21
Welcome to the world of two Arabidopsis genes: At4g14770 and At3g22760 Presented by: Matt Emmer HC70AL Spring 2006 At4g14770 and At3g22760

Welcome to the world of two Arabidopsis genes:

  • Upload
    kalona

  • View
    31

  • Download
    0

Embed Size (px)

DESCRIPTION

Welcome to the world of two Arabidopsis genes:. At4g14770 and At3g22760. At4g14770 and At3g22760. Presented by: Matt Emmer HC70AL Spring 2006. At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins. TSO1 - PowerPoint PPT Presentation

Citation preview

Page 1: Welcome to the world of  two  Arabidopsis  genes:

Welcome to the world of two Arabidopsis genes:

At4g14770 and At3g22760

Presented by:

Matt EmmerHC70AL

Spring 2006

At4g14770 and At3g22760

Page 2: Welcome to the world of  two  Arabidopsis  genes:

At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain

Proteins• TSO1

– involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores

– Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation

• Tesmin – a member of the CXC family, and a testis-

specific protein

Page 3: Welcome to the world of  two  Arabidopsis  genes:

Structure of At4g14770 Structure of At4g14770 (1(1stst Line) Line)

Gene Size 3452 bp

# of Exons 8

# of Introns 7

Protein Encoded

Tesmin/TSO1-like

CXC Domain

# of Amino Acids

659

T-DNA Location

First Intron

Page 4: Welcome to the world of  two  Arabidopsis  genes:

?

Structure of At3g22760 Structure of At3g22760 (2(2ndnd Line) Line)

Gene Size 3076 bp

# of Exons 10

# of Introns 9

Protein Encoded

Tesmin/TSO1-like

CXC Domain

# of Amino Acids

610

T-DNA Location

5’ UTR

Page 5: Welcome to the world of  two  Arabidopsis  genes:

Where is At4g14770 Expressed?

Page 6: Welcome to the world of  two  Arabidopsis  genes:

Where is At3g22760 Expressed?

Page 7: Welcome to the world of  two  Arabidopsis  genes:

Were there Mutants in the 1st Line?

WTMut

9 Homozygous Mutants Identified in First Line

1 Heterozygous Mutant

Expected Size

Wild Type 802 bp

T-DNA 644 bp

Page 8: Welcome to the world of  two  Arabidopsis  genes:

4.5 ng/μLPlant 13

1.5 ng/μLPlant 12

4 ng/μLPlant 10

15 ng/μLPlant 4

5 ng/μLPlant 3

ConcentrationPlant

0.5 ng/μLWild Type

2 ng/μLPlant 18

4 ng/μLPlant 16

2 ng/μLPlant 15

ConcentrationPlant

What were the DNA Concentrations?

Were there Mutants in the 2nd Line?

1,624 bpWild Type

1,095 bpT-DNA

Expected Size

Page 9: Welcome to the world of  two  Arabidopsis  genes:

Genotyping with separate primers

Page 10: Welcome to the world of  two  Arabidopsis  genes:
Page 11: Welcome to the world of  two  Arabidopsis  genes:

Seeds and Silique

Page 12: Welcome to the world of  two  Arabidopsis  genes:

Embryos

Page 13: Welcome to the world of  two  Arabidopsis  genes:

MutantMutant vs.vs. Wild TypeWild Type

Any Difference?

NONO

Page 14: Welcome to the world of  two  Arabidopsis  genes:

What’s Upstream of At4g14770?

3237 3237 bpbp

1918 1918 bpbp

1319 1319 bpbp

1918 + 1319 1918 + 1319 = 3237= 3237

Single EcoRI Site in Upstream Region

I-proof Pcr Ecori Digest

Page 15: Welcome to the world of  two  Arabidopsis  genes:

Upstream Bioinformatics Upstream Bioinformatics

Primers Eco RI Site

Page 16: Welcome to the world of  two  Arabidopsis  genes:

How accurate was the SP6 and T7 Sequencing Data?

• Only a single mismatch in the SP6 sequencing data

Actual Sequence: AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG

Page 17: Welcome to the world of  two  Arabidopsis  genes:

What’s Upstream of At3g22760?

2911 2911 bpbp

I-proof Pcr Ecori Digest

Page 18: Welcome to the world of  two  Arabidopsis  genes:

Did the T-DNA insert Did the T-DNA insert actually knock out actually knock out

At4g14770?At4g14770?

Page 19: Welcome to the world of  two  Arabidopsis  genes:

Did the T-DNA insert Did the T-DNA insert actually knock out actually knock out

At4g14770?At4g14770?

• Two Possibilities:– Intron was spliced out– T-DNA was not spliced

out, resulting in a longer mRNA strand

• Follow up experiment:

Page 20: Welcome to the world of  two  Arabidopsis  genes:

ConclusionsConclusions• 1st Line mutants were attained

– No mutant phenotype observed– Evidence to suggest that gene knockout was not

successful

• Limited information obtained for 2nd line– No mutant plants attained– SALK indicates a T-DNA insert is in 5’ UTR, so

gene may not have been knocked out

• Future Experiments– Double/Triple Knock Outs to overcome duplication:

• At4g14770, At3g22760, At3g22780

Page 21: Welcome to the world of  two  Arabidopsis  genes:

AcknowledgementsAcknowledgements

The TA’s• Mike Gaviño • Ria Yagnik• Jonathan Russell

The Big Shots• Dr. Bob Goldberg • Dr. Anhthu Bui

• Dr. Xingjun Wang

Big Shots To Be• Tomokazu Kawashima• Brandon Le• Jessica Luke

HC70AL

Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather