWER MARKS

ANS1

Four types. 1

2 The tumor causing gene in the bacteria can be substituted with gene of interest and introduced into plants

1

3 Polymerase chain reaction. Because it is thermostable DNA polymerase enzyme gets isolated from bacteria Thermusaquaticus.

½+1/2=1

4 Propionibacteriasharmanii. 15 Normal endonuclease -make cut at random position within

DNA. Restriction endonuclease-cut only at specific site. ½+1/2=1

6 Medical termination of pregnancy.They are carried out to get rid of unwanted pregnancy either due to casual unprotected intercourse or failure of contraceptive used during coitus or rapes.

1+1=2

7 A]Salmonella typhii B] Streptococcus pneumonia C] Wuchereria bancrofti and wuchereria Malaya D] Entamoebahistolytica

8. A] Flowers of brinjol-where anthers and stigma are exposed.

½+1/2+1/2+1/2=2

8 A] Flower of beans---remain closed to ensure self pollination. B] Zygote is formed by syngamy so diploid. PEN is formed by the fusion of secondary diploid nucleus with one of the male gamete so triploid in nature.

ORExine-Sporopollenin. lntine--cellulose and pectin. Exine is made of most resistant organic material. lt can withstand high temp. and PH.

½ +1/2=1

½+1/2=1

½+1/2=11

9 Species that have been introduced from another geographic region to an area outside its natural range. Eg. 1. Parthenium lantana and Eicchornia are the exotic species of plant that have invaded the native species of India and caused environmental damage. 2. Introduction of African catfish Clarias gariepinus for aquaculture purpose is posing threat to many indigenous catfish. 3. Nile perch introduced into Lake Victoria in East Africa lead to the extinction of Cichlid fish.

2

10 Eli Lilly company prepared two DNA sequence coding for chain A and Bof human insulin and introduced it into the plasmid of E. coli, l which was used to produce insulin. , insulin from animal source caused allergy in some patient. ln humans insulin is systhesized as a prohormone which has extra 3 g

2

Page 6: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

stretch called C-peptide. 11. A] embryo b] endosperm c] seed d] pericarp eJ testa f] tegmen 1/2X6=312. TtYyxTtyy TY TyTyty x Ty ty ½+1 ½ +1=3

Ty TyTTYy TtYyTTyy TtyyTtYy ttYyTtyy Ttyy

Phenotype: Tall & yellow=3 Tall & green=3Dwarf &green=1 Dwarf & yellow=1 PROPORTION OF TALL AND GREEN is 3/8 PROPORTION OF DWARF AND GREEN is 1/8

13. Urey and Miller experiment:Stanley Miller and Harold C. Urey in 1953 tested the Oparin-Haldane theory. They made an apparatus to circulate methane, ammonia, water vapour and hydrogen gases. All these gases were put in a flask fitted with electrodes. In another flask, water was being boiled continuously. The electrical charges, to provide energy similar to lightening etc. were passed for one week or more. After that they collected and analysed the contents of the apparatus. He was able to get a number of amino acids, some of which are known to be present in the proteins e.g., glycine, alanine, aspartic acid and glutamic acid. Miller also got several of the simple acids that are known to occur in the living organisms such formic acid, acetic acid, propionic acid, lactic acid and succinic acid. Hence they proved the Oparin and Haldane theory and now it is clear that reducing atmosphere was essential for such abiotic synthesis.

1 ½ + 1 ½ =3

Page 7: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

14. lnnate immunity ---Non-specific, defence present since birth. Acquired immunity---The immunity developed by an animal in response to a disease caused by infection of microbes. It is specific 4 types of barriers l] Physical-skin ii]Physiological-acid in the stomach, saliva in the mouth iii]CelluIar---PMNL-Neutrophils 7 monocyte iv]Cytokine-virus infected cells secrete protein called interferons which protect non infected cells from further viral infection.

½ + ½ =1

1/2x4=2

15. Definition. ‘The density of a population in a given habitat during a given period fluctuates due to four basic processes: Natality, Mortality, Immigration, Emigration. Explain each one.

