Welcome to Biotechnology! August 26 th, 2013 Grab one of each of the following and put your name on it: 1. file folder 2. student information card

Welcome to Biotechnology! August 26th, 2013

Grab one of each of the following and put your name on it: 1. file folder 2. student information card (fill it out completely) 3. popsicle stick 4. scratch sheet of paper—fold into a tent and write your

name on it just like the example on the board and place it in front of you. You will place this name tent in front of your for two weeks until schedule changes are complete.

Materials list—DUE WEDNESDAYTake 5-10 minutes to fill out this information

Biotechnology Warm Up August 26th, 2013

Grab a white board and a dry erase marker from the back of the classroom and answer the following questions: What do you think biotechnology is? What would you like to learn about in biotechnology? Think about what you know about DNA and how we are

manipulating it today. Can you think of any useful things we have been able to do with biotechnology?

Take 5-10 minutes to answer these to the best of your ability

Now I need a volunteer to come up to the board and write down everyone’s answers

Biotechnology Warm Up AnswersAugust 26th, 2013

What do you think biotechnology is?the exploitation of biological processes for

industrial and other purposes, esp. the genetic manipulation of microorganisms for the production of antibiotics, hormones, etc. What would you like to learn about in biotechnology?

Answers will vary Think about what you know about DNA and how we are

manipulating it today. Can you think of any useful things we have been able to do with biotechnology?

http://www.bio.org/articles/what-biotechnology

Biotechnology What Now?August 26th, 2013

Environmental Systems explores the nature of science and the natural world. Students examine environmental issues and learn to make informed decisions using scientific problem solving. Specific topics include ecological interactions, matter and energy flow in ecosystems, biodiversity, characteristics and growth of populations, evolution, succession, biogeochemical cycles, soil and land resources, agriculture, waste management, and characteristics of terrestrial biomes. UT@Austin K-12 Ed

Environmental systems involves many hands on activities, including building solar ovens, growing plants, and exploring our natural resources. We also watch a LOT of movies.

Take a vote on who would like to be in an environmental systems class.


Sign in, get your name and place it in front of you on your table

Go get a white board and dry erase marker from the back of the room, and answer the following questions.

What is DNA? Why is it important? Write down everything you remember about DNA

Now I need a volunteer to come up to the board and write down everyone’s answer.

Biotechnology August 27th, 2013

Mrs. Chagra Website www.ideaprompter.com

Now we will go around the room and introduce ourselves.

On your whiteboard, draw a simple picture that conveys who you are. Then we will go around the room and introduce ourselvesNameSomething interesting about yourselfWhat you want to do after high schoolPut all whiteboards and dry erase markers back NEATLY!


1. Please get your name tent out of the appropriate box and place it in front of you.

2. What is biotechnology? If you don’t remember talk with a partner for about 1 minute, then I need a volunteer to come to the board and write down the answer.

3. What do the following have in common? Talk with your partner about what you think they may have in common.

tuberculosis Alzheimer’s disease cancerChlamydia common cold HIV/AIDSDrug abuse Escherichia coli hepatitisHuman papilloma virus (HPV) Lyme diseaseMalaria yellow fever plague

Biotechnology Warm Up AnswersAugust 28th, 2013

1. Biotechnology is a broad term that describes several techniques to study and manipulate organisms or their components.

2. The following are all diseases for which biotechnology companies are trying to develop new vaccines. Many of the new vaccines will be available in the next decade. With vaccine protection, millions of lives would be saved. Vaccine development is one application of some of the laboratory advances in biotechnology.

tuberculosis Alzheimer’s disease cancerChlamydia common cold HIV/AIDSDrug abuse Escherichia coli hepatitisHuman papilloma virus (HPV) Lyme diseaseMalaria yellow fever plague

Biotechnology Agenda August 28th, 2013

Get a whiteboard for each pair.What does a successful classroom look like to you?Brainstorm with your partner for a few minutes. Then write your ideas down on the white board. You can also draw an illustration if you would like.I need a volunteer to come up to the board and write down everyone’s answers.


1. Please go get your name tent and place it in front of you.

2. What does “Lab Safety” mean to you?3. Have you had or have known of anyone that had a

laboratory accident?4. Can you name at least 3 proper procedures for

laboratory safety?5. Can you see any safety equipment located around

the room? What is it and what is it for?http://www.youtube.com/watch?v=DWRGSaaKXV4http://www.youtube.com/watch?v=d_Bj7ZGwk-4http://www.youtube.com/watch?v=F6NEdcZY2WYhttp://www.youtube.com/watch?v=C561PCq5E1ghttp://www.youtube.com/watch?v=xJG0ir9nDtc

http://www.youtube.com/watch?v=DWRGSaaKXV4

http://www.youtube.com/watch?v=DWRGSaaKXV4

http://www.youtube.com/watch?v=d_Bj7ZGwk-4



http://www.youtube.com/watch?v=F6NEdcZY2WY

http://www.youtube.com/watch?v=F6NEdcZY2WY

http://www.youtube.com/watch?v=C561PCq5E1g

http://www.youtube.com/watch?v=C561PCq5E1g

http://www.youtube.com/watch?v=xJG0ir9nDtc


1. We will go over the laboratory safety guidelines. You will take a quiz. You will also take this form home to your parents for a signature. This is for a grade and is due TOMORROW!!!!


1. Please get your name tent and the safety quiz and place it in front of you.

2. We will go over the test.3. I have all the lab safety rule #s on the board.

Please pick one, write your name next to it.4. Write the rule IN YOUR OWN WORDS on the white

board and we will all share them with the entire class.


You and a partner will draw a poster that depicts the two rules that you picked.

You must work on this the entire rest of the period. This means that I expect the poster to LOOK like you worked on it the ENTIRE period. Not thrown together during the last 10 minutes.

Please email me the poster or turn it in by the end of the period. [email protected]

Biotechnology Warm Up and Agenda Sept 3rd, 2013

1. Please get your name tent and place it in front of you.

2. We will go through a ppt. on how to properly record in your journals.

3. If you did not bring a journal, take notes on a piece of paper and add it to your journal at a later time.

4. As you are taking notes, I will come by and give you a grade for either having your journal or not. 100% if you have it today, 75% for bringing it late.

Biotechnology Warm Up Sept 4th, 2013

Please get your name tent and place it in front of you. Answer the following in COMPLETE SENTENCES:1. Write down the proper procedure for

writing warm ups in your journals.2. Why are there specific procedures for

keeping a lab notebook?3. Name one famous scientist that we

studied yesterday.

Biotechnology AGENDA Sept 4th, 2013

You will take notes on how to read an MSDS Material Safety Data Sheet.You will use your notes to complete a handout on ACETONE!http://www.usmra.com/repository/category/hazardous_chemicals/How_to_read_MSDS_and_labels.pdf

http://www.usmra.com/repository/category/hazardous_chemicals/How_to_read_MSDS_and_labels.pdf

http://www.usmra.com/repository/category/hazardous_chemicals/How_to_read_MSDS_and_labels.pdf

Biotechnology WARM UP Sept 5th, 2013

Place your name tent in front of you.Get your chemical label quizzes out of the box.For your warm up, write down the following

questions. Leave enough room between each question to answer the questions.

1. What is genetically modified food?http://www.youtube.com/watch?v=jAP6ZtfP9ZQ

2. What are the five GMO myths?http://www.youtube.com/watch?v=ptDd9ftNaq8

3. What does SANTO have to do with GMOs?http://www.indiegogo.com/projects/santo-7-13-15-gmo-mo

vie

http://www.youtube.com/watch?v=jAP6ZtfP9ZQ

http://www.youtube.com/watch?v=ptDd9ftNaq8

http://www.indiegogo.com/projects/santo-7-13-15-gmo-movie

http://www.indiegogo.com/projects/santo-7-13-15-gmo-movie


We will go over the chemical label quiz and syllabus.You will take a quiz.Answer everything in COMPLETE SENTENCES.There will be 5 points DEDUCTED for each question not answered in COMPLETE SENTENCES.We will TRADE AND GRADE:Write Graded by: Your NameI will also grade the quizzes. If you do not properly mark off questions when wrong, I will subtract 10 points from your quiz.


Pick up a hand out.Place your name tent in front of you.Please answer the following in complete sentences in your journals, under the last warm up. If you have your syllabus with you, you can use it.1. According to the syllabus we went over

yesterday, what is the consequence for the first infraction?

2. What is the consequence for the 2nd infraction?3. What is the consequence for the 3rd infraction?


You will complete the handout while watching the following video:http://www.youtube.com/watch?v=mH0jL5njNFIhttp://www.youtube.com/watch?v=GKm2Ch3-Myg

http://www.youtube.com/watch?v=mH0jL5njNFI

http://www.youtube.com/watch?v=GKm2Ch3-Myg


Pick up a packet.Place your name tent in front of you.Please answer the following in complete sentences in your journals, on a new page, write the day and date.1. In a COMPLETE SENTENCE, name a reason

why it may not be a good idea to eat genetically modified organisms.

2. How long have humans been eating genetically modified foods?

3. As far as you can tell, how does Bill Nye feel about genetically modified organisms?


You will read chapter 1.I will go over a ppt.You will answer questions from the chapter.


Place your name tent in front of you.Please answer the following in complete sentences in your journals, under the last warm up. 1. What is biotechnology?2. What does transgenic mean?3. Name three common foods that we eat that

are genetically modified.


1. What is biotechnology?Biotechnology is the study and manipulation of living things or their component molecules, cells, tissues, or organs.2. What does transgenic mean?Transgenic means being or used to produce an organism or cell of one species into which one or more genes or another species have been incorporated.3. Name three common foods that we eat that are

genetically modified.Three common foods that have been genetically modified are corn, soy and tomatoes.


You will define 18 vocabulary words from chapter 1 in your journals.You will define these words from the chapter and then define them in your own words. You will also create a small illustration to represent that word in your journals.


Place your name tent in front of you.Please answer the following in complete sentences in your journals, under the last warm up. 1. How do we use biotechnology to modify

denim jeans?2. How do bacteria grow resistant to

antibiotics?3. What are the 4 major domains of

biotechnology?


1. How do we use biotechnology to modify denim jeans?Biotechnology is used to modify denim jeans by genetically engineering enzyme products that break down the cotton fibers to create the stone-washed look.2. How do bacteria grow resistant to antibioticsBacteria grow resistant to antibiotics because antibiotics are being so commonly used and many people do not finish the proper dosage, allowing the most resistant bugs to live and proliferate.3. What are the 4 major domains of biotechnology?The 4 major domains of biotechnology are industrial and environmental biotechnology, medical and pharmaceutical biotechnology, agricultural biotechnology, and diagnostic research biotechnology.


LAB 1Using the handout I have provided you, answer the following questions in your journals:1. Name three types of measurements.2. What system do scientists use for measurements?3. What is one tool that we use to measure volume? Draw a picture of

it with water in it and include a meniscus.4. What is one tool that we use to measure mass? Draw a picture of it

with the three balances showing a measurement.5. The objects you will be using to measure water displacement are

three similar sized blocks of different substances.6. What three objects will you be using to measure mass?7. What will you use to measure distance?8. To measure length, you will measure a penny, a paper clip and a

book. You will measure each item with a meter stick and a ruler.

AS SOON AS YOU HAVE FINISHED ANSWERING THE QUESTIONS ABOVE, PLEASE RAISE YOUR HAND, I WILL STAMP YOUR WORK AND SIT QUIETLY UNTIL EVERYONE IS FINISHED.


LAB 1Answer the questions for the pre-lab and we will do the lab tomorrow.


Place your name tent in front of you.Please answer the following in complete sentences in your journals, under the last warm up. 1. What is Escherichia coli?2. What is the difference between old

biotechnology and new biotechnology?3. What are antibiotics?


1. What is Escherichia coli?Escherichia coli is a bacteria that is commonly found in the lower intestine of warm-blooded organisms. We use E. coli to produce many human proteins.2. What is the difference between old biotechnology and new

biotechnology?Old biotechnology includes selective breeding and the fermentation of certain foods and beverages. New biotechnology includes the ability to “cut and paste” DNA pieces from one organism and place them into another.3. What is an antibiotic?An antibiotic is a chemical substance produced by one organism that is destructive to another. The word comes from antibiosis a term coined in 1889 by Paul Vuillemin which means a process by which life could be used to destroy life.


Taking Proper Measurements.You will rotate between each station and measure using various measuring devices and techniques.


