Transcript
Page 1: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

1

PharmID: A New Algorithm for Pharmacophore Identification

Stan YoungStan Young

Jun FengJun Feng and Ashish Sanil and Ashish Sanil

NISSNISS

MPDMMPDM

3 June 20053 June 2005

Page 2: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

2

X-ray Structure

Protein surface

Bound drug

Zinc

H2O’sHidingAround

NoteZincion

Page 3: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

3

Outline

BackgroundBackground

Computational Procedure and AlgorithmComputational Procedure and Algorithm

ExamplesExamples

ConclusionsConclusions

Page 4: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

4

Conformation Generation

OMEGA® generates OMEGA® generates thousands of conformers thousands of conformers in a few seconds.in a few seconds.

It is able to reproduce It is able to reproduce bioactive conformations.bioactive conformations.

Boström, Greenwood, and Gottfries. J. Mol. Graph. Mod., 2003, 21, 449-462

Page 5: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

5

Many feature combinations

Exhaustive enumeration of pharmacophore Exhaustive enumeration of pharmacophore hypotheseshypotheses

No. of Features No. of Features Possible combinationsPossible combinations

44 55

55 1616

66 4242

77 9999

Page 6: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

6

Pharmacophore Identification

Active molecules are known, Active molecules are known, receptor unknownreceptor unknown.. AssumeAssume that all molecules bind in a common that all molecules bind in a common

manner to the biological target.manner to the biological target. Difficulties:Difficulties:

Conformational flexibilityConformational flexibility Many different combinations of Many different combinations of

pharmacophoric groups pharmacophoric groups

Two very large search spaces:Two very large search spaces: conformations and feature combinations.conformations and feature combinations.

Page 7: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

7

Work Flow for Pharmacophore Identification

Single conformer SDF or SMILES

External Conformation GenerationProgram

PharmID

Different Pharmacophore Hypotheses

Page 8: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

8

Our Strategy

To superimpose the molecules in 3D, we To superimpose the molecules in 3D, we first align the bit string for each conformer first align the bit string for each conformer in 1D.in 1D.

Ideally, the important features and best Ideally, the important features and best conformers will be picked out at the same conformers will be picked out at the same time. time.

Our search is a many to one, Our search is a many to one, not many to many!not many to many!

Page 9: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

9

Computation Procedure

1.1. Pharmacophore Pharmacophore bit stringbit string generation generation

2.2. Bit stringBit string alignment/assessment alignment/assessment

3.3. Hypothesis generationHypothesis generation

4.4. RefinementRefinement

Page 10: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

10

Feature Definition

Predefined pharmacophore features:Predefined pharmacophore features:HD : Hydrogen Bond DonorHD : Hydrogen Bond DonorHA : Hydrogen Bond AcceptorHA : Hydrogen Bond AcceptorPOS: Positive Charge CenterPOS: Positive Charge CenterNEG: Negative Charge CenterNEG: Negative Charge CenterARC: Aromatic CenterARC: Aromatic CenterHYP: Hydrophobic CenterHYP: Hydrophobic Center

User defined groups:User defined groups:Any Any functionalfunctional groups can be defined using groups can be defined using DaylightDaylight®® SMART strings. SMART strings.

Page 11: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

11

Bit String Generation

1 0 1 0 1 ... 1 0 01 0 1 0 1 ... 1 0 0

....

..

Conf. 1

Conf. 2

Conf. 3

0 0 1 0 0 ... 1 0 00 0 1 0 0 ... 1 0 0

1 0 0 0 0 ... 1 0 01 0 0 0 0 ... 1 0 0

1 0 0 0 1 ... 1 0 01 0 0 0 1 ... 1 0 0

NH

N

3D Atom (group) – Distance – Atom (group) features.

F1………………Fm

Page 12: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

12

Definition of Distance Bins

homogeneous non-overlapped. homogeneous non-overlapped. 0-1, 1-2, 2-3, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 0-1, 1-2, 2-3, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 11-12, 12 11-12, 12 Å Å and above.and above.

heterogeneous non-overlapped. heterogeneous non-overlapped. 1-2, 2-5, 5-8, 8-12, 13 1-2, 2-5, 5-8, 8-12, 13 Å and above.Å and above.

Overlapped. Overlapped. 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12 10-12 Å.Å.

Page 13: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

13

Data Structure for Input

0 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 00 0 11 0 1 ...0 1 ... 11 1 01 0 11 0 1 1 00 1 1 0 11 000 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 0......1 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 01 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 00 0 11 0 0 ...0 0 ... 11 0 00 0 11 0 0 0 00 0 0 0 11 000 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 00 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 0......

M1C1M1C1M1C2M1C2M1C3M1C3............M2C1M2C1M2C2M2C2M2C3M2C3............

