Volume 3, Issue 22013
ISSN: 2159-8967www.AFABjournal.com
90 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 91
Sooyoun Ahn University of Florida, USA
Walid Q. AlaliUniversity of Georgia, USA
Kenneth M. Bischoff NCAUR, USDA-ARS, USA
Debabrata BiswasUniversity of Maryland, USA
Claudia S. Dunkley University of Georgia, USA
Lawrence GoodridgeColorado State University, USA
Leluo GuanUniversity of Alberta, Canada
Joshua GurtlerERRC, USDA-ARS, USA
Yong D. HangCornell University, USA
Divya JaroniOklahoma State University, USA
Weihong Jiang Shanghai Institute for Biol. Sciences, P.R. China
Michael JohnsonUniversity of Arkansas, USA
Timothy KellyEast Carolina University, USA
William R. KenealyMascoma Corporation, USA
Hae-Yeong Kim Kyung Hee University, South Korea
W.K. KimUniversity of Manitoba, Canada
M.B. KirkhamKansas State University, USA
Todd KostmanUniversity of Wisconsin, Oshkosh, USA
Y.M. Kwon University of Arkansas, USA
Maria Luz Sanz MuriasInstituto de Quimica Organic General, Spain
Melanie R. MormileMissouri University of Science and Tech., USA
Rama NannapaneniMississippi State University, USA
Jack A. Neal, Jr.University of Houston, USA
Benedict OkekeAuburn University at Montgomery, USA
John PattersonPurdue University, USA
Toni Poole FFSRU, USDA-ARS, USA
Marcos RostagnoLBRU, USDA-ARS, USA
Roni ShapiraHebrew University of Jerusalem, Israel
Kalidas ShettyNorth Dakota State University, USA
EDITORIAL BOARD
92 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
EDITOR-IN-CHIEFSteven C. RickeUniversity of Arkansas, USA
EDITORSTodd R. CallawayFFSRU, USADA-ARS, USA
Cesar CompadreUniversity of Arkansas for Medical Sciences, USA
Philip G. CrandallUniversity of Arkansas, USA
MANAGING and LAYOUT EDITOREllen J. Van LooGhent, Belgium
TECHNICAL EDITORJessica C. ShabaturaFayetteville, USA
ONLINE EDITION EDITORC.S. ShabaturaFayetteville, USA
ABOUT THIS PUBLICATION
Agriculture, Food & Analytical Bacteriology (ISSN
2159-8967) is published quarterly, beginning with
this inaugural issue.
Instructions for Authors may be obtained at the
back of this issue, or online via our website at
www.afabjournal.com
Manuscripts: All correspondence regarding pend-
ing manuscripts should be addressed Ellen Van Loo,
Managing Editor, Agriculture, Food & Analytical
Bacteriology: [email protected]
Information for Potential Editors: If you are interested
in becoming a part of our editorial board, please con-
tact Editor-in-chef, Steven Ricke, Agriculture, Food &
Analytical Bacteriology: [email protected]
Advertising: If you are interested in advertising with
our journal, please contact us at advertising@afab-
journal.com for a media kit and current rates.
Reprint Permission: Correspondence regarding re-
prints should be addressed Ellen Van Loo, Managing
Editor, Agriculture, Food & Analytical Bacteriology
Ordering Print Copies: print editions of this journal
may be purchased and shipped internationally from
our website order form at www.afabjournal.com
Subscription Rates: Subscriptions are not available
at this time. To be advised when subscriptions plans
are made available, please join our newsletter at
www.afabjournal.com
Mailing Address: 2138 Revere Place . Fayetteville, AR . 72701 Website: www.AFABjournal.com
EDITORIAL STAFF
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 93
Linoleic Acid Isomerase Expression in Escherichia coli BL21 (DE3) and Bacillus sppS. Saengkerdsub
145
Current and Near-Market Intervention Strategies for Reducing Shiga Toxin-Producing Escherichia coli (STEC) Shedding in Cattle.
T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, and D. J. Nisbet
103
Potential for Rapid Analysis of Bioavailable Amino Acids in Biofuel Feed Stocks D. E. Luján-Rhenals, and R. Morawicki
121
Isolation and Initial Characterization of Acetogenic Ruminal Bacteria Resistant to Acidic ConditionsP. Boccazzi and J. A. Patterson
129
ARTICLESConsumers’ Interest in Locally Raised, Small-Scale Poultry in GeorgiaE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, and S. C. Ricke
94
Instructions for Authors162
Introduction to Authors
The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.
TABLE OF CONTENTS
REVIEW
94 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
www.afabjournal.comCopyright © 2013
Agriculture, Food and Analytical Bacteriology
ABSTRACT
An online questionnaire was developed that targeted consumers with an interest in sustainable and
local poultry production in Georgia. Approximately 97% of the respondents expressed an interest in sup-
porting efforts to make sustainably raised poultry processed in Georgia available. Even for a high premium
of $5.00/lb, some respondents would shift their current chicken purchases towards these locally raised
chickens. Respondents reported some interest in attributes such as pasture raised, air chilled and Georgia
grown for their poultry. Knowledge about the demand for local pastured poultry supports the need for in-
frastructure to support Mobile Processing Units for Georgia farmers interested in locally raised small-scale
poultry production.
Keywords: consumer, small-scale poultry production, pastured poultry
InTRoduCTIon
The term pasture raised poultry refers to a pro-
duction system in which chickens or other poultry
are raised primarily on pasture, with the birds sup-
plementing their feed grain by foraging for up to 20
percent of their dietary intake. Until the 1930s, when
large concentrated animal feeding operations first
developed, almost all chickens were raised on pas-
Correspondence: Steven C. Ricke, [email protected]: +1-479-575-4678 Fax: +1-479-575-6936
ture. However, the concept of raising pastured poul-
try was never completely abandoned, and in 1993
Joel Salatin of Swoope, Virginia published Pastured
Poultry Profit$, a book in which he outlined a model
for modern pastured poultry production using small,
mobile, floorless, enclosed chicken shelters or hoop
houses. The modern pastured poultry movement
has flourished because of the increased demand of
consumers wanting to purchase pastured poultry
products (Faulkner, 2011).
Georgia produces more broilers than any other
state, more than 1.3 billion birds in 2010 (USDA,
Consumers’ Interest in Locally Raised, Small-Scale Poultry in GeorgiaE. J. Van Loo1,2, W. Q. Alali3, S. Welander4, C. A. O’Bryan1, P. G. Crandall1, S. C. Ricke1
1Department of Food Science and Center for Food Safety, University of Arkansas, Fayetteville, AR2Present address: Department of Agricultural Economics, Faculty of Bioscience Engineering,
Ghent University, Ghent, Belgium3Center for Food Safety and Department of Food Science & Technology,
University of Georgia, Griffin, GA4Georgia Organics, 200-A Ottley Drive, Atlanta, GA
Agric. Food Anal. Bacteriol. 3: 94-102, 2013
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 95
2011). However, the small-scale poultry industry in
Georgia is severely limited in growth due to regulato-
ry challenges imposed by the strict state rules, which
do not allow an exemption from federal inspection
for small farmers who process more than 1,000 birds/
year. An analysis of the Georgia consumers’ inter-
est in these small-scale farmer poultry products was
necessary to support the need for a new processing
option for these farmers. The various processing op-
tions and the preferences of the farmers were previ-
ously studied (Van Loo et al., 2013). The purpose of
this survey was to evaluate the consumer interest for
locally raised pastured poultry in Georgia. A relative-
ly high interest in these products could potentially
justify the development of new processing options
for the small-scale Georgia farmers.
MATeRIAlS And MeThodS
Notices of the pending survey were posted in the
Georgia Organics print newsletter, and in an elec-
tronic newsletter, as well as by a targeted email to
a list of interested poultry consumers based on con-
nections Georgia Organics made at conferences and
meetings. The link to the survey was also posted on
Georgia Organics’ website. A total of 508 Georgia
consumers took the survey between September of
2008 and July of 2010. Table 1 contains the ques-
tions and choice of possible answers. Frequency
tables, mean values and standard deviations were
determined using JMP (release 9.0.0: SAS Insti-
tute, Inc.).The consumer study targeted consumers
with an interest in sustainable and local foods pro-
duced in Georgia. The consumer survey consisted
of questions about (i) current poultry consumption;
(ii) consumer interest in locally pasture raised poultry
as well as their purchasing behavior if this product
would be available to them at different price levels;
and (iii) consumers’ interest in different poultry char-
acteristics/properties.
ReSulTS And dISCuSSIon
Poultry Consumption
A total of 508 consumers responded to the survey.
Among those who reported purchasing any type of
chicken in the previous 3 months, whole chicken and
Figure 1. Chicken purchasing habits of Georgia consumers (n = 508) during previous 3 months
0
100
200
300
400
500
Whole chickens Parts with skin/bones Parts skinless withbones
Partsboneless/skinless
Num
ber
96 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Table 1. Questionnaire
1. Indicate to what degree you agree with the following statement: “I support efforts to make this new type of chicken available in Georgia.” 1 = not at all, 2 = yes, some interest, 3 = yes, absolutely
2. In the last three months, have you purchased chicken meat (any source, any type) in the following forms?
• Whole chickens• Parts (with skin/bones)• Parts (skinless) with bones• Parts (skinless and boneless)• Other (please specify)
3. How many pounds of chicken (any source, any type) do you purchase per month?
4. How many whole chickens (any source, any type) do you purchase per month?Choices: 0, 1, 2, 3, 4, 5, 6, more than 6 (please specify)
5. If this new type of chicken were available as whole chickens at your favorite place to shop, please indicate the percentage of your current chicken purchasing you’d shift.
For example, if you’d shift 40% of your purchasing to pasture raised Georgia poultry if it were available at $4.00/pound, select “40” from the drop-down menu on the $4.00 row. Price points $2.50, $3.00, $3.50, $4.00, $4.50, $5.00
6. Indicate your level of interest in the following, as it pertains to this new type of poultry. 1 = not at all interested, 5 = very interested.
• Boneless,• Georgia grown,• Air chilled• Sustainably raised• Skinless• Pasture raised• Certified organic• Soy free• Other (please specify)
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 97
skinless boneless parts were the most popular types,
75% and 73% respectively (Figure 1). A smaller per-
centage, 63%, reported purchasing chicken parts
with skin and bones in the past 3 months, and the
least popular was skinless chicken parts with bones
(32%). Other categories mentioned included ground
chicken and livers/gizzards, with less than 1% of re-
spondents each. The vast majority of the consumers
reported monthly chicken purchases of between 1
and 10 pounds (Figure 2). For whole chickens in par-
ticular, almost 1/3 (32%) reported buying only one
whole chicken per month (Figure 3).
Consumer’s interest and willingness to pay for sustainable locally raised and pro-cessed poultry in Georgia
Consumers were asked about their interest in a
new type of poultry that would be raised sustainably
on Georgia pastures, meet or exceed all current san-
itary and safety measures, be processed in Georgia,
and be available for purchase at their favorite place
to purchase chicken. Figure 4 illustrates that among
these consumers there is a great interest in this type
of poultry; 94% said that they were “absolutely” inter-
ested in being able to purchase this type of poultry.
This can be explained by the nation-wide increase
of consumers’ interest in local foods. Peer reviewed
literature in agricultural economics substantiates a
strong consumer preference for locally-produced
foods (Zepeda and Li, 2006; Keeling-Bond et al.,
2009; Carpio and Isengildina- Massa, 2009; Marti-
nez et al., 2010). When asked, consumers list diverse
reasons for their “buy local” preferences, including
preference for fresher foods, minimal food miles, re-
duction of carbon footprint, and support for the lo-
cal economy (Guptill and Wilkins, 2002; ERS, 2010).
