3. ISOLATION AND
IDENTIFICATION OF
CHITINASE PRODUCING
ORGANISMS
Chapter 3: Isolation and Identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 49
3.1. INTRODUCTION
Major contributions of microbes have been in the development of biotechnology and
genetics. Microbes present many advantageous features of short life cycle, simple
organization and ease of growing and manipulating them in laboratory conditions.
These features are exploited by the industries in attempts to develop commercially
valuable products, which will help human society at large. Soil presents a habitat for a
major repository of micro-organisms which are responsible for producing a variety of
value added products. Thus, screening of soil samples and isolation of organisms form
the first stage in attempts to obtain microbes which produce products of commercial
value.
Microbial ecology necessitates studying, measure, and evaluating the variety of
microbes present in the community, effect of the microbes in that environment and
parameters of the habitat. These studies include - enumeration of organisms present,
study of the morphological characters of organisms and their interaction with the
environment, culturing and identifying the nature of the organisms present and their
diversity, evaluating the metabolic pathways employed by the community of the
organisms, and identifying the metabolic product and their effects on the environment
(Atlas & Bartha 1997; Barton & Northup 2011).
Amongst the diverse varieties of microflora found in the soil, bacteria are the most
abundant. Each of these bacteria requires unique nutritional requirements in order to
flourish. Traditional methods to isolate and monitor micro-organisms include total
viable count (TVC) which allows only a small fraction of microbial community to be
detected. The isolation and identification procedures are often tedious, mainly because
it is extremely difficult to stimulate the natural conditions in the laboratory. The
enrichment culture technique can prove to be beneficial as it is useful for isolation of
a specific type of micro-organism from an environment that is replete with different
types of microbes. This technique allows the proliferation of the desired organisms
which may be present in the environmental source in very small numbers.
Subsequently, the desired organisms can be isolated and characterized later
(Cappuccino 1999).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 50
The enrichment medium can be designed to contain specific substrate which will
preferentially promote the growth of desired population of micro-organisms. An ideal
enrichment process commences with inoculation of the environmental source (usually
soil) into the enrichment medium. After the growth of the organisms is observed in
the initial inoculated medium, the primary culture is serially transferred into a fresh
enrichment broth of the same composition until the population of the desired
organism is predominant in the culture (Cappuccino 1999). Along with the
enrichment process, a selective procedure can be employed in order to isolate the
dominant organisms of interest by spreading a small amount of enriched medium onto
solidified medium. The use of solidified media demonstrates the importance of a
selective force in the process of isolation as a preliminary tool in order to obtain the
isolate of interest (P. F. Stanbury et al. 1995)
The enrichment technique ensures the selection of desired population of organisms
because once the desired population flourishes, these organisms adapt to the medium
components and achieve exponential growth at a much faster rate. This population
adapts the ability to utilize the incorporated substrate, whereas the competitors lack
the ability to enzymatically use the substrate in the medium. This technique has a
range of applications in the field of clinical, industrial and environmental
microbiology. It is commonly employed to isolate and identify specific soil micro-
organisms for production of value added products (Bisen et al. 2012b).
Correct identification of the organism is the most important task before a
microbiologist and the most practical way to identify the organisms includes
classifying the bacteria based on morphological and biochemical characteristics.
Bergey’s Manual of Systematic Bacteriology, first presented the identification scheme
which included the classification of bacteria primarily on five characteristics: energy
and carbon source, mode of locomotion, morphology and Gram stain reaction,
gaseous requirements and the ability to produce endospores. Before opting for
identification, it is essential to ensure that the starting material is a pure culture. A
“pure culture” is the one that contains all of the daughter colonies to be like the
parent.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 51
The first step to the identification scheme includes studies on the phenotypic
characteristics of the organism, of which Gram staining, colony morphology and cell
motility are important. Gram stain forms a basis for “phenotypic identification” of the
organism. Biochemical tests are important for identification of the organisms up to
genus and species level. These include the determination of the ability of the organism
to utilize certain nutrients, products of metabolism, response to chemicals and the
ability to produce a particular enzyme. The traditional bacterial identification
methods, however, suffer from drawback like they can be used only for identification
of organisms which are cultivated in vitro.
Recently, the use of molecular techniques has proven to be beneficial for
identification of organisms. These techniques help to overcome the limitations of the
biochemical tests and are widely used to confirm the identity of the organism.
16SrRNA sequence forms a basis of many molecular techniques, the sequence can be
analysed followed by comparison to databases providing up to 100,000 sequences.
These techniques are particularly useful for strain identification (Bisen et al. 2012a).
Identification of bacteria by studying its homology with 16SrRNA gene sequence to
that of the known and recorded bacterial strains in the databases, has become a routine
part of phenotypic characterization and replaced many culture-based techniques
(Clarridge 2004). Ribosomal RNA (rRNA) genes possess highly conserved regions
that are suitable as sites for Polymerase Chain Reaction (PCR) primers that recognise
large, diverse groups of organisms and possess variable regions that provide distinct
signatures for identification at the phylogenetic levels (Persing et al. 2004).
Previously, a number of strains have been determined by determination of its
16SrRNA gene sequences. The largest databank of nucleotide sequences GenBank
comprises over 20 million deposited sequences, of which over 90,000
are of
16SrRNA gene. This allows the job of comparative analysis of sequence of an
unknown strain to that with previously deposited sequences (Clarridge 2004).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 52
In order to derive the sequence for a non-cultured bacterium, the basic method
involves using universal primers against the 16SrRNA gene region in PCR so as to
increase the amount of DNA and then to sequence the amplicon (Clarridge 2004).
In the present study, the soil samples were collected from varied environments
followed by an enrichment strategy which enabled isolation of chitinolytic organisms.
The screening procedure was followed in order to select true chitin degraders which
were first identified biochemically. The biochemical tests allowed the identification of
the organism up to the genus level. The identity of each of the selected isolates was
confirmed by carrying out 16SrRNA sequencing. This involved extraction of genomic
DNA (gDNA) followed by amplification by PCR using universal bacterial primers
(Vickerman et al. 2007). The PCR product was analysed using Agarose Gel
Electrophoresis (AGE). Gene sequencing was carried out after analysing the PCR
product.
This chapter discusses:
Collection and enrichment of soil samples from different sites
Isolation of chitinolytic organism from the enriched soil samples
Identification of chitinolytic organisms using biochemical and 16SrRNA
techniques
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 53
3.2. THEORETICAL
The first step to 16SrRNA gene sequencing was to isolate and extract genomic DNA
from each isolate. Genomic DNA is the entire hereditary material present in the
nucleus. The extraction of DNA involves isolation of DNA from other cellular
components, such as proteins, lipids and RNA. Genomic DNA can be isolated from a
variety of starting materials like tissue sample, blood, cultured cells, fixed tissues,
yeasts, bacteria, etc. For the present study genomic DNA was extracted from the
bacterial cells.
Extraction of DNA:
The process of isolation of genomic DNA usually involves disruption and lysis of the
cells, which is followed by removal of proteins and other contaminants and finally
recovering the DNA. Proteinase K is usually employed in order to remove proteins
from the sample, followed by salting-out and organic extraction.
Organic extraction of DNA was used to isolate genomic DNA from each selected
isolate in the present study. It is the conventional technique which has been in use
since many years and it is used for situations when either Restriction fragment length
polymorphism (RFLP) or PCR typing is performed. Organic extraction of DNA
involves sequential addition of some chemicals. Initially, addition of sodium
dodecylsulfate (SDS) and Proteinase K facilitate to lyse open the cell walls and
degrade the proteins that protect the DNA molecules bound to the chromosomes. Next
step involves the addition of phenol/chloroform mixture in order to separate the DNA
from proteins. Following the addition of phenol/chloroform mixture, the DNA
solubilizes in the aqueous phase of the organic-aqueous mixture. The mixture is
centrifuged to separate away the unwanted proteins and cellular debris, leaving the
double stranded DNA in the aqueous phase. The aqueous phase is then transferred
into a fresh Eppendorf for analysis. This technique is particularly useful for recovery
of high molecular weight DNA (Butler 2005).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 54
Polymerase Chain Reaction (PCR):
History
The field of molecular biology has greatly benefited with the technique of polymerase
chain reaction or PCR. The ability of PCR to make millions of copies of DNA with a
specific sequence has revolutionized the field of molecular biology (Butler 2005).
In 1971, Khorana and his colleagues described a method for duplicating a region of
duplex DNA using two DNA synthesis primers, in vitro (Kleppe et al. 1971).
However, this concept failed to receive attention for another 12 years. “Sometimes a
good idea comes to you when you are not looking for it.” With these words Kary
Mullis, started an account in Scientific American about how he had a revelation that
led him to develop PCR in 1983 (McPherson & Moller 2006a). He was awarded
Nobel Prize in Chemistry in 1993, less than 10 years after the technique was
described.
PCR technique
PCR involves copying the DNA in the test tube and it uses basic fundamentals of the
natural DNA replication processes. In simple terms, the duplex DNA strands are
unwound following which each strand of parent molecule is used as a template to
produce a complementary ‘daughter’ strand. In a simple buffer system, target region
of the DNA molecule is amplified by DNA polymerase that uses deoxynucleotides
that act as building blocks of new strands, sequence specific primers that bind to the
target region of DNA (McPherson & Moller 2006b).
The process involves the separation of the template strands by heat, which causes the
hydrogen bonds between the base pairs of DNA strands to break; this step is known as
denaturation. The oligonucleotide primers, then find their complementary sequences
on the templates and DNA polymerase then begins to add deoxynucleotides to the 3’-
OH group of the primers, producing new duplex molecules (McPherson & Moller
2006b).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 55
At the next heating step, these new double stranded molecules are once again
denatured and each single strand provides for a site for the primer binding and act as a
template for further DNA synthesis. Thus, there is an exponential increase in the
number of the copies of the ‘target’ DNA sequence where the number of strands of
the target sequence will be doubled at each PCR cycle. There is 100 % efficiency and
the reaction is very specific and precise (McPherson & Moller 2006b).
Figure 3.1: DNA amplification process with the Polymerase Chain
Reaction(Butler 2005)
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 56
Agarose Gel Electrophoresis:
Electrophoresis is a technique used to separate and sometimes purify macromolecules
– especially nucleic acids and proteins – that differ in size, charge and conformation.
It is a method of separating macromolecules based on the rate of movement while
under the influence of an electric field (Sambrook, Maniatis, et al. 1989).