Page 14: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

14

The Trick

If you know the correct conformation for each molecule, then it is relatively easy to identify the key features.

If you know the correct features and distances, then it is easy to identify the correct conformation.

Guess one, predict the other, iterate.

Page 15: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

15

Given the features, easy to find the conformations

M1C1M1C1M1C2M1C2M1C3M1C3............M2C1M2C1M2C2M2C2M2C3M2C3............

0 0 0 0 11 0 0 ... 0 0 ... 11 0 0 0 0 11 0 0 0 0 0 0 0 0 11 0 0

0 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 0 0 0 11 0 1 ... 0 1 ... 11 1 0 1 0 11 0 1 1 0 0 1 1 0 11 0 00 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 0......1 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 01 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 0 0 0 11 0 0 ... 0 0 ... 11 0 0 0 0 11 0 0 0 0 0 0 0 0 11 0 00 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 00 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 0......

Page 16: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

16

Given the conformations, easy to find the features.

M1C1M1C1M1C2M1C2M1C3M1C3............M2C1M2C1M2C2M2C2M2C3M2C3............

00110000..00001100..

0 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 0 1 0 0 ... 0 0 0 1 0 0 0 0 1 00 0 0 0 11 0 1 ... 0 1 ... 11 1 0 1 0 11 0 1 1 0 0 1 1 0 11 0 00 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 0 0 0 0 ... 0 0 0 0 0 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 00 1 0 1 0 ... 1 0 0 0 1 1 0 0 1 0......1 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 01 0 1 0 0 ... 0 0 0 0 0 0 1 0 0 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 0 0 0 0 ... 1 0 0 0 0 0 1 0 1 00 0 0 0 11 0 0 ... 0 0 ... 11 0 0 0 0 11 0 0 0 0 0 0 0 0 11 0 00 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 00 0 0 0 0 ... 0 1 0 0 0 0 1 0 1 0......

Page 17: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

17

Bioinformatics Motif Finding using Gibbs Sampling.

1.1. Remove one sequence. Remove one sequence.

2.2. Randomly select one position for each sequence. Randomly select one position for each sequence.

3.3. Calculate probabilities for all positions for the Calculate probabilities for all positions for the motif “window”.motif “window”.

4.4. Using the “window” compute probabilities for Using the “window” compute probabilities for removed sequence motif position. removed sequence motif position.

5.5. Repeat the above steps for all sequences until Repeat the above steps for all sequences until converged.converged.

This will be easier to see with pictures.

Page 18: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

18

Objective Function

W

i

J

j j

jiji p

qcF

1 1

,, log

• W : bit string length

• ci,j : count of residue j in position i

• qi,j : residue frequencies, position i, residue j

• pj : residue background frequencies

• J: residue types, 20 for protein, 4 for DNA, RNA

W x 20

Window

Page 19: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

19

Alignment Algorithm

Mostly used in sequence alignmentMostly used in sequence alignmentto find the common motif.to find the common motif. TCAGAACCAGTTATAAATTTATCATTTCCTTCTCCACTCCTGCCTCAGGATCCAGCACACATTATCACAAACTTAGTGTCCACATTATCACAAACTTAGTGTCCATCCATCACTGCTGACCCT…………..…………..

Fast and sensitive, less likely to fall into local Fast and sensitive, less likely to fall into local minimum.minimum.

Lawrence, et al. (1993) Science, 262, 208-214

W x 20

Page 20: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

20

PharmID Algorithm using Gibbs.

1.1. Remove one compound. Remove one compound.

2.2. Start with a random conformer for other Start with a random conformer for other compounds.compounds.

3.3. Calculate probabilities for feature importance.Calculate probabilities for feature importance.

4.4. Compute conformation probabilities for omitted Compute conformation probabilities for omitted compound. compound.

5.5. Repeat steps 1-4 until converges.Repeat steps 1-4 until converges.

Again, pictures will make this clear.

Page 21: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

21

Gibbs Sampling: FingerprintsMovement

Conf_1 Conf_2 Conf_3 possible

Mol_1 010000000 100010001 010100100 0, 9, 18

Mol_2 000100000 010000100 100010001 0, 9, 18

Mol_3 101010001 000100100 0, 9,

Mol_4 001000100 100110001 010101001 0, 9, 18

1_2 010000000 100010001 010100100

2_3 000100000 010000100 100010001

3_1 101010001 000100100

4_2 001000100 100110001 010101001

Page 22: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

22

Bit String Alignment

Only 2 residue types (0, 1)Only 2 residue types (0, 1)

Rigid molecules that have only 1 or a few Rigid molecules that have only 1 or a few conformers can speed up the alignment and conformers can speed up the alignment and help to determine the best set of features.help to determine the best set of features.