In a 2009 national study, respondents cited reasons
for buying local food as: freshness (82%), support for
the local economy (75%), and knowing the source of
their food (58%) (Food Marketing Institute, 2009). The
2008 Farm Act defines the total distance a product
can be transported and still be eligible for marketing
as a “locally or regionally produced agricultural food
product” as less than 400 miles from its origin, or the
State in which it is produced (USDA, 2008). As such
the Georgia raised poultry sold in Georgia meets the
definition for a local product.
The price of meat is an extrinsic factor that can
affect consumer’s purchasing decisions (Lange et al.,
1999; Lockshin et al., 2006). The participating con-
sumers in our study were willing to pay premium
prices for these products. Consumers were asked
the question “If this new type of chicken were avail-
able as whole chickens at your favorite place to shop,
please indicate the percentage of your current chick-
en purchasing you would shift. For example, if you
would shift 40% of your purchasing to pastured raised
Georgia poultry if it were available at $4.00/pound,
select “40” from the drop-down menu on the $4.00
row.” Depending on the price charged for whole
pasture raised chicken, the consumers were willing
to shift a different amount of their current whole
chicken purchases (Figure 5). Van Loo et al. (2010)
reported price as the main disincentive for organic
chicken purchases. Similarly, our results indicate that
price has a negative correlation to the demand of
locally raised pastured poultry from Georgia. With
a higher price point for the locally raised pastured
poultry, the reported demand decreases. For the low
price of $2.50/lb, 213 (42%) of the respondents were
willing to shift 100% of their current whole chicken
purchases towards locally raised chicken. At a higher
price of $3.00/lb, 175 respondents were willing to
shift 100% of their current chicken purchases towards
this local product. However, even for a high premium
of $5.00/lb, 75 (15%) of the respondents would shift
100% of their current chicken purchases towards this
local product. Van Loo et al. (2011) indicated in previ-
ous research that consumers who are habitual buyers
of sustainable meat products are also willing to pay a
higher premium price for these products. Michel et
al. (2011) reported that half of the participants were
willing to pay a 30% premium for value-added chick-
en compared to conventional chicken products. Ver-
beke and Viaene (1999) conversely found that price
was ranked fifth regarding perception of pork, beef
and poultry attributes by consumers, behind qual-
ity, taste, free of hormones and healthy. Furnols et
98 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Figure 2. Pounds of chicken purchased during previous 3 months? (n = 508)
Figure 3. Number of whole chickens purchased per month by survey respondents (n=508).
0
50
100
150
200
250
300
350
400
0 1-10 11-20 21-30 31-40 41-50 51+
Num
ber
of
cons
umer
s
Pounds purchased
0
20
40
60
80
100
120
140
160
180
0 1 2 3 4 5 6 6+
Num
ber
fo
co
nsum
ers
Number of chickens
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 99
Figure 4. Consumer support for sustainably raised, Georgia pastured poultry. 1 = no interest, 2 = some interest, 3 = absolutely.
Figure 5. Percent of respondents willing to shift chicken purchases to pasture raised Georgia poultry at different price points per pound
213175 158
135
80 75
3671 93
72
5835
17 2236
43
45
42
2340
56
74
81
94
610
1528
49 71
$2.50 $3.00 $3.50 $4.00 $4.50 $5.00
Num
ber
of
resp
ond
ents
Price point
100% 55-95% 50% 5-45% 0
1 = Not at all0%
2 = Some interest
5%
3 = Absolutely95%
100 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
al. (2011) found that lamb meat price played only
a minor role in determining consumer’s purchasing
decisions, except that when sorted by demograph-
ics men considered that the price was the most im-
portant factor. No demographic information was
collected in the survey reported here, so no such
determination can be made, but we may conclude
that price was not as big a factor for our respondents
as other factors.
Interest and relative importance of dif-ferent poultry characteristics
Respondents rated the importance of/interest in 8
different meat quality criteria using the 5 point Likert
scale, with 1 being not at all interested and 5 being
very strongly interested (Table 2). When evaluating
the average importance of the meat quality attri-
butes, the most important chicken product attribute
was “sustainably raised” (3.70) followed by “Geor-
gia grown” (3.63), “pasture raised” (3.45) and “cer-
tified organic“(3.13). These four product properties
are characteristic for local pasture or organic raised
poultry and appear to be more important than other
characteristics. These other characteristics, related
to general properties, not particularly characteris-
tic for pasture raised, locally or organically raised
poultry were found less important such as air chilled
(2.84), boneless (2.59), skinless (2.47) and soy-free
(2.42). These results indicate that the consumers who
answered this portion of the survey were interested
in sustainable locally raised and processed poultry
products and suggest that there is a strong demand
this product. Food selection and consumption can
be affected by different intrinsic and extrinsic cues
such as country of origin, price or type of feed such
as grain versus grass fed (Verlegh and van Ittersum
2001; Furnols et al., 2011). For instance, Furnols et
al. (2011) found that origin of lamb meat was one of
Table 2. The frequency distribution among the 5 levels of interest for different chicken product properties and average Likert scale value where 1 = not at all interested and 5 = very interested
Chicken product
properties1 2 3 4* N Mean St. dev.
Sustainably raised 0% 3.3% 23.0% 73.8% 61 3.70 0.53
Georgia grown 2.2% 3.3% 23.9% 70.7% 92 3.63 0.66
Pasture raised 3.8% 11.3% 20.8% 64.1% 53 3.45 0.84
Certified organic 6.8% 13.1% 40.3% 39.8% 187 3.13 0.89
Air-chilled 13.1% 15.3% 46.4% 25.2% 316 2.84 0.95
Boneless 21.4% 22.0% 33.2% 23.4% 329 2.59 1.07
Skinless 25.0% 22.3% 33.1% 19.6% 325 2.47 1.07
Soy-free 33.2% 10.2% 37.8% 18.7% 281 2.42 1.13
*No respondents answered 5
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 101
the most important factors in purchasing, with lo-
cally grown lamb being the most preferred. This is
consistent with our study where “Georgia grown” is
an attribute of high importance. The pasture raised
attribute had a higher score than organic certified.
This is similar with the study from Michel et al. (2011)
where consumers also indicated a preference for
free-range chicken over organic chicken and may
be a consequence of the associated higher price of
organic meat as compared to pasture or free-range
poultry.
However, we need to be careful drawing conclu-
sions about the ranking of the importance of the at-
tributes since varying totals for responding to these
questions makes it difficult to make a definitive
statement. For instance, “sustainably raised” has a
Likert value of 3.70 but only 61 persons in the survey
rated that attribute at any level. None of the respon-
dents claimed to be strongly interested in any of the
options. One possibility in our study is that other
attributes might be more important to the respon-
dents. In looking at comments, this has some validity
as some of the respondents mentioned “humanely
slaughtered” as an aspect they valued. Another pos-
sibility is that terms such as “sustainably raised”, “air
chilled” or “soy free” were not defined and some
respondents may not have been familiar with these
terms.
ConCluSIonS
The polled consumers have a great interest in sus-
tainable locally raised poultry products processed in
Georgia and are willing to pay extra for these prod-
ucts compared to conventional poultry products. It
is important to emphasize that the results are based
on surveying consumers currently interested in sus-
tainable and local foods and therefore cannot be
generalized for all Georgian consumers. Therefore,
we would suggest that future research not only focus
on the consumers currently involved with Georgia
Organics, but research involve a statistically repre-
sentative group of all Georgia poultry consumers.
The consumer awareness as well as their interest and
willingness to pay for local and sustainable poultry
products will help decide the future for pastured
poultry in Georgia and other regions.
ACknowledgeMenTS
The preparation of this manuscript was partially
funded by SARE grant LS11-245 and USDA-NIFSI
grant #2008-51110-04339.
RefeRenCeS
Carpio, C. E., and O. Isengildina-Massa. 2009. Con-
sumer willingness to pay for locally grown prod-
ucts: The case of South Carolina. Agribusiness
25:412–426.
Faulkner, D. 2011. Pastured chicken. Farming maga-
zine, Fall, 2011:28-29.
Food Marketing Institute. 2009. U.S. Grocery shop-
per trends. Food Marketing Institute: Arlington,
VA.
Furnols, M. F., C. Realini, F. Montossi, C. Sanudo, M.
M. Campo, M. A. Oliver, G. R. Nute, and L. Guer-
rero. 2011. Consumer’s purchasing intention for
lamb meat affected by country of origin, feeding
system and meat price: A conjoint study in Spain,
France and United Kingdom. Food Qual. Pref. 22:
443-451.
Guptill, A., and J.L. Wilkins. 2002. Buying into the
food system: Trends in food retailing in the U.S.
and implications for local foods. Agric. Human Val-
ues 19:39-51.
Keeling-Bond, J., D. Thilmany, and C. Bond. 2009.
What influences consumer choice of fresh produce
purchase location. J. Agric. Appl. Econ. 41:61-74.
Lange, C., F. Rousseau, and S. Issanchou. 1999. Ex-
pectation, liking and purchase behaviour under
economical constraint. Food Qual. Pref. 10:31–39.
Lockshin, L., W. Jarvis, F. d’Hauteville, and J-P. Per-
routy. 2006. Using simulations from discrete choice
experiments to measure consumer sensitivity to
brand, region, price, and awards in wine choice.
Food Qual. Pref. 17:166–178.
102 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Martinez, S., M. Hand, M. Da Pra, S. Pollack, K. Ral-
son, T. Smith, S. Vogel, S. Clark, L. Lohr, S. Low,
and C. Newman. 2010. Local food systems: con-
cepts, impacts, and issues. US Dep. Agric, Econ.
Res. Serv., ERR Rep. 97. Available at http://www.
ers.usda.gov/Publications/ERR97/ERR97.pdf Ac-
cessed February 2012.
Michel, M. L., S. Anders, and W. V. Wismer. 2011.
Consumer preferences and willingness to pay for
value-added chicken product attributes. J. Food
Sci.76: S469–S477.
Salatin, J. 1996. Pastured Poultry Profit$. Chelsea
Green Pub Co. 335 p.
USDA. 2008. USDA 2008 Farm Bill. Main Outline. Ac-
cessed March 2011. http://www.5
usda.gov/wps/portal/usda/farmbill2008?navid=FAR
MBILL2008.
USDA. 2011. Poultry – Production and value. 2010
Summary. April 2011. Available at http://usda01.
library.cornell.edu/usda/current/PoulProdVa/Poul-
ProdVa-04-28-2011.pdf. Accessed 02/22/2012.
Van Loo, E. J., V. Caputo, R. M., Nayga, J. Meullenet,
P. G. Crandall, and S. C. Ricke. 2010. The effect of
organic poultry purchase frequency on consumer
attitudes toward organic poultry meat. J. Food Sci.
75: S384–S397.
Van Loo, E. J., V. Caputo, R. M. Nayga Jr., J-F. Meul-
lenet, and S .C. Ricke. 2011. Consumers’ willingness
to pay for organic chicken breast: Evidence from
choice experiment. Food Qual. Pref. 22:603-613.
Van Loo, E. J., W. Q. Alali, S. Welander, C. A. O’Bryan,
P. G. Crandall, and S. C. Ricke. 2013. Independent
poultry processing in Georgia: survey of producers’
perspective. Agric., Food, Anal. Bacteriol. 3:70-77.
Verbeke, W., and J. Viaene. 1999. Beliefs, attitudes
and behaviour towards fresh meat consumption in
Belgium: Empirical evidence from a consumer sur-
vey. Food Qual. Pref. 10:437–445.