Principle
In gel electrophoresis, charged molecules when placed in an electric field, they
migrate towards either positive or negative pole according to their charge. In contrast
to proteins, which have either net positive or either net negative charge, nucleic acids,
i.e. DNA and RNA, have a consistent negative charge imparted by their phosphate
backbone, and thus migrate towards the anode. Moreover, molecules which have
similar charge will have a different charge to mass ratio due to inherent differences in
molecular weight. These differences in combined, form a sufficient basis for a
differential migration when ions in the solution are subjected to an electric field. Thus
electrophoresis allow separation of charged molecules in the sample (Sambrook,
Maniatis, et al. 1989).
The macromolecules like proteins and nucleic acids are electrophoresed in a matrix or
gel support. The gel is itself a porous matrix, or meshwork, often made up of
carbohydrate chains. Commonly, the gel is cast in a shape of a thin slab, with wells
for loading the sample. The gel is immersed within an electrophoresis buffer that
provides ions to carry a current along with some type of buffer to maintain the pH at
relatively constant value.
Agarose Gel
The gel matrix is composed of agarose or polyacrylamide, each of which has
attributes suitable for a particular task. Agarose is a fraction extracted from agar
producing seaweeds. It comprises of alternating units of galactose and 3, 6-anhydro-
L-galactose. The chemical structure gives agarose the capacity to form gels that are
resistant even at very low concentrations.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 57
It is typically used in the concentration of 0.5 % to 2 % for separation of both nucleic
acids and proteins. Agarose is a neutral and toxic-free material so it can be handled
freely. Agarose gels are extremely easy to prepare: simply mixing the agarose powder
with a buffer solution, dissolve it by heating; gel formation occurs between 40-41 oC.
The gelling properties are attributed to inter and intramolecular hydrogen bonding
between long agarose chain. This cross linked structure gives the gel uniform pore
size. Lower concentration of agarose, larger the pore size and vice versa (Sambrook,
Maniatis, et al. 1989).
Agarose gels have a large range of separation, but relatively low resolving power. It is
favoured since it remains quite stable at applied current, has a low melting point and
also since it is non-toxic. Fragments of DNA from about 200 to 50,000 bps can be
separated by varying the concentration of agarose, using standard electrophoretic
techniques (Sambrook, Maniatis, et al. 1989).
Basic setup
The electrophoresis equipment and power supplies necessary for conducting agarose
gel electrophoresis are relatively simple and consists of:
An electrophoresis chamber and power supply.
UV- transparent gel casting plastic tray, which are available in a variety of sizes.
Sample comb, to prepare wells in the gel for loading samples.
Electrophoresis buffer, usually Tris – acetate – EDTA (TAE) or Tris – borate –
EDTA (TBE) at a concentration of approximately 0.05 M, over a pH range of 7.5
to 8.0. Buffers not only establish a pH, but provide ions to support conductivity.
EDTA is invariably incorporated in these buffers to suppress the activity of
DNases.
Loading buffer, that contains glycerol, which is dense, allowing the sample to
‘fall’ into the wells, and a tracking dye such as Bromophenol blue, which adds
color to the sample, thereby simplifying the loading process and the dye migrates
through the gel almost at the same rate as the nucleic acids thereby allowing
visual monitoring of the electrophoresis process.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 58
Ethidium bromide, a fluorescent dye used for staining nucleic acids. It
intercalates between bases of DNA and RNA.
Transilluminator (an ultraviolet light box), is used to visualize ethidium bromide
stained DNA gels (Sambrook, Maniatis, et al. 1989).
Migration of DNA fragments in agarose gel
Fragments of linear DNA migrate through agarose gels with a mobility that is
inversely proportional to the log10 of their molecular weight, i.e., if you plot the
distance from the wall that DNA fragments have migrated against the log 10 of either
their molecular weights or number of base pairs, a roughly straight line will be
formed. Circular forms of DNA migrate in agarose distinctly differently from linear
DNAs of the same mass (Sambrook, Maniatis, et al. 1989).
Agarose concentration
By using gels with different concentrations of agarose, one can resolve different sizes
of DNA fragments. Higher concentrations of agarose facilitate separation of small
DNA’s, while low agarose concentrations allow resolution of larger DNA’s
(Sambrook, Maniatis, et al. 1989).
Voltage
As the voltage applied to a gel is increased, larger fragments migrate proportionally
faster than small fragments. If the separation of the electrodes is ‘d’ metres and the
potential difference between them is ‘V’ volts, the potential gradient is V/d
volts/meter. The force of an ion bearing a charge ‘q’ coulombs ‘Vq/d’ newtons. The
rate of migration under unit potential gradient is called mobility of the ion. Thus, an
increase in the potential gradient will increase the rate of migration proportionally.
For that reason, the best resolution of fragments larger than about 2 kb is attained by
applying no more than 5 volts per cm to the gel (Sambrook, Maniatis, et al. 1989).
Electrophoresis buffer
Several buffers have been recommended for electrophoresis of DNA. The most
commonly used for duplex DNA are TAE and TBE. DNA fragments migrate at
different rates in these two buffers due to differences in ionic strength. As the ionic
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 59
strength of the buffer increases, the proportion of current carried by the buffer will
increase and the share of the current carried by the sample will decrease, thus slowing
its rate of migration. In low ionic strength, the proportion of current carried by the
buffer will decrease and share of current carried by the sample will increase, thus
increasing its rate of migration. The ionic strength is generally selected within a range
of 0.05M to 0.1M (Sambrook, Maniatis, et al. 1989).
Effects of ethidium bromide
Ethidium bromide is a fluorescent dye that intercalates between bases of nucleic acids
and allows very convenient detection of DNA fragments in gels. Binding of ethidium
bromide to DNA alters its mass and rigidity and therefore its mobility (Sambrook,
Maniatis, et al. 1989).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 60
3.3. MATERIALS AND METHODS
3.3.1. Soil collection and site information
Four soil samples were collected for the purpose of isolating suitable chitinase
producing organisms using enrichment technique. The soil samples were collected in
a sterile plastic container and labelled accordingly. The four sites from which the soil
samples were collected are as follows:
Beach sand (Malad)
Beach sand was collected during the low tide, in the area where the chitinous rich
waste material was observed. Soil from the depth of 4-5 cms was collected. The
uppermost layer of the soil was collected where maximum microbial activity is
observed.
Tide condition: Low tide
Date of sample collection: 17/11/09
Garden soil (Kandivli)
Garden soil was collected from the disposal compost site where the local wastes from
fruits, vegetables and seafood wastes like prawn heads had been buried in the trench.
Soil from the depth of 10-12 cms was collected.
Date of sample collection: 10/12/09
Dumping ground soil (Malad)
The sample from a waste disposal site was collected from the depth of 5-6 cms.
Date of sample collection: 10 /12/09
Fish market soil (Kandivli)
Local fish market soil was collected from 5-6 cm depth where the seafood wastes
were disposed. This soil was very rich with chitinous material and hence it was
assumed that this source will pose as a rich source for chitinolytic organisms.
Date of sample collection: 15/12/09
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 61
Culture media and chemicals
Throughout the study, the chemicals used were of analytical grade purchased from
Qualigens Fine Chemicals, Mumbai, India. Ready-made dehydrated media were
procured from Hi Media Laboratories Pvt Ltd, Mumbai.
In the present investigation, culture media were prepared according to manufacturer’s
instructions. Compositions of the media are listed wherever required. Weighed
quantity of dehydrated medium was suspended in a measured quantity of distilled
water (D/W) and mixed well. In case of solid media, the medium was heated in the
microwave to dissolve the dehydrated powder completely. The media was sterilized
by autoclaving at 121 oC under the pressure of 15 psi for 20 min. Sterilized medium
was allowed to cool and stored at 4 oC until use. All media, thus prepared were used
within seven days.
3.3.2. Isolation and enrichment of chitinolytic organism from the soil samples
Soil samples collected from the earlier mentioned sites were processed in order to
assess the initial microbial load as well as to study the type of microflora in each of
the soil samples.
Media and solution used:
Nutrient Agar (NA)
Saline
Compositions:
Nutrient Agar
Table 3.1: Composition of Nutrient Agar
Composition (28 gms /1000ml) Quantity (gms/litre)
Peptone 5
Beef extract 3
Sodium chloride 8
Agar 15
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 62
Saline
Table 3.2: Composition of Saline
Method:
In order to enumerate and study the initial microflora of each of the soil samples, 1 g
of soil sample was diluted using 10 ml of sterile saline. This mixture was vortexed so
as to facilitate proper mixing of the solution as well as separation of soil particles. The
mixture was left undisturbed for 20 minutes, allowing the soil particles to settle down
completely. 500 µL of the supernatant was serially diluted in 4.5 ml sterile saline.
Dilutions up to 10-10
were prepared and viable count was performed by a spread plate
technique on NA plates.
Enrichment strategy of soil samples
Three successive enrichments for each soil sample were carried out in order to narrow
down on those isolates which possess the chitin degrading ability.
Media used:
Minimal Salts Media (MSM) containing 1 % chitin powder
Table 3.3: Composition of MSM containing 1 % chitin powder
Composition Quantity (gms/litre)
Potassium dihydrogen phosphate 7
Di potassium hydrogen phosphate 3
Magnesium sulphate 5
Ammonium sulphate 0.2
Chitin powder 1
Ferrous sulphate 0.001
Zinc sulphate 0.001
Final pH (at 25 oC) 7.0 ± 0.2
Composition Quantity (gms/litre)
Sodium chloride 8.5
D/W 1000ml
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 63
Method:
Each soil sample was subjected to the process of enrichment, which allowed the
proliferation of desired organisms by creating unfavourable conditions for growth of
undesired organisms.
For enrichment of each of the soil samples, sterile Minimal Salts Media (MSM)
containing 1 % chitin powder was used as an enrichment medium. The enrichment
process was initiated by adding 5 g of soil sample to enrichment medium. The
incubation of flask was carried out at 27 ± 2 oC (room temperature), on a shaker at
150 rpm. The process of enrichment was carried out at room temperature since the
soil microbes had been acclimatized to this range of temperature in the natural
environment.
The process of enrichment was carried out in three stages for each of the soil samples
collected. Each enrichment stage lasted for a period of 25 to 30 days.
First enrichment as mentioned earlier, comprises of MSM containing 1 % chitin
powder inoculated with 5 g of respective soil sample. This system was incubated for a
period of 25 to 30 days at room temperature under shaker conditions (150 rpm).
Second enrichment process was carried out for respective soil samples; 11 ml of
inoculum from the first enrichment flask was aliquoted and transferred aseptically
into 100 ml of fresh sterile MSM containing 1 % chitin powder. Similarly, this system
was incubated for a period of 25 to 30 days at room temperature under shaker
conditions (150 rpm).
