Upload
elinor-austin
View
254
Download
0
Tags:
Embed Size (px)
Citation preview
www.grimmy.com/
Transcription &
Translation
•Transcription: writing again
•Translation: changing languages
Today we’ll go from here... To here
Text
Off to see the wizard...
• DNA replication
– both strands => new DNA
– => new cell
• Transcription– 1 strand => new RNA– => new protein
Sending ‘messages’ out from DNA
20 toys• EVERY one has a blue part. Chem name?• EVERY one has a red part. Chem name?• Thus these are all…? • How many are there?
Amino Acids• How are they similar?• How are they different?• What do the differences mean in
terms of “feel”?• How many are there?• Possible?
Amino Acids• You & partner have an amino
acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids)
Nucleic Acids• How are they similar?• How are they different?• What do the differences mean in
terms of “feel”?• Which is more diverse in terms of
shape and ‘feel’?• Which would allow for more diverse
shapes and surfaces when ‘connected’?
How does a codon ‘mean’ an amino acid?
The Play is the thing…
The Play is the thing…Or, Fun With Blocks
The Play is the thing…
• ‘Types of Bonds’– Velcro – can be easily broken/re-
made during lab– Duct tape – breaking it gets you and
zero (0) for this week’s quiz
The Play is the thing…
• The Players
The Play is the thing…
• The Players– tRNA
The Play is the thing…
• The Players– tRNA– Ribosome
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase– RNA polymerase
The Play is the thing…
• The Players– tRNA (4 people)– Ribosome (1)– Aminoacyl tRNA synthetase (4)– RNA polymerase (1-2) * and RNA– Termination factor (1)
Blinding you with Science (jargon)
RNA Polymerase: joins RNA links into a chain
mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA
tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids
ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide
aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs
Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart
Learning your ‘lines’
• Handout: Each group find questions related to their role; answer them
• Lab manual, textbook, internet OK as sources
• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts
5’ end is pointy/spiky3’ end is soft/furry
DNA Template
• 5’ CTTAAATCCGAATGCCCATG 3’
5’ is “sticky”, 3’ is “fuzzy”
5’ CTTAAATCCGAATGCCCATG 3’5’ is “sticky”, 3’ is “fuzzy”
Wielding the Power• ‘Recall’ that ribosome assembly is
the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit
• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!
Ready…. Go!• mRNA at the central bench• ribosome assembles around it• synthetases at bench corners (or ‘diffuse’
opp. direction vs. tRNA)• tRNAs will ‘diffuse’ by following a path
through the room• When any event first happens*, action
stops, molecules involved will announce, explain
• Go until a protein happens
“Who” knows what’s going on?
• What happens if a tRNA carries the wrong amino acid?
• What happens if the mRNA contains a copy error relative to DNA?
• What happens if a tRNA has a mutated anticodon
Exit Condition1.) Pair up (two in a group)
2.) Write your names and SECTION at the top of the paper3.) EXPLAIN the process of TRANSLATION
Include the following in your answer:tRNAmRNA
RibosomeAUG codon
RNA polymeraseAminoacyl tRNA synthetase
Termination factordiffusion
Meet your new best
friend
Protocol:(1) Put a ½ inch layer of milk into a picnic
plate
(2) Add a drop of each of several food colorings at different locations towards the perimeter
(3) Touch a wooden stick to a dab of dishwashing detergent
(4) Touch the detergent to the center of the milk
(5) Observe!
WHAT DID YOU SEE?
-Hypothesize: What all is going on? How can you
test your hypothesis?