Verlegh, P.W.J, and K. van Ittersum. 2001. The ori-
gin of spices: the impact of geographic product
origin on consumer decision making, in Frewer L.,
E. Risvik, H. Schifferstein (Eds) Food, People and
Society, Springer, New York, pp 267-279.
Zepeda, L., and J. Li. 2006. Who buys local food? J.
Food Dist. Res. 37:1-11.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 103
www.afabjournal.comCopyright © 2013
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Cattle can naturally contain foodborne pathogenic bacteria such as Shiga Toxin-Producing E. coli (STEC).
These foodborne pathogenic bacteria are a threat to public health through contamination of foods and
water supplies. In order to reduce human exposures and resultant illnesses, research has focused in recent
years on the development of live animal intervention strategies that can be applied to reduce the burden
of STEC entering the food chain. This review addresses the application of interventions that have been
proposed or implemented to reduce STEC in live cattle. Recent years have seen increasing development
of new interventions (e.g., vaccination, DFM, chlorate, phages) and into understanding what effect diet and
the microbial population have on the microbial populations of the gut of cattle. This research has resulted
in several novel interventions and potential dietary additions or changes that can reduce STEC in cattle,
and many of them are in, or very near to entering, the marketplace. The live animal interventions must be
designed in a coherent, complementary context as part of a multiple-hurdle scheme to reduce pathogens
entry into the food supply.
Keywords: Escherichia coli, shiga toxin, intervention, cattle, shedding, near-market, multiple hurdle
InTRoduCTIon
The beef industry has been significantly impacted
by the emergence of Shiga toxin-producing Esch-
Correspondence: Todd Callaway, [email protected]: +1-979-260-9374 Fax: +1-979-260-9332.
erichia coli (STEC) bacteria which are naturally found
in cattle (Karmali et al., 2010). STEC-caused illness-
es are a zoonotic disease (Karesh et al., 2012) that
costs the American economy more than $1 billion
each year in direct and indirect costs from more than
175,000 human illnesses (Scallan et al., 2011; Scharff,
2010). While strategies focused on the prevention
of transmission via carcasses have been largely suc-
REVIEWCurrent and near-market intervention strategies for reducing
Shiga Toxin-Producing Escherichia coli (STEC) shedding in cattle
T. R. Callaway1, T. S. Edrington1, G. H. Loneragan2, M. A. Carr3, D. J. Nisbet1
1Food and Feed Safety Research Unit, USDA/ARS, 2881 F&B Rd., College Station, TX 778452Department of Animal and Food Sciences, Texas Tech University, Lubbock, TX 79409
3Research and Technical Services, National Cattlemen’s Beef Association, Centennial, CO 80112
Proprietary or brand names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies neither approval of the product, nor exclusion of others that
may be suitable.
Agric. Food Anal. Bacteriol. 3: 103-120, 2013
104 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
cessful, they are far from perfect (Arthur et al., 2007a;
Barkocy-Gallagher et al., 2003). Thus it has been
necessary to develop animal management controls
as well as applicable intervention strategies for use in
live cattle (Callaway et al., 2004b; LeJeune and Wet-
zel, 2007; Oliver et al., 2008; Sargeant et al., 2007).
Because human STEC exposures are not limited
only to food-based routes, but include animal con-
tact, it is likely that reducing STEC in cattle can im-
prove public health in rural communities, as well as
in reducing foodborne illnesses (LeJeune and Kerst-
ing, 2010; Rotariu et al., 2012). As discussed pre-
viously (Callaway et al., 2013) the logic underlying
focusing on reducing foodborne pathogenic bacte-
ria in live cattle is straightforward: 1) reducing the
amount of pathogens entering processing plants
will reduce the burden on the plants and render the
in-plant interventions more effective; 2) reducing
horizontal pathogen spread from infected animals
(especially in “supershedders”) in transport and lai-
rage; 3) will reduce the pathogenic bacterial burden
in the environment and wastewater streams; and 4)
will reduce the direct risk to those in direct contact
with animals via petting zoos, open farms, rodeos
and to animal workers.
This present review is intended to complement
the accompanying STEC ecology and animal man-
agement-focused review (Callaway et al., 2013) and
will stress the application of external intervention
strategies focused on reducing STEC in live cattle.
We will divide the interventions into two broad cat-
egories: 1) Probiotic approaches that utilize the com-
petitive nature of the gastrointestinal microbiome,
and 2) Anti-pathogen strategies that specifically tar-
get pathogens based on their physiology and eco-
logical niches.
PRoBIoTIC APPRoACheS, hARneSS-Ing MICRoBIAl eCology
In recent years, probiotic approaches (e.g., those
that utilize live or dead cultures of microorganisms
to alter the microbial population of the gut) have
received increased interest as a method to reduce
foodborne pathogenic bacteria in cattle. Tradition-
ally, probiotic products in the cattle industry have
been used to enhance production efficiency of meat
or milk (Callaway and Martin, 2006; Fuller, 1989; Tour-
nut, 1989; Yoon and Stern, 1996). However recent
years have an increase in the use of the probiotic
types: direct fed microbials (DFM), competitive ex-
clusion cultures (CE), and prebiotics to reduce E.
coli O157:H7 populations in cattle (McAllister et al.,
2011) and can be considered part of an “organic”
approach to improving food safety (Siragusa and
Ricke, 2012).
In general it appears that probiotic products work
to alter the microbial ecology of the gastrointestinal
tract through a variety of mechanisms. As the DFM/
CE bacteria attach to the surface of the intestinal ep-
ithelium this physical binding can prevent opportu-
nistic pathogens from attaching to the intestinal wall
(Collins and Gibson, 1999; Kim et al., 2008). Volatile
fatty acids produced by microbial fermentation can
be toxic to some bacterial species (Ricke, 2003; Rus-
sell, 1992; Wolin, 1969), and other bacterial products
(such as ethanol, traditional antibiotics, or colicins/
bacteriocins [described below]) are produced by
some intestinal bacteria to eliminate competition
within the same environmental niche (Jack et al.,
1995). Collectively, these modes of action demon-
strate the complexities involved with interrupting
the cycle of transmission and colonization of cattle
with E. coli O157:H7, and emphasize that a multiple-
hurdle using complementary interventions has the
greatest chance of improving food safety at the live
animal level.
Direct Fed Microbials
Direct Fed Microbials are widely fed in beef and
dairy cattle and are typically composed of yeast,
fungal or bacterial cultures or end-products of fer-
mentation, and the cultures may be live or dead. A
DFM is fed to animals daily to improve the ruminal
fermentation and production efficiency (Martin and
Nisbet, 1992). Increasingly, companies claim some
benefit to them in reducing E. coli O157:H7 shed-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 105
ding in cattle. Researchers compared several of
the commercially-available growth enhancement
probiotics and yeast products and found that feed-
ing these probiotics provided no effect in regards
to pathogen levels in cattle (Keen and Elder., 2000;
Swyers et al., 2011). A probiotic culture comprised
of Streptococcus bovis and Lactobacillus gallinarum
from the rumen of cattle reduced E. coli O157 shed-
ding when given to experimentally-infected calves,
and this decrease was attributed to an increase in
VFA concentration in the gut (Ohya et al., 2001). Pro-
biotic products have been developed to specifically
reduce E. coli O157:H7 shedding in cattle. A pro-
biotic that contained S. faecium or a mixture of S.
faecium, L. acidophilus, L. casei, L. fermentum and
L. plantarum significantly reduced fecal shedding
of E. coli O157:H7 in sheep, yet, a monoculture of
Lactobacillus acidophilus was found to be ineffec-
tive (Lema et al., 2001). A DFM comprised of Bacillus
subtilis did not affect the fecal prevalence or concen-
tration of E. coli O157:H7 and did not impact aver-
age daily gain in feedlot cattle (Arthur et al., 2010a).
Studies have also indicated that cultures of Lacto-
bacillus acidilacti and Pediococus could directly in-
hibit E. coli O157:H7, likely through the production
of organic acids and low pH (Rodriguez-Palacios et
al., 2009).
Other researchers demonstrated that a direct-fed-
microbial (DFM) L. acidophilus culture derived direct-
ly from the rumen of cattle reduced E. coli O157:H7
shedding by more than 50% when fed to feedlot
cattle (Brashears and Galyean, 2002; Brashears et al.,
2003a; Brashears et al., 2003b). In an independent
evaluation, this DFM reduced fecal shedding of E.
coli O157:H7 in cattle from 46% to 13% (Ransom et
al., 2003). In a further refinement of this DFM, where
the L. acidophilus cultures were combined with Pro-
pionibacterium freudenreichii (a propionate-produc-
ing commensal intestinal bacteria) a reduction in the
prevalence of E. coli O157:H7 occurred in the feces
from approximately 27% to 16% and reduced the
prevalence on hides from 14% to 4% (Elam et al.,
2003; Younts-Dahl et al., 2004). Further work with this
DFM again showed that it reduced E. coli O157:H7
and Salmonella in feces and on hides (Stephens et
al., 2007b), and it further reduced concentrations of
E. coli O157:H7 in the feces (Stephens et al., 2007a;
Stephens et al., 2007b), which may be more of a criti-
cal impactor of carcass contamination than simple
prevalence levels (Arthur et al., 2010b). Additional
studies using only the L. acidophilus DFM found no
impact of low dose DFM feeding on E. coli O157:H7
prevalence (Cull et al., 2012). It is important to note
that in this study a low dose DFM product was uti-
lized, and further research indicates that the effect
on E. coli O157:H7 prevalence and concentrations
is impacted by DFM dosage levels (Cull et al., 2012).
This Lactobacillus-based DFM is currently market-
ed as Bovamine™ and Bovamine Defend™ based
on dosing levels and both are widely used in the
cattle industry because they have been reported to
improve the growth efficiency of cattle, at least in a
feedlot ration. There will likely not be a single DFM
that can work effectively at reducing E. coli O157:H7
populations in cattle and improve production effi-
ciency in all production systems (i.e., feedlots, cow-
calf, stockers, and dairies). Therefore, alternative
DFM cultures selected specifically for each produc-
tion segment or situation need to be developed so
that the food safety improvement can occur while
economically balancing the cost of its inclusion in
cattle rations thus “paying for” the enhancement of
food safety.
Competitive exclusion
Competitive exclusion (CE) is another probiotic
approach that has been used to eliminate E. coli
O157:H7 (as well as Salmonella) from cattle gas-
trointestinal tracts (Brashears and Galyean, 2002;
Brashears et al., 2003a; Brashears et al., 2003b; Zhao
et al., 2003). Competitive exclusion as a technology,
involves the addition of a (non-pathogenic) bacterial
culture (of one or more species) to the intestinal tract
to reduce colonization or decrease populations of
pathogenic bacteria (Fuller, 1989; Nurmi et al., 1992).
An established gastrointestinal microbial population
makes an animal more resistant to transient oppor-
tunistic infections (Fuller, 1989), because the species
106 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
best adapted to occupy a particular niche within the
intestinal tract succeeds, and pathogenic bacteria
are generally viewed as opportunists.
A CE culture should be derived from the animal
of interest, thus CE cultures attempt to take advan-
tage of co-evolution of host and microorganism.