Further, similar third enrichment process was carried out which was the last step of
the enrichment stage for each soil sample, wherein, 11 ml of inoculum from the
second enrichment flask was aliquoted and transferred aseptically into 100 ml of fresh
sterile MSM containing 1 % chitin powder and was incubated for a period of 25 to 30
days at room temperature under shaker conditions (150 rpm).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 64
During each of the enrichment stage, viable count was performed at regular intervals
in order to access the enriched microflora and each colony was studied
macroscopically in terms of colony characteristics and subjected to preliminary
screening. Viable counts were performed using the spread plate technique on 2 %
Nutrient agar. The plates were incubated at room temperature for a period of 24 - 48
hours, after which bacterial counts were obtained.
Figure 3.2: General scheme for enrichment process
3.3.3. Preliminary screening of chitinolytic organisms
Preliminary screening abetted the selection of isolates for further study. Screening
technique of the enriched colonies involved selection of isolates which possessed the
ability to produce chitinase which resulted in degradation of the substrate chitin.
Colloidal Chitin Agar (CCA) was employed to select the isolates which were able to
utilize chitin as a sole source of carbon and energy. The isolates which possessed the
ability to degrade chitin produced a distinct zone of clearance around it. These
colonies were sub-cultured onto sterile NA slants and maintained for further studies.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 65
Media used:
Colloidal Chitin Agar
Table 3.4: Composition of Colloidal Chitin Agar
Preparation of Colloidal chitin
Colloidal chitin is the most preferred substrate for investigation of chitinase activity.
Chitin is used in a colloidal form as a water insoluble substrate for chitinase. Colloidal
chitin was prepared by the modified method of Robert and Selitrennikoff (Roberts &
Selitrennikoff 1988): To 5 g of powdered chitin, 50 ml of concentrated HCl was
added slowly. The mixture was left standing for 6 h. The mixture then was added to
250 ml of ice-cold ethanol with continuous stirring. The pH of the solution was
adjusted to 7 and the precipitate was collected by centrifugation at 8000 rpm for 30
min at 4 oC. The colloidal chitin collected was dried at room temperature and later
stored at 4 oC for further use.
Preparation of Colloidal Chitin Agar
All the components of the media were weighed and added to MSM. This media was
mixed thoroughly and heated in the microwave to dissolve the components. The
media was sterilized by autoclaving at 121 oC under the pressure of 15 psi for 20 min.
Sterilized medium was allowed to cool and then poured into sterile Petri plates. The
plates were left to solidify.
Composition Quantity (per 100ml)
Colloidal Chitin 1 g
Yeast Extract 0.001 g
Agar 1.5 g
Minimal Salts Media 100 ml
Final pH (at 25 oC) 7.0 ± 0.2
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 66
Method:
The colonies obtained from regular viable counts were subjected to preliminary
screening on sterile CCA plates. Colonies with distinguishable colony characteristics
were spot inoculated onto sterile CCA plates and incubated for 4-5 days at room
temperature. Isolates were selected on the basis of clearance zone: colony size
(CZ/CS) ratio on CCA plates (Cody 1989). Isolates showing high CZ/CS ratio were
regarded as chitinase producing and they were maintained on slants of NA.
3.3.4. Secondary screening of chitinolytic isolates
The selected colonies were confirmed for their ability to degrade chitin. This was
done by sub-culturing the colonies on a Nutrient agar medium followed by spot
inoculating the culture on CCA. The colonies which retained the ability to degrade
chitin were able to produce a zone of clearance on CCA plates. These colonies were
taken as true chitin degraders and selected for further studies.
3.3.5. Identification of the isolates capable of producing chitinase
The isolates obtained from various soil samples, which showed the ability to produce
chitinase were identified by conventional identification tests. These tests include
standard morphological and biochemical tests which helped in identification of the
isolates up to the genus level of identification.
3.3.5.1. Morphological characterization
Gram’s character: Gram staining of each isolates was performed as described in
Textbook of Medical Laboratory Technology (Godkar & Godkar 2007) and the Gram
nature of each of the isolates were recorded.
Colony morphology: Colony characteristics of overnight grown cultures of each
isolate on Nutrient agar was observed and recorded.
Cell morphology: The Gram stained smears of the isolates were observed
microscopically under the magnification of 1000 X using an oil immersion lens to
determine the morphological characteristics of the cells.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 67
Test for motility: The test for motility was performed as described in Textbook of
Medical Microbiology (Collee et al. 1996) and method used to detect motility was
“hanging drop technique”.
Presence of endospores: The bacterial isolates were checked for the presence of
endospores by performing the staining procedure for endospore staining as described
in Experiments in Microbiology, Plant Pathology and Biotechnology (Aneja 2003)
Lactose fermentation Test:
This test uses MacConkey Agar. This is a differential and low selectivity medium
used to distinguish lactose fermenting from non-lactose fermenting bacteria.
Media used:
MacConkey Agar
Table 3.5: Composition of MacConkey Agar
Composition (51.53 gms/1000ml) Quantity (gms/litre)
Peptic digest of animal tissue 17.00
Proteose peptone 3.00
Lactose 10.00
Bile salts 1.5
Sodium Chloride 5.00
Neutral red 0.03
Agar 15.00
Final pH (at 25 °C) 7.1 ± 0.2
Method: Plates were inoculated with test organism, incubated at 37 °C for 48 h.
Interpretation: Pale colonies indicate non-lactose fermenting bacteria, whereas
bright pink opaque colonies indicate lactose fermenting bacteria.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 68
3.3.5.2. Biochemical characterization
Bacteria differ widely in their ability to metabolize carbohydrates and other
compounds. For the purpose of identification, these differences can be demonstrated
by four different tests which are described below (Collee et al. 1996).
Tests to check the carbohydrate utilization oxidatively and fermentatively.
Tests for specific breakdown products.
Tests for the ability of bacteria to utilize certain proteins and amino acids.
Tests to study the various enzymes produced by isolated bacteria.
All the tests were performed as per standard techniques given in Mackie and
McCartney’s Practical Medical Microbiology (Collee et al. 1996).
Inoculum preparation
The isolates were streaked onto Nutrient agar plates and 18- hours-old culture of each
isolate was obtained. These cultures were prepared according to the 0.5 Mac
Farland’s turbidity standard (107- 10
8 organisms/ml). These suspensions of the
isolates were kept constant and were used for inoculation throughout all biochemical
tests (Brown & Poxton 1996).
Incubation temperature and time
All the inoculated tubes, plates and slants were incubated at 37 °C for 24-48 h unless
and otherwise mentioned.
Requirements, preparations and methods for biochemical identification of the
isolates
I. Fermentation of carbohydrates and related compounds
The purpose of this test is to detect the production of acid and gas or acid alone when
a pure culture is grown in the presence of a test compound.
Sugars used in this test:
Hexose: Glucose
Monosaccharide: Xylose
Dissacharides: Sucrose, Lactose, Maltose
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 69
Polyhydric Alcohol: Mannitol
Indicator used: Andrade’s indicator
Medium used: 1.5 % Peptone water
Preparation of media
1.5 % peptone water was prepared and Andrade’s indicator was added to it so as to
achieve a resultant concentration of indicator in the medium as 1 %. The medium was
dispensed into tubes. An inverted Durham tube was introduced into each tube to
detect gas production. During preparation and sterilization, it is to be ensured that the
inverted Durham tube is devoid of any air bubbles.
10 % solutions of the above mentioned sugars were prepared in distilled water and
autoclaved at 10 psi for 10 min. The sterile sugar solution was added to the individual
tubes of peptone water under sterile conditions so as to obtain the resultant
concentration of 1 % sugar in each tube.
Method: The sugar fermentation media were inoculated with the test organisms. 6
tubes corresponding to each sugar were inoculated for each isolate and incubated at
37 °C for 24 h.
Interpretation: Turbidity in the tubes indicated growth. Andrade’s indicator will
change color as a result of the formation of acids during the fermentation, resulting in
the development of a pink color in the medium while the appearance of air bubble
within the inverted Durham tube indicated the production of gas during fermentation
of sugars.
II. Test for checking the oxidative/ fermentative utilization of carbohydrate
This method depends upon the use of a semi-solid medium containing carbohydrates
together with pH indicator placed in a tube. If acid is produced only at the surface of
the medium, where the conditions are aerobic, the attack on the sugar is considered to
be oxidative. If acid is found throughout the tube, including the lower layers where
conditions are anaerobic, the breakdown of sugar is considered to be fermentative.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 70
Media used:
Oxidative fermentative medium (Hugh and Leifson medium)
Table 3.6: Composition of Oxidative fermentative medium
Components Quantity (gms/liter)
Peptone 2
NaCl 2
K2HPO4 0.3
1% Bromothymol blue
(1% aqueous solution)
3ml
Agar 3
Sugar used: Glucose
Preparation of media:
The pH adjusted to 7.1 before adding bromothymol blue and medium is autoclaved at
121 °C for 15 min. The sugar to be added was sterilized separately. 10 % stock of
sugar was prepared and sterilized separately at 10 psi for 10 minutes, and added to the
medium to give a final concentration of 1 %.
Method: Test organisms were stab inoculated in butt with straight nichrome wire
loop, incubated at 37 °C for 24-48 h.
Interpretation:
1) Yellow coloration only at the surface of butt indicates the oxidative utilization of
carbohydrates.
2) Yellow coloration of whole butt indicates the fermentative utilization of
carbohydrates.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 71
III. Tests for specific breakdown products
a) Methyl Red Test (MR test):
This test was employed to detect the production of sufficient acid during the
fermentation of glucose.
Media used:
MR-VP medium (Buffered glucose broth)
Table 3.7: Composition of MR-VP medium
Composition: (17.0 gms /1000 ml) Quantity (gms/liter)
Buffered peptone 7
Dipotassium phosphate 5
Dextrose 5
Final pH (at 25 oC) 6.9 ± 0.2
Indicator used:
Methyl red indicator solution
Table 3.8: Composition of Methyl Red indicator
Composition Quantity
Methyl red 0.1g
Ethanol 300 ml
Distilled water 200 ml
Method: Glucose phosphate broth was inoculated with the test organisms and
incubated at 37 oC for 24 h. About 5 drops of Methyl red indicator solution was added
to the broth culture, mixed well and was observed for the development of bright red
color.
Interpretation: Bright red color indicates positive MR test.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 72
b) Vogus Prouskauer Test (VP or Acetoin production test)
Many bacteria ferment carbohydrates with the production of acetyl methyl carbinol
(CH3.CO.CHOH.CH3) or its reduction product 2,3-butylene glycol (CH3.
CHOH.CHOH.CH3). It can be detected by chemical methods. This test is usually
done in conjunction with the methyl red test since the production of acetyl methyl
carbinol or butylene glycol usually results in insufficient acid accumulation during
fermentation to give a methyl red positive reaction (Collee et al. 1996).