Place your name tent in front of you.Please answer the following in complete sentences in your journals, under the last warm up. 1. What are restriction enzymes?2. What is DNA ligase?3. What does the human gene t-PA do?


1. What are restriction enzymes?Restriction enzymes are enzymes that cut pieces of DNA at or near a specific sequence of bases. These are produced chiefly by certain bacteria.2. What is DNA ligase?DNA ligase is an enzyme that pastes pieces of DNA together to create new combinations of DNA information.3. What does the human gene t-PA do?The human gene t-PA produces a blood-clot dissolving enzyme.


1. What did you notice about taking measurements for our lab on Friday?

2. Did each person make the same measurement for each station?

3. Why could measurements be different if two people are measuring the same item?


1. What did you notice about taking measurements for our lab on Friday?

I couldn’t remember how to use a triple beam balance2. Did each person make the same measurement

for each station?Some people’s measurements were different.3. Why could measurements be different if two

people are measuring the same item?People estimated different valuesErrors in Measurements


Do you have any questions over what we have covered this far?

syllabuslab safetyE. colirestriction enzymesGMOsCAFOstaking proper measurements

TEST


We will go through our lab results from Friday.We will demonstrate proper data collection techniques:DATA TABLE: Paper Clip Measurements

Answer the following questions in your journals:1. What is the difference between precise and accurate?2. Which station had the largest discrepancies in

measurements? Why?3. What questions from the quiz yesterday did you not know

the answer to?4. http://www.youtube.com/watch?v=qzfS1Z4Aec0

Person measuring

Measurement with ruler

Measurement with meter stick

Person 1 5 mm 4.5 mm

Person 2 5.1 mm 4.8 mm

Person 3 5.2. mm 4.5mm

Average 5.1 mm 4.6mm

http://www.youtube.com/watch?v=qzfS1Z4Aec0


You can also take this time to update your journals-including your TABLE OF CONTENTS.5-8 minutes, and WRITE A CONCLUSION.When you are finished, you can get started on the vocabulary for Chapter 1, sections 2-8.AFTER YOU HAVE DEFINED ALL THE WORDS AND DRAWN A MINI PICTURE, You and a partner will pick two vocabulary words and define them and draw them on a sheet of paper with markers or colored pencils to be displayed in the room.


Using the Biotech handout, answer the following questions:1. What would be a benefit to create round-up ready (herbicide resistant) soybeans, corn or cotton?

2. Why would a growth hormone for cows (Posilic bovine somatotropine) be beneficial to farmers?

3. Why would a company want to create a virus-resistant papaya?


Using the Biotech handout, answer the following questions:1. What would be a benefit to create round-up ready

soybeans, corn or cotton? Round up ready soybeans, corn or cotton will be able to resist the herbicide round up. Therefore the farmers can use as much round up to kill the unwanted weeds in their fields, but not the valuable crop.

2. Why would a growth hormone for cows (Posilic bovine somatotropine) be beneficial to farmers? This grown hormone allows the cows to have a higher yield of milk production.

3. Why would a company want to create a virus-resistant papaya? The virus wiped out many acres of papaya production. Introduction of the transgenic papaya has allowed for continued papaya production.


YOU WILL WRITE A VOCABULARY WORD WITH A DEFINITION AND A PICTURE! MAKE IT LOOK LIKE SENIOR WORK. YOU ARE MAKING ME A WORD WALL.Bovine growth hormone-Posilac bovine somatotropinA growth hormone that enables lactating cells in dairy cows live longer to produce more milk.


Using the Biotech handout, answer the following questions:1. When would it beneficial for doctors to use genetically engineered t-PA?

2. What animal do they use to make t-PA?

3. Draw the diagram on page 12 in your journals and describe the process of engineering the human t-PA gene.


Using the Biotech handout, answer the following questions:1. When would it beneficial for doctors to use genetically

engineered t-PA? Doctors use t-PA in patients that have had a heart attack to clear blocked blood vessels.

2. What animal to they use to make t-PA? Researchers genetically engineer mammalian cells using Chinese hamster ovary cells.

3. Draw the diagram on page 12 in your journals and describe the process of engineering the human t-PA gene.


You will define and interpret the vocabulary words from Chapter 1 section 1.2-1.8 by writing the definitions in your journals IN YOUR OWN WORDS with a corresponding illustration to demonstrate your understanding of the vocabulary word. Ex.:Bovine growth hormone-(Posilac bovine somatotropin)A growth hormone that enables lactating cells in dairy cows live longer to produce more milk.


Using the Biotech handout, answer the following questions:

1. Why would a biotechnology company specialize in particular product area?

2. What are the questions that must be answered in a “product development plan?” Just write the first question in each area.


Using the Biotech handout, answer the following questions:

1. Why would a biotechnology company specialize in particular product area? Companies can specialize in a particular product area because the manufacturing processes and procedures are nearly the same among similar products. The protocols for manufacturing recombinant growth hormone are almost identical to those for producing recombinant human insulin.

2. What are the questions that must be answered in a “product development plan?” Does the product meet a critical need? Is the market large enough to produce enough sales? Do preliminary data support that the product will work? Can patent protection be secured? Can the company make a profit?


Please read pages 10-14, then answer the questions on page 14:1. Name two antibiotics used as medicines.2. The use of what kind of enzymes allows

scientists to cut and paste pieces of DNA together to form recombinant DNA? (There are two, one to cut and one to paste together)

3. Explain how making human tissue plasminogen activator (t-PA) in CHO cells is an example of genetic engineering in detail! I need at least a one page explanation.

Biotechnology WARM UP Sept 23rd, 2013

Please pick up the Biotechnology Packet Sections 1.2-1.8 and answer the following questions in your journals.

1. A drug discovery process can take nearly 15 years. Explain why it takes so long to bring a new drug to market.

2. Does every product in research and development make it to market? Yes or no? Explain.

Biotechnology WARM UP Sept 23rd, 2013

Please pick up the Biotechnology Packet Sections 1.2-1.8 and answer the following questions in your journals.1. A drug discovery process can take nearly 15 years.

Explain why it takes so long to bring a new drug to market. Each company’s pipeline is reviewed regularly in light of the product development plan. If the answers to the questions are unsatisfactory, the company will pull the product from the pipeline. If the product is a pharmaceutical product it has to go through Phase III clinical trials with thousands of patients included in the testing before the FDA will approve the product.

2. Does every product in research and development make it to market? Yes or no? Explain. No, it may be learned early in research and development that a potential product is too costly to produce. That product may pulled form the pipeline early on before the company has invested too many resources in its development.

Biotechnology AGENDA Sept 23rd, 2013

You will be answering the questions on the handout as you watch the “Cracking the Code” DVD.

Biotech Warm Up September 24th, 2013

1. What is RNA?2. What is transcription?

RNA polymerase (green) synthesizes a strand of RNA that is complementary to the DNA template strand below it.


1. What is RNA? RNA molecules differ from DNA molecules in several important ways: They are single stranded rather than double stranded; their sugar component is a ribose rather than a deoxyribose; and they include uracil (U) nucleotides rather than thymine (T) nucleotides. Also, because they are single strands, RNA molecules don't form helices; rather, they fold into complex structures that are stabilized by internal complementary base-pairing.2. What is transcription?Transcription is the first step in decoding a cell's genetic information. During transcription, enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix

http://www.nature.com/scitable/topicpage/the-information-in-dna-is-decoded-by-6524808

Biotechnology AGENDA Sept 24th , 2013

You will be finishing the questions on the handout as you watch the “Cracking the Code” DVD.


1. What are ribosomes?2. What is translation?


1. What are ribosomes?Ribosomes are the sites in a cell in which protein synthesis takes place. Cells have many ribosomes, and the exact number depends on how active a particular cell is in synthesizing proteins. For example, rapidly growing cells usually have a large number of ribosomes (Figure 5).2. What is translation?After the transcription of DNA to mRNA is complete, translation — or the reading of these mRNAs to make proteins — begins. Recall that mRNA molecules are single stranded, and the order of their bases — A, U, C, and G — is complementary to that in specific portions of the cell's DNA.


You will continue to take notes as we go through a ppt. about the metric system.


1. What is an amino acid?2. What is a codon?


1. What is an amino acid? Amino acids are the building blocks of proteins made from amine and carboxylic acid functional groups, along with a side-chain specific to each amino acid.

2. What is a codon? Every amino acid is represented by a three-nucleotide sequence or codon along the mRNA molecule. For example, AGC is the mRNA codon for the amino acid serine, and UAA is a signal to stop translating a protein — also called the stop codon.


You will take notes as we go through a ppt. about the metric system.


1. What is the prefix for 1-thousandth (1/1000) of anything (in the metric system)?

2. What is the prefix for 1,000 of anything?3. What is the prefix for 1-1oo (1/100) of anything?4. What is the prefix for a million of something?


1. What is the prefix for 1-thousandth (1/1000) of anything (in the metric system)? milli

2. What is the prefix for 1,000 of anything? kilo3. What is the prefix for 1-1oo (1/100) of anything? centi4. What is the prefix for a million of something? mega


You will complete a worksheet on the metric system.


1. What do you do to the exponents when you multiply?2. What do you do to the exponents when you divide?3. What do you have to do to the exponents when you add

or subtract?


1. What do you do to the exponents when you multiply? Add them

2. What do you do to the exponents when you divide? Subtract them

3. What do you have to do to the exponents when you add or subtract? You have to make them match for example:

1 x 10^4 + 1 x 10^2 = 100 x 10^2 + 1 x 10^2

Biotechnology Agenda Sept 30th, 2013

You will complete a worksheet on the metric system.

Biotech Warm Up October 3rd, 2013

MUDDIEST POINT OPPORTUNITY BEFORE THE QUIZ:Ask a question or any part of scientific notation or

significant digits

Biotech Warm Up October 4th, 2013

New York Times article (2/2002; now archived) recently reported that nearly 9 out of 10 doctors involved in clinical trial protocols had financial ties to the pharmaceutical industry (such as research funding, travel or consulting fees, or personal stock investment). About 6 out of 10 had financial ties to companies whose drugs were either considered or recommended in the clinical trial guidelines they wrote. Do you feel that either situation above constitutes a conflict of interest? Do you feel that physicians should hold stock in the companies they are condicting clinical trials for? What would you recommend to remedy any potential conflict of interest?http://www.kpho.com/story/21773162/pooprints-dna-tests-dogs-to-cut-down-on-left-behind-waste

http://query.nytimes.com/gst/abstract.html?res=F50A11FB35590C758CDDAB0894DA404482

http://query.nytimes.com/gst/abstract.html?res=F50A11FB35590C758CDDAB0894DA404482

http://www.kpho.com/story/21773162/pooprints-dna-tests-dogs-to-cut-down-on-left-behind-waste





If you were eating genetically modified (GM) food, would you know it from reading a food label? Or do you think you are already eating genetically modified foods right now? Answer first, but then if you want visit The True Foods shopping List.

Last year, pharmaceutical companies spent over $2.5 billion (in a $122 billion US pharmaceutical market) in Direct-to-Consumer (DTC) advertising on TV and in magazines. DTC works to the advantage of the pharmaceutical companies, as prescriptions written for the top 50 most heavily advertised drugs rose 24.6 %, compared to 4.3 % for all other drugs combined in 2000 (ref). However, the group Pharma maintains that Direct-to-Consumer Advertising strengthens our health care system. Can you think of one advantage and one disadvantage of DTC drug advertising for (a) the consumer (b) their physician? What is Pharma, and do you think they are a reliable, unbiased source of information about the Pharmaceutical industry??

http://www.ncsl.org/programs/health/rxads.htm

http://www.phrma.org/issues/directconsumer/

Biotechnology Agenda Oct 8th, 2013

You will write notes as I go through a ppt. on proper pipetting techniques.


One of the controversies about Epogen involves medicare funding for this expensive drug. Medicare would like to keep some anemia patients at a 'sub-optimal' hemacrit (RBC level) to reduce the amount of Epo subsidized by Medicare. These patients would be slightly anemic, weak, and tired, but not as much as if they didn't receive any Epo! Please comment on the on this issue from the perspective of (a) the patient (b) the physician treating these patients, (3) Medicare ?