Depending on the stage of production of the ani-
mal (i.e., maturity of the gut), the goal of CE can be
the exclusion of pathogens from the naïve gut of a
neonatal animal, or the displacement of an already
established pathogenic bacterial population (Nurmi
et al., 1992). For example, many researchers have
isolated commensal (non-pathogenic) E. coli strains
that show tendencies to reduce E. coli O157:H7 pop-
ulations, at least in vitro (Fox et al., 2009a; Reissbrodt
et al., 2009; Zhao et al., 1998). Researchers used a
defined population of multiple commensal E. coli
strains that were isolated from cattle and found this
generic E. coli CE culture could displace an estab-
lished E. coli O157:H7 population from calves (Zhao
et al., 1998). In a follow up study, calves that were
colonized with the E. coli CE product shed less E.
coli O111:NM and O26:H111 (both STEC strains iso-
lated from cattle, but the CE product did not reduce
E. coli O157:H7 (Zhao et al., 2003). Other researchers
have isolated E. coli strains that display a “proximity-
dependent” killing of E. coli O157:H7 strains which
could possibly be utilized in CE cultures or as a DFM
(Sawant et al., 2011). While the mechanism of this
killing has not been defined, it does not appear to
be mediated by colicins or phages (Sawant et al.,
2011).
Colicins and colicin-producing E. coli
Colicins are antimicrobial proteins produced by
certain E. coli strains that kill or inhibit the growth
of other E. coli strains (Konisky, 1982; Lakey and
Slatin, 2001; Smarda and Smajs, 1998), including E.
coli O157:H7 (Jordi et al., 2001; Murinda et al., 1996;
Schamberger and Diez-Gonzalez, 2002). The con-
cept of using colicins as an intervention strategy to
kill food borne pathogens is not new (Joerger, 2003;
Murinda et al., 1996), but until recently has been lim-
ited by cost to use as treatment on finished meat
products (Abercrombie et al., 2006; Liu et al., 2011;
Patton et al., 2008) or vegetables (Nandiwada et al.,
2004). Recently however, the costs of production and
purification of colicins was lowered by recombination
protein expression work (Stahl et al., 2004). Because
of the increased availability of the colicins, scaled
up studies could be conducted in a mouse model,
where it was demonstrated that E. coli O157:H7 was
prevented from colonization (Leatham et al., 2009).
Recently, specific studies have examined the use of
specific colicins against E. coli O157:H7 in vitro in
gastrointestinal simulations (Callaway et al., 2004d)
and against other E. coli in vivo (Cutler et al., 2007).
In spite of the seemingly simple addition of a
protein (colicin) to animal diets to control E. coli
O157:H7, studies have indicated that the sensitivity
of E. coli O157:H7 strains to any single colicin can
be highly variable (Murinda et al., 1996; Murinda et
al., 1998; Schamberger and Diez-Gonzalez, 2002).
Because some E. coli O157:H7 strains are colicino-
genic and produce specific concomitant immunity
proteins (Murinda et al., 1998), these strains of E.
coli O157:H7 can be resistant to certain added co-
licins or even a broad category of colicins (Alonso
et al., 2000). Therefore, if colicins are to be used as
a preharvest intervention strategy, there must be si-
multaneous administration of several categories of
colicins. Furthermore, if colicins are to be a viable an-
ti-E. coli O157:H7 intervention strategy, the proteins
must be protected from gastric and intestinal deg-
radation. As a way of getting colicins into the lower
gut of cattle, researchers have proposed a specific
form of DFM/CE of feeding colicin-producing E. coli
in cattle rations (Schamberger and Diez-Gonzalez,
2002; Schamberger et al., 2004; Zhao et al., 1998).
These strains have been shown to colonize the lower
gut of cattle, but the reduction in concentration of E.
coli O157 was approximately 2 log10 CFU/g, not a
complete elimination (Nandiwada et al., 2004).
The complex nature of ruminant animal gastroin-
testinal tract, and the long (12-18 month) life span
of cattle going into a feedlot means that CE use in
cattle as a “one shot” approach may not completely
eliminate E. coli O157:H7 and other STEC shedding
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 107
throughout the lifetime of the animal. So individual
CE for various phases of production cycles or chang-
es (e.g., entry to the feedlot) may need to be de-
veloped, or an early-established CE culture may be
best supplemented over time by DFM and/or prebi-
otic feeding (synbiotics, described below).
Prebiotics
Organic compounds that are unavailable to, or in-
digestible by the host animal, but are digestible by
a specific segment of the microbial population are
generally classified as “prebiotics” (Patterson and
Burkholder, 2003; Schrezenmeir and De Vrese, 2001;
Walker and Duffy, 1998). For example, fructo-oligo-
saccharides, are sugars that are not degraded by in-
testinal enzymes that can pass down to the cecum
and colon to become “colonic food” for the host
bacterial population and provide nutrients to the in-
testinal mucosa (Houdijk et al., 1998; Willard et al.,
2000). Some prebiotics can provide a competitive
advantage to specific members of the native micro-
flora (e.g., Bifidobacteria, Butyrivibrio) that can help
to exclude pathogenic bacteria from the intestine via
direct competition for nutrients or for binding sites
through the production of “blocking factors”, or an-
timicrobial compounds in a fashion similar to that of
CE (Zopf and Roth, 1996). Other prebiotics (Celma-
nax) have been shown to have an anti-adhesive ef-
fect on E. coli O157:H7 in vitro using bovine cells,
which should be investigated further (Baines et al.,
2011).
Coupling the use of CE and prebiotics is known as
“synbiotics”, and could yield a synergistic effect in
reduction of food-borne pathogenic bacterial popu-
lations in food animals prior to slaughter (Bomba et
al., 2002). To date, prebiotics have not been widely
implemented in cattle due to their expense, and the
ability of ruminal microorganisms to degrade a wide
variety of typical prebiotic substrates, however as
costs change, their inclusion as part of a synbiotic di-
rected anti-pathogen strategy may become feasible.
AnTI-PAThogen STRATegIeS, TARgeT-ed TReATMenT
In spite of the potential of probiotic approaches,
other pathogen-reduction strategies have been de-
veloped for use in the live animal that target patho-
gens directly. Many of these treatments utilize the
host animal, natural members of the microbial eco-
system, or utilize an aspect of pathogen physiology
to inhibit pathogen survival.
Antibiotics
The use of antibiotics specifically to control E. coli
O157:H7 shedding in cattle is controversial. Few re-
searchers have delved into this area in cattle to date.
Neomycin is an antibiotic that is approved for use in
cattle to treat enteric infections and has been shown
to reduce E. coli O157:H7 populations in the gut
(Elder et al., 2002; Ransom et al., 2003) and on the
hides of cattle (Ransom et al., 2003). Other research-
ers have found that in swine artificially infected with
E. coli O157:H7, the feeding of chlortetracycline and
tylosin decreased fecal shedding, while bacitracin
did not impact E. coli O157:H7 populations (Cor-
nick, 2010). It is hypothesized that the generalized
disruption of the microbial ecosystem that is caused
by antibiotic treatment indirectly affects the E. coli
O157:H7 populations; the use of some antibiotics
thus may provide E. coli O157:H7 a competitive ad-
vantage in the ruminant gastrointestinal tract. The
use of antibiotics to reduce E. coli O157:H7 in cattle
has not been recommended because of concerns
relating to the development of antimicrobial resis-
tance.
Bacteriophages
Bacteria can be infected by naturally-occurring
bacteriophages (bacterial viruses) that are found in
many environments (Kutter and Sulakvelidze, 2005;
Lederberg, 1996), including the intestinal tract of
cattle (Callaway et al., 2006; Goodridge, 2008; Go-
108 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
odridge, 2010). Phages can have very narrow target
spectrums, and may only be active against a single
bacterial species, or even strain because they tar-
get specific receptors on the surface of the bacte-
rium (Lederberg, 1996). This specificity should allow
phages to be used as an anti-pathogen treatment,
a kind of “smart bomb” targeting on the species
we wish to eliminate, without perturbing the over-
all microbial ecosystem (Johnson et al., 2008). Lytic
phages “hijack” a targeted bacterium’s biosynthetic
machinery to produce daughter phages; when intra-
cellular nutrients are depleted, the host bacterium
bursts, releasing phages to repeat the process in a
fashion similar to a chain reaction. An exponential
increase in the number of phages continues as long
as target bacteria are present, allowing phages to
persist in the environment rather than simply de-
grade over time as a chemical treatment. However,
phage populations are self-limiting; if the targeted
bacteria are removed from the environment, then
phage populations diminish. One potential draw-
back to the use of phages is the rapid development
of bacterial resistance to a single phage, thus much
of the effort has been focused on the development
of multi-phage cocktails (Tanji et al., 2005).
Phages have been examined for use in two dif-
ferent approaches to reduce E. coli O157:H7, within
the gut of cattle before slaughter, and as a hide or
environmental decontaminant (Ricke et al., 2012).
Commercial phage-based anti-E. coli O157:H7 are
currently focused on the use of lytic phages in hide
wash and surface cleansing products; FSIS has issued
a letter of no objection to this use of phages. Phage
products for use as a hide spray have been released
into the marketplaces (Omnilytics and Elanco, Final-
yse). Company-based research indicates a signifi-
cant reduction in positive trim samples from cattle
that were sprayed with this product. Processors are
finding appropriate critical control points in which to
include phage sprays on carcasses prior to de-hiding
in relation to other hide spray intervention steps to
reduce E. coli O157:H7 on the hides of cattle as they
enter the food chain. Several phages isolated by Eu-
ropean laboratories have shown promise as E. coli
O157:H7 reduction agents sprayed on cattle hides,
but that they require an extended exposure time
(1 h) to obtain maximal effect (Coffey et al., 2011).
Interestingly, several phages have been isolated
recently that are effective both against Salmonella
spp. and E. coli O157:H7 (López-Cuevas et al., 2011;
López-Cuevas et al., 2012; Park et al., 2012), which
offers the hope of phage use as a broad-spectrum
food safety improvement.
Phages have been used successfully in several in
vivo research studies examining the effect of phage
on diseases that impact animal production efficiency
or health (Huff et al., 2002; Smith and Huggins, 1982;
1983; 1987). Bacteriophage treatment reduced en-
terotoxigenic E. coli (ETEC)-induced diarrhea and
splenic ETEC colonization in calves (Smith and Hug-
gins, 1983; 1987). With the increasing focus on im-
proving food safety throughout the food production
continuum, bacteriophages have been used to con-
trol experimentally inoculated foodborne patho-
genic bacteria, especially E. coli O157:H7 in cattle
gastrointestinal tracts (Bach et al., 2003; Bach et al.,
2009; Callaway et al., 2008; Kudva et al., 1999; Niu
et al., 2008; Rozema et al., 2009). Several different
phages have been isolated from feedlot cattle (Cal-
laway et al., 2006; Niu et al., 2009; Niu et al., 2012;
Oot et al., 2007) and other sources (Liu et al., 2012;
McLaughlin et al., 2006) and have been used to
reduce E. coli O157:H7 strains in experimentally-
infected animals as proofs of concept (Bach et al.,
2009; Callaway et al., 2008; Rivas et al., 2010). In oth-
er studies, naturally phage-infected ruminants have
been shown to be more resistant to E. coli O157:H7
colonization (Raya et al., 2006) and the presence
of these endemic phages have often confused re-
sults of intervention studies (Kropinski et al., 2012).
Commercialization studies for these on farm prod-
ucts have had mixed results (Stanford et al., 2010),
but studies focusing on the development of appro-
priate, effective multi-phage cocktails are currently
underway (Stanford and McAllister, personal com-
munication). No matter what point in the beef pro-
duction chain the phages are utilized in (e.g., hides
or in the live animal), they must be carefully selected
for: 1) action against multiple E. coli O157:H7 strains
as well as other non-O157 STEC strains, 2) members
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 109
of a cocktail must utilize different receptors to mini-
mize resistance development, and 3) must be strictly
lytic (i.e., does not transfer genetic material) because
phage-mediated transfer is the mechanism by which
STEC originally acquired their Shiga-toxin genes
(Brabban et al., 2005; Law, 2000).