Media used:
Methyl Red – Voges Proskauer (MR-VP) medium
Composition of MR-VP medium
Refer to Table 3.7
Method: As for the Methyl red test, Glucose phosphate broth were inoculated with
the test organisms and incubated at 37 oC for 24 h. To this broth culture 1 ml of
O’Meara’s reagent (40 % KOH and 3 ml of a 5 % solution of α – naphthol in absolute
ethanol) was added and incubated at 37 oC for 30 min and then observed for
coloration.
Interpretation: A positive reaction is denoted by the development of an eosin pink
color after incubation.
IV. Test for the ability of the bacteria to utilize particular substrate
a) Starch utilization test
This test was performed to test the ability of the isolate to produce amylase. Amylase
enzyme acts on starch and converts it into simple sugars. This could be detected by
iodine solution. In the presence of starch, iodine gives dark blue coloration.
Media used:
Starch agar
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 73
Preparation of media: Composition of NA is provided in this chapter in Table 3.1.
To this autoclaved, cooled and molten medium, 10 ml of 10 % starch solution
(autoclaved separately at 10 psi for 10 min) was added and poured to prepare Starch
agar plates.
Method: Plates were inoculated with test organisms and incubated at 37 ° C for 48 h.
After incubation, the plate was flooded with iodine solution.
Interpretation: Presence of amylolytic activity was indicated by clearance around the
colonies against the blue background.
b) Citrate utilization test:
This test was performed to detect the ability of an isolated test organism to utilize
citrate as a sole carbon and energy source for growth and an ammonium salt as the
sole source of nitrogen.
Medium used:
Simmons Citrate Agar
Table 3.9: Composition of Simmons Citrate Agar
Composition (24.28 gms/1000 ml) Quantity (gms/liter)
Magnesium sulphate 0.2
Ammonium dihydrogen phosphate 1
Dipotassium phosphate 1
Sodium citrate 2
Sodium chloride 5
Bromothymol blue 0.08
Agar 15
Final pH (at 25 oC) 6.8 ± 0.2
Method: Simmon’s citrate agar slant was streaked with the test organism and
incubated at 37 °C for 24 h.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 74
Interpretation: Positive = Change in color from green to blue and the streak of
growth.
Negative = Original green color and no growth.
V. Test for metabolism of proteins and amino acids
a) Indole test
This test was employed to demonstrate the ability of certain bacteria to decompose the
amino acid, tryptophan, to indole, which accumulates in the medium. Indole is then
tested for by a colorimetric reaction with p – dimethyl amino benzyldehyde (Kovac’s
reagent).
Media used:
Tryptone Water
Table 3.10: Composition of tryptone water
Composition: (25 gms/1000 ml) Quantity (gms/liter)
Casein enzymic hydrolysate 20
Sodium chloride 5
Final pH (at 25 oC) 7.5 ± 0.2
Indicator used:
Kovac’s reagent
Table 3.11: Composition of Kovac’s reagent
Components Quantity
Amyl or isoamyl alcohol 150 ml
p-Dimethyl amino benzyldehyde 10g
Concentrated hydrochloric acid 50 ml
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 75
Method: Sterile Tryptone water was seeded with test organism and incubated at 37
oC for 24 h. At the end of the incubation period 0.5 ml of Kovac’s reagent was added
to the culture and mixed well.
Interpretation: A positive reaction was indicated by formation of a reddish pink ring
on the surface of the inoculated media.
b) Arginine dihydrolase
The purpose is to see if the isolate can utilize the amino acid arginine. The use of
arginine is accomplished by the enzyme arginine dihydrolase. The medium contained
a small amount of glucose, which the organism initially utilizes. This causes the pH to
drop which is indicated by a change in the colour of the medium from purple to
yellow. Once the medium has been acidified, the enzyme arginine dihydrolase is
activated, causing the arginine in the medium to be utilised. Change in the colour of
the medium from yellow back to purple indicates a positive test for arginine
dihydrolase
Medium used:
L-arginine dihydrolase medium
Table 3.12: Composition of L-arginine dihydrolase medium
Components Quantity (gms/liter)
L-arginine monohydrochloride 5
Yeast extract 3
Glucose 1
Bromocresol purple 0.015
Final pH (at 25 oC) 6.8 ± 0.2
Method: Test cultures were inoculated and incubated at 37 °C for 24-72 h. The
medium was observed for color change after 24 h, 48 h and 72 h.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 76
Interpretation: The medium first becomes yellow due to acid production during
glucose fermentation; later if decarboxylation occurs, the medium become violet. The
control should remain yellow.
c) Gelatin liquefaction test
Some of the bacteria have the ability to liquefy gelatin. Gelatin breakdown was
demonstrated by incorporating it in buffered NA, growing the culture on it and
flooding the medium with a reagent that differentially precipitated either gelatin or its
break down products.
Media used:
Gelatin agar
Table 3.13: Composition of Gelatin agar
Components Quantity
Nutrient agar 1 liter
Potassium dihydrogen phosphate 0.5 g
Di potassium hydrogen phosphate 1.5 g
Gelatin 4 g
Glucose 0.05 g
Test reagent: Mercuric chloride solution
Preparation of test reagent: 15 grams of mercuric chloride was added to 20 ml of
concentrated hydrochloric acid. The volume of this mixture was made up 100 ml with
D/W.
Method: The plates were inoculated with test cultures and incubated at 37 °C for 24
h. They were then flooded with mercuric chloride solution.
Interpretation: Clear zone around gelatin liquefying colonies showed positive
confirmation of the test.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 77
VI. Combined Tests
a) Triple Sugar Iron (TSI) Test
This medium was used as a multi-test medium, which detects fermentation reaction,
gas production and ability of an organism to produce H2S.
Media used:
Triple Sugar Iron (TSI) agar
Table 3.14: Composition of Triple Sugar Iron agar
Composition (65 gms/1000 ml) Quantity (gms/liter)
Peptic digest of animal tissue 10
Casein enzymic hydrolysate 10
Beef extract 3
Yeast extract 3
Lactose 10
Sucrose 10
Dextrose 1
Sodium chloride 5
Ferrous sulphate 0.2
Sodium thiosulphate 0.3
Phenol red 0.024
Agar 12
Final pH (at 25 oC) 7.4 ± 0.2
Method: A heavy inoculum was streaked over the surface of the slope and stabbed in
the butt. The medium was incubated at 37 oC for 48 h.
Interpretation: The results were interpreted as the fermentation reactions on the
slope and in the butt by a change in color to yellow due to acid production. The
cracking of the medium and cavities formed indicated gas production. The blackening
of the medium indicated H2S production.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 78
VII. Tests for various enzymes produced by the isolates
The isolates was checked for the production of enzymes like
1. Oxidase
2. Catalase
3. Nitratase
4. Urease
1. Oxidase
This test is used to detect the presence of cytochrome oxidase enzyme present in the
organism, which will catalyze the loss of electrons from a redox dye, tetra methyl p-
phenylene diamine hydrochloride. So, the dye gets oxidized to give deep purple
colour.
Method: Test organisms were inoculated on NA plates and incubated at 37 °C for 24
h. A small filter paper strip soaked in a 1.0-1.5 % solution of tetra methyl p-
phenylene diamine hydrochloride was laid in a Petri plate. The colonies to be tested
were smeared on the paper by using flame sterilized glass slide or rod.
Interpretation: Positive reaction was indicated by deep purple hue, appearing within
5-10 seconds, a delayed positive reaction by coloration in 10-60 seconds and a
negative reaction by absence of coloration or by coloration later than 60 seconds.
2. Catalase
This test demonstrates the presence of catalase, an enzyme that catalyze the release of
oxygen from hydrogen peroxide.
Method: Test organisms were inoculated on NA slant and incubated at 37 °C for 24
h.10 % hydrogen peroxide was added drop wise to cultured slant with substantial
growth and checked for effervescence.
Interpretation: Effervescence within 30 seconds indicates a positive test.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 79
3. Nitratase
This test was carried out to detect the presence of the enzyme, nitrate reductase
(nitratase), which causes the reduction of nitrates to nitrites.
Media used:
Nitrate broth
Table 3.15: Composition of Nitrate broth
Composition (39 gms/1000 ml) Quantity (gms/liter)
Peptic digest of animal tissue 0.5
Meat extract 0.3
Sodium chloride 30
Potassium nitrate 0.1
Final pH (at 25 oC) 7.0 ± 0.2
Test reagents used: Sulphanilic acid and α – naphthylamine
Composition of test reagents:
1) Sulphanilic acid: 0.8 g of sulphanilic acid dissolved in 100 ml of 5 M of acetic
acid.
2) α – naphthylamine: 0.5 g of α – naphthylamine dissolved in 100 ml of 5 M of
acetic acid.
Method: Nitrate broth was inoculated with the test organisms and incubated at 37oC
for 24-48 h. 2-3 drops of sulphanilic acid and α- naphthylamine was added to nitrate
broth and the color change was observed.
Interpretation: Development of the red colour indicates the presence of nitrite and
thus the ability of an organism to reduce nitrate to nitrite was confirmed.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 80
4. Urease
Bacteria, particularly those growing naturally in an environment with exposure to
urine, may decompose urea by means of the enzyme urease
NH2.CO.NH2 + H2O 2NH3 +CO2
The presence or absence of this enzyme was detected by growing the organism in the
presence of urea. The production of alkali was detected by means of pH indicator
added to the media.
Media used:
Urea agar base
Table 3.16: Composition of Urea agar base
Composition (24 gms/950 ml) Quantity (gms/950 ml)
Peptic digest of animal tissue 0.1
Dextrose 0.1
Sodium chloride 0.5
Monopotassium phosphate 0.2
Phenol red 0.012
Agar 15
Final pH (at 25 oC) 6.8 ± 0.2
Preparation of media: After sterilization and cooling of Urea agar base
approximately to 50 oC, 50 ml of sterile 40 % urea was added. Mixed well and
dispensed aseptically in 5 ml aliquots in sterilized tubes for the preparation of slants.
Method: The entire slope surface of urea agar slant was heavily inoculated with test
organism and incubated at 37 °C for about 24-48 h.
Interpretation: Urease positive reaction is indicated by the change in color of the
media to purple pink.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 81
3.3.6. Characterization of optimum growth conditions for the isolates
The potential chitinase producing strains selected were further studied so as to
characterize their growth conditions. The parameters which were studied are as
follows:
A. Study of comparative growth of the isolate in different media
B. Study of optimum pH
C. Study of optimum temperature
D. Study of growth response at different salt concentrations.
Preparation of inoculum
Saline suspensions of each of the isolate was prepared from 18 hours old culture as
per the 0.5 McFarland turbidity standard to obtain approximate cell density of 107-8
cells/ml. 10µL of this suspension was used as inoculum. Negative control was
included in each experimental batch. All the flasks, tubes or plates were incubated at
37 oC for 24 hours to 5 days, unless otherwise mentioned.
