Whole Genome of Ancient Human is Decoded

Gene Expressionnew frontiers

…the processes by which information contained in genes and genomes is decoded by cells, in order to produce molecules that determine the phenotypes observed in organisms,

– transcription is controlled so that the correct DNA sequences are expressed as mRNA in the right cells, at the right time, and in the right amount.

- and, now we’re learning -

- processing and translation of mRNA is further controlled (through RNA/Protein complexes), via ancient, conserved processes.

Central Dogmaaddendum

DNA

RNA

transcription

Protein

translation

Transcription Factors

Alt. SplicingAlt. Poly-A,Alt. Translatin Start

Transcriptional Network(cell cycle)

(example)

Science. 2002 Oct 25;298(5594):799-804.

Central Dogmaaddenda

DNA

RNA

transcription

Protein

translation

Transcription Factors

TGS

PTGS

TGS: Transcriptional Gene Silencing

PTGS: Post Transcriptional Gene Silencing

tiny RNAs (20-to-25 nt RNAs)

• in eukaryotic cells, tiny RNAs function as transcriptional regulators of gene expression in (at least) three distinct pathways,

– small interfering RNAs (siRNAs) direct RNA destruction via the RNA interference (RNAi) pathway,

• and transcriptional regulation via epigenetic processes,

– micro (miRNAs) regulate RNA translation.

Ancient History (1)

Cell 75, 843 (1993)

Some development timing genes code for short anti-sense molecules, …appeared to be unique to C. elegans.

miRNAmicro-RNA

• Post-transcriptional regulatory “genes”,

– contain ~22 nucleotides (processed),

– are cleaved from somewhat larger double stranded RNA (dsRNA) precursors - by a protein complex called Dicer;

– are expressed in certain cell types and at certain times during differentiation (also called short temporal (stRNA).

How would a cell express this?

Anti-Sense Blocking of Translation

“Sense Strand”

“Anti-Sense”

Why use RNA to block mRNA function?

miRNA

miRNAs

• Conserved amongst eukaryotic cells,

– Often associated with hetrochronic genes,

– difficult to identify in genomic sequences because they don’t have long ORFs,

How might you locate them?

Ancient History (II)(co-suppression)

Transgene expression often decreases as the copy number of transgenes increased.

Over Expression Studies• Make a gene construct with,

– Structural Gene,

– Active promoter (often from a virus promoter),

– Marker gene to be able to determine transformation.

Gene of InterestActive promoterMarker Gene (w/P)

• Expect,

– Higher levels of protein,

– Gene-dosage phenotypes,

– Glorious publication.

Frequent Results: no protein produced, scorn from senior scientists.

Anti-Sense Studies

• Another good idea: use a transgene with the coding sequence reversed...

Active promoterMarker Gene tseretnI fo eneGGene of InterestNative promoter

mRNA5’ 3’

anti-sense RNA5’ 3’

Duplex RNA formation.

Expected Results

• Low, to no detectable single stranded transcript,

• Low, to no protein products,

• Glorious publication detailing gene function.

Actual Results (Wacky)

• Phenotypes ranged from death to over-expression,

• Transcript levels were also extremely variable,

• Scorn from senior scientists.

Co-suppression Modes

...Transcriptional Gene Silencing (TGS),

– RNA functions in the methylation of promoters and structural elements of genes,

...Post-Transcritional Gene Silencing (PTGS),

– involves the specific degradation of mRNA via a double-stranded RNA intermediate, dsRNA.

RNAiRNA interference

...while attempting to do anti-sense KO of gene expression in C. elegans, Guo and Kemphues, Cell 81, 611 (1995) observed that sense and anti-sense strands worked equally,

– in an anti-sense experiment, a gene is constructed so that it produces a complementary strand to an expressed transcript,

• the goal is to complement, thus inactivate the mRNA.

...following up, other researchers found that dsRNA worked at least an order of magnitude better that either sense or anti-sense strands.

RNAi

…stolen for doing Reverse Genetic studies,

– dsRNA triggers sequence specific degradation of complementary

mRNAs.

amplification

delivery

Today

Nature 408: 331 - 336

http://www.wormbase.org

Ce III 2315 Genes

Functional GenomicsThe Question(s)

Can we establish a high throughput system to assign cellular function to genes identified in metazoans?

- using cell division and associated processes as the scorable phenotype,

In the process, can we learn about…

– cell division genes,

– embryology,

– general development,

– anything else?

Differential Interference Contrast MicroscopyNomarski Optics

DIC MicroscopyNomarski Optics

Reverse GeneticsKnockomics, Knockology...

Sequence to Phenotype to Function

Forward vs. Reverse Genetics• Treat thousands of organisms with a mutagen,

– random mutagenesis,

• Identify an individual with a phenotype of interest,

• Identify the gene.

• Treat thousands of organisms with a mutagen (usually),

– random mutagenesis, or other gene expression block,

• Identify individual(s) with a genotype of interest,

• Identify the phenotype.

Forward

Reverse

Reverse GeneticsFunctional Genomics

Gene DNASequence

Gene Disruption PhenotypeAnalysis

Function

DevelopmentPhysiology

Cell BiologyGenetically Link

New Data, New Technologynew paradigms

• The C. elegans genome is sequenced, and we can identify 2315 candidate sequences on Chromosome III.

• We can see cell division through a microscope, and further, we are able to identify many abnormalities.

• We have RNAi technology at hand to selectively “knock down” any gene we are interested in.

Further, RNAi can be added to cells prior to fertilization, mitosis commences after fertilization.