Vaccination
Immunization has worked very effectively against
pathogenic bacteria, including E. coli strains that
cause edema disease in pigs and Salmonella in
poultry (Gyles, 1998; Johansen et al., 2000). Unfor-
tunately, because EHEC/STEC do not cause disease
in cattle, the immunostimulation provided by these
foodborne pathogens is not as potent, because it
appears that natural exposure to E. coli O157:H7
does not confer protection to the host (Gyles, 1998).
Thus vaccine production has specifically targeted as-
pects of the physiology of E. coli O157:H7 (Walle et
al., 2012). Vaccination is widely accepted in the cat-
tle industry, thus it is reasonable to predict that pro-
ducers will implement this pathogen reduction tech-
nique if the vaccine is economically feasible, and can
be incorporated into existing production systems.
To date, two basic targeting strategies have been
utilized to develop vaccines against E. coli O157:H7,
and both have had their successes (Snedeker et al.,
2012; Varela et al., 2013; Walle et al., 2012).
Siderophore Receptor and Porin (SRP) protein vaccines
Siderophores are proteins excreted by bacteria in
an effort to obtain iron from its environment, and E.
coli O157:H7 utilizes secreted siderophores in the in-
testinal tract of cattle. The SRP vaccine targets this
protein and disrupts iron transport into the bacte-
rium, resulting in cell death. The EpitopixTM SRP
vaccine has been conditionally approved for use in
cattle in the U.S. and is undergoing additional safety
and efficacy tests. Preliminary research results are
promising when the vaccine is utilized in a 3 dose
treatment regimen (Thornton et al., 2009). Other
researchers found that vaccination with the SRP re-
duced fecal concentrations of E. coli O157:H7 in
cattle by 98%, but the vaccine did not affect cattle
performance (Thomson et al., 2009). Vaccination
of cattle with this SRP in another study reduced the
prevalence of E. coli O157:H7 by nearly 50% (Fox et
al., 2009b). A two-dose SRP vaccination reduced the
prevalence and number of “high-shedding” cattle,
with a reported efficacy of 53% and 77%, respective-
ly (Cull et al., 2012). Vaccination of pregnant dams
along with a second vaccination of calves was shown
to reduce E. coli O157:H7 (from 25% to 15%, respec-
tively) in feedlot cattle (Wileman et al., 2011).
Bacterial Extract Vaccines
A vaccine produced from E. coli O157:H7 extracts
(type III secreted proteins) has been produced as
EconicheTM. This vaccine has been licensed in Can-
ada and is pending a conditional license in the U.S.
Preliminary experimental results indicated that this
vaccine reduced E. coli O157:H7 shedding in feedlot
cattle from 23% to less than 9% (Moxley et al., 2003;
Potter et al., 2004; Van Donkersgoed et al., 2005). In
an evaluation study, it was demonstrated that vac-
cination reduced fecal shedding from 46% to 14%
(Ransom et al., 2003). Recent studies have shown
an experimental three dose regimen reduced E. coli
O157:H7 shedding by 65%, but that a 2 dose system
was less effective (Moxley et al., 2009). However, in
a follow up study, a two dose regimen was shown
to reduce rectal colonization by E. coli O157:H7 in
feedlot cattle (Smith et al., 2009b). The benefits of
vaccinating cattle in reducing cattle hides positive
for E. coli O157:H7 can be lost by comingling with
non-vaccinated cattle during transport (Smith et al.,
2009a).
While the Econiche vaccine pioneered the use
of bacterial extracts, other extract-type vaccines
against multiple E. coli O157:H7 proteins (e.g., inti-
min and tir) have been produced that reduce fecal
shedding in experimental-infection models (Mc-
Neilly et al., 2010); vaccines against a hemolysin pro-
110 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
tein encoded in the locus of enterocyte effacement
(LEE) island has also shown promise in reducing E.
coli O157:H7 shedding in cattle (Sharma et al., 2011).
Vaccines targeting EspA, EspB, shiga-toxin 2, and In-
timin proteins have been used in pregnant cows, and
it was shown that the antibodies were transferred to
calves, but the effect of this vaccination on coloni-
zation was not determined (Rabinovitz et al., 2012).
Further multi-protein vaccines have been developed
that can reduce fecal shedding of E. coli O157:H7
in a sheep model (Yekta et al., 2011), including a
Stx2B-Tir-Stx1B-Zot protein vaccine that successfully
reduced E. coli O157:H7 shedding in a goat model
(Zhang et al., 2012). Most excitingly, because the
non-O157 STEC share the Type-III secretion system
proteins, it appears that vaccines targeting these
proteins (e.g., Tir, EspB, EspD, EspA, and NleA) can
provide some degree of cross-protection from the
non-O157 STEC (Asper et al., 2011).
Bacterial ghosts (e.g., cellular membranes) have
recently been used to produce an immune response
that reduced E. coli O157:H7 populations in mice
(Cai et al., 2010; Mayr et al., 2012) and calves (Vilte
et al., 2012). A live-attenuated Salmonella strain that
expresses the E. coli O157:H7 intimin protein has
been demonstrated to induce immune responses in
cattle (Khare et al., 2010). Others have devised chi-
meric multi-protein (eae, tir, intimin) vaccines (Amani
et al., 2010) that can be produced in plants, poten-
tially providing a source of an edible vaccine (Am-
ani et al., 2011) that can be included in cattle rations
rather than having to be injected via the stressful
handling procedures currently required that add ex-
pense to the producers. However, for this approach
to be utilized in ruminants, the proteins must be pro-
tected from the extensive proteolytic nature of the
rumen microbial ecosystem, which will obviously add
to the complexity and expense of vaccination via the
edible vaccine approach.
Cattle Hide washing
Currently, cattle hides are typically washed to re-
move visible contamination from hides. The hide
washes can contain antimicrobial compounds (e.g.,
organic acids [described in previous section], so-
dium hydroxide, trisodium phosphate [TSP], cetyl-
pyridinium chloride [CPC] , hypobromous acid, or
electrolyzed or ozonated water), which serves to re-
duce some of the bacterial contamination (including
foodborne pathogens) entering the processing plant
on the hide (Arthur et al., 2007b; Bosilevac et al.,
2004; Bosilevac et al., 2005a; Bosilevac et al., 2005b;
Schmidt et al., 2012). The most common hide/car-
cass rinse additive has been organic acids such as
lactic or acetic acid (Berry and Cutter, 2000; Loretz et
al., 2011). Hide washes significantly reduce the load
of E. coli O157:H7 entering the plant on the hide,
which has been linked to final carcass contamina-
tion levels (Arthur et al., 2007a; Arthur et al., 2010b),
thus improving food safety; but they do not reduce
the prevalence of E. coli O157:H7 entering the plant
within the animal.
Sodium chlorate
Addition of chlorate to E. coli cultures kills these
bacteria because E. coli can respire under anaero-
bic conditions by reducing nitrate to nitrite via the
dissimilatory nitrate reductase enzyme (Stouthamer,
1969). The intracellular bacterial enzyme nitrate re-
ductase does not differentiate between nitrate and
its analog, chlorate which is reduced to chlorite in
the cytoplasm; chlorite accumulation kills bacteria
(Stewart, 1988). Chlorate treatment in vitro quickly
reduced populations of E. coli O157:H7 and Salmo-
nella (Anderson et al., 2000a). Chlorate addition to
animal rations reduced experimentally inoculated
E. coli O157:H7 populations in swine and sheep in-
testinal tracts (Anderson et al., 2001; Edrington et
al., 2003) as well as Salmonella in broiler intestinal
contents (Byrd et al., 2003). Other studies indicated
that soluble chlorate administered via drinking water
significantly reduced E. coli O157:H7 ruminal, cecal
and fecal populations in both cattle and sheep (An-
derson et al., 2002; Callaway et al., 2002; Callaway et
al., 2003). Hide contamination with E. coli O157:H7
plays a significant role in carcass/product contami-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 111
nation (Arthur et al., 2009; Arthur et al., 2010a; Arthur
et al., 2010b), and chlorate treatment reduces both
fecal and hide populations of E. coli (Anderson et
al., 2005). In vitro and in vivo results have indicated
that chlorate treatment does not adversely affect the
ruminal or the cecal/colonic fermentation (Anderson
et al., 2000b). Additional studies have demonstrated
that chlorate alters neither the antibiotic resistance,
nor toxin production by E. coli O157:H7 (Callaway et
al., 2004a; Callaway et al., 2004c). The LD50 of so-
dium chlorate is from 1.2 to 4 g/kg BW; by way of
comparison, the LD50 of sodium chloride is approxi-
mately 3 g/kg BW (Fiume, 1995). Therefore, it does
not appear that chlorate poses a severe risk for use
in animals due to inherent toxicity.
Because of the dramatic impact chlorate has on
food-borne pathogenic bacterial populations, it was
suggested that chlorate could be supplemented
in the last feeding before cattle are shipped to the
slaughterhouse. The use of chlorate to reduce food-
borne pathogenic bacteria in food animals is pres-
ently under review by the U. S. Food and Drug Ad-
ministration, but has not been approved at this time.
whAT ABouT PoTenTIAl unInTend-ed ConSequenCeS?
Before we attempt to completely eliminate STEC
from the live animal, we must consider the law of
unintended consequences, and its impact on food
safety (Callaway et al., 2007). The poultry industry
was hampered in the early part of the 20th century
by fowl typhoid/cholera which impacted productiv-
ity and efficiency of production. This disease was
caused by Salmonella Gallinarum and Pullorum,
which do not cause illness in humans, but do cause
illness solely in poultry (CDC, 2006). A concerted
effort was made to rid the national poultry flock of
these bacterial diseases, and this effort was success-
ful at eliminating these diseases which were highly
adapted to live only in their host (poultry). However,
by removing a member of the microbial ecosystem
from the intestinal meta-population, a niche in the
ecosystem was opened (Kingsley and Bäumler, 2000).
This niche was occupied by another Salmonella that
was not host-adapted and was transmitted from ro-
dents to poultry, Salmonella Enteritidis (Kingsley and
Bäumler, 2000). This foodborne pathogen has sub-
sequently become widespread in the national poul-
try flocks and represents one of the most common
serotypes isolated from human salmonellosis cases
(CDC, 2006; Scallan et al., 2011). Therefore, in all
our efforts to eliminate STEC from animals prior to
slaughter, we must be aware that some other bacte-
ria will undoubtedly fill the vacuum in the microbial
ecosystem.
ConCluSIonS
Pre-harvest interventions to reduce E. coli O157:H7
and other STEC in cattle can reduce foodborne
pathogen penetration into the food chain. How-
ever, implementation of these pre-harvest strate-
gies does not eliminate the need for best practices
in the processing plant and in the food preparation
environment. Recent years have seen an increase
in the research into developing new interventions
(e.g., vaccination, DFM, chlorate, phages) and into
understanding what effect the microbial population
and host physiology has on STEC populations in the
gut of cattle. This research has resulted in several
novel interventions and potential dietary additions
or changes that can reduce STEC in cattle, and many
of them are in, or very near to entering, the market-
place. However, it must be noted that the live-an-
imal interventions must be installed in a coherent,
complementary fashion to reduce pathogens as part
of an integrated multiple-hurdle approach that com-
plements other post-harvest strategies to minimize
pathogen contact and resultant human illnesses.
RefeRenCeS
Abercrombie, J. G., M. J. B. Paynter and S. S. Haya-
saka. 2006. Ability of colicin V to control Esche-
richia coli O157:H7 in ground beef. J. Food Safety
26:103-114.