A. Test for comparative growth study of the isolates in different media
Each isolate was inoculated in three different growth media – Nutrient broth (NB),
Luria Bertani broth (LB) and Soyabean Casein digest broth (SCB). The media, which
resulted in the maximum and dispersed growth of the isolate, was selected for further
characterization experiments.
Media used:
Nutrient broth
Luria Bertani broth
Soyabean Casein digest broth
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 82
Compositions:
Nutrient broth
Table 3.17: Composition of Nutrient broth
Composition (13 gms/1000 ml) Quantity (gms/litre)
Peptic digest of animal tissue 5.00
Sodium chloride 5.00
Beef extract 1.50
Yeast extract 1.50
Final pH (at 25 °C) 7.2 ± 0.2
Luria Bertani broth
Table 3.18: Composition of Luria Bertani broth
Composition (25 gms/1000 ml) Quantity (gms/litre)
Casein enzymic hydrolysate 10.00
Yeast extract 5.00
Sodium chloride 10.0
Final pH (at 25 °C) 7.5 ± 0.2
Soyabean Casein digest broth
Table 3.19: Composition of Soyabean Casein digest broth
Composition (30 gms/1000 ml) Quantity (gms/litre)
Pancreatic digest of casein 17.00
Peptic digest of soyabean meal 3.00
Sodium chloride 5.00
Dextrose 2.50
Dibasic potassium phosphate 2.50
Final pH (at 25 °C) 7.3 ± 0.2
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 83
B. Test for study of optimum pH
To determine the optimum pH, 20 ml of SC broth was dispensed into assay tubes and
sterilized by autoclaving at 121 oC 15 lb psi for 20 min. The pH range was selected
from 4.0 to 10.0 (4.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0). Test isolates were inoculated
and incubated at 37 oC. The tubes were assessed visually for microbial growth in
terms of turbidity for 48 h.
C. Test for study of optimum temperature
To determine the optimum temperature, 20 ml of SC broth was dispensed into assay
tubes and sterilized by autoclaving at 121 oC 15 psi for 20 min. The temperatures
selected were as follows: 4 oC, 25
oC, 37
oC, 40
oC and 50
oC. Test isolates were
inoculated and incubated at respective temperatures. The tubes were assessed visually
for microbial growth in terms of turbidity for 48 h.
D. Study of growth response to different conditions:
a) Study of growth response to anaerobic conditions
This test uses anaerobic agar. This media is specifically used for cultivation and
selectively growing anaerobic bacteria like Clostridium and other anaerobic
organisms (Collee et al. 1996).
Media used:
Anaerobic agar
Table 3.20: Composition of Anaerobic agar
Composition (58 gms/1000 ml) Quantity (gms/litre)
Casein enzymic hydrolysate 20.00
Dextrose 10.00
Sodium chloride 5.00
Sodium thioglycollate 2.00
Sodium formaldehyde Sulphoxylate 1.00
Methylene blue 0.002
Agar 20.00
Final pH (at 25 °C) 7.2 ± 0.2
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 84
Method: Plates were inoculated with test organism, incubated at 37 °C for 96 h, in
anaerobic conditions. These conditions were obtained with the help of an anaerobic
gas pack jar.
Interpretation: Growth on the plates shows the presence of facultative anaerobic
bacteria. Absence of any growth on the plates after incubation shows the presence of
strict aerobic bacteria. After the incubation is completed, the media plates are seen to
turn pale yellow.
b) Study of growth at different NaCl concentrations
To study the effect of different concentrations of NaCl, SC broth with a range of NaCl
concentration (0.5 %, 2 %, 5 %, 7 %, 9 %, 10 % and 12 %) was prepared. Test
organisms were inoculated and incubated at 37 oC. The tubes were examined for
growth for 48 h.
3.3.7. Antibiotic Sensitivity Test (AST)
The test was performed to check the sensitivity of the isolates against various
antibiotics. The test was carried out on sterile Mueller Hinton (MH) agar medium
using antibiotic discs from Hi Media. MH agar is employed in determination of
antimicrobial susceptibility testing. It is selected by Clinical and Laboratory Standards
Institute (CLSI) for various reasons:
It reveals good batch-to-batch reproducibility for susceptibility testing.
It is low in sulphonamide, trimethoprim and tetracycline inhibitors.
It supports the growth of most non-fastidious bacterial pathogens.
Many data and much experience regarding its performance have been recorded
(Murray et al. 2003).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 85
Media used:
Mueller Hinton (MH) agar
Table 3.21: Composition of MH agar
Composition (38 gms/1000 ml) Quantity (gms/litre)
Beef, infusion form 300.00
Casein acid hydrolysate 17.500
Starch 1.500
Agar 17.000
Final pH (at 25 °C) 7.3 ± 0.1
Method:
0.5 ml of test organisms were surface spread on sterile MH agar plates. The antibiotic
disc was placed aseptically with the help of forceps which was flame sterilized every
time before placing each antibiotic disc. Plates were incubated at 37 oC for 24 h and
observed for the zone of inhibition.
Interpretation:
The results were compared with the chart provided by the Clinical and Laboratories
Standards Institute (CLSI 2012).
3.3.8. Preparation of glycerol stocks
Glycerol stocks of the selected chitinase producers were prepared to ensure their
viability during longer period of storage.
A single colony of interest was picked and grown overnight in Nutrient broth. After
incubation, the purity of the culture was ensured by Gram staining. Glycerol stocks
with 15 % glycerol content were prepared as prescribed by Sambrook, Fritsch, et al.
(1989) with slight modification where in 87 % glycerol was used instead of 100 %
glycerol. 0.17 ml of 87 % glycerol was added to a sterile 1.5 ml Eppendorf tube
followed by 0.83 ml of overnight culture. The tube was vortex mixed and labelled
with all pertinent information. The glycerol stocks were stored at -80 ºC until further
use.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 86
3.3.9. Extraction of DNA from bacterial cells
Genomic DNA was extracted from each selected chitinolytic isolates using the
procedure as described in Short Protocols in Molecular Biology (Wilson 1995).
Requirements:
Sample: Overnight culture of bacterial cells
Media: St NB (refer Table 3.16)
Reagents: Tris EDTA (TE) Buffer
10 % Sodium Dodecyl Sulphate (SDS)
Proteinase K – 10 mg/ml
5 M NaCl
CTAB/NaCl solution
24: 1 Chloroform/isoamyl alcohol
25: 24:1 Phenol/chloroform/isoamyl alcohol
Isopropanol
70 % ethanol
Compositions:
TE Buffer
1 ml of 1 M Tris-HCl (pH 8) + 0.2 ml EDTA (0.5M). The volume was made up to
100 ml with D/W.
1 M Tris (Molecular weight – 121.14 g)
First 3.027 g of Tris was dissolved in 15 ml D/W and the pH of the solution was
adjusted to 8 with concentrated HCl. The final volume of the buffer was made up to
25 ml with D/W.
0.5 M EDTA (Molecular weight – 373.2 g)
0.5 M EDTA = 4.65 g in 25 ml D/W
A part of weighed disodium EDTA salt was dissolved in 10 ml D/W and the pH of the
solution was adjusted to 8 with 10 N NaOH. Then another small part of the same
disodium EDTA salt was added to the above solution. The volume was made up to 25
ml with D/W.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 87
10 % SDS
1 g of SDS dissolved in 10 ml D/W.
5 M NaCl (Molecular weight – 58.44 g)
14.61 g of NaCl was dissolved in 30 ml D/W and the final volume was made up to 50
ml with D/W.
CTAB/NaCl
4.1 g of NaCl was dissolved in 80 ml D/W. The solution was heated and while stirring
the solution, 10 g of N-cetyl-N, N, N,-trimethyl ammonium bromide (CTAB) was
added. The solution was heated to dissolve the CTAB completely. Finally the total
volume was made up to 100 ml with D/W.
70 % ethanol
70 ml of absolute ethanol was made up to 100 ml with D/W.
Method:
Day1. An overnight culture of each selected isolate was made by inoculating 10 ml of
sterile NB media with a single bacterial colony, and incubating it overnight at room
temperature under shaker conditions.
Day2. The overnight grown cultures were examined for the presence of any
contamination by carrying out Gram’s staining of each isolate. The media was then
subjected to centrifugation to obtain cell pellet of each isolate. The cell pellet of each
isolate was re-suspended in 600 µL of TE buffer. To the mixture, 60 µL of 10 % SDS
and 6 µL of 10 mg/ml proteinase K were added. The mixture was incubated for one
hour at 37 oC. Following incubation, 200 µL of 5 M NaCl was added and mixed
thoroughly. This was followed by the addition of 600 µL of CTAB/NaCl solution.
The mixture was incubated for 10 min at 65 oC. Equal amount of chloroform/isoamyl
alcohol was added to the mixture and micro-centrifuged for five min. The supernatant
was transferred into a fresh sterile tube. Equal amount of phenol/chloroform/isoamyl
alcohol was added and mixed well. The mixture was subjected to micro-centrifugation
for five min. Again the supernatant was transferred into a fresh sterile tube. 0.6
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 88
volumes of isopropanol were added and mixed gently. The mixture was micro-
centrifuged for five min. This was followed by washing of DNA precipitate with one
ml of 70 % ethanol. The tubes were left overnight at 37 oC in order to let the ethanol
evaporate from the DNA samples.
Day3. The DNA pellets from each isolate were re-suspended in 40 µL of TE buffer.
These DNA samples were subjected to qualitative analysis by carrying out Agarose
Gel Electrophoresis. In case smearing effect was observed, the genomic DNA
samples were subjected to treatment with RNAses. This involved addition of 2 µL of
RNAses in gDNA samples followed by incubation for one hour at 37 oC. Following
incubation, the gDNA samples were subjected to phenol/chloroform extraction and
phenol/chloroform/isoamyl alcohol extraction and finally precipitation of gDNA with
iso-propanol. This was followed by washing of the pellet with 70 % ethanol. The
ethanol was evaporated and the sample was re-constituted in a minimum volume of
TE Buffer, followed by qualitatively analysing the samples by Agarose Gel
Electrophoresis.
3.3.10. Polymerase chain reaction for amplification 16SrRNA gene
Following extraction of genomic DNA from selected chitinolytic isolates, the gDNA
was used as a source of template DNA for amplification of 16SrRNA gene from each
of the isolates using PCR technique (Sambrook, P.Maniatis, et al. 1989).