The target of most means of drug delivery is to get drugs into the bloodstream. The most direct way to do this is via injection directly into the blood. Why, then, do you think many drugs are taken orally, or are being developed for inhalation or nasal therapy?

http://www.prospect.org/print/V11/20/goozner-m.html


I will demonstrate how to use a micropipetter, then, individually, you will come up and demonstrate how to use it. As you are waiting your turn with the micropipetter, please complete the worksheet I have provided IN YOUR JOURNALS using the CLASS SET along with the “PRELAB NOTES”


Humulin, a drug made by Eli Lilly, is the human insulin protein made by bacteria. How can a bacteria make a human protein?

Given that it takes a tremendous amount of time and money to develop a drug, do you think that the ~20 year patent protection fairly covers the property rights of a company? Do you think there are any incentives given to a company to develop drugs that only have a very small market - maybe only affecting ~100 - 200 people a year?

Before Herceptin was approved for use by the FDA in 1998, breast cancer patients were selected to receive Herceptin via a 'lottery'. The use of Herceptin was granted by allowing 'compassionate access' to this drug. Explain what you think this term means, and why you think Genentech only allowed 25 women at a time to receive Herceptin.

http://www.cancer.org/treatment/treatmentsandsideeffects/clinicaltrials/compassionate-drug-use


Micropipette Practice LabYou will get into groups of 4-5 people. You will find a micropipette at each lab station.Each person will practice using the micropipette measuring three different volumes. You will distribute these in the appropriate receptacles.


Please write down the following questions and leave enough space to answer them while watching an educational video.

What are stem cells?

What are adult stem cells?

What are embryonic stem cells?

Where do the embryonic stem cells come from?


What are stem cells? An undifferentiated cell of a multicellular organism that is capable of giving rise to indefinitely more cells of the same type, and from which certain other kinds of cells arise by differentiation

What are adult stem cells? Adult stem cells are also called somatic stem cell and are found in bone marrow and may also exist in the brain and the heart.

What are embryonic stem cells? Embryonic stem cells are derived from embryos that develop from eggs that are fertilized in vitro– and then donated with informed consent of the donors. They do not come from eggs fertilized in a woman’s body.

Where do the embryonic stem cells come from? Embryonic stem cells come from fertilized eggs in a fertilization clinic that are destined for destruction.


Micropipette Practice LabFollow the instructions in Techniques Lab

A handout.Each person will practice using the three

different size micropipette, and practice using the centrifuge.

Please look at various stations for the various size micropipettes. There are only 5 of each but there are 7 lab stations

There are only THREE CENTRIFUGES! You must share!


Which nitrogen base pairing is correct? a. Adenine: Cytosine, Thymine: Guanineb. Adenine: Guanine, Cytosine: Thyminec. Adenine: Adenine, Cytosine: Cytosined. Adenine: Thymine, Guanine: Cytosine

What is rDNA? In transformation, the DNA is cut with? What sugar is used in DNA?


Which nitrogen base pairing is correct? d. Adenine: Thymine, Guanine: Cytosine

What is rDNA? Recombinant DNA In transformation, the DNA is cut with? Restriction enzymes What sugar is used in DNA? Deoxyribose

Biotech Agenda October 14th, 2013

1. Watch this short video (Steps in Gene Cloning) and answer the following questions in your journals:

a. What do restriction enzymes do?b. What does the ligase do?c. What is it called when the plasmid vector is inserted into the bacterial host cells?d. What is a DNA library?

2. Watch this short video (Processes of recombinant DNA technology) and answer the following questions in your journals:

a. What is the first step?b. What is the second step?c. What is the third step?d. What properties should an ideal vector have?e. What are the two vectors he mentions in the video?f. What is the 4th step?

3. We will go through a ppt. and take notes.


1. All three of the micropipettors you used in the labs last week measure in what units?

While you are watching the video answer the following questions:2. What is a plasmid?3. What does it allow the bacteria to do?4. What enzyme opens up the plasmid?5. What enzyme “glues” the foreign DNA into the plasmid?


1. All three of the micropipettors you used in the labs last week measure in what units? microliters

While you are watching the video answer the following questions:2. What is a plasmid? A piece of DNA found in a bacteria3. What does it allow the bacteria to do? The plasmid allows the

bacteria to resist deadly foreign substances.4. What enzyme opens up the plasmid? Restriction enzymes5. What enzyme “glues” the foreign DNA into the plasmid? Ligase


1. FINISH PPT. AND NOTES


1. Where do Human Embryonic Stem Cells (hES) come from?2. What are the ethical implications of using hES cells for medical

research?While watching the video, answer the following questions3. What are sticky ends?4. What can this process lead to?


1. Where do Human Embryonic Stem Cells (hES) come from? Excess fertilized human zygotes from fertilization clinics.

2. What are the ethical implications of using hES cells for medical research? Is this embryo a potential human?

While watching the video, answer the following questionshttp://www.teachersdomain.org/asset/biot11_vid_genengdna/3. What are sticky ends? They are un-even ends of the DNA that

will allow it to attach to another piece of DNA4. What can this process lead to? Multiple fragments in one

plasmid or no inserts at all.


1. Substitute, complete your math worksheets


While watching the video clip, answer the following questions in your journals: http://www.teachersdomain.org/asset/nsn11_vid_bodyparts/

1. What is the first organ they show?2. What do cells need to grow?3. What is biorubber?4. Why is it important that the implant have the host cells?5. What is the obstacle that must be overcome?6. What are all the requirements for an organ to function?

http://www.teachersdomain.org/asset/nsn11_vid_bodyparts/



While watching the video clip, answer the following questions in your journals: http://www.teachersdomain.org/asset/nsn11_vid_bodyparts/

1. What is the first organ they show? Lungs2. What do cells need to grow? A framework or scaffold3. What is biorubber? It is a material that will allow the

creation of a scaffold4. Why is it important that the implant have the host cells?

Host cells will reject foreign substances.5. What is the obstacle that must be overcome? All cells

need blood vessels.6. What are all the requirements for an organ to function?

They may need an electrical signal, mechanical blood pressure, oxygen, etc.




Micropipette Lab

Biotech Warm Up October 21st, 2013

1. What are three methods for creating rDNA? a. Translation, transformation, excitationb. Transformation, expression, ligationc. Transformation, phage introduction, non-bacterial transformationd. Transfection, transformation, translation

2. Foreign DNA is inserted into what?3. In microinjection, the DNA is injected directly into the

______________of the cell being transformed.

Biotech Warm Up October 21st, 2013

1. What are three methods for creating rDNA? c. Transformation, phage introduction, non-bacterial transformation

2. Foreign DNA is inserted into what? Expression vectors3. In microinjection, the DNA is injected directly into the nucleus of

the cell being transformed.

Biotech Agenda October 21st, 2013

1. Finish Micropipettor Lab2. Write a Conclusion

Biotech Warm Up October 22nd, 2013

1. Please draw the following diagram in your journals

Biotech Agenda October 22nd, 2013

Complete the DNA Electrophoresis Gel simulation worksheet


If the same restriction enzymes we discussed yesterday: EcoRI, HindIII, BamHI, NcoI, BmrI, and SfuI were used on a piece of DNA from a different organism (not Lamba), would the fragments be the same size? Why or why not?


If the same restriction enzymes we discussed yesterday: EcoRI, HindIII, BamHI, NcoI, BmrI, and SfuI were used on a piece of DNA from a different organism (not Lamba), would the fragments be the same size? Why or why not?The fragments from different DNA would be different lengths with the same restriction enzymes because every piece of DNA is unique UNLESS you are an identical twin.

Biotech Agenda October 23rd, 2013

Gel Electrophoresis Hand out Continued…


1. What is the molar mass of NaCl?2. What is the molar mass of NaOH?3. What is molar mass of CaCl2?

4. What is the molar mass of C12H22O11?


1. What is the molar mass of NaCl? 58 grams2. What is the molar mass of NaOH? 40 grams3. What is molar mass of CaCl2? 110 grams

4. What is the molar mass of C12H22O11?342 grams


Molarity LabTake a handoutWatch a brief video on how to calculate grams from Molarityhttp://www.youtube.com/watch?v=BTRm8PwcZ3U

TIPS AND TRICKS:The powder must be added to the cup BEFORE THE WATER.

http://www.youtube.com/watch?v=BTRm8PwcZ3U

http://www.youtube.com/watch?v=BTRm8PwcZ3U


Please write the following definition in your journals:1. Polymerase chain reaction (PCR) is a process that enables researchers to produce millions of copies of a specific DNA sequence in approximately two hours. This automated process bypasses the need to use bacteria for

amplifying DNA.Please write the following words in your journals and you will define them as we go through a simulation, so leave space in between them!2. Denature3. Anneal4. Taq polymerase


REDEMPTION DAY!COMPLETE THE MOLARITY LAB/WORKSHEET


1. Why do the largest fragments of DNA stay near the top of the electrophoresis gel?

2. What does PCR stand for?3. As you watch the following animation please answer

the following questions:a. What is the template DNA?b. What is the purpose of the MgCl2?c. What is the purpose of the Taq DNA polymerase?d. What is the purpose of primer 1 and 2?e. What is dNTP?f. Why do you need the PCR buffer?http://www.youtube.com/watch?v=DkT6XHWne6E

http://www.youtube.com/watch?v=DkT6XHWne6E

http://www.youtube.com/watch?v=DkT6XHWne6E


1. Why do the largest fragments of DNA stay near the top of the electrophoresis gel? They are too large and move slowly through the gell

2. What does PCR stand for? Polymerase Chain Reaction3. As you watch the following animation please answer the following

questions:a. What is the template DNA? Contains the target fragment to be

amplified.b. What is the purpose of the MgCl2? Essential cofactor for Taq DNA

Polymerasec. What is the purpose of the Taq DNA polymerase? An enzyme that

helps catalyze the polymerization of DNAd. What is the purpose of primer 1 and 2? Primer single DNA sequence

designed to locate DNA fragments…Two primers are needed to amplify target DNA fragments.

e. What is dNTP? Mix of nucleotides, which are the building blocks of new DNA strands?

f. Why do you need the PCR buffer? Creates an environment for optimum activity Taq polymerase.


DNA TO THE RACES WORKSHEET!


1. In gel electrophoresis, describe where the smallest fragments of DNA end up and why.

2. What units do our micropipettors measure in?3. What two colors do you mix together to get orange?4. What two colors do you mix together to get green?5. What two colors do you mix together to get purple?


1. In gel electrophoresis, describe where the smallest fragments of DNA end up and why. The smallest fragments are going to end up on the bottom of the gel. The reason why is because of the snake like movement made be the DNA, and the smallest fragments move the farthest and the fastest.

2. What units do our micropipettors measure in? microliters

3. What two colors do you mix together to get orange? yellow and red

4. What two colors do you mix together to get green? Yellow and blue

5. What two colors do you mix together to get purple? Red and blue


Micropipettor Lab!More practice for us to use the micropipettors, NOT BREAK THEM, and get comfortable with them.


1. What are “sticky ends?” Draw a diagram—use specific DNA sequences

2. What are “blunt ends?” Draw a diagram—use specific DNA sequences

3. Will a DNA fingerprint work if you do not have DNA from the suspect? Why or why not?

4. In California if you get pulled over for a traffic violation, officers are offering to not give tickets if the driver is willing to give a sample of DNA. What do you think of this? Would you be willing to give a sample of DNA to avoid a traffic fine? Why or why not?


Who ate the cheese worksheet!You will solve a mystery of who ate the cheese. BEFORE YOU CUT THE PAPER UP, please write on the back of the worksheet which DNA is which.

Biotech Agenda October 31st, 2013

Computer Lab!DNA scavenger hunt and worksheet!

Biotech Agenda November 1st, 2013

Redemption Day.Use this opportunity to make up any failing grades or missed work.

Biotech Warm Up November 4th, 2013

1. What is the difference between chromosomal and plasmid DNA in Bacteria?

2. What is heredity?3. What is a trait?4. What is a chromosome?

http://learn.genetics.utah.edu/content/begin/traits/




1. What is difference between chromosomal and plasmid DNA in Bacteria?

2. What is heredity?3. What is a trait?4. What is a chromosome?




Biotech Agenda November 4th, 2013

Gel Electrophoresis Simulation Bead LabIn your journals, start on a fresh page and define the following using your lab worksheet:1. Rf

2. Standard Curve3. Electrophoresis4. Test sample preparation5. Gel preparation6. Gel loading7. Sample tracking8. Gel stainingAfter you have defined the terms above, follow the procedures on your hand out and complete the lab!