112 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Alonso, G., G. Vilchez and R. L. Vidal. 2000. How
bacteria protect themselves against channel-form-
ing colicins. Inter. Microbiol. 3:81-88.
Amani, J., S. L. Mousavi, S. Rafati and A. H. Salma-
nian. 2011. Immunogenicity of a plant-derived ed-
ible chimeric EspA, Intimin and Tir of Escherichia
coli O157:H7 in mice. Plant Sci. 180:620-627.
Amani, J., A. H. Salmanian, S. Rafati and S. L. Mousa-
vi. 2010. Immunogenic properties of chimeric pro-
tein from espA, eae and tir genes of Escherichia
coli O157:H7. Vaccine. 28:6923-6929.
Anderson, R. C., S. A. Buckley, L. F. Kubena, L. H.
Stanker, R. B. Harvey and D. J. Nisbet. 2000a.
Bactericidal effect of sodium chlorate on Esche-
richia coli O157:H7 and Salmonella Typhimurium
DT104 in rumen contents in vitro. J. Food Prot.
63:1038-1042.
Anderson, R. C., S. A. Buckley, L. H. Stanker, L. F.
Kubena, R. B. Harvey and D. J. Nisbet. 2000b. Ef-
fect of sodium chlorate on Escherichia coli concen-
tration in the bovine gut. Microb. Ecol. Health Dis.
12:109-116.
Anderson, R. C., T. R. Callaway, T. J. Anderson, L. F.
Kubena, N. K. Keith and D. J. Nisbet. 2002. Bacte-
ricidal effect of sodium chlorate on Escherichia coli
concentrations in bovine ruminal and fecal con-
tents in vivo. Microb. Ecol. Health Dis. 14:24-29.
Anderson, R. C., T. R. Callaway, S. A. Buckley, T. J.
Anderson, K. J. Genovese, C. L. Sheffield and D.
J. Nisbet. 2001. Effect of oral sodium chlorate
administration on Escherichia coli O157:H7 in the
gut of experimentally infected pigs. Int. J. Food
Microbiol. 71:125-130.
Anderson, R. C., M. A. Carr, R. K. Miller, D. A. King,
G. E. Carstens, K. J. Genovese, T. R. Callaway, T.
S. Edrington, Y. S. Jung, J. L. McReynolds, M. E.
Hume, R. C. Beier, R. O. Elder and D. J. Nisbet.
2005. Effects of experimental chlorate prepara-
tions as feed and water supplements on Esche-
richia coli colonization and contamination of beef
cattle and carcasses. Food Microbiol. 22:439-447.
Arthur, T. M., J. M. Bosilevac, D. M. Brichta-Harhay,
M. N. Guerini, N. Kalchayanand, S. D. Shackelford,
T. L. Wheeler and M. Koohmaraie. 2007a. Trans-
portation and lairage environment effects on prev-
alence, numbers, and diversity of Escherichia coli
O157:H7 on hides and carcasses of beef cattle at
processing. J. Food Prot. 70:280-286.
Arthur, T. M., J. M. Bosilevac, D. M. Brichta-Harhay,
N. Kalchayanand, S. D. Shackelford, T. L. Wheeler
and M. Koohmaraie. 2007b. Effects of a minimal
hide wash cabinet on the levels and prevalence of
Escherichia coli O157:H7 and Salmonella on the
hides of beef cattle at slaughter. J. Food Prot.
70:1076-1079.
Arthur, T. M., J. M. Bosilevac, N. Kalchayanand, J.
E. Wells, S. D. Shackelford, T. L. Wheeler and M.
Koohmaraieie. 2010a. Evaluation of a direct-fed
microbial product effect on the prevalence and
load of Escherichia coli O157:H7 in feedlot cattle.
J. Food Prot. 73:366-371.
Arthur, T. M., D. M. Brichta-Harhay, J. M. Bosilevac,
N. Kalchayanand, S. D. Shackelford, T. L. Wheeler
and M. Koohmaraie. 2010b. Super shedding of
Escherichia coli O157:H7 by cattle and the impact
on beef carcass contamination. Meat Sci. 86:32-
37.
Arthur, T. M., J. E. Keen, J. M. Bosilevac, D. M. Brich-
ta-Harhay, N. Kalchayanand, S. D. Shackelford,
T. L. Wheeler, X. Nou and M. Koohmaraie. 2009.
Longitudinal study of Escherichia coli O157:H7 in a
beef cattle feedlot and role of high-level shedders
in hide contamination. Appl. Environ. Microbiol.
75:6515-6523.
Asper, D. J., M. A. Karmali, H. Townsend, D. Rogan
and A. A. Potter. 2011. Serological response of
shiga toxin-producing Escherichia coli type III se-
creted proteins in sera from vaccinated rabbits,
naturally infected cattle, and humans. Clin. Vacc.
Immunol. 18:1052-1057.
Bach, S. J., R. P. Johnson, K. Stanford and T. A. McAl-
lister. 2009. Bacteriophages reduce Escherichia
coli O157:H7 levels in experimentally inoculated
sheep. Can. J. Anim. Sci. 89:285-293.
Bach, S. J., T. A. McAllister, D. M. Veira, V. P. J. Gan-
non and R. A. Holley. 2003. Effect of bacterio-
phage DC22 on Escherichia coli O157:H7 in an
artificial rumen system (RUSITEC) and inoculated
sheep. Anim. Res. 52:89-101.
Baines, D., S. Erb, R. Lowe, K. Turkington, E. Sabau,
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 113
G. Kuldau, J. Juba, L. Masson, A. Mazza and R.
Roberts. 2011. A prebiotic, Celmanax, decreases
Escherichia coli O157:H7 colonization of bovine
cells and feed-associated cytotoxicity in vitro.
BMC Res. Notes. 4:110-118.
Barkocy-Gallagher, G. A., T. M. Arthur, M. Rivera-Be-
tancourt, X. Nou, S. D. Shackelford, T. L. Wheeler
and M. Koohmaraie. 2003. Seasonal prevalence
of shiga toxin-producing Escherichia coli, includ-
ing O157:H7 and non-O157 serotypes, and Sal-
monella in commercial beef processing plants. J.
Food Prot. 66:1978-1986.
Berry, E. D. and C. N. Cutter. 2000. Effects of acid
adaptation of Escherichia coli O157:H7 on efficacy
of acetic acid spray washes to decontaminate beef
carcass tissue. Appl. Environ. Microbiol. 66:1493-
1498.
Bomba, A., R. Nemcová, D. Mudronová and P. Guba.
2002. The possibilities of potentiating the efficacy
of probiotics. Trends Food Sci. Technol. 13:121-
126.
Bosilevac, J. M., T. M. Arthur, T. L. Wheeler, S. D.
Shackelford, M. Rossman, J. O. Reagan and M.
Koohmaraie. 2004. Prevalence of Escherichia coli
O157 and levels of aerobic bacteria and entero-
bacteriaceae are reduced when hides are washed
and treated with cetylpyridinium chloride at a
commercial beef processing plant. J. Food Prot.
67:646-650.
Bosilevac, J. M., X. Nou, M. S. Osborn, D. M. Allen
and M. Koohmaraie. 2005a. Development and
evaluation of an on-line hide decontamination
procedure for use in a commercial beef processing
plant. J. Food Prot. 68:265-272.
Bosilevac, J. M., S. D. Shackelford, D. M. Brichta and
M. Koohmaraie. 2005b. Efficacy of ozonated and
electrolyzed oxidative waters to decontaminate
hides of cattle before slaughter. J. Food Prot.
68:1393-1398.
Brabban, A. D., E. Hite and T. R. Callaway. 2005. Evo-
lution of foodborne pathogens via temperate bac-
teriophage-mediated gene transfer. Foodborne
Path. Dis. 2:287-303.
Brashears, M. M. and M. L. Galyean. 2002. Testing
of probiotic bacteria for the elimination of Esch-
erichia coli O157:H7 in cattle. http://foodsafety.
ksu.edu/articles/263/probiotic_Ecoli_cattle.pdf.
26 April, Accessed 2013.
Brashears, M. M., M. L. Galyean, G. H. Loneragan, J.
E. Mann and K. Killinger-Mann. 2003a. Prevalence
of Escherichia coli O157:H7 and performance by
beef feedlot cattle given Lactobacillus direct-fed
microbials. J. Food Prot. 66:748-754.
Brashears, M. M., D. Jaroni and J. Trimble. 2003b.
Isolation, selection, and characterization of lactic
acid bacteria for a competitive exclusion product
to reduce shedding of Escherichia coli O157:H7 in
cattle. J. Food Prot. 66:355-363.
Byrd, J. A., R. C. Anderson, T. R. Callaway, R. W.
Moore, K. D. Knape, L. F. Kubena, R. L. Ziprin and
D. J. Nisbet. 2003. Effect of experimental chlorate
product administration in the drinking water on
Salmonella Typhimurium contamination of broil-
ers. Poult. Sci. 82:1403-1406.
Cai, K., X. Gao, T. Li, X. Hou, Q. Wang, H. Liu, L. Xiao,
W. Tu, Y. Liu, J. Shi and H. Wang. 2010. Intragas-
tric immunization of mice with enterohemorrhagic
Escherichia coli O157:H7 bacterial ghosts reduces
mortality and shedding and induces a Th2-type
dominated mixed immune response. Can. J. Mi-
crobiol. 56:389-398.
Callaway, T. R., R. C. Anderson, T. S. Edrington, K. M.
Bischoff, K. J. Genovese, T. L. Poole, J. A. Byrd, R.
B. Harvey and D. J. Nisbet. 2004a. Effects of sodi-
um chlorate on antibiotic resistance in Escherichia
coli O157:H7. Foodborne Path. Dis. 1:59-63.
Callaway, T. R., R. C. Anderson, T. S. Edrington, K. J.
Genovese, R. B. Harvey, T. L. Poole and D. J. Nis-
bet. 2004b. Recent pre-harvest supplementation
strategies to reduce carriage and shedding of zoo-
notic enteric bacterial pathogens in food animals.
Anim. Health Res. Rev. 5:35-47.
Callaway, T. R., R. C. Anderson, T. S. Edrington, Y. S.
Jung, K. M. Bischoff, K. J. Genovese, T. L. Poole,
R. B. Harvey, J. A. Byrd and D. J. Nisbet. 2004c.
Effects of sodium chlorate on toxin production by
Escherichia coli O157:H7. Curr. Iss. Intest. Micro-
biol. 5:19-22.
Callaway, T. R., R. C. Anderson, K. J. Genovese, T. L.
Poole, T. J. Anderson, J. A. Byrd, L. F. Kubena and
114 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
D. J. Nisbet. 2002. Sodium chlorate supplementa-
tion reduces E. coli O157:H7 populations in cattle.
J. Anim. Sci. 80:1683-1689.
Callaway, T. R., T. S. Edrington, R. C. Anderson, J. A.
Byrd and D. J. Nisbet. 2007. Gastrointestinal mi-
crobial ecology and the safety of our food supply
as related to Salmonella. J. Anim. Sci. 86:167-172.
Callaway, T. R., T. S. Edrington, R. C. Anderson, K. J.
Genovese, T. L. Poole, R. O. Elder, J. A. Byrd, K. M.
Bischoff and D. J. Nisbet. 2003. Escherichia coli
O157:H7 populations in sheep can be reduced by
chlorate supplementation. J. Food Prot. 66:194-
199.
Callaway, T. R., T. S. Edrington, A. D. Brabban, R. C.
Anderson, M. L. Rossman, M. J. Engler, M. A. Carr,
K. J. Genovese, J. E. Keen, M. L. Looper, E. M. Kut-
ter and D. J. Nisbet. 2008. Bacteriophage isolat-
ed from feedlot cattle can reduce Escherichia coli
O157:H7 populations in ruminant gastrointestinal
tracts. Foodborne Path. Dis. 5:183-192.