Requirements:
Sample: Extracted genomic DNA of each selected isolate
Reagents: Sterile D/W
10X PCR buffer
25 mM MgCl2
10 mM Dinucleotide Triphosphatase (dNTP) mix
Primers: 20 pmol/µL (Vickerman et al. 2007)
FP – 8F: 5’AGAGTTTGATCCTGGCTCAG 3’
RP – 1391R: 5’ GACGGGCGGTGTGTRCA 3’
Taq Polymerase enzyme
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 89
Miscellaneous: Ice pack
Sterile gloves
Applied Biosystems Thermocycler (ABI2400)
All the reagents were from Applied Biosystems and the dNTP mix was from
Fermentas Lifesciences.
Method:
The PCR reaction mixture of the reagents was prepared by adding the accurate
volume of reagents and primers as given below:
Components Quantity (in µL)
10X PCR Buffer 2.5
25 mM MgCl2 1.5
10 mM dNTP Mix 2.5
Taq Polymerase 0.25
Sterile Distilled Water 15.25
Forward Primer (8F) 1
Reverse Primer (1391R) 1
Template DNA 1
Total Volume 25
The volume of reagents mentioned above was for a single reaction. For multiple
reactions, corresponding volume of reagents was multiplied by the number of
reactions and then split into equal parts.
The template DNA was added to the reaction mixture and the final volume of the
mixture was made up with sterile D/W. This was followed by performing thermal
cycling under the following conditions:
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 90
Cycling Step Temperature Time Number of
cycles
Initial DNA
denaturation
94 oC 5 min 1 cycle
Denaturation 94 oC 1 min 35 cycles
Annealing 55 oC 45 sec
Extension 72 oC 2 min
Final extension 72 oC 10 min 1 cycle
Final Hold 4 oC -
After the completion of thermal cycling, the PCR products were qualitatively
analysed by carrying out Agarose Gel Electrophoresis.
3.3.11. Qualitative analysis of Genomic DNA/PCR product by Agarose Gel
Electrophoresis
The genomic DNA and PCR products obtained from each of the isolates were
qualitatively analysed as per the procedure described by J Sambrook et al. (1989).
Requirements:
Sample: Genomic DNA/ amplified PCR product
Reagents: Agarose (1 %)
1X Tris Borate EDTA electrophoresis buffer (TBE)
Ethidium bromide (10 mg/ml)
6X Gel loading buffer
Molecular marker – Lambda DNA/ EcoR1 + HindIII Marker
Miscellaneous: Electrophoresis apparatus with gel casting trays
Power pack
UV Transilluminator
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 91
Compositions:
10X TBE stock solution
108 g Tris Base
55 g boric acid
40 ml 0.5 M EDTA, pH 8.0 [186.1 g Na2EDTA.2H2O was dissolved in 700 ml H2O.
The pH was adjusted to 8.0 with 10 M NaOH. Then the final volume was made up to
1 liter with D/W]
1X TBE working solution
10X TBE stock solution was diluted 1:10 times before use [100 ml of TBE stock
solution was mixed with D/W to make up the volume to 1 liter].
Ethidium bromide solution – 10 mg/ml
10 mg ethidium bromide was dissolved in 1 ml D/W. This solution was stored in a
sterile Eppendorf tube wrapped in an aluminium foil at 4 oC.
6X Gel loading buffer
10 % Glycerol
0.25 % Bromophenol blue prepared in H2O from 0.5 % stock Bromophenol blue
solution [50 mg of Bromophenol blue dissolved in 10 ml D/W].
The buffer was prepared as follows:
344 µL of available glycerol stock (87 %) + 500 µL of 0.5 % Bromophenol blue
solution. The volume was made up to 1 ml with D/W and mixed well. This solution
was stored at 4 oC.
1 % Agarose
0.5 g of agarose powder was added to 50 ml of TBE buffer and heated so as to
completely dissolve the constituents.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 92
Method:
A horizontal gel electrophoresis casting tray was rinsed with soap solution and water,
and then wiped with methanol.
1 % agarose was prepared and 2 µL ethidium bromide was added to the warm agarose
solution at 50 oC. The solution was mixed well and poured into the casting tray. The
comb was inserted carefully and the gel was allowed to solidify.
After the solidification, the comb was removed and the casting tray was transferred
into the agarose gel electrophoresis apparatus.
1X TBE buffer was added to the tank and the samples were loaded into the wells. The
samples were prepared by mixing it with loading dye.
The gel was run at 100 V for 45-50 min. The bands were visualized in the Gel
Documentation system, Alpha Inotech under UV.
FOR PCR Products:
The PCR products bands were visualized in the Gel Documentation system and
observed for bands of expected product size (~1.3 Kb) following which, the PCR
products were sent for bidirectional 16SrRNA gene sequencing at GeneOm Biotech –
contract service research labs, Pune.
The sequence generated from each isolate was further analysed and compared with
that in GenBank using NCBI BLAST Tool (Basic Local Alignment Search Tool). The
maximum resembling sequences were compared and aligned with closely related
sequences using CLUSTALW software. Distance based phylogenetic tree was
constructed using the NJ algorithm.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 93
3.4. RESULTS AND DISCUSSION
Enrichment and isolation of chitinolytic organism from the soil samples
Swiontek Brzezinska et al. (2010) suggested that chitinolytic organisms, isolated from
soil are more active than the ones isolated from water and bottom sediment samples,
hence they can be considered more appropriate for agricultural use. Therefore, soil
samples were collected from different environments to isolate chitinolytic organisms.
These soil samples were processed in order to obtain the initial count of microbes.
The initial count of each of the soil samples has been presented in the Table 3.22.
Table 3.22: Initial colony count obtained from all soil samples
Sr.No Soil Sample Initial Count (cells/ml)
1 Beach sand 105
2 Garden soil 105
3 Dumping ground soil 104
4 Fish market soil 103
Each of the soil samples were subjected to enrichment process which ensured the
proliferation of chitinase producing organisms. During the process of enrichment and
viable count, mixed and pure culture colonies were obtained which were capable of
producing chitinase. In a natural environment, organisms often co-exist as a part of
multi-species community, which interact amongst themselves (Keller & Surette 2006;
Haruta et al. 2009). These communities later on form an integral part of biological
system (Straight & Kolter 2009).
As mentioned earlier, the enrichment process was carried out in three successive
stages and viability count of the cells was performed at regular intervals for each step
of the enrichment process in order to study the type of microflora being enriched. The
first enrichment allowed the proliferation of micro-organisms which were capable of
utilizing chitin as a sole source of carbon and energy. Chitinolytic micro-organisms
were then further allowed to out-grow the other type of flora present in the initial
inoculum by carrying out subsequent enrichments. These stages allowed the true-
chitin utilizing micro-organisms to proliferate that may be present in each of the
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 94
original soil sample but in very small numbers. The enrichment process revealed that
the diversity of the microbes obtained from each of the soil samples was limited. This
may be attributed to the limitations of the method based on laboratory cultivation, and
the presence of viable and dormant but non-culturable cells.
Another noteworthy observation made was that a majority of the isolated micro-
organisms from the enriched broth were affiliated to the phylogenetic class Bacillus.
This observation was in accordance with a previous report by Hoster et al. (2005).
Previous studies also confirm the frequent recovery of members of this class during
the enrichment of chitin-degrading micro-organisms from soil and marine samples
(Kuroshima et al. 1996; Ivanova et al. 1999).
The micro-organisms isolated from the enrichment process were assumed to be
chitinase producers and further subjected to preliminary and secondary screening
procedures.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 95
Table 3.23: Colony characteristics of the isolates obtained from soil sample 1
SOIL SAMPLE 1 – BEACH SAND SOIL
Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6 Colony 7 Colony 8
Size Large Pinpoint Small Large Small Small Large Pinpoint
Shape Circular Circular Circular Irregular Circular Circular Irregular Circular
Color White Cream White Cream Orange Yellow Off White Yellow
Margin Entire Entire Entire Irregular Entire Entire Irregular Entire
Consistency Butyrous Butyrous Butyrous Rough Butyrous Butyrous Butyrous Butyrous
Elevation Flat Flat Low convex Flat Low convex Convex Low convex Convex
Opacity Opaque Translucent Translucent Translucent Translucent Opaque Opaque Opaque
Gram’s
Nature
Gram +ve
cocci
Gram –ve
coccobacilli
Gram –ve
rods
Gram –ve
coccobacilli
Gram –ve
rods
Gram +ve
cocci
Gram –ve
coccobacilli
Gram +ve
cocci
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 96
Table 3.24: Colony characteristics of the isolates obtained from soil sample 2
SOIL SAMPLE 2 - GARDEN SOIL
Colony
1
Colony
2
Colony
3
Colony
4
Colony
5
Colony
6
Colony
7
Colony
8
Colony
9
Colony
10
Size Small Pinpoint Large Small Large Large Small Small Small Medium
Shape Circular Circular Circular Irregular Irregular Irregular Circular Circular Circular Irregular
Color White White White Yellow White Cream Yellowish White Greenish Greenish
Margin Entire Entire Entire Irregular Irregular Irregular Irregular Entire Entire Irregular
Consistency Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous
Elevation Low
convex
Low
convex Flat Flat Flat Flat Flat
Low
convex
Low
convex Flat
Opacity Opaque Translucent Opaque Opaque Translucent Translucent Translucent Opaque Translucent Translucent
Gram’s
Nature
Gram
+ve
bacilli
Gram +ve
bacilli
Gram
+ve
bacilli
Gram
+ve
cocci
Gram –ve
coccobacilli
Gram –ve
coccobacilli
Gram –ve
coccobacilli
Gram
+ve
bacilli
Gram –ve
rods
Gram –ve
rods
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 97
Table 3.25: Colony characteristics of the isolates obtained from soil sample 3
SOIL SAMPLE 3 – DUMPING GROUND SOIL
Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6
Size Small Pinpoint Small Large Medium Medium
Shape Circular Circular Circular Circular Circular Circular
Color Reddish Cream Cream White Cream Off white
Margin Entire Entire Entire Serrate Entire Entire
Consistency Butyrous Butyrous Butyrous Powdery Butyrous Butyrous
Elevation Flat Flat Low convex Flat Low convex Flat
Opacity Translucent Opaque Opaque Opaque Opaque Opaque
Gram’s Nature Gram +ve cocci Gram –ve rods Gram +ve bacilli Gram +ve bacilli
Gram –ve
coccobacilli Gram –ve rods
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 98
Table 3.26: Colony characteristics of the isolates obtained from soil sample 4
SOIL SAMPLE 4 – FISH MARKET SOIL
Colony 1 Colony 2 Colony 3 Colony 4
Size Medium Small Small Small
Shape Circular Circular Circular Irregular
Color White Off white White Off white
Margin Entire Entire Entire Irregular
Consistency Butyrous Butyrous Butyrous Butyrous
Elevation Flat Low convex Convex Low convex
Opacity Opaque Opaque Translucent Opaque
Gram’s Nature Gram -ve coccobacilli Gram +ve bacilli Gram –ve rods Gram +ve bacilli
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 99
Preliminary and secondary screening of the isolates:
The colonies, which were consistently obtained from regular viable count during the
enrichment process, were subjected to preliminary screening. The colony
characteristics of the isolates from each of the soil samples have been summarized in
Tables 3.23 - 3.26.