1. Who was the scientist that discovered the laws of inheritance using pea plants?

2. What kitchen appliance was used to show phage DNA?3. What are the names of the scientists that discovered

the phage transformed DNA?


1. Who was the scientist that discovered the laws of inheritance using pea plants? Gregory Mendel 1883

2. What kitchen appliance was used to show phage DNA? A blender

3. What are the names of the scientists that discovered the phage transformed DNA? Alfred Hershey and Martha Chase


Gel Electrophoresis Simulation Bead LabIn your journals, start on a fresh page and define the following using your lab worksheet:1. Rf

2. Standard Curve3. Electrophoresis4. Test sample preparation5. Gel preparation6. Gel loading7. Sample tracking8. Gel stainingAfter you have defined the terms above, follow the procedures on your hand out and complete the lab!


1. What was the “chip” Steve Fodor’s work led the way for?

2. Which scientist worked with pus?3. What is density gradient centrifugation?


1. What was the “chip” Steve Fodor’s work led the way for? The Gene Chip

2. Which scientist worked with pus? Freidrick Meischer3. What is density gradient centrifugation?density gradient centrifugationa procedure for separating particles such as viruses or ribosomes or molecules such as DNA in which the sample is placed on a preformed gradient such as sucrose or cesium chloride. Upon centrifugation either by rate zonal or equilibrium procedures, the macromolecules are 'banded' in the gradient and can be collected as a pure fraction.


Jello Lab Start on a fresh page in your journals. Record the procedures for the following:You will get into groups of 4.Your group will draw a card.If you draw card A you will make the jello according to the instructions.If you draw card B you will make the jello with ½ of the required solution.When you finish, you MUST CLEAN UP your station and write a conclusion.


A Process to Dye for: Gel Electrophoresis Pre-lab


1. What is the “fly room?”2. What did Thomas Cech discover that makes it no

longer true to state “all enzymes are proteins?”3. What does transposition in corn chromosomes?


1. What is the “fly room” referring to in the scavenger hunt we did last week? A room full of fruit flies at Columbia University studied by Thomas Morgan

2. What did Thomas Cech discover that makes it no longer true to state “all enzymes are proteins?” Sydney Brenner showed that RNA could act as its own catalyst.

3. What is transposition in corn chromosomes? A transposable element (TE, transposon or retrotransposon) is a DNA sequence that can change its position within the genome, sometimes creating or reversing mutations and altering the cell's genome size. Transposition often results in duplication of the TE. Barbara McClintock's discovery of these jumping genes earned her a Nobel prize in 1983

http://en.wikipedia.org/wiki/DNA_sequence

http://en.wikipedia.org/wiki/Genome

http://en.wikipedia.org/wiki/Mutation

http://en.wikipedia.org/wiki/Genome_size

http://en.wikipedia.org/wiki/Barbara_McClintock

http://en.wikipedia.org/wiki/Nobel_prize


Agarose Production LabStart a new page in your journal. Title it Agarose Production Lab.Write Procedures, and copy these down:

Put 100 mL of water into the beaker at your lab station.

Weigh the plastic cup you are going to use to measure the agarose and record the mass.

Add 1 gram to that in your journals, and then add agarose using a popsicle stick until the scale balances.

CAREFUL! AGAROSE IS VERY EXPENSIVE! DO NOT WASTE IT! Turn on your hotplate and place the beaker on your hotplate.

DON’T OVERHEAT! DO NOT TURN IT UP TO 10—KEEP IT AT 7 OR 8. Stir constantly using a popsicle stick. This will blow

up just like the jello if too hot. Stir until liquid is clear. Once it is clear, turn off hotplate. Remove from heat using tongs or gloves. Place on the lab table. Wait for it to cool. While you are waiting for it to cool draw the data

table in your notebooks from the last question on the handout from yesterday.

Once the beaker is cool enough to touch, pour the ENTIRE solution into the cast.

Once the solution is in the cast, leave it alone and finish the worksheet from yesterday, or taste the jello and record your observations.

Answer the following questions in your journals in complete sentences as you are waiting for the agarose to harden:

What will happen to the gel if I try to pick it up?

What will happen to the gel if I drop it?What will happen to the gel if I pull the

end pieces of the cast off too quickly?How can I ensure my gel remains intact?


1. What is a test tube baby?2. What was the name of the person that really discovered

the structure of DNA using x-rays and ultimately died of radiation poisoning?


1. What is a test tube baby? The process involves monitoring and stimulating a woman's ovulatory process, removing ovum or ova (egg or eggs) from the woman's ovaries and letting sperm fertilise them in a fluid medium in a laboratory. The fertilised egg (zygote) cultured for 2–6 days in a growth medium and is then transferred to the patient's uterus with the intention of establishing a successful pregnancy.

2. What was the name of the person that really discovered the structure of DNA using x-rays and ultimately died of radiation poisoning? Rosalind Franklin

http://en.wikipedia.org/wiki/Ovum

http://en.wikipedia.org/wiki/Ovary

http://en.wikipedia.org/wiki/Spermatozoon

http://en.wikipedia.org/wiki/Zygote

http://en.wikipedia.org/wiki/Uterus


1. REDEMPTION DAY2. Please look over all your assignments.3. If you are missing anything, look in the missed work

folder.4. If you have looked and cannot find it, then ask me.5. Trade and Grade: A Process to DYE for Pre-LAB


1. How do we make the DNA fragments move in the gel when performing electrophoresis?

2. Which direction do the DNA fragments move?3. What direction will our dye move when we do the dye

electrophoresis?


1. How do we make the DNA fragments move in the gel when performing electrophoresis? We run an electric current through it.

2. Which direction do the DNA fragments move? Toward the positive electrodes.

3. What direction will our dye move when we do the dye electrophoresis? Some dye will move toward the positive end and some dye will move toward the negative end.


1. 1st Period—Gel Electrophoresis with various dyes.2. 3rd-4th Period—Create a gel to perform gel

electrophoresis tomorrow. Watch the agarose producation video.

Agarose Production LabStart a new page in your journal. Title it Agarose Production Lab.Write Procedures, and copy these down:

Put 100 mL of water into the beaker at your lab station.

Weigh the plastic cup you are going to use to measure the agarose and record the mass.

Add 1 gram to that in your journals, and then add agarose using a popsicle stick until the scale balances.

CAREFUL! AGAROSE IS VERY EXPENSIVE! DO NOT WASTE IT! Turn on your hotplate and place the beaker on your hotplate.

DON’T OVERHEAT! DO NOT TURN IT UP TO 10—KEEP IT AT 7 OR 8. Stir constantly using a popsicle stick. This will blow

up just like the jello if too hot. Stir until liquid is clear. Once it is clear, turn off hotplate. Remove from heat using tongs or gloves. Place on the lab table. Wait for it to cool. While you are waiting for it to cool draw the data

table in your notebooks from the last question on the handout from yesterday.

Once the beaker is cool enough to touch, pour the ENTIRE solution into the cast.

Once the solution is in the cast, leave it alone and finish the worksheet from yesterday, or taste the jello and record your observations.

Answer the following questions in your journals in complete sentences as you are waiting for the agarose to harden:

What will happen to the gel if I try to pick it up?

What will happen to the gel if I drop it?What will happen to the gel if I pull the

end pieces of the cast off too quickly?How can I ensure my gel remains intact?


1. What does PCR stand for? (Use the notes in your journals!)

2. What do we use PCR for?3. How is PCR useful in DNA fingerprinting?


1. What does PCR stand for? Polymerase Chain Reaction

2. What do we use PCR for? Polymerase Chain Reaction is a process by which strands of DNA are duplicated many times.

3. How is PCR useful in DNA fingerprinting? By having many fragments of DNA it is easier to distinguish the bands in the electrophoresis gel.


1st Period—Hand out3rd and 4th Period—Gel Electrophoresis Dye Lab


1. In the gel electrophoresis lab we did, what did the dye represent?

2. What is the main difference between the dye lab we did, and an electrophoresis lab we may do in the future with real DNA?


1. In the gel electrophoresis lab we did, what did the dye represent? The Dye represented DNA

2. What is the main difference between the dye lab we did, and an electrophoresis lab we may do in the future with real DNA? The main difference is that DNA is negatively charged and will only move in one direction—towards the positive electrode. Therefore the wells in the gel will be located on one end of the gel and not in the middle.


Electrophoresis Post Lab


1. In your own words, explain how PCR can amplify a molecule of DNA 1 billion times - or more - in just few hours!

2. How many copies of DNA would result if you did 25 cycles of PCR?


1. In your own words, explain how PCR can amplify a molecule of DNA 1 billion times - or more - in just few hours!

PCR duplicates each strand of DNA per cycle. The first cycle will make four copies and so on and so forth. It only takes a few seconds to duplicate the DNA strand, therefore a billion copies can made within a couple of hours.2. How many copies of DNA would result if you did 25

cycles of PCR?

Number of copies of DNA obtained after 'n' cycles = 2(n+1) = 67,108,864


Chapter 2 and worksheet on polymers. When finished, define the following terms in your journals using the chapter 2 packet and draw a picture or diagram of the word.Cytology Anatomy Physiolog

yRespiration

Unicellular

Tissue Organ Protein Eukaryotic Protist

Organelles Mitochondria

Sugar Starch Nucleic acids

Lipids Pancreas Hormone Chlorophyll Photosynthesis

Chloroplast cytoplasm Lysosome Ribosome Cell wall

Cellulose Plasma membrane

Glucose Adenosine triphosphate

Nucleus

Chromosomes

Enzyme Pigments Messenger RNA (mRNA)

Amino acids


1. In the structure of DNA, which two bases are the “purine” bases and which two are the “pyrimidine” bases?

2. Which one is the larger one?


1. In the structure of DNA, which two bases are the “purine” bases and which two are the “pyrimidine” bases?

The Purine bases are A and G, Pyrimidine bases are C and T2. Which one is the larger one?The Purine bases are larger than the pyrimidine bases. Please draw the following in your journals.


Define the following terms in your journals using the Raw Materials of Biotechnology packet and draw a picture or diagram of the word.1. Cytology 2. Anatomy 3.

Physiology4. Respiration

5. Unicellular

6. Tissue 7. Organ 8. Protein 9. Eukaryotic 10. Protist

11. Organelles

12.Mitochondria

13. Sugar 14. Starch 15. Nucleic acids

16. Lipids 17. Pancreas 18. Hormone

19. Chlorophyll

20. Photosynthesis

21. Chloroplast

22. cytoplasm

23. Lysosome

24. Ribosome 25. Cell wall

26. Cellulose 27. Plasma membrane

28. Glucose

29. Adenosine triphosphate

30. Nucleus

31. Chromosomes

32. Enzyme 33. Pigments

34. Messenger RNA (mRNA)

35. Amino acids


1. How are monomers related to polymers?2. When polymers are broken down into monomers,

what would your body do with those monomers?


1. How are monomers related to polymers? A monomer is the repeating unit that makes up polymers. A polymer is a large molecule that is made up of the many repeating subunits (monomers).2. When polymers are broken down into monomers,

what would your body do with those monomers? The body uses those monomers for protein construction and respiration.Monomers are generally linked together through a process called dehydration synthesis, while polymers are disassembled through a process called hydrolysis. Both of these chemical reactions involve water. In dehydration synthesis, bonds are formed linking monomers together while losing water molecules. In hydrolysis, water interacts with a polymer causing bonds that link monomers to each other to be broken.

http://nhscience.lonestar.edu/biol/dehydrat/dehydrat.html

http://www.avogadro.co.uk/organic/hydrolysis/hydrolysis.htm


Using your chapter 2 packet define the following vocabulary words in your journals with a picture or diagram:

36.Polypeptide 37.Vero cells

38.HeLa cells

39. Prokaryotic

40. Anaerobic respiration

41. Macromolecule

42.Organic 43.Carbohydrates

44.Cytoskeleton

45.Polymer

46.Monosaccharide

47.Disaccharide

48.Polysaccharide

49.Fructose 50. Sucrose

51. Lactose 52. Amylose

53.Amylopectin

54.Glycogen 55.Cellular respiration

56. Deoxyribose 57.Ribose 58. Hydrophobic

59.Triglycerides

60.Phospholipids

61. Hydrophilic 62. Steroids

63. R group 64. RNA 65.Nucleotides

Biotech Warm Up November 21st, 2013

1. What are strands of amino acids connected to one another called?

2. What are the monomers that make up DNA?

Biotech Warm Up November 21st, 2013

1. What is a strand of amino acids connected to one another called?

Polypeptides2. What are the monomers that make up DNA?Nucleotides

Biotech Agenda November 21st, 2013

Using your chapter 2 packet, complete the following:Questions 1-4 in section 2.1 page 46Questions 1-4 in section 2.2 page 51Questions 1-4 in section 2.3 page 61Questions 1-4 in section 2.4 page 63WRITE THE ANSWERS IN COMPLETE

SENTENCES IN YOUR JOURNALS!