Page 23: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

23

Hypothesis Generation Why? Why?

Features may not be part of the same pharmacophore.Features may not be part of the same pharmacophore.

How?How?

Clique Detection. (Bron-Kerbosch Algorithm)Clique Detection. (Bron-Kerbosch Algorithm)A clique is a set of ALL connected points. A clique is a set of ALL connected points.

Page 24: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

24

Hypothesis Generation in Selected Conformers : Clique Detection

N

O

OH

Pharmacophore FeaturesTwo point Pharmacophores identifiedby Gibbs Sampling

A pharmacophore hypotheses should be an all-connected graph

Discarded two point pharmacophores

Page 25: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

25

Hypothesis Generation: Output

Pharmacophore 1Pharmacophore 1Members: 1 2 3 5 …(Mol. ID)Members: 1 2 3 5 …(Mol. ID)Features: Hydrogen Bond Donor, Hydrogen Bond Features: Hydrogen Bond Donor, Hydrogen Bond Acceptor, …Acceptor, …

Pharmcophore 2Pharmcophore 2Members: 4 6 8 … Members: 4 6 8 … Features: …Features: …

…… ……

Page 26: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

26

Refinement

For all molecules For all conformers

For all hypotheses generated Test each qualified conformer against each

hypothesis End ForIf new hypothesis found

Insert the new hypothesis into the listEnd For

End For

Page 27: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

27

Benchmarking: Test Datasets

1. Bit string alignment1. Bit string alignment

20 20-bit strings20 20-bit strings

2. Single binding mode2. Single binding mode

Angiotensin-Converting Enzyme (ACE) inhibitorsAngiotensin-Converting Enzyme (ACE) inhibitors

3. 3. Multiple binding modesMultiple binding modes/mechanisms/mechanisms

Dopamine receptor inhibitors (D2/D4)Dopamine receptor inhibitors (D2/D4)

Page 28: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

28

Example 1: A Toy Dataset (Gibbs Sampling Only)

20 x 20 bit strings,

mimic 20 molecules,

each with 20 conformers.

Each bit string is 20 bits long.

Computation time:

<1 sec.

Result:

1_14 10001000010000000100

2_14 10001000010000000100

3_15 10001000010000000100

4_12 10001000010000000000

5_15 10001000010010000100

6_7 10001000010000000000

7_8 10001000010000000000

8_19 10001000010000000100 …

Page 29: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

29

Example 2: ACE Inhibitors

78 active compounds.78 active compounds.

OMEGAOMEGA® From OpenEye® is used to ® From OpenEye® is used to generate multiple conformers.generate multiple conformers.

Two RMSD cutoffs used:Two RMSD cutoffs used:2.0 Å : 4,613 conformers generated. 2.0 Å : 4,613 conformers generated. 1.0 Å : 1.0 Å : 46,26846,268 conformers generated. conformers generated.

Page 30: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

30

ACE inhibitors Results

Using 4,613 conformers,Using 4,613 conformers,55/78 molecules contain expected 55/78 molecules contain expected pharmacophore.pharmacophore.

Using Using 46,26846,268 conformers, conformers,65/7865/78 molecules contain expected molecules contain expected pharmacophore.pharmacophore.

Page 31: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

31

Example 2: ACE inhibitors:Best Identified Pharmacophore

O

Zn Binding SiteO

O

2.84 ~ 4.50 Å4.51 ~ 5.70 Å

4.99 ~ 6.77

Page 32: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

32

Example 2: ACE inhibitorsOther possible pharmacophore

Page 33: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

33

Example 3: Testing on Multiple Binding Modes (D2, D4 ligands)

Page 34: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

34

Example 3: Dopamine antagonists

Two pharmacophores were extracted from one data set!

Page 35: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

35

Conclusion

Traditional Methods:Traditional Methods:Exhaustive enumeration of pharmacophores, Exhaustive enumeration of pharmacophores, limited limited coverage of conformational spacecoverage of conformational space..

““Many to many” limits search.Many to many” limits search.

PharmID:PharmID:Selective enumeration of pharmacophores, Selective enumeration of pharmacophores, better coverage of conformational space.better coverage of conformational space.

Each search is “many to one”.Each search is “many to one”.

Page 36: 1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005

36

Acknowledgements

CoworkersCoworkersStan Young, Jun Feng, Ashish SanilStan Young, Jun Feng, Ashish Sanil

OMEGA is a product from OpenEye OMEGA is a product from OpenEye Scientific Software Inc.Scientific Software Inc.

Support from Hereditary Disease Support from Hereditary Disease Foundation.Foundation.

Become a NISS affiliate!


Recommended