A total of 28 isolates were obtained from enrichment of soil samples. These isolates
were assumed to be potent chitinase producers and were subjected to preliminary
screening in order to narrow down on the number of isolates on the basis of clearance
zone: colony size (CZ/CS) ratio. The colonies which exhibited high (CZ/CS) ratios
were selected for further studies. The (CZ/CS) ratios of the isolates obtained from
each of the soil samples have been tabulated in the Tables 3.28 – 3.31.
Preliminary screening revealed that although some colonies from each soil sample
were consistently observed throughout the enrichment process, not all the isolates
were capable of chitinase production. These isolates were unable to produce the zone
of clearance on CCA plates. This phenomenon is explained by the authors Beier &
Bertilsson (2013) which states that during enrichment process it is plausible that
chitinolytic bacteria sometimes process more chitin substrate than they are able to
utilize. The hydrolysis products produced as a result of degradation of chitin are
actively utilized by other micro-organisms with no apparent chitinase activity. This
may have led to the growth of microbes which lack the ability to utilize chitin. This
phenomenon of inter-specific cross feeding is the reasonable explanation for
proliferation of non-chitinolytic microbes during the enrichment process. The results
obtained from preliminary screening confirmed the occurrence of inter-specific cross
feeding phenomenon during the enrichment process.
The chitinase producing colonies were further subjected to secondary screening,
which involved repeated sub-culturing on NA plates followed by spot inoculation on
CCA plates to check for their ability to degrade chitin.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 100
Consistent chitin degraders i.e. isolates which showed distinct zone of clearance on
repeated subculture, were selected for further studies. The isolates selected for further
studies, along with their (CZ/CS) ratio have been summarized below in Table 3.27.
Table 3.27: Isolates selected for further studies
Colony Obtained from CZ/CS Ratio
Colony 6 – S1 Beach sand soil 1.92 ± 0.07
Colony 3 – S2 Garden soil 2.22 ± 0.48
Colony 10 – S2 Garden soil 1.88 ± 0.13
Colony 3 – S3 Dumping ground soil 1.99 ± 0.56
Colony 4 – S4 Fish market soil 2.27 ± 0.25
These isolates were subjected to biochemical identification tests as described in
Bergey’s Manual of Systematic Bacteriology.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 101
Table 3.28: Clearance zone to Colony size (CZ/CS) ration of isolates (in cms) from soil sample 1 (S1)
Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6 Colony 7 Colony 8
CZ/CS ratio NA 1.43 ± 0.29 1.38 ± 0.10 NA NA 1.92 ± 0.07 1.57 ± 0.08 1.45 ± 0.13
Values are Mean ± SD of 3 replications
Key: NA – Not Applicable. No zone of inhibition observed
Table 3.29: Clearance zone to Colony size (CZ/CS) ration of isolates (in cms) from soil sample 2 (S2)
Colony
1
Colony
2
Colony
3
Colony
4
Colony
5
Colony
6
Colony
7
Colony
8
Colony
9
Colony
10
CZ/CS
ratio
0.63
±
0.12
0.48
±
0.04
2.22
±
0.48
NA NA NA NA 0.87
±
0.2
1.16
±
0.08
1.88
±
0.13
Values are Mean ± SD of 3 replications
Key: NA – Not Applicable. No zone of inhibition observed
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 102
Table 3.30: Clearance zone to Colony size (CZ/CS) ration of isolates (in cms) from soil sample 3 (S3)
Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6
CZ/CS ratio NA 1.32 ± 0.2 1.99 ± 0.56 0.87 ± 0.78 NA NA
Values are Mean ± SD of 3 replications
Key: NA – Not Applicable. No zone of inhibition observed
Table 3.31: Clearance zone to Colony size (CZ/CS) ration of isolates (in cms) from soil sample 4 (S4)
Colony 1 Colony 2 Colony 3 Colony 4
CZ/CS ratio 1.31 ± 0.27 1.43 ± 0.29 1.56 ± 0.10 2.27 ± 0.25
Values are Mean ± SD of 3 replications
Key: NA – Not Applicable. No zone of inhibition observed
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 103
Biochemical identification of the isolates capable of producing chitinase
Of the 28 isolates evaluated, five potential chitinase producers were selected for
further assessment. Each of the isolates were identified on the basis of their
morphological characteristics, namely, cell morphology (Gram’s nature, shape,
motility and the presence of endospores); colony morphology (colour, size, shape,
opacity, margin, elevation, and consistency) and biochemical characteristics using
standard biochemical test suggested in Bergey’s Manual of Systematic Bacteriology
(Claus & Berkeley 1986). The results of the morphological and biochemical tests
performed for each of the selected isolates are represented in Table 3.32 and Table
3.33 respectively.
Identification of the organism usually goes hand in hand with performing Antibiotic
Sensitivity Test (AST). This test was performed in order to confirm the identity of
each isolate along with compiling the information on what type of antibiotics to
consider for each isolate, as these isolates require to be user and environment-friendly.
The results of this test are presented in the Table 3.34.
Along with morphological and biochemical identification, additional accessory tests
were performed in order to further confirm the identity of each selected isolates. Each
isolate was studied in order to investigate the optimum pH, temperature and salt
concentration for maximum growth. The results of the test in order to investigate the
optimum conditions for maximum growth of each isolate have been summarized in
the Table 3.35.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 104
Table 3.32: Morphological characteristics of each of the isolates selected from the
screening process
Colony 6
S1
Colony 3
S2
Colony 10
S2
Colony 3
S3
Colony 4
S4
Gram Nature Gram
positive
cocci
Gram positive
bacilli
Gram negative
short rods
Gram
positive
bacilli
Gram
positive
bacilli
Motility Non motile Sluggishly
motile
Motile Non motile Non motile
Presence of
Endospore
Absent Sub terminal Absent Central Sub
terminal
Lactose
fermentation
NA NA Lactose non-
fermenter
NA NA
Key: NA- Not applicable
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 105
Table 3.33: Biochemical characteristics of the selected isolates from the screening
process
TEST Colony 6
S1
Colony 3
S2
Colony 10
S2
Colony 3
S3
Colony 4
S4
Tests to distinguish between aerobic and anaerobic breakdown of carbohydrates
O/F Aerobic* + + + + +
O/F Anaerobic - - - - -
Tests to show fermentation of range of carbohydrates: Acid production from
Glucose + + + + +
Sucrose + + - + +
Lactose + - - - +
Maltose + + - + +
Mannitol + - - - +
Xylose + - - - -
Tests for Specific Breakdown Products
Methyl Red + + - + +
VP Test - - - - -
Tests to show Ability to utilize particular Substrate
Starch + + + + -
Citrate - - + - -
Tests for Metabolism of Proteins and Amino acids
Indole
Production
- - - - -
Arginine
dihydrolyase
- - + - -
Gelatin
hydrolysis
+ + + + +
Tests for Enzymes
Catalase + - +
+
+ +
Oxidase - - + - -
Urease - + - + +
Nitrate
Reduction
+ - - - +
Combined Tests
Triple Sugar
Iron(TSI)
A/A A/A K/K A/A A/A
Key: + indicates positive reaction for the test
- indicates negative reaction the test
* indicates utilization of carbohydrate resulted in yellow coloration in the
medium
Acidic Slant, Acidic butt (A/A)
Alkaline Slant, Alkaline butt (K/K)
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 106
Table 3.34: Antibiotic Sensitivity of each of the chitinolytic organisms
Antibiotic Zone of Inhibition (in mm)
Colony 6
S1
Colony 3
S2
Colony 10
S2
Colony 3
S3
Colony 4
S4 Aztreonam 8 16 31 16 --
Cefoperazone 19 20 29 18 15
Tetracycline 20 23 24 19 19
Levofloxacin 28 26 34 30 20
Cefixime -- -- -- -- 28
Ofloxacin 14 21 23 23 --
Penicillin G 19 -- 6 -- 14
Imipenem -- -- -- -- 19
Cefuroxime 8 -- -- -- --
Azithromycin 28 19 20 21 8
Carbenicillin 14 -- 21 -- 28
Ciprofloxacin 12 20 21 23 14
Piprac/Tazobact 20 20 29 20 12
Augmenin 19 -- 22 -- 20
Methicillin 9 -- 10 -- 19
Ceftriaxone 18 11 29 -- 9
Amikacin 16 33 21 23 18
Tobramycin -- 35 -- 22 16
Sulfamethizole 24 32 33 24 --
Norfloxacin -- 32 11 22 24
Chloramphenicol 32 44 18 27 --
Cefadroxil 24 37 -- 26 32
Bacitracin 8 19 -- -- 24
Cephalexin 18 31 -- 25 8
Lincomycin -- 29 -- 17 18
Novobiocin 27 39 -- 22 --
Meropenem -- -- -- -- 27
Cefazolin -- -- 31 -- --
Oxacillin 9 -- 12 -- --
Ceftazidime -- -- -- -- 9
Sparfloxacin 24 38 40 26 --
Nalidixic acid -- 30 -- 22 24
Metronidiazole -- -- -- --
Vancomycin 28 30 -- 19 --
Co-trimoxazole 10 31 33 13 --
Trimethoprim -- -- -- -- 28
Cloxacillin
-- -- -- -- 10
Erythomycin -- 33 -- 26 --
Key: -- indicates no inhibition observed
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 107
Table 3.35: Summary of optimum growth parameters for each chitinolytic
organisms
Colony
6
S1
Colony
3
S2
Colony
10
S2
Colony
3
S3
Colony
4
S4
Optimum pH 7 7 7 7 7
Optimum temperature 37 oC 37
oC 37
oC 37
oC 37
oC
Optimum NaCl
concentration (%)
0.5 0.5 0.5 0.5 0.5
After the assessment of biochemical characteristics, the identity of each of the
selected isolates from the screening procedure was investigated up to the genus level
of identification. The summary of biochemical identification of the chitinolytic
isolates have been represented below in the Table 3.36.