½ ½+5=21/2[3]

16. A] There are 3 RNA polymerase in the nucleus. The RNA polymerase 1 transcribe rRNAs whereas the RNA polymerase ii transcribe precursor of mRNA the hnRNA. RNA polymerase iii is responsible for transcription of tRNAsrRNA& snRNA.B] The primary transcripts Contains both the exon and the introns and are nonfunctional. Hence, it is subjected to a process of splicing. C] hnRNA undergoes additional processing called as capping and tailing

1+1+1=3

17. 1] Microbes naturally present in the sewage are employed in the secondary treatment of the sewage. 2] The effluent from the prim. Treatment is passed into the aeration tanks. 3] Rapid growth of aerobic microbes into flocs which consume org. matter and reduce the BOD. 4} Then the effluent is passed into the settling tank where the

1/2X6=3

Page 8: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

flocs are allowed to sediment forming the activated sludge. 5] Major parts of this activated sludge is pumped into anaerobic sludge digesters. 6] During this digestion bacteria produces a mixture of gases like methane,H2S and carbon-di-oxide which form biogas.

18. Unambiguous code means that one code codes for only one amino acid. Universal means that codon and its corresponding amino acid are the same in all organism. Degenerate code means that same amino acid are coded by more than one codon eg. UUU and UUC code for phenylalanine.

ORThe Lac operon: Jacob and Monod (1961) proposed a model of gene regulation, known as operon model. Operon is a co-ordinated group of genes such as structural genes, operator genes, promoter genes, regulater genes and repressor which function or transcribed together and regulate a metabolic pathway as a unit. There are three structural genes, lac Z, lac Y and lac A, coding for galactosidase, permease and transacetylase respectively. These three genes are controlled by a single switch called operator. The operator switch is controlled by the repressor protein which coded by the regulator gene. When the repressor binds to the operator, the genes are not expressed (switched off). When the operator switch is on, the three structural genes transcribe a long polycistronic mRNA catalysed by RNA – polymerase. A few molecules of lactose (inducer) enter the cell by the action o enzyme permease. They are converted into an active form of lactose which binds to the repressor and changes its configuration and prevents it from binding to the operator. Beta-galactosidase breaks lactose into glucose and galactose.

1+1+1=3

Page 9: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

19. Yes. If the sex of the foetus is known it leads to female foeticide. It is illegal.

1+1+1=3

20. 800 sperms, 200 eggs Difference Role of acrosome

111

21. A] l. Origin of replication. [ii] Selective marker [iii] Recognition site for the restriction enzyme to recognize. B] DNA is a hydrophilic molecule, therefore cannot pass through the cell membrane. The bacterial cells can be made competent by treating them with specific concentration of a divalent ion like calcium. The cell are then incubated on ice followed by a heat shock by placing at 42degree centigrade and then putting back on ice.

1 ½ + 1 ½ =3

22. I] 1 ½ + 1 ½ =3

Page 10: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

Ii] DDT conc. disturb Ca++ metabolism, egg shells become thin, premature breaking resulting in decline in bird population.

23. A] Understanding, team work, motivational capacity.B] To understand the problem faced by family and the nation.C] Public awareness-mass media, education at all levels, family planning, increasing marriageable age.

1+1+2=4

24. A) Law of Dominance and incomplete dominance to be explained.

Example of pea flower and snapdragon .VV X vv RR X rr

Make cross and write its phenotypic and genotypic ratio. B) Definition with example

ORA]

1 ½ +1 ½+=3

1+1=2

1 ½ ½ X4=2

1 ½

Page 11: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

B] FACTORS: [l]Gene migration or gene flow. [ii]Genetic drift. [iii]Mutation. [iv] Natural selection. [v]Genetic recombination, [any 4] C]

25. Plant breeding is the purposeful manipulation of plant species in order to create desired plant types that is better suited for cultivation give better yield and are disease resistant. FIVE STEPS: l} Collection of variability. [ii] evaluation& selection of parents. [iii] cross hybridization among the selected parents. [iv] selection and testing of superior recombinants. [v] testing, release and commercialization of new cultivators.