Biotech Agenda November 22nd, 2013

Using your chapter 2 packet, finish the questions and define the following vocabulary words in your journals with a picture or diagram:

1.Polypeptide 2.Vero cells

3.HeLa cells 4. Prokaryotic

5. Anaerobic respiration

6. Macromolecule

7.Organic 8.Carbohydrates

9.Cytoskeleton

10.Polymer

11.Monosaccharide

12.Disaccharide

13.Polysaccharide

14.Fructose 15. Sucrose

16. Lactose 17. Amylose

18.Amylopectin

19.Glycogen 20.Cellular respiration

21. Deoxyribose 22.Ribose 23. Hydrophobic

24.Triglycerides

25.Phospholipids

26. Hydrophilic 27. Steroids

28. R group 29. RNA 30.Nucleotides

Biotech Warm Up December 2nd, 2013

1. What is glycogen?2. What is glycerol?3. What is hair and the baleen food-filtering system

in the mouth of humpback whales composed of?

Biotech Warm Up December 2nd, 2013

1. What is glycogen?Glycogen is an animal starch with branched glucose chains.2. What is glycerol?Glycerol is the building block to all lipids known as triglycerides. 3. What is hair and the baleen food-filtering system

in the mouth of humpback whales composed of?Hair and baleen on humpback whale is composed of keratin protein molecules.

http://en.wikipedia.org/wiki/Lipid

http://en.wikipedia.org/wiki/Triglycerides

Biotech Agenda December 2nd, 2013

We will create a model of DNA using paper and colored markers or pencils.When you have finished labeling your base pairs and coloring your paper model we will watch a short video to instruct you on how to fold the model.

Biotech Warm Up December 3rd, 2013

1. What is the Central Dogma of Biology?2. What do lysosomes do?

Biotech Warm Up December 3rd, 2013

1. What is the Central Dogma of Biology?The Central Dogma of Biology states that DNA codes for RNA and that RNA codes for proteins (DNA->mRNA->proteins). Once scientists had described the Central Dogma, they could propose and test strategies for manipulating protein production by manipulating DNA and RNA codes. Moving genes into cells to produce new proteins is the basic principle in genetic engineering.2. What do lysosomes do?A lysosome is a membrane-bound organelle that is responsible for the breakdown of cellular waste.

Biotech Agenda December 3rd, 2013

We will create a model of DNA using paper and colored markers or pencils.

When you have finished labeling your base pairs and coloring your paper model we will watch a short video to instruct you on how to fold the model.

I will grade your vocab, pictures, and questions from the week before the holiday.

Biotech Warm Up December 4th, 2013

1. Name two differences between a prokaryotic cell and eukaryotic cell.

2. What do red blood cells lack that most other eukaryotic cells contain?


1. Name two differences between a prokaryotic cell and eukaryotic cell.

A prokaryotic cell does not contain organelles and vary in how they utilize sugar.2. What do red blood cells lack that most other

eukaryotic cells contain?The doughnut shape of mammalian RBCs results from the loss of a nucleus during maturation.

Biotech Agenda December 4th, 2013

PPT: An Introduction to Genes and Genomes

You will get into groups of 5Each person will have two slides with

notes that they will explain to the rest of the group—while the group writes the notes on their guided notes handouts.

I will time each personYou will have 2 minutes to explain each

slide while the team mates write notes


1. What do plant cells contain that animal cells do not?

2. What is the monomer that builds carbohydrates?


1. What do plant cells contain that animal cells do not?

Most plant cells contain chloroplasts and a rigid cell wall. Animal cells do not posses cell walls.

2. What is the monomer that builds carbohydrates?Glucose or a form of it and can include monosaccharides, disaccharides as well as polysaccharides.


QUIZPPT. STRUCTURE OF DNA


1. How many chromosomes are in the human genome?

2. How do the matching base pairs bond together in the DNA molecule?


1. How many chromosomes are in the human genome?

There are 46 chromosomes: 23 pairs of chromosomes. 22 pairs of autosomes and one pair of sex chromosomes.2. How do the matching base pairs bond together in

the DNA molecule? The matching base pairs attach themselves to each other (a purine to a pyrimidine) with hydrogen bonding.


How tall would one strand of DNA be stretched out? How many times would all the DNA in all of our cells

stretch to the sun? What does DNA stand for? How many letters are in the code for a human? How many chromosomes are in a human?What are the monomers that make up DNA?What are the three parts to the DNA molecule? What number prime does he start with on the right

side? Which means that the other side has to begin with…?What are the three MAJOR DIFFERENCES

BETWEEN DNA and RNA


1. Name the two pyrimidines. How many rings do they have?

2. Name the two purines. How many rings do they have?


1. Name the two pyrimidines. How many rings do they have? Cytosine and thymine, they have one ring.

2. Name the two purines. How many rings do they have? Adenine and guanine, they have two rings.


1. How tall would one strand of DNA be stretched out? 2. How many times would all the DNA in all of our

cells stretch to the sun? 3. What does DNA stand for? 4. How many letters are in the code for a human? 5. How many chromosomes are in a human?6. What are the monomers that make up DNA?7. What are the three parts to the DNA molecule? 8. What number prime does he start with on the right

side? 9. Which means that the other side has to begin

with…?10. What are the three MAJOR DIFFERENCES

BETWEEN DNA and RNA


1. What is the 3’ and 5’ in reference to?2. What does it mean that the two strands of DNA

run “anti-parallel” to one another?


1. What is the 3’ and 5’ in reference to? It refers to the direction of the individual strand of DNA. It is in reference to the number of the carbon atom on the sugar (deoxyribose), clockwise from the oxygen.

2. What does it mean that the two strands of DNA run “anti-parallel” to one another? One strand runs in one direction and the other strand runs in the other direction in reference to the #3 or #5 carbon on the molecule counting clockwise from the oxygen.


You will build a model of DNA using household items (anything you want)

Criteria: Groups no larger than 3 The following items must be present and apparent:

1. Sugars2. Phosphate3. 4 distinct bases4. Hydrogen bonds EXTRA CREDIT Distinguish between purines and pyrimidines Pick a specific DNA sequence from a real organism and show it to me

TODAY’S EXIT SLIP Group members (3 per group MAX!) Ideas for items to use (at least 3) Potential size Who will bring what tomorrow to get started


1. In which direction does the DNA polymerase add nucleotides?

2. What has to be present in order for DNA polymerase to begin adding nucleotides?


1. Which direction does DNA polymerase add nucleotides? DNA polymerase builds from 5’ to 3’ which means it must start on the 3’ strand.

2. What has to be present in order for DNA polymerase to begin adding nucleotides? An RNA primer must begin the process for DNA polymerase.




1. Sugars2. Phosphate3. 4 distinct bases4. Hydrogen bonds EXTRA CREDIT distinguish between purines and pyrimidines Use a genuine, specific DNA sequence from an organism

Put your name on the handout and start filling it out.


1. What is the enzyme that separates the DNA strands to enable duplication?

2. How do you number the deoxyribose or ribose sugar?


1. What is the enzyme that separates the DNA strands to enable duplication? The enzyme is called Helicase.

2. How do you number the deoxyribose sugar? Draw an example. You number the carbons in the deoxyribose starting to the right of the oxygen atom.




1. Sugars2. Phosphate3. 4 distinct bases4. Hydrogen bonds EXTRA CREDIT distinguish between purines and pyrimidines

TODAY’S AGENDA BUILD THE MODEL!!


1. What is the enzyme that binds the “Okazaki” fragments after the DNA polymerase has built them?

2. What is the “replication fork?”


1. What is the enzyme that binds the “Okazaki” fragments after the DNA polymerase has built them? DNA Ligase

2. What is the “replication fork?” The beginning area of the “split” in the DNA strands.





TODAY’S AGENDA BUILD AND PRESENT!


1. What is needed to hold the strands apart while replication is proceeding?

2. What is meant when we say that DNA replicates “semi-conservatively?”


1. What is needed to hold the strands apart while replication is proceeding? Binding proteins are needed to hold the strands apart.

2. What is meant when we say that DNA replicates “semi-conservatively?” It means that replication uses an original strand to make a complementary strand.





TODAY’S AGENDA FINISH PRESENTATIONS!


DNA Model Presentations

Biotech Warm Up, Wed Dec 18th, 2013

1. What is a codon?2. How many nitrogenous bases create a codon?


1. What is a codon? A code for an amino acid2. How many nitrogenous bases create a codon?Three bases.


DNA Model Presentations


1. How many carbons are in a pentose sugar?2. Which carbon does the nitrogenous base attach to?3. Which carbon does the phosphate attach to?

Biotech Warm Up, Thurs Dec 19th, 2013

1. How many carbons are in a pentose sugar? There are 5 carbons in a pentose sugar.

2. Which carbon does the nitrogenous base attach to? The carbon the nitrogenous base attaches to is the #1 carbon.

3. Which carbon does the phosphate attach to? The phosphate attaches to the #5 carbon in the sugar.


Complete the hand out on the structure of DNA.

Biotech Warm Up, Fri Dec 20th, 2013

1. Name at least 10 things you plan to do on Christmas break.

Biotech Warm Up, Tues Jan 7th, 2014

1. Using the following chart, determine the amino acid(s) the following sequence would make: UCAUUUGGCCAAUGA

Biotech Warm Up, Tues Jan 7th, 2014

1. Using the following chart, determine the amino acid(s) the following sequence would make: UCAUUUGGCCAAUGA

Serine, Phenylalanine, glycine,Glutamine, stop

Biotech Agenda Jan 7th, 2014

FINISH “PHOTO 51” AND TURN IN WORKSHEET TODAY FOR A GRADE!

Biotech Warm Up, Wed Jan 8th, 2014

1. Name the 4 macromolecules we have studied.2. Name a function of each.

Biotech Warm Up, Wed Jan 8th, 2014

1. Name the 4 macromolecules we have studied. The four macromolecules we have studied are lipids, carbohydrates, proteins and nucleic acids.

2. Name a function of each. Lipids are fats and triglycerides: long term energy storage, forming cell membranes, and hormones and vitamins. Carbohydrates are for short term energy storage and structural components in cells, such as the cell walls of plants. Proteins are made up of amino acids (20 different types). Proteins act as enzymes or structural units in cells. They perform most of the work in a cell: metabolism, memory, hormone action and movement. Nucleic acids act as a blueprint from which all the instructions for building our cells comes from.


REVIEW PACKET: YOU ONLY GET ONE, PUT YOUR NAME ON IT

WORTH TWO DAILY GRADESWE ARE GOING TO LIBRARY TO DO A SIMULATION

& QUIZhttp://sites.fas.harvard.edu/~

biotext/animations/replication1.swfhttp://highered.mcgraw-hill.com/sites/0072943696/st

udent_view0/chapter3/animation__dna_replication__quiz_1_.html

Once you submit your quiz results, email them to [email protected] are only required to put in your name and email address

http://sites.fas.harvard.edu/~biotext/animations/replication1.swf

http://sites.fas.harvard.edu/~biotext/animations/replication1.swf

http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__dna_replication__quiz_1_.html




mailto:[email protected]

Biotech Warm Up, Friday Jan 10th, 2014

1. Why do cells need to replicate their DNA?2. Write down 10 things (OR MORE!) you know about DNA

and replication.

Biotech Warm Up, Friday Jan 10th, 2014

1. Why do cells need to replicate their DNA? Cells divide for an organism to grow or reproduce, every new cell needs a copy of the DNA or instructions to know how to be a cell. DNA replicates right before a cell divides.

2. Write down 10 things you know about DNA, RNA and/or replication.

1. DNA has 4 bases2. Those bases are adenine, thymine, guanine and cytosine3. Two of them are pyrimidines and two are purines.4. The two pyrimidines are thymine and cytosine.5. The two purines are adenine and guanine.6. Pyrimidines are single-ringed molecular structures.7. Purines are double-ringed molecular structures.8. RNA uses uracil instead of thymine.9. DNA polymerase is the enzyme that creates the new strand

during replication.10. DNA helicase is the enzyme that splits the DNA molecules into

two strands to allow for replication.