Table 3.36: Summary of biochemical identification of the chitinolytic organisms
ISOLATE NAME
OBTAINED FROM
BIOCHEMICALLY
IDENTIFIED AS
Colony 6 S1 Beach soil Cellulosimicrobium spp.
Colony 3 S2 Garden Soil Bacillus spp.
Colony 10 S2 Garden soil Pseudomonas spp.
Colony 3 S3 Dumping ground soil Bacillus spp.
Colony 4 S4 Fish Market soil Bacillus spp.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 108
As per Bergey’s manual of Systematic Bacteriology, Colony 6 from beach sand soil
(Soil sample 1), resembled Cellulosimicrobium spp. (Claus & Berkeley 1986). The
morphological, biochemical and growth condition characterization matched with the
description provided in the Bergey’s manual of Systematic Bacteriology (Claus &
Berkeley 1986). Previously, strains of Cellulosimicrobium cellulans have been
reported to be isolated from alcohol fermentation industrial waste (Ferracini-Santos &
Sato 2009) and soil sample from Taiwan (Lo et al. 2009). The occurrence of
Cellulosmicrobium has also been reported in soil, compost samples and fetal tissues
or placenta samples from cases of equine abortion, premature birth and term
pregnancies of horses (Bolin et al. 2004; Yoon et al. 2007; Kamble & Jadhav 2013).
As per Bergey’s manual of Systematic Bacteriology (Claus & Berkeley 1986), Colony
3 and Colony 10 from garden soil (Soil sample 2) resembled Bacillus and
Pseudomonas spp. respectively. Earlier, Pseudomonadaceae have been reported to
constitute approximately 80 % of the chitinolytic population in the soil (Frändberg &
Schnürer 1998). Previous literature suggests that Pseudomonas is known to be
resistant to antibiotics and it is also implicated as an opportunistic pathogen of clinical
relevance (Mesaros et al. 2007). Although reports are available for usage of
Pseudomonas as biocontrol agents, the limited viability of Pseudomonas spp., has
hindered practical application (Weller 1988; Gardener 2007) and hence this isolate
was not selected for further studies Also, compared to other bacteria, Bacillus spp.
offer many advantages as biocontrol agents therefore Colony 3 which was identified
as belonging to Bacillus spp. was considered for further studies.
Colony 3 from soil sample 3 and Colony 4 from soil sample 4 which were garden soil
and fish market soil respectively were resembling Bacillus spp. as per Bergey’s
manual of Systematic Bacteriology (Claus & Berkeley 1986). The presence of
Bacillus spp. in garden and fish market soil confirmed the role of Bacillus spp. in
degradation of chitin containing substrates and recycling carbon and nitrogen in
nature.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 109
On the basis of previous literature reports, out of five chitinolytic organisms, four
isolates, belonging to Bacillus spp. (Colony 3 S2, Colony 3 S3 and Colony 4 S4) and
Cellulosimicrobium spp. (Colony 6 S1) were selected for further studies. In further
experiments, Colony 3 S2, Colony 6 S1, Colony 3 S3 and Colony 4 S4 will be
referred as Isolate 1, Isolate 2, Isolate 3 and Isolate 4 respectively for the description
of outcomes.
Extraction of Genomic DNA from bacterial cells and PCR for amplification of
16SrRNA gene:
Genomic DNA pellets were visualized as white pellets from each isolate following
isopropanol precipitation; these pellets were left overnight to dry and re-constituted
the following day in TE buffer. The extracted gDNA was qualitatively analysed by
carrying out Agarose Gel Electrophoresis.
The agarose gel electrophoresis indicated that the gDNA from the Isolates 1 and 2
were successfully extracted whereas gDNA from Isolates 3 and 4 showed trailing
effect (Figure 3.3). This phenomenon was attributed to the presence of RNA
contamination in the gDNA samples; the smearing and trailing effect of the gDNA
bands has been most frequently observed with high-molecular weight DNA fragments
(Voytas 2000). The absence of sharp bands of gDNA has been attributed to diffusion
of DNA through the gel, when gels are run for long periods of time at low voltages
(Voytas 2000). The gDNA samples from each isolates were subjected to RNase A
treatment which cleared out RNA contamination from the gDNA samples (Figure
3.4).
The genomic DNA samples were stored at -20 oC and used for PCR reactions. The
extracted genomic DNA of each of the four isolates served as template DNA for
amplification of 16SrRNA gene using PCR technique. Universal bacterial 16SrRNA
primers- 8F and 1391R were used for amplification of the 16SrRNA gene (Vickerman
et al. 2007). Under the optimized reaction mixture and reaction conditions, all the
isolates gave the amplified product of approximately 1.3 Kb using universal bacterial
primers (Figure 3.5).
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 110
Figure 3.3: Agarose gel electrophoresis of genomic DNA (gDNA) extracted from
all the isolates. Legend: Lane 1- gDNA from isolate 1; Lane 2- gDNA from isolate
2; Lane 3- gDNA from isolate 3; Lane 4- gDNA from isolate 4
Figure 3.4: Agarose gel electrophoresis of genomic DNA (gDNA) from
chitinolytic isolates following RNase A treatment. Legend: Lane 1- gDNA from
isolate 1; Lane 2- gDNA from isolate 2; Lane 3- gDNA from isolate 3;Lane 4-
gDNA from isolate 4
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 111
Figure 3.5: Agarose gel electrophoresis of PCR products from chitinolytic
isolates using universal bacterial 16SrRNA primers- 8F and 1391R. Legend:
Lane 1- DNA ladder (EcoRI/HindIII Marker); Lane 2- blank; Lane 3- PCR product
of isolate 2; Lane 4 – blank; Lane 5 – PCR product from isolate 3;Lane 6 –PCR
product from isolate 4; Lane 7 – blank; Lane 8 –PCR product from isolate 1
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 112
16SrRNA sequencing of the amplified PCR products of chitinolytic isolates:
To validate the isolates identity up to the species level, the PCR amplification
products were sent for sequencing at Gene Ombiotech Labs, Pune and the sequence
obtained were compared with the database of GenBank using the NCBI Blast tool.
The sequence data obtained following bidirectional sequencing of each isolate has
been presented in the Figures 3.6, 3.8, 3.10 and 3.12. This was followed by a
similarity search for the sequences obtained from each isolate using the BLAST
program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) which served to demonstrate the
identity of each isolate. The results obtained using Blast program has been included in
the Appendix I.
The partial sequence obtained for Isolate 1 using universal bacterial forward primer
8F resulted in the sequencing of 517 base pairs. The plausible causes of short DNA
sequencing read lengths can be attributed to excess template DNA or primers, too
little DNA or contamination of DNA template (Nucleics 2013). This problem could
be rectified by checking the concentration of the template DNA by taking
spectrophotometer readings.
The sequence of 827 bp obtained from Isolate 1 showed 98 % homology identity of
the culture to Bacillus cereus. The sequence of 912 bp obtained from Isolate 2
demonstrated 97 % homology identity of the culture to be alike to Cellulosimicrobium
cellulans whereas the sequences of 994 bp and 923 bp obtained from isolates 3 and 4
showed the cultures having 93 % and 96 % homology, confirming the isolates to be
Bacillus cereus strain NOC2011 and Bacillus licheniformis respectively.
A neighbour-joining distance gene tree was constructed using the NJ algorithm. The
phylogenetic trees for each of the isolates were constructed by comparing and
aligning the maximum resembling sequences to the sequence obtained from each
isolates using the CLUSTALW tool (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The
phylograms of each of the isolates have been presented in the Figures 3.7, 3.9, 3.11
and 3.13.
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 113
In the present study, the identification of the selected chitinolytic isolates was
confirmed up to the species level. It is reported that one of the most potential uses of
16SrRNA gene sequence informatics is to provide genus and species identification of
the isolates that do not fit any recognized biochemical profiles. It is also known that
results from a limited number of studies to date, suggest that 16SrRNA gene
sequencing provides genus identification, in most cases (> 90 %) 1 to 14 % of the
isolates remaining unidentified (Drancourt et al. 2000; Mignard & Flandrois. 2006).
The difficulties in obtaining the genus and species identification have been attributed
to few sequences deposited in nucleotide databases, species sharing similar and/or
identical 16SrRNA sequences (Janda & Abbott 2007). In regards to bacterial
classification, 16SrRNA gene sequencing has low phylogenetic power at species level
and poor discriminatory power for some genera, and DNA relatedness studies are
necessary to provide absolute resolution to taxonomic problems. The genus Bacillus
has been reported to exhibit this phenomenon (Janda & Abbott 2007). Hence, the use
of technologies based on microarray may prove to be more sensitive for molecular
species identification. The results of biochemical and 16SrRNA identification of each
of the chitinolytic isolates have been summarized in the Table below (3.37). The next
goal of the project included assessment and optimization of chitinase activity from
selected isolates followed by selection of potential BCA’s for further investigation.
This has been discussed in detail in following chapter.
Table 3.37: Summary of identification of chitinolytic isolates
ISOLATE
ORIGIN
BIOCHEMICALLY
IDENTIFIED AS
LINEAGE REPORT
RESULTS
Isolate 1/
Colony 3 S2
Garden soil Bacillus spp. Bacillus cereus
Isolate 2/
Colony 6 S1
Marve
Beach soil
Cellulosimicrobium spp. Cellulosimicrobium
cellulans
Isolate 3/
Colony 3 S3
Garden soil Bacillus spp. Bacillus cereus strain
NOC2011
Isolate 4/
Colony 4 S4
Fish market
soil
Bacillus spp. Bacillus licheniformis
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 114
Figure 3.6: Bidirectional sequence of 16SrRNA gene for Isolate 1 using universal
bacterial 16SrRNA primers – 8F and 1391R
Figure 3.7: Phylogenetic tree analysis for Isolate 1 based on 16SrRNA sequences
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 115
Figure 3.8: Bidirectional sequence of 16SrRNA gene for Isolate 2 using universal
bacterial 16SrRNA primers – 8F and 1391R
Figure 3.9: Phylogenetic tree analysis for Isolate 2 based on 16SrRNA sequences
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 116
Figure 3.10: Bidirectional sequence of 16SrRNA gene for Isolate 3 using
universal bacterial 16SrRNA primers – 8F and 1391R
Figure 3.11: Phylogenetic tree analysis for Isolate 3 based on 16SrRNA
sequences
Chapter 3: Isolation and identification of chitinase producing organisms
School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 117
Figure 3.12: Bidirectional sequence of 16SrRNA gene for Isolate 4 using
universal bacterial 16SrRNA primers – 8F and 1391R
Figure 3.13: Phylogenetic tree analysis for Isolate 4 based on 16SrRNA
sequences