Callaway, T. R., T. S. Edrington, A. D. Brabban, J. E.
Keen, R. C. Anderson, M. L. Rossman, M. J. Engler,
K. J. Genovese, B. L. Gwartney, J. O. Reagan, T. L.
Poole, R. B. Harvey, E. M. Kutter and D. J. Nisbet.
2006. Fecal prevalence of Escherichia coli O157,
Salmonella, Listeria, and bacteriophage infecting
E. coli O157:H7 in feedlot cattle in the southern
plains region of the United States. Foodborne
Path. Dis. 3:234-244.
Callaway, T. R., T. S. Edrington, G. H. Loneragan,
M. A. Carr and D. J. Nisbet. 2013. Shiga Toxin-
producing Escherichia coli (STEC) ecology in cattle
and management based options for reducing fecal
shedding. Agric. Food Anal. Bacteriol. 3:39-69.
Callaway, T. R. and S. A. Martin. 2006. Use of fungi
and organic acids in production animal diets. In:
Ed. Feedstuffs Direct-fed Microbial, Enzyme and
Forage Additive Compendium, 8th Ed. Miller
Publishing, Inc., Minnetonka, MN. 25-33.
Callaway, T. R., C. H. Stahl, T. S. Edrington, K. J.
Genovese, L. M. Lincoln, R. C. Anderson, S. M.
Lonergan, T. L. Poole, R. B. Harvey and D. J. Nis-
bet. 2004d. Colicin concentrations inhibit growth
of Escherichia coli O157:H7 in vitro. J. Food Prot.
67:2603-2607.
CDC. 2006. Salmonella Annual Summary, 2005.
www.cdc.gov/ncidod/dbmd/phlisdata/salm-
tab/2005/SalmonellaTable1_2005.pdf 18 June
2007, Accessed.
Coffey, B., L. Rivas, G. Duffy, A. Coffey, R. P. Ross and
O. McAuliffe. 2011. Assessment of Escherichia
coli O157:H7-specific bacteriophages e11/2 and
e4/1c in model broth and hide environments. Int.
J. Food Microbiol. 147:188-194.
Collins, D. M. and G. R. Gibson. 1999. Probiotics,
prebiotics, and synbiotics: approaches for modu-
lating the microbial ecology of the gut. Amer. J.
Clin. Nutr. 69:1052S-1057S.
Cornick, N. A. 2010. Tylosin and chlorotetracycline
decrease the duration of fecal shedding of E. coli
O157:H7 by swine. Vet. Microbiol. 143:417-419.
Cull, C. A., Z. D. Paddock, T. G. Nagaraja, N. M. Bel-
lo, A. H. Babcock and D. G. Renter. 2012. Efficacy
of a vaccine and a direct-fed microbial against fe-
cal shedding of Escherichia coli O157:H7 in a ran-
domized pen-level field trial of commercial feedlot
cattle. Vaccine. 30:6210-6215.
Cutler, S. A., S. M. Lonergan, N. Cornick, A. K. John-
son and C. H. Stahl. 2007. Dietary inclusion of
colicin E1 is effective in preventing postweaning
diarrhea caused by F18-positive Escherichia coli in
pigs. Antimicrob. Ag. Chemother. 51:3830-3835.
Edrington, T. S., T. R. Callaway, R. C. Anderson, K. J.
Genovese, Y. S. Jung, R. O. Elder, K. M. Bischoff
and D. J. Nisbet. 2003. Reduction of E. coli
O157:H7 populations in sheep by supplementa-
tion of an experimental sodium chlorate product.
Small Ruminant Res. 49:173-181.
Elam, N. A., J. F. Gleghorn, J. D. Rivera, M. L. Galy-
ean, P. J. Defoor, M. M. Brashears and S. M. Younts-
Dahl. 2003. Effects of live cultures of Lactobacillus
acidophilus (strains NP45 and NP51) and Propioni-
bacterium freudenreichii on performance, carcass,
and intestinal characteristics, and Escherichia coli
strain O157 shedding of finishing beef steers. J.
Anim. Sci. 81:2686-2698.
Elder, R. O., J. E. Keen, T. E. Wittum, T. R. Callaway,
T. S. Edrington, R. C. Anderson and D. J. Nisbet.
2002. Intervention to reduce fecal shedding of
enterohemorrhagic Escherichia coli O157:H7 in
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 115
naturally infected cattle using neomycin sulfate. J.
Anim. Sci. 80 (Suppl. 1):15 (Abstr.).
Fiume, M. Z. 1995. Final report on the safety assess-
ment of potassium chlorate. J. Amer. Coll. Toxicol.
14:221-230.
Fox, J. T., J. S. Drouillard and T. G. Nagaraja. 2009a.
Competitive exclusion Escherichia coli cultures on
E. coli O157 growth in batch culture ruminal or fe-
cal microbial fermentation. Foodborne Path. Dis.
6:193-199.
Fox, J. T., D. U. Thomson, J. S. Drouillard, A. B. Thorn-
ton, D. T. Burkhardt, D. A. Emery and T. G. Naga-
raja. 2009b. Efficacy of Escherichia coli O157:H7
siderophore receptor/porin proteins-based vac-
cine in feedlot cattle naturally shedding E. coli
O157. Foodborne Path. Dis. 6:893-899.
Fuller, R. 1989. Probiotics in man and animals. J.
Appl. Bacteriol. 66:365-378.
Goodridge, L. D. 2008. Phages, bacteria, and food.
In: Abedon, S. T. Ed. Bacteriophage Ecology.
Nova Publishers, New York. 302-331.
Goodridge, L. D. 2010. Designing phage therapeu-
tics. Curr. Pharmaceut. Biotechnol. 11:15-27.
Gyles, C. L. 1998. Vaccines and shiga toxin-produc-
ing Escherichia coli in animals. In: Kaper, J. B. and
A. D. O’Brien Ed. Escherichia coli O157:H7 and
other shiga toxin-producing E. coli strains. Amer.
Soc. Microbiol. Press, Washington, DC. 434-444.
Houdijk, J. G. M., M. W. Bosch, M. W. A. Verstegen
and H. J. Berenpas. 1998. Effects of dietary oli-
gosaccharides on the growth and faecal charac-
teristics of young growing pigs. Anim. Feed Sci.
Technol. 71:35-48.
Huff, W. E., G. R. Huff, N. C. Rath, J. M. Balog, H.
Xie, P. A. Moore and A. M. Donoghue. 2002. Pre-
vention of Escherichia coli respiratory infection
in broiler chickens with bacteriophage (SPR02).
Poult. Sci. 81:437-441.
Jack, R. W., J. R. Tagg and B. Ray. 1995. Bacteriocins
of gram-positive bacteria. Microbiol. Rev. 59:171-
200.
Joerger, R. D. 2003. Alternatives to antibiotics:
Bacteriocins, antimicrobial peptides and bacterio-
phages. Poult. Sci. 82:640-647.
Johansen, M., L. O. Andresen, L. K. Thomsen, M. E.
Busch, H. Wachmann, S. E. Jorsal and C. L. Gyles.
2000. Prevention of edema disease in pigs by pas-
sive immunization. Can. J. Vet. Res. 64:9-14.
Johnson, R. P., C. L. Gyles, W. E. Huff, S. Ojha, G. R.
Huff, N. C. Rath and A. M. Donoghue. 2008. Bac-
teriophages for prophylaxis and therapy in cattle,
poultry and pigs. Anim. Health Res. Rev. 9:201-
215.
Jordi, B. J. A. M., K. Boutaga, C. M. E. Van Heeswijk,
F. Van Knapen and L. J. A. Lipman. 2001. Sensitiv-
ity of shiga toxin-producing Escherichia coli (STEC)
strains for colicins under different experimental
conditions. FEMS Microbiol. Lett. 204:329-344.
Karesh, W. B., A. Dobson, J. O. Lloyd-Smith, J. Lu-
broth, M. A. Dixon, M. Bennett, S. Aldrich, T. Har-
rington, P. Formenty, E. H. Loh, C. C. Machalaba,
M. J. Thomas and D. L. Heymann. 2012. Ecology
of zoonoses: natural and unnatural histories. Lan-
cet. 380:1936-1945.
Karmali, M. A., V. Gannon and J. M. Sargeant. 2010.
Verocytotoxin-producing Escherichia coli (VTEC).
Vet. Microbiol. 140:360-370.
Keen, J. and R. Elder. 2000. Commercial probiot-
ics are not effective for short-term control of en-
terohemorrhagic Escherichia coli O157 infection in
beef cattle. In: Proc.s 4th Intl. Symp. Works. Shiga
Toxin (Verocytotoxin)-producing Escherichia coli
Infect., Kyoto, Japan. 92 (Abstr.).
Khare, S., W. Alali, S. Zhang, D. Hunter, R. Pugh, F.
C. Fang, S. J. Libby and L. G. Adams. 2010. Vac-
cination with attenuated Salmonella enterica Dub-
lin expressing E. coli O157:H7 outer membrane
protein Intimin induces transient reduction of fecal
shedding of E. coli O157:H7 in cattle. BMC Vet.
Res. 6:35-47.
Kim, Y., S. H. Kim, K. Y. Whang, Y. J. Kim and S. Oh.
2008. Inhibition of Escherichia coli O157:H7 at-
tachment by interactions between lactic acid bac-
teria and intestinal epithelial cells. J. Microbiol.
Biotechnol. 18:1278-1285.
Kingsley, R. A. and A. J. Bäumler. 2000. Host adapta-
tion and the emergence of infectious disease: The
Salmonella paradigm. Molec. Microbiol. 36:1006-
1014.
Konisky, J. 1982. Colicins and other bacteriocins
116 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
with established modes of action. Ann. Rev. Mi-
crobiol. 36:125-144.
Kropinski, A. M., E. J. Lingohr, D. M. Moyles, H. W.
Ackermann, S. Ojha, A. Mazzocco, Y. M. She, S. J.
Bach, E. A. Rozema, K. Stanford, T. A. McAllister
and R. P. Johnson. 2012. Endemic bacteriophages:
A cautionary tale for evaluation of bacteriophage
therapy and other interventions for infection con-
trol in animals. Virol. J. 9:207-216.
Kudva, I. T., S. Jelacic, P. I. Tarr, P. Youderian and C. J.
Hovde. 1999. Biocontrol of Escherichia coli O157
with O157-specific bacteriophages. Appl. Environ.
Microbiol. 65:3767-3773.
Kutter, E. and A. Sulakvelidze. 2005. Bacterio-
phages: Biology and Applications. CRC Press,
New York.
Lakey, J. H. and S. L. Slatin. 2001. Pore-forming coli-
cins and their relatives. In: Van Der Goot, F. G. Ed.
Pore-forming toxins. Springer-Verlag GmbH & Co.
KG, Berlin. pp. 131-161.
Law, D. 2000. The history and evolution of Esche-
richia coli O157 and other shiga toxin-producing E.
coli. World J. Microbiol. Biotechnol. 16:701-709.
Leatham, M. P., S. Banerjee, S. M. Autieri, R. Mer-
cado-Lubo, T. Conway and P. S. Cohen. 2009.
Precolonized human commensal Escherichia coli
strains serve as a barrier to E. coli O157:H7 growth
in the streptomycin-treated mouse intestine. In-
fect. Immun. 77:2876-2886.
Lederberg, J. 1996. Smaller Fleas...ad infinitum:
Therapeutic bacteriophage redux. Proc. Natl.
Acad. Sci. USA. 93:3167-3168.