Review for MidtermJan 13th-17th Midterms and reviewNo Warm Ups

Biotech Warm Up, Wednesday Jan 21th, 2014

1. What is the CENTRAL DOGMA OF BIOLOGY?

Dogma-Dogma is a principle or set of principles laid down by an authority as incontrovertibly true.[1] It serves as part of the primary basis of an ideology, nationalism or belief system, and it cannot be changed or discarded without affecting the very system's paradigm, or the ideology itself. They can refer to acceptable opinions of philosophers or philosophical schools, public decrees, religion, or issued decisions of political authorities. -WIKI

http://en.wikipedia.org/wiki/Dogma

http://en.wikipedia.org/wiki/Ideology

http://en.wikipedia.org/wiki/Nationalism

http://en.wikipedia.org/wiki/Paradigm


1. What is the CENTRAL DOGMA OF BIOLOGY? The central dogma of biology is that DNA codes for RNA which codes for proteins which is the source of all life.

Dogma-Dogma is a principle or set of principles laid down by an authority as incontrovertibly true.[1] It serves as part of the primary basis of an ideology, nationalism or belief system, and it cannot be changed or discarded without affecting the very system's paradigm, or the ideology itself. They can refer to acceptable opinions of philosophers or philosophical schools, public decrees, religion, or issued decisions of political authorities. -WIKI

http://en.wikipedia.org/wiki/Dogma

http://en.wikipedia.org/wiki/Ideology

http://en.wikipedia.org/wiki/Nationalism

http://en.wikipedia.org/wiki/Paradigm

Biotech Warm Up, Thursday Jan 23rd, 2014

1. What is a protein? 2. What are the building blocks of proteins?3. Write down anything you think you may know about

proteins.

Biotech Warm Up, Thursday Jan 23rd, 2014

1. What is a protein? 2. What are the building blocks of proteins?3. Write down anything you think you may know about

proteins.Proteins are large biological molecules, or macromolecules, consisting of one or more chains of amino acid residues. Proteins perform a vast array of functions within living organisms, including catalyzing metabolic reactions, replicating DNA, responding to stimuli, and transporting molecules from one location to another. Proteins differ from one another primarily in their sequence of amino acids, which is dictated by the nucleotide sequence of their genes, and which usually results in folding of the protein into a specific three-dimensional structure that determines its activity. -WIKI

http://en.wikipedia.org/wiki/Biomolecule

http://en.wikipedia.org/wiki/Macromolecule

http://en.wikipedia.org/wiki/Amino_acid

http://en.wikipedia.org/wiki/Enzyme_catalysis

http://en.wikipedia.org/wiki/DNA_replication

http://en.wikipedia.org/wiki/Cell_signaling

http://en.wikipedia.org/wiki/Nucleotide_sequence

http://en.wikipedia.org/wiki/Genes

http://en.wikipedia.org/wiki/Protein_folding

http://en.wikipedia.org/wiki/Protein_structure

Biotech Agenda Jan 23rd, 2014

While watching the videos, answer the following questions:1. What is translation?2. What is a ribosomal unit3. What is a polypeptide?4. What is transcription?5. What is tRNA?6. What is an exon?7. What is an intron?8. What is mRNA?9. What is hydrophobic?10. What is hydrophilic?11. What is the TATA box?12. What is the site called that binds to the codon?

Biotech Warm Up, MondayJan 27th, 2014

1. What does tRNA do?2. What does mRNA do?3. What is a ribosomal unit?4. Draw this diagram.

Biotech Warm Up, MondayJan 27th, 2014

1. What does tRNA do? Transfer RNA brings the amino acids to the ribosomal unit.

2. What does mRNA do? mRNA has the original code (modified with uracil) as the template for making proteins.

3. What is a ribosomal unit? A ribosome connected to the mRNA, allowing tRNA to bring in amino acids and connecting them.


We will do a popcorn reading! Chapter 5I will assign someone to begin the reading.That person will read a minimum of two lines (more if

you would like!)Then call on someone to continue the reading.Everyone starts with a 100% participation grade. If you are called on, and don’t know where we are in

the reading you lose 10 points—each time.Write the questions on the last page in your journals.Once you answer them, I will come by and stamp

them.

Cardinal Time Agenda Jan 27th, 2014

Pick a vocabulary word.Draw a picture and the definition on a sheet of paper

to display in front of the class:

mRNA tRNA tertiary structure Peptide chain reverse transcriptase monoclonal antibody epitopes Hybridoma ELISA ribosomal unit translation

transcription Codon anitcodon hydrophobic hydrophilic non-polar Alanine valine isoleucine leucineproline methionine Phenylalanine tryptophan glycine cysteine serine

threonine Tyrosine asparagine gluatamine arginine

histidine Lysine aspartic acid glutamic acid hybridoma

Biotech Warm Up, WednesdayJan 29th, 2014

Write down the following questions and then answer while watching the animation.1. What are the three sites in the ribosomal unit?2. What is the function of each?http://www.proteinsynthesis.org/what-is-protein-synthesis/

http://www.proteinsynthesis.org/what-is-protein-synthesis/



Write down the following questions and then answer while watching the animation.1. What are the three sites in the ribosomal unit? A

(aminoacyl or acceptor site), P (peptidyl site), and E (exit site)

2. What is the function of each? Acceptor site accepts the tRNA with an amino acid on it. Peptidyl site accepts the peptidyl-tRNA (a tRNA with the growing peptide attached. The empty tRNA goes to the exit site and gets released by the ribosomal unit.





Answer the questions on the back of the chapter 5 handout in your journals.

Each student will be assigned a specific amino acid and line up in a particular order.

You will have one hand on the next person’s shoulder.You will arrange yourselves according to the

properties listed on your amino acid.

Biotech Warm Up, Thursday Jan 30th, 2014

1. Where does transcription happen in the cell?2. What happens to the mRNA before it leaves the nucleus?We will watch a short animation to refresh your memory.

http://upload.wikimedia.org/wikipedia/commons/9/98/RNAP_TEC_small.jpg

Biotech Warm Up, ThursdayJan 30th, 2014

1. Where does transcription happen in the cell? Inside the nucleus.

2. What happens to the mRNA before it leaves the nucleus? It is modified:

Introns are spliced out 7 methyl guanosine cap Poly-A tail

http://upload.wikimedia.org/wikipedia/commons/9/98/RNAP_TEC_small.jpg


We will go through a ppt. on transcription and translation

Biotech Warm Up, Friday Jan 31st, 2014

1. How does translation know where to begin?2. How does translation know when to end?3. What is the part in the middle called?

Biotech Warm Up, Friday Jan 31st, 2014

1. How does translation know where to begin? It always begins at a start codon.

2. How does translation know when to end? It always ends at a stop codon.

3. What is the part in the middle called? The Open Reading Frame (ORF)

Biotech Agenda Jan 31st, 2014

PPT.

Biotech Warm Up, Monday Feb 3rd, 2014

Look at the picture below to answer the following questions. 1. On the red strand at the bottom of the picture, what are

the three letter codes located in the three sites called?2. What does the red strand represent?3. What are the three letters above those that are pairing

with them called?4. Which actually determines theamino acid, the codon or anticodon?

Biotech Warm Up, MondayFeb 3rd, 2014

Look at the picture below to answer the following questions. 1. On the red strand at the bottom of the picture, what are

the three letter codes located in the three sites called? Codons

2. What do they do? The code for amino acids to make proteins.

3. What are the three letters above those that are pairing with them called? Anticodons

4. What actually determines theamino acid, the codon or the anticodon?The codon from the mRNA determines the amino acid.

Biotech Agenda Feb 3rd, 2014

What is a Protein Handout

Biotech Warm Up, TuesdayFeb 4th, 2014

This is the order of bonding that occurs in protein folding:1. Disulfide bonds – sulfide molecules2. Hydrogen bonds – partial positive and negative charges in

water3. Charges – positive and negative charges in ionic bonding

4. Polarity – hydrophobic and hydrophilic regions

Biotech Agenda Feb 4th, 2014

Finish Worksheets (10 mins) Grade papers

Biotech Warm Up, WednesdayFeb 5th, 2014

1. What is the difference between RNA Polymerase and DNA Polymerase?

2. Why do they call the ribosomal unit a “protein factory?”


1. What is the difference between RNA Polymerase and DNA Polymerase?

RNA polymerase (RNAP or RNApol), also known as DNA-dependent RNA polymerase, is an enzyme that produces primary transcript RNA. In cells, RNAP is necessary for constructing RNA chains using DNA genes as templates, a process called transcription. DNA polymerase replicates DNA by semi-conservative replication—one old strand and one new strand.2. Why do they call the ribosomal unit a “protein factory?”The ribosomal unit is made up of a 30S sub-unit and 50S sub-unit. It is also composed of the mRNA and tRNA. It synthesizes proteins by connecting amino acids through peptide bonds.

http://en.wikipedia.org/wiki/Enzyme

http://en.wikipedia.org/wiki/Primary_transcript

http://en.wikipedia.org/wiki/RNA

http://en.wikipedia.org/wiki/Cell_(biology)

http://en.wikipedia.org/wiki/Gene

http://en.wikipedia.org/wiki/Transcription_(genetics)


SIMULATION Transcription Translation Protein synthesisWe will demonstrate on the board the process of transcription, translation and protein synthesis. Then you practice at your table.

Biotech Warm Up, ThursdayFeb 6th, 2014

The strand of DNA reads AAAATGCCCGGTACCTTAAGGGCC1. What is the complementary mRNA strand read?2. What do the anticodons of the tRNA read?3. What are the amino acids that are created from this

strand?


The strand of DNA reads AAAATGCCCGGTACCTTAAGGGCC1. What is the complementary mRNA strand read?UUUUACGGGCCAUGGAAUUCCCGG2. What do the anticodons of the tRNA read?AAAAUGCCCGGUACCUUAAGGGCC3. What are the amino acids that are created from the

strand?Phenylalanine, Tyrosine, Glycine, Proline, Tryptophan, Asparagine, Serine, Arginine


ReviewGrades

Biotech Warm Up, MondayFeb 10th, 2014

1. What don’t you know about translation, transcription or protein folding? Write it down.

a. DNA polymeraseb. RNA polymerasec. mRNAd. tRNAe. Codonsf. Anticodons


TEST


1. When there is a mutation in a DNA sequence, but the amino acid is the same it is called a silent mutation. Why do you think this is? Look at the following example:


1. When there is a mutation in a DNA sequence, but the amino acid is the same it is called a silent mutation. Why do you think this is? Look at the following example:

It is called a silent mutation because it doesn’t really change anything. The change codes for the same amino acid so the protein will remain the same.Wild type or wildtype refers to the phenotype of the typical form of a species as it occurs in nature. Originally, the wild type was conceptualized as a product of the standard, "normal" allele at a locus, in contrast to that produced by a non-standard, "mutant" allele. It is now appreciated that most or all gene loci exist in a variety of allelic forms, which vary in frequency throughout the geographic range of a species, and that a uniform wild type does not exist. In general, however, the most prevalent allele e.g., the one with the highest gene frequency - is the one deemed as wild type.[1]

http://en.wikipedia.org/wiki/Phenotype

http://en.wikipedia.org/wiki/Species

http://en.wikipedia.org/wiki/Allele

http://en.wikipedia.org/wiki/Mutant

http://en.wikipedia.org/wiki/Frequency

http://en.wikipedia.org/wiki/Wild_type


Finish Chapter 2 PPT. Mutations


1. Where do antibiotics come from?2. Why don’t they always work?


1. Where do antibiotics come from? From bacteria as a defense mechanism against other bacteria.

2. Why don’t they always work? Bacteria become resistant. Video “Mutations, Selection the Bacteria Resist”


Write down the following questions in your journals. Leave space to answer them while watching the video clip—Mutations, DNA Mutation, and an introduction to Extra Chromosomal Mutations.1. Are mutations always bad?2. What is the analogy he uses to explain mutations?3. What are spontaneous mutations?4. What are induced mutations?5. How does benzo (a) pyrene cause cancer?6. What is a substitution mutation?7. What happens 50% of the time with substitutions?8. What is an insertion mutation?9. What is a deletion mutation?10. What is duplication?11. What is an inversion?12. What is an insertion?13. What is a translocation?


1. When do inversion and translocations mutations occur?2. Name two mutations that are beneficial.


1. When do inversion and translocations mutations occur? During Meiosis

2. Can you think of an example of a mutation that is beneficial?


Food, Inc. and movie sheet


1. Why does most of our food contain corn?2. What does corn do the pH of the cow’s stomach?


1. Why does most of our food contain corn? It is heavily subsidized by the U.S. Government—between $2-$10 billion a year.

2. What does corn do the pH of the cow’s stomach? It makes it more acidic—lowering the pH. This promotes evolution of dangerous strains of E. coli. It also increases the amount of the bacteria in the cow’s stomach.

3. Subsidy-A subsidy is a form of financial or in kind support extended to an economic sector (or institution, business, or individual) generally with the aim of promoting economic and social policy.

4. Polyploid cells and organisms are those containing more than two paired sets of chromosomes. Most eukaryotic species are diploid, meaning they have two sets of chromosomes—one set inherited from each parent.

http://en.wikipedia.org/wiki/Institution


Banana and Strawberry DNA extraction Pre-LabThere are three handouts with instructions on how to do the DNA extraction lab. You will use these handouts to answer the following questions in your journals:1. Where is DNA present?

Is DNA in the food you eat?2. Strawberries are octoploid. What does this mean?3. The lab requires a salt buffer. What does the salt do?4. The lab requires soap. What does the soap do?5. The lab requires alcohol. What does the alcohol do?Please write the following definitions:Precipitate-cause (a substance) to be deposited in solid form from a solution.

Soluble-(of a substance) able to be dissolved, esp. in water. E.g. DNA is not soluble in alcohol.

After you have completed all of the above, write down all procedures for your DNA extraction lab. You will only be able to rely on your notes tomorrow.THERE WILL BE NO PROCEDURES FOR YOU TO FOLLOW!!!

Biotech Warm Up, Wednesday Feb 19th, 2014

1. How many products do we eat that have genetically modified organisms in them?

2. Are GMO’s (genetically modified organisms) labeled? Why or why not?

http://justlabelit.org/



Biotech Warm Up, Wednesday Feb 19th, 2014

1. How many products do we eat have genetically modified organisms in them? 1000s

2. Are GMO’s (genetically modified organisms) labeled? Why or why not? Not in the USA





Banana and Strawberry DNA extraction LabYou will work in groups of 4.There will be supplies at each lab table.Please have your materials list and procedures.When you have finished, clean up your station and set it up for the next class.Do Conclusions and Analysis on the handout in your journals.

Biotech Warm Up, Thursday Feb 20th, 2014

1. What was the difference between the DNA we extracted from the strawberries and the bananas?

2. Why was there a difference between the two?

Biotech Warm Up, Thursday Feb 20th, 2014

1. What was the difference between the DNA we extracted from the strawberries and the bananas? There was more DNA from the strawberries than the bananas.

2. Why was there a difference between the two? Because strawberries are octoploid and bananas are triploid.


Banana and Strawberry DNA extraction Lab Conclusion (10-15 min)http://www.dnalc.org/view/15529-Radiation-can-cause-DNA-mutations-3D-animation-with-narration.htmlMutations worksheets

http://www.dnalc.org/view/15529-Radiation-can-cause-DNA-mutations-3D-animation-with-narration.html



Biotech Warm Up, Friday Feb 21st, 2014

1. What is a mutagen?2. What did Rosalind Franklin die of? What was she

exposed to that probably caused it?3. How is the ozone layer necessary for our survival?

Biotech Warm Up, Friday Feb 21st, 2014

1. What is a mutagen? A mutagen is an agent that causes mutations.

2. What did Rosalind Franklin die of? What was she exposed to that probably caused it? She dies of ovarian cancer probably caused by the x-rays she was exposed to.

3. How is the ozone layer necessary for our survival? Human exposure to UV-B increases the risk of skin cancer, cataracts, and a suppressed immune system. UV-B exposure can also damage terrestrial plant life, single cell organisms, and aquatic ecosystems.

Biotech Agenda Feb 21st, 2014

Finish mutations worksheets


1. What is radioactive decay?2. Why do large elements need more neutrons than smaller

elements?3. What is alpha, beta and gamma decay?http://www.youtube.com/watch?v=oFdR_yMKOCw

http://www.youtube.com/watch?v=oFdR_yMKOCw

http://www.youtube.com/watch?v=oFdR_yMKOCw


1. What is radioactive decay? Radioactive decay, also known as nuclear decay or radioactivity, is the process by which a nucleus of an unstable atom loses energy by emitting particles of ionizing radiation. A material that spontaneously emits this kind of radiation—which includes the emission of energetic alpha particles, beta particles, and gamma rays—is considered radioactive.

2. Why do large elements need more neutrons than smaller elements? Because protons are positively charged and are repelled by each other. Without many more neutrons, the nucleus would fall apart.

3. What is alpha, beta and gamma decay? Alpha loses two protons and two neutrons, beta loses an electron(positron or electron) and gamma emits high frequency energy.

http://en.wikipedia.org/wiki/Atomic_nucleus

http://en.wikipedia.org/wiki/Atom

http://en.wikipedia.org/wiki/Ionizing_radiation

http://en.wikipedia.org/wiki/Alpha_particle

http://en.wikipedia.org/wiki/Beta_particle

http://en.wikipedia.org/wiki/Gamma_ray


Finish mutations worksheetsWatch Chernobyl


1. Which type of radiation is the most dangerous to living organisms?

Radiation causing mutations video cliphttp://www.youtube.com/watch?v=prQlj890YIE

http://www.youtube.com/watch?v=prQlj890YIE



Which type of radiation is the most dangerous to living organisms and why? All ionizing radiation causes similar damage at a cellular level, but because rays of alpha particles and beta particles are relatively non-penetrating, external exposure to them causes only localized damage, e.g. radiation burns to the skin. Gamma rays and neutrons are more penetrating, causing diffuse damage throughout the body (e.g. radiation sickness, cell's DNA damage, cell death due to damaged DNA, increasing incidence of cancer) rather than burns. http://www.youtube.com/watch?v=prQlj890YIE

http://en.wikipedia.org/wiki/Ionizing_radiation

http://en.wikipedia.org/wiki/Alpha_particle

http://en.wikipedia.org/wiki/Beta_particle

http://en.wikipedia.org/wiki/Radiation_burn

http://en.wikipedia.org/wiki/Radiation_sickness



Finish Chernobyl


1. The nucleus does not containa. Electronsb. Protonsc. Neutrons

2. The mass number represents the number of a. Protons and neutronsb. Protons and electronsc. Electrons and neutronsd. None of the above


1. The nucleus does not containa. Electrons

2. The mass number represents the number of a. Protons and neutrons


Bill Nye Greatest Discoveries Genetics


1. The most penetrating of the following radiations isa. Alpha.b. Beta.c. Gamma

2. When dealing with the biological effects of radiation, we distinguish between external and internal hazards. Which of the following is the least dangerous as an external hazard?

a. Alpha.b. Beta.c. Gamma


1. The most penetrating of the following radiations isc. Gamma

2. When dealing with the biological effects of radiation, we distinguish between external and internal hazards. Which of the following is the least dangerous as an external hazard?

a. Alpha.


Mutations Worksheets

Biotech Warm Up, FridayFeb 28th, 2014

1. The chemical properties of an atom are determined by its

a. Atomic numberb. Number of isotopesc. Ability to fissiond. Mass number

2. Name three things you learned in the Chernobyl video.

a. b. c.

Biotech Warm Up, FridayFeb 28th, 2014

1. The chemical properties of an atom are determined by its

a. Atomic number

2. Name three things you learned in the Chernobyl videos.

Chernobyl was largely a farming community before the accidentWildlife has flourished since the humans moved outThere is still lots of radioactive material in the soil, in the plants, and in the animals that live theirAs long as humans aren’t digging around in soil, they don’t have to wear protective gear.Dormouse have a large percentage of mutations, however, the population overall is healthy.


Go Over TestOpen Notes Quiz

Biotech Warm Up, TuesdayMarch 4th, 2014

1. A mutation is …2. Very high __________ are mutagens.3. Mutations provide the __________ that are the basis of

changes in a species.

Biotech Warm Up, Tuesday March 4th, 2014

1. A mutation is …2. Very high __________ are mutagens.3. Mutations provide the __________ that are the basis of

changes in a species.

Biotech Agenda March 4th, 2014

Grade Mutations Worksheets

Biotech Warm Up, WednesdayMarch 5th, 2014

1. A change in DNA that changes one base, but does not change the amino acid is called…

2. A change in the DNA that adds a nucleotide or removes one is called a ____ or ____ and causes a _____________.


1. A change in DNA that changes one base, but does not change the amino acid is called…

a point mutationa substitutiona silent mutation

2. A change in the DNA that adds a nucleotide or removes one is called a deletion or insertion and causes a frameshift.


Grade Mutations WorksheetsArticle on mutations

Biotech Warm Up, ThursdayMarch 6th, 2014

1. Sickle cell is caused from this type of mutation.


1. Sickle cell is caused from this type of mutation. Sickle cell anemia is caused by a substitution, point mutation.


Pain MovieEXIT SLIP: GET OUT A PIECE OF PAPER. WRITE DOWN THE FOLLOWING WORDS:

GENEMUTATIONHEREDITYBENEFICIALDETRIMENTALINDUCED

Biotech Warm Up, FRIDAYMarch 7th, 2014

1. Write down your plans for spring break. Write down at least 10 things you will do.


SENIOR SKIP DAY! WHOO HOO!Ebola Virus NOVA movie

Biotech Warm Up, MondayMarch 17th, 2014

1. ______________ - one base in DNA is changed to another.

2. A _____________ mutation is a type of DNA change, but the amino acid remains the same.

3. A _____________ is a permanent change in the genetic material of a cell.

4. Mutation can occur in two basic ways. One way is an incorrect substitution of a single base in a codon of a gene. This may or may not cause a change in the amino acid. It is called a _____ __________.

5. __________ are agents that interact with DNA to cause mutations (radiation, chemicals).


1. Substitution - one base in DNA is changed to another.

2. A silent mutation is a type of DNA change, but the amino acid remains the same.

3. A mutation is a permanent change in the genetic material of a cell.

4. Mutation can occur in two basic ways. One way is an incorrect substitution of a single base in a codon of a gene. This may or may not cause a change in the amino acid. It is called point mutation.

5. Mutagens are agents that interact with DNA to cause mutations (radiation, chemicals).


Go over test.


1. Four functions of proteins are:a. b. c. d.

2. There are ___ amino acids used to make proteins.3. An amino acid consists of a carbon atom surrounded

by:a. b. c. d.


1. Four functions of proteins are:a. structureb. molecular transportc. catalystd. hormones

2. There are 20 amino acids used to make proteins.3. An amino acid consists of a carbon atom surrounded

by:a. a carboxyl groupb. an amine groupc. an r-groupd. a hydrogen atom


Outbreak, the movie.


1. This type of mutation ___________ is, in general, not as damaging as this type of mutation __________.

2. In the movie about Ebola, what did the doctors do to save the nurses’ life?

3. What was the logic behind their thinking?


1. This type of mutation point mutation is, in general, not as damaging as this type of mutation deletion or insertion which results in a frameshift.

2. 2. In the movie about Ebola, what did the doctors do to save the nurses’ life? They gave her a blood transfusion from patients that had survived exposure to the disease.

3. What was the logic behind their thinking? They reasoned that the convalescent’s that had survived the virus had aniti-bodies that were combating the Ebola virus.


Computer LabYou will research a mutation in humans that causes a disorder. Write down the following questions in your journals.

1. What is the disorder?2. What kind of mutation causes the disorder? Be

specific, is it a point mutation, substitution, deletion, etc.3. Are there any treatments for the disorder? If so,

name them.4. Is this a common disorder? How many people are

afflicted each year?5. If you knew that you or a loved one could get this

disorder (even an unborn baby) what would you do , if anything? If this is not applicable to your disorder –disregard.