ORA]Morphine-poppy plant -paparversomniferum. It binds to specific opoidreceptor present in CNS &gastrointestinal track. Cocaine-coca plant-Erythroxylum coca. lt interferes with the transport of neurotransmitter. Marijuana-cannabis indica. It affects the cardiovascular system of the body. B] I] Contact inhibition is the property of normal cell, in which contact with other cell inhibits their uncontrolled growth. Metastasis is the property in which tumor cells reach distant sites so the body through blood. Ii]biopsy/radiography/CY/MRI

5

2+1 ½ +1 ½ =5

1+1+1=3

½ +1/2 =1

½ +1/2=1

Page 12: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

III]Activates immune system and destroy the tumor.26. Genetic diversity: A single species might show high diversity at

the genetic level. Its distributional range. The genetic variation shown by the medicinal plant Rauwolfoia oomitonia in different Himalayan ranges might be in terms or the potency and concentration or the active chemical (reserpine) that the plant produces. India has more than 50,000 genetically different strains or rice, and 1,000 Varieties or mango.

The world is facing accelerated rate of speciesextinction largely due to human activities. Thereare four major causes called 'The evil quartet'.(i) Habitat loss and fragmentation :Urbanisation, industrialization, clearingforest for agriculture, filling wetlands,caused extinction of endemic species.(ii) Over exploitation : Causing reduction tosize of its population so that it becomesvulnerable to extinction.(iii) Alien species invasions : Non-nativespecies introduced for economic and otheruses, invaded and drive away the localspecies. Exotic/alien species have provedharmfuI to both aquatic and terrestrialecosystem.(iv) Co-extinction : Certain obligatorymutualistic relationships exist in nature.Extinction of one will automatically causeextinction of other. For example, if the hostfish becomes extinct all the parasitesexclusively found in it will also becomeextinct.

ORA] If succession occur in an area devoid of life is termed as primary succession, on the other hand, if succession occur in an area where natural or man-made causes have resulted in destruction but area still has organic matter, then it is termed as sec. successionPrimary succession on a bare rock is very slow as establishment of new communities is a slow process and formation of soil takes several hundred yrs. On other hand, in areas where natural biotic communities have been destroyed e.g. forest after fire or abandoned land after floods succession is faster. It is so because such areas still have soil and sediment rich in org. matter. B] Primary productivity is defined as the amount of biomass produced per unit area over a time period by plants during photosynthesis. Explain gross primary

1

1+1+1+1=4

2+1 ½ +1 ½=5

Page 13: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

productivity, net primary productivity.FACTORS: [Any 3] Primary productivity depends on the plant species inhibiting a particular area. Environmental factor. Availability of nutrient.Photosynthetic capacity of plant.

BIOLOGY CLASS XII

UNIT WISE WEIGHTAGE

Page 14: mmrlakshmi.files.wordpress.com  · Web viewKENDRIYA VIDYALAYA SANGATHAN, MUMBAI REGION. EXAMINATION. SUB.: BIOLOGY. CLASS: XII. TIME 3 HRS M.M : 70 . 1. This question paper contains

Unit

Title Marks

1. Reproduction 142. Genetics and evolution 183. Biology and Human Welfare 144. Biotechnology and its applications 105. Ecology and environment 14

TOTAL 70

Content VSA1 mark

SA I2 marks

SA II3 marks

VBQ4 marks

LA5 marks

Total

Unit 6Reproduction

1(1) 2(2) 3(3) 14

Unit 7Genetics and evolution

1(1) 4(3) 1(5) 18

Unit 8Biology in Human Welfare

1(1) 1(2) 2(3) 1(5) 14

Unit 9Biotechnology and its applications

2(1) 1(2) 2(3) 10

Unit 10Ecology

1(2) 1(3) 1(4) 1(5) 14

Total 5 10 36 4 15 70