Reverse GeneticsDiscovery Research (High Throughput)

• Few, if any, hypothesis going in,

• High throughput, (2232 genes),

• Lots of “negative” results, (87.1% of the genes tested),

• Value is in (12.9%)…

– the analysis of the data in concert with annotations in the data sets and references in the literature,

– the generation of materials for further “hypothesis” - or - “discovery” driven research.

dsRNAs (I)Where do they come from?

• PCR primer pairs were designed for each of the genes discovered via bioinformatic analysis of the sequenced chromosome,

– and confirmed through EST sequences, or experimental expression studies,

– shortest region > 500 bp, or > 90% of ORF.

gene

dsDNA

dsRNAs (II)PCR Primers +

• T3 or T7 promoter sequences were included in the PCR primers...

gene

5’ - GTAATACGACTCACTATAGGG GCTAAGCTATTCGATGCTA - 3’

gene specific sequenceT7 promoter sequence

T3 sequence tacked onto the reverse primer.

T3 and T7 RNA Polymerase

• Bacteriophage T3 and T7 RNA polymerases are DNA-dependent RNA polymerases with high sequence specificity for T3 or T7 promoters.

• T3 and T7 RNA polymerases synthesize RNA 5' to 3'.

• These enzymes are isolated from an overproducing recombinant E. coli clone, and are available commercially.

dsRNAs (III)in vitro transcription

• T3 and T7 polymerases were used to make single stranded RNA,

– sRNA (sense) and asRNA (antisense)…

T7 polymerase

sRNA asRNA

T3 polymerase

dsDNA

- two reactions -

dsRNAs (IV)Where do they come from?

• sRNA and asRNA are then mixed, and form dsRNA,

T7 polymerase

sRNA asRNA

T3 polymerase

dsDNA

- two reactions -

dsRNA

• Done for 2232 genes, all in 96 well plates...

dsRNAs (VI) x 2232

• Quality control…

– Each dsRNA reaction product was run out on a gel, assayed to see if it migrated as a ssRNA or dsRNA based on the estimated size of the product(s)…

dsRNA ssRNA

…ssRNA and ds RNA of the same length migrate differently under electrophoresis.

dsRNAs (IV)Where do they come from?

• sRNA and asRNA are then mixed, and form dsRNA,

T7 polymerase

sRNA asRNA

T3 polymerase

dsDNA

- two reactions -

dsRNA

• Done for 2232 genes, all in 96 well plates...

Then What?

• dsRNAs (was) injected ... into the gonads of adult wild-type hermaphrodites, which were left at 20 °C for 24 h,

• Embryos were then removed and analyzed for potential defects in cell-division processes, capturing 1 image every 5 s using time-lapse Nomarski Differential Interference Contrast (DIC) microscopy,

• A minimum of three embryos from three different worms were filmed from shortly after fertilization until the four-cell stage.

http://fire.biol.wwu.edu/young/470/rnai_movies.html

C. elegans

Life Cycles

And More… Progeny Tests

• Three animals were transferred to a fresh plate 24 h after injection, and left at 20 °C. – Two days later, the plate was inspected with a stereomicroscope

(20–40x magnification) for the presence of eggs, F1 larvae and their developmental stage (normally L2–L4).

– Two days after that, the plate was inspected for the presence of F1 adults (normally >100), their overall body morphology and the presence of F2 progeny.

• Partially penetrant embryonic lethality and subtle developmental defects were not scored in this analysis.

• dsRNAs that gave rise to defects in less than 5% of the adult progeny were not considered as being associated with a phenotype.

But?

• It’s supposed to be high throughput, so experiments were designed to minimize the time required,

– in part to make the acquisition of so much “meaningless” data palatable (89.1%),

– in part because it is a whole lot of work no matter how you approach it,

• Remember, along with discovery, this experiment was designed to establish a workable paradigm for future large scale analysis of metazoan (and other complex) organisms.

So, Firstestablish reliability

• Injected 13 dsRNAs targeted to known components of the cell division process,

– all 13 known mutations were observable using DIC photography,

• This control tested RNAi efficiency, and the efficacy of

DIC phenotype scoring...

13 of 13 genes were disrupted, based on clear DIC image

acquisition.

High Throughput Protocols 1st establish acceptable failure rates...

• Tried mixing (multiplexing) dsRNA from 2 or more genes...

92% Rate deemed acceptable.

1. Then did it, 2. Then checked the results...

• When a phenotype was observed…

– to see which of the two dsRNAs caused the phenotype, fresh worms were injected with the dsRNA (one at a time),

– genomic sequence was examined to make sure that only the dsRNA targeted gene was responsible,

• Gene families,

• Miscalled ORFs.

Then checked the results again...

Conclusion: “As a result, the DIC phenotypes reported here almost certainly result from inactivation of the expected genes”.

For Example...

• Makes sense….

For Example (II)...

• Surprising…so many translation and ribosomal proteins involved meiosis.

Forward vs. Reverse Scorecard

• 7 of 7 known chromosome III DIC observable, early embryo phenotypes observed,

• 9 of 14 late embryo phenotypes observed,

• 9 of 31 larvae/adult phenotypes observed.

7 of 7 known, plus 126 new genes!

Cousins and Orthologs!Everyone and Metazoans

Successful?

• High throughput: Yes,

• Fidelity: Yes, 7/7,

• Discovery: Yes, > 100 new genes involved in early embryo development, especially cell division,

• Helpful to Metazoan biologists?

Next

Presentations