Computer Lab Please write your name next to the disorder you would like to learn about.18p deletion syndrome Turner syndrome Down syndromeTriple x syndrome Klinefelter syndrome47XYY syndrome Absent vasa AchondroplasiaAdrenal gland disorder Albinism Alexander diseaseAngelman syndrome Benjamin syndrome Bladder cancerBirt-Hogg-Dube syndrome Breast CancerFabry disease Cat cry syndrome Stickler syndromeCockayne syndrome Colorectal cancer Wilson’s diseaseMenkes disease Crouzon syndrome Crohn’s diseaseDwarfism Alzheimer disease Gunther disease


Computer Lab Please write your name next to the disorder you would like to learn about.Hereditary hemorrhagic telanglectasia Osteogenesis imperfectaAchondroplasia Hyperoxaluria primaryPhenylketonuriaPfeiffer syndrome Pheochromocytoma Noonan syndromeGaucher disease Mediterranean fever Patau syndromePendred syndrome Peutz-Jegners syndromeMuscular dystrophy Canavan disease Tay-Sachs diseaseThanatophoric dysplasia Thyroid disease Prion diseaseTreacher Collins syndrome hemochromatosisTuberous sclerosis Galactosemia Fragile x syndromeX-linked severe combined immunodeficiency Kennedy’s diseaseWilson disease Williams Syndrome Variegate porphyriaUsher syndrome


1. Breakage of a chromosome can lead to four types of changes in chromosome structure. List them.


1. Breakage of a chromosome can lead to four types of changes in chromosome structure. List them.

a. A deletion removes a chromosomal segment.b. A duplication repeats a segment.c. An inversion reverses a segment within a chromosome.d. A translocation moves a segment from one chromosome

to another. Translocations can occur within a chromosome (intrachromosomal) or between chromosomes (interchromosomal). In an intrachromosomal translocation, a segment breaks off the chromosome and rejoins it at a different location.


PresentationsYou will present your findings to the class.Write down the following questions in your journals for each disorder presented.

1. What is the disorder?2. What kind of mutation causes the disorder? Be

specific, is it a point mutation, substitution, deletion, etc.3. Are there any treatments for the disorder? If so,

name them.4. Is this a common disorder? How many people are

afflicted each year?5. If you knew that you or a loved one could get this

disorder (even an unborn baby) what would you do , if anything? If this is not applicable to your disorder –disregard.

Biotech Warm Up, FridayMarch 21st, 2014

1. Southern Blot: a method used for detection of a specific DNA sequence in DNA samples. Southern blotting combines transfer of electrophoresis-separated DNA fragments to a filter membrane and subsequent fragment detection by a probe.

Biotech Agenda March 21st, 2014

Continue Southern Blot ppt.


1. Why do bacteria have restriction enzymes?2. What does PCR have to do with DNA

fingerprinting?


1. Why do bacteria have restriction enzymes? Bacteria use restriction enzymes to chop up foreign viral DNA

2. What does PCR have to do with DNA fingerprinting? The DNA must be amplified in order to see the fragments in the gel.


Finish PresentationsFinish Outbreak


VectorsVectors are pieces of DNA that are used to

transfer genes into a host cell.Marker genes can be used to determine if the

gene has been taken up. Marker genes must have some distinguishable characteristic. For example if you put a gene that enables bacteria to be resistant to the antibiotic ampicillin resistance on the same vector as the gene for human insulin production, then any bacteria that are immune to ampicillin will also be able to produce insulin.


Chapter 3 ppt.Transformation (Griffith’s experiment)Gene CloningThe Sanger Method


1. What are all restriction sites?2. Why is E. coli a good organism for

transformation?


1. What are all restriction sites? Palindromes2. Why is E. coli a good organism for

transformation?i. Well studiedii. Has enzymes necessary for replicationiii. No nuclear membranesiv. Grows rapidly (20 min. generation time)v. Inexpensivevi. Normally not pathogenicvii. Easy to work with and transform


Chapter 3 ppt.Transformation (Griffiths Experiment)Gene CloningThe Sanger Method


1. What do we use DNA fingerprinting for?2. DNA Fingerprinting is extremely accurate.

However, there is one instance where it won’t help. What is that instance?

3. What shows are there that focus on forensic science? Write down as many as you can think of.


1. What do we use DNA fingerprinting for? To determine criminals and paternity.

2. DNA Fingerprinting is extremely accurate. However, there is one instance where it won’t help. What is that instance? Identical twins

3. What shows are there that focus on forensic science? Write down as many as you can think of.

CSI, Dexter, Bones, Law and Order, 48 Hours, Criminal Minds, Cold Cases


The Sanger Method Worksheet

Biotech Warm Up, FridayMarch 28th, 2014

1. What is a dideoxyribose and how does it stop replication?2. How many fragments did you obtain in the worksheet

yesterday?3. How do you use the Sanger Method to determine a DNA

sequence?

Biotech Warm Up, FridayMarch 28th, 2014

1. What is a dideoxyribose and how does it stop replication? Dideoxyribose is a nucleotide that is missed an oxygen so that bonding can not occur with the following nucleotide and replication stops.

2. How many fragments did you obtain in the worksheet yesterday? 16 fragments

3. How do you use the Sanger Method to determine a DNA sequence? By reading the gel from the positive side to the negative side you can determine the sequence of the replicated DNA and use that information to determine the template DNA.


DNA Sequencing Worksheet

Biotech Warm Up, MondayMarch 31st, 2014

1. Should plasmids that we use to clone genes have more than one restriction site? Why or why not?

2. Would restriction enzymes be useful if they cut DNA at random sites?

3. Why do we need a template (SINGLE) strand of DNA to perform the Sanger Method?

4. Which way do you read the gel when determining the DNA template for the Sanger Method?

Biotech Warm Up, MondayMarch 31st, 2014

1. Should plasmids that we use to clone genes have more than one restriction site? Why or why not? Plasmids should only have one restriction site so that it remains in one piece. Multiple sites result in multiply pieces which would reduce the number of useful recombination events.

2. Would restriction enzymes be useful if they cut DNA at random sites? If restriction enzymes cut in random sites, we would have no way of knowing how or if they would recombine to the desired gene.

3. Why do we need a template strand of DNA to perform the Sanger Method? The template strand needs to be single stranded because the process is base on duplication. We need the template strand in order to determine it’s sequence.

4. Which way do you read the gel when determining the DNA template for the Sanger Method? You read the gel from the positive to the negative side (on our paper it was from the bottom –up, smallest to largest).

Biotech Agenda March 31st, 2014

Grade WorksheetsQUIZ10. Which conclusion can correctly be made based on Griffith’s experiment when he mixed the DEAD smooth bacteria with the LIVE rough bacteria?

Biotech Agenda April 1st, 2014

Chapter 3 ppt. continued…

Biotech Warm Up, ThursdayApril 3rd, 2014

1. Why is PCR (polymerase chain reaction) so efficient? In other words, why can we amplify DNA so quickly?

2. Why is PCR so important in studying genetics?

Biotech Warm Up, ThursdayApril 3rd, 2014

1. Why is PCR (polymerase chain reaction) so efficient? In other words, why can we amplify DNA so quickly? PCR works so quickly because there are two template strands to copy at a time, which double, then double and so on…the result is exponential growth.

2. Why is PCR so important in studying genetics? PCR is so important when studying genetics because without millions of copies of DNA it would be much more difficult to do.

Biotech Agenda April 3rd, 2014

Manual PCR Simulation

Biotech Warm Up, FridayApril 4th, 2014

1. If you start out with one double strand of DNA, how many strands will you have after 6 PCR cycles?

2. How many will you have after 15 cycles?


1. If you start out with one double strand of DNA, how many strands will you have after 6 PCR cycles? 2n= 26 = 2x2x2x2x2x2=64

2. How many will you have after 15 cycles? 2n = 215= 2x2x2x2x2x2x2x2x2x2x2x2x2x2x2=32,768

Biotech Agenda April 4th, 2014

PCR Computer simulation – whole classWork sheet

Biotech Warm Up, MondayApril 7th , 2014

1. What is a transgenic organism?2. What is the process by which it becomes a transgenic

organism?3. Name a transgenic organism.

Biotech Warm Up, MondayApril 7th, 2014

1. What is a transgenic organism? An organism whose genetic material has been altered using genetic engineering techniques.

2. What is the process by which it becomes a transgenic organism? The process by which organisms take up and express foreign DNA is transformation.

3. Name a transgenic organism. Glofish, corn, cotton, mice, soybeans, pigs, and cats.

4. http://www.wired.com/science/discoveries/news/2007/12/YE_10_organisms

http://www.wired.com/science/discoveries/news/2007/12/YE_10_organisms



Computer Lab Google: Southern Blot AnimationGo to southern-blot TeachLine http://teachline.ls.huji.ac.il/72320/methods-tutorial/southern/southern-blot.htmlGo through the slidesThen watch Southern Blotting youtube http://www.youtube.com/watch?v=VmCTsmhx2_whttp://www.dnatube.com/video/1512/Southern-blotThen go through Animation 4.11, step through or narratedThen go to Animation Quiz 5 http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_5.htmlEmail results to [email protected] Keep watching until you UNDERSTAND the Southern Blotting technique!


http://teachline.ls.huji.ac.il/72320/methods-tutorial/southern/southern-blot.html



http://www.youtube.com/watch?v=VmCTsmhx2_w

http://www.youtube.com/watch?v=VmCTsmhx2_w

http://www.dnatube.com/video/1512/Southern-blot

http://www.dnatube.com/video/1512/Southern-blot

http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_5.html



mailto:[email protected]

Biotech Warm Up, TuesdayApril 8th, 2014

1. How is the Southern Blot Method used?2. Why is it important in the study of genetics?


1. How is the Southern Blot Method used? The Southern Blot method is used to permanently label a gene of interest that can be detected from among the many different DNA fragments.

2. Why is it important in the study of genetics? The Southern blot is important because it can locate DNA sequences that have similar sequences to the one being studied, which is how many functionally related genes have been discovered and characterized.

Southern Blot ppt.


Biotech Warm Up, WednesdayApril 9th, 2014

1. What is a “probe” in reference to the Southern Blot method?

2. What is hybridization?


1. What is a “probe” in reference to the Southern Blot method? A probe is a DNA fragment with a specific sequence whose presence in the target DNA is to be determined. The probe DNA is labelled so that it can be detected, usually by incorporating radioactivity or tagging the molecule with a fluorescent or chromogenic dye.

2. What is hybridization? Hybridization is when the probe attaches itself to the target DNA fragment.

Southern Blot worksheet


Biotech Warm Up, Thursday April 10th, 2014

1. On yesterday’s assignment, why did you draw all the fragments on one diagram and only one or two fragments on the other?


1. Write down all the steps to the Southern Blot and the purpose of each.

Biotech Warm Up, Thursday April 11th, 2014

1. What are the steps to the Southern Blot technique?a. Cut genomic DNA with restriction enzymes, so it will

be in fragments.b. Run the fragments through gel electrophoresis, to sort

out the sizes.c. Then denature the DNA with an alkaline solution and

transfer to a nylon membrane, we need the DNA single stranded so it will hybridize with the probe.

d. Insert a radioactive labeled or fluorescently labeled probe into the membrane, so it will attach to the gene of interest.

e. Incubate the nylon membrane so the probe will hybridize with the target DNA.

f. Expose to x-ray film. Only areas with the probe will be permanently stored on the nylon membrane.

Southern Blot worksheet



1. What is a DNA fingerprint? Draw a diagram of what one would look like.

2. What could police obtain at a crime scene that would be considered DNA evidence?


1. A DNA fingerprint (also called DNA profiling, DNA testing, genetic fingerprinting)

is a technique where DNA from a person is digested by restriction enzymes, amplified and drawn through an electrophoresis gel to separate different sized fragments. These fragments are so variable that unrelated individuals are extremely unlikely to have the same profile.

2. What could police obtain at a crime scene that would be considered DNA evidence?

A weapon, such as a baseball bat, fireplace poker or knife, which could contain sweat, skin, blood or other tissue

A hat or mask, which could contain sweat, hair or dandruff A facial tissue or cotton swab, which could contain mucus, sweat, blood or

earwax A toothpick, cigarette butt, bottle or postage stamp, all of which could contain

saliva A used condom, which could contain semen or vaginal or rectal cells Bed linens, which could contain sweat, hair, blood or semen A fingernail or partial fingernail, which could contain scraped-off skin cells

TEST!



1. Match the suspect with the DNA obtained at two crime scenes. Draw the diagram in your journals.


1. Match the suspect with the DNA obtained at two crime scenes. Draw a diagram in your journals.

Suspect 2 was at crime scene 1. But onlythe victim left DNA evidence at crimescene 2.

Megabucks worksheet



1.

Documents

Welcome to Biotechnology! August 26 th, 2013 Grab one of each of the following and put your name on it: 1. file folder 2. student information card