LeJeune, J. and A. Kersting. 2010. Zoonoses: An oc-
cupational hazard for livestock workers and a pub-
lic health concern for rural communities. J. Agric.
Safe. Health. 16:161-179.
LeJeune, J. T. and A. N. Wetzel. 2007. Preharvest
control of Escherichia coli O157 in cattle. J. Anim.
Sci. 85:e73-80.
Lema, M., L. Williams and D. R. Rao. 2001. Reduc-
tion of fecal shedding of enterohemorrhagic Esch-
erichia coli O157:H7 in lambs by feeding microbial
feed supplement. Small Rum. Res. 39:31-39.
Liu, S. M., D. M. Miller and R. F. Roberts. 2011. Clon-
ing of genes encoding colicin E2 in Lactococcus
lactis subspecies lactis and evaluation of the coli-
cin-producing transformants as inhibitors of Esch-
erichia coli O157:H7 during milk fermentation. J.
Dairy Sci. 94:1146-1154.
Liu, Y., J. H. Li, H. Y. Shi, J. P. Wen and Y. B. Sun. 2012.
Biological characteristics of enterohemorrhagic E.
coli O157-specific bacteriophages isolated from
raw sewage. J. Jilin Univ. Med. Ed. 38:79-83.
López-Cuevas, O., N. Castro-del Campo, J. León-
Félix, A. González-Robles and C. Chaidez. 2011.
Characterization of bacteriophages with a lytic
effect on various Salmonella serotypes and Esch-
erichia coli O157:H7. Can. J. Microbiol. 57:1042-
1051.
López-Cuevas, O., N. Castro-Del Campo, J. León-
Félix, B. Valdez-Torres and C. Chaidez. 2012. Eval-
uation of bacteriophage av-08 for simultaneous
biocontrol of Salmonella Montevideo and Esch-
erichia coli O157: H7 in experimentally contami-
nated chicken skin. J. Food Safety 32:305-310.
Loretz, M., R. Stephan and C. Zweifel. 2011. An-
tibacterial activity of decontamination treatments
for cattle hides and beef carcasses. Food Control.
22:347-359.
Martin, S. A. and D. J. Nisbet. 1992. Effect of direct-
fed microbials on rumen microbial fermentation.
J. Dairy Sci. 75:1736-1744.
Mayr, U. B., P. Kudela, A. Atrasheuskaya, E. Bukin, G.
Ignatyev and W. Lubitz. 2012. Rectal single dose
immunization of mice with Escherichia coli O157:
H7 bacterial ghosts induces efficient humoral and
cellular immune responses and protects against
the lethal heterologous challenge. Microb. Bio-
technol. 5:283-294.
McAllister, T. A., K. A. Beauchemin, A. Y. Alazzeh, J.
Baah, R. M. Teather and K. Stanford. 2011. Re-
view: The use of direct fed microbials to mitigate
pathogens and enhance production in cattle. Can.
J. Anim. Sci. 91:193-211.
McLaughlin, M. R., M. F. Balaa, J. Sims and R. King.
2006. Isolation of Salmonella bacteriophages from
swine effluent lagoons. J. Environ. Qual. 35:522-
528.
McNeilly, T. N., M. C. Mitchell, T. Rosser, S. McAteer,
J. C. Low, D. G. E. Smith, J. F. Huntley, A. Mahajan
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 117
and D. L. Gally. 2010. Immunization of cattle with
a combination of purified intimin-531, EspA and
Tir significantly reduces shedding of Escherichia
coli O157:H7 following oral challenge. Vaccine.
28:1422-1428.
Moxley, R. A., D. Smith, T. J. Klopfenstein, G. Erick-
son, J. Folmer, C. Macken, S. Hinkley, A. Potter and
B. Finlay. 2003. Vaccination and feeding a com-
petitive exclusion product as intervention strate-
gies to reduce the prevalence of Escherichia coli
O157:H7 in feedlot cattle. In: Proc.s Proc. 5th Int.
Symp. on Shiga Toxin-Producing Escherichia coli
Infections, Edinburgh, UK. 23 (Abstr.).
Moxley, R. A., D. R. Smith, M. Luebbe, G. E. Erickson,
T. J. Klopfenstein and D. Rogan. 2009. Escherichia
coli O157:H7 vaccine dose-effect in feedlot cattle.
Foodborne Path. Dis. 6:879-884.
Murinda, S. E., S. M. Liu, R. F. Roberts and R. A. Wil-
son. 1998. Colicinogeny among Escherichia coli
serotypes, including O157:H7, representing four
closely related diarrheagenic clones. J. Food Prot.
61:1431-1438.
Murinda, S. E., R. F. Roberts and R. A. Wilson. 1996.
Evaluation of colicins for inhibitory activity against
diarrheagenic Escherichia coli strains, includ-
ing serotype O157:H7. Appl. Environ. Microbiol.
62:3192-3202.
Nandiwada, L. S., G. P. Schamberger, H. W. Schafer
and F. Diez-Gonzalez. 2004. Characterization of
an E2-type colicin and its application to treat alfal-
fa seeds to reduce Escherichia coli O157:H7. Int. J.
Food Microbiol. 93:267-279.
Niu, Y. D., T. A. McAllister, Y. Xu, R. P. Johnson, T.
P. Stephens and K. Stanford. 2009. Prevalence
and impact of bacteriophages on the presence of
Escherichia coli O157:H7 in feedlot cattle and their
environment. Appl. Environ. Microbiol. 75:1271-
1278.
Niu, Y. D., K. Stanford, H. W. Ackermann and T. A.
McAllister. 2012. Characterization of 4 T1-like lytic
bacteriophages that lyse Shiga-toxin Escherichia
coli O157:H7. Can. J. Microbiol. 58:923-927.
Niu, Y. D., Y. Xu, T. A. McAllister, E. A. Rozema, T. P.
Stephens, S. J. Bach, R. P. Johnson and K. Stanford.
2008. Comparison of fecal versus rectoanal mu-
cosal swab sampling for detecting Escherichia coli
O157:H7 in experimentally inoculated cattle used
in assessing bacteriophage as a mitigation strat-
egy. J. Food Prot. 71:691-698.
Nurmi, E., L. Nuotio and C. Schncitz. 1992. The
competitive exclusion concept: development and
future. Int. J. Food Microbiol. 15:237-240.
Ohya, T., M. Akiba and H. Ito. 2001. Use of a trial
probiotic product in calves experimentally infect-
ed with Escherichia coli O157. Japan Agric. Res.
Quart. 35:189-194.
Oliver, S. P., D. A. Patel, T. R. Callaway and M. E. Tor-
rence. 2008. ASAS Centennial Paper: Develop-
ments and future outlook for preharvest food safe-
ty. J. Anim. Sci. 87:419-437.
Oot, R. A., R. R. Raya, T. R. Callaway, T. S. Edrington,
E. M. Kutter and A. D. Brabban. 2007. Prevalence
of Escherichia coli O157 and O157:H7-infecting
bacteriophages in feedlot cattle feces. Lett. Appl.
Microbiol. 45:445-453.
Park, M., J. H. Lee, H. Shin, M. Kim, J. Choi, D. H.
Kang, S. Heu and S. Ryu. 2012. Characterization
and comparative genomic analysis of a novel bac-
teriophage, SFP10, simultaneously inhibiting both
Salmonella enterica and Escherichia coli O157:H7.
Appl. Environ. Microbiol. 78:58-69.
Patterson, J. A. and K. M. Burkholder. 2003. Appli-
cation of prebiotics and probiotics in poultry pro-
duction. Poult. Sci. 82:627-631.
Patton, B. S., S. M. Lonergan, S. A. Cutler, C. H. Stahl
and J. S. Dickson. 2008. Application of colicin E1
as a prefabrication intervention strategy. J. Food
Prot. 71:2519-2522.
Potter, A. A., S. Klashinsky, Y.Li, E. Frey, H. Townsend,
D. Rogan, G. Erickson, S. Hinkley, T. Klopfenstein,
R. A. Moxley, D. R. Smith and B. B. Finlay. 2004.
Decreased shedding of Escherichia coli O157:H7
by cattle following vaccination with type III secret-
ed proteins. Vaccine. 22:362-369.
Rabinovitz, B. C., E. Gerhardt, C. Tironi Farinati, A.
Abdala, R. Galarza, D. A. Vilte, C. Ibarra, A. Cataldi
and E. C. Mercado. 2012. Vaccination of pregnant
cows with EspA, EspB, γ-intimin, and Shiga toxin
2 proteins from Escherichia coli O157: H7 induc-
es high levels of specific colostral antibodies that
118 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
are transferred to newborn calves. J. Dairy Sci.
95:3318-3326.
Raya, R. R., P. Varey, R. A. Oot, M. R. Dyen, T. R. Cal-
laway, T. S. Edrington, E. M. Kutter and A. D. Brab-
ban. 2006. Isolation and characterization of a new
T-even bacteriophage, CEV1, and determination
of its potential to reduce Escherichia coli O157:H7
levels in sheep. Appl. Environ. Microbiol. 72:6405-
6410.
Reissbrodt, R., W. P. Hammes, F. Dal Bello, R. Prager,
A. Fruth, K. Hantke, A. Rakin, M. Starcic-Erjavec
and P. H. Williams. 2009. Inhibition of growth of
Shiga toxin-producing Escherichia coli by non-
pathogenic Escherichia coli. FEMS Microbiol. Lett.
290:62-69.
Ricke, S. C. 2003. Perspectives on the use of organic
acids and short chain fatty acids as antimicrobials.
Poult. Sci. 82:632-639.
Ricke, S. C., P. Hererra and D. Biswas. 2012. Bacte-
riophages for potential food safety applications in
organic meat production. In: S. C. Ricke, E. J. Van
Loo, M. G. Johnson and C. A. O’Bryan Ed. Organ-
ic meat production and processing. John Wiley &
Sons, Inc., New York. 407-424.
Rivas, L., B. Coffey, O. McAuliffe, M. J. McDonnell,
C. M. Burgess, A. Coffey, R. P. Ross and G. Duffy.
2010. In vivo and ex vivo evaluations of bacterio-
phages e11/2 and e4/1c for use in the control of
Escherichia coli O157:H7. Appl. Environ. Micro-
biol. 76:7210-7216.
Rodriguez-Palacios, A., H. R. Staempfli, T. Duffield
and J. S. Weese. 2009. Isolation of bovine intes-
tinal Lactobacillus plantarum and Pediococcus aci-
dilactici with inhibitory activity against Escherichia
coli O157 and F5. J. Appl. Microbiol. 106:393-401.
Rotariu, O., I. Ogden, L. MacRitchie, K. Forbes, A.
Williams, P. Cross, C. Hunter, P. Teunis and N. Stra-
chan. 2012. Combining risk assessment and epi-
demiological risk factors to elucidate the sources
of human E. coli O157 infection. Epidemiol. Infect.
140:1414-1429.
Rozema, E. A., T. P. Stephens, S. J. Bach, E. K. Okine,
R. P. Johnson, K. I. M. Stanford and T. A. McAllister.
2009. Oral and rectal administration of bacterio-
phages for control of Escherichia coli O157:H7 in
feedlot cattle. J. Food Prot. 72:241-250.
Russell, J. B. 1992. Another explanation for the
toxicity of fermentation acids at low pH: anion ac-
cumulation versus uncoupling. J. Appl. Bacteriol.
73:363-370.
Sargeant, J. M., M. R. Amezcua, A. Rajic and L. Wad-
dell. 2007. Pre-harvest interventions to reduce the
shedding of E. coli O157 in the faeces of weaned
domestic ruminants: a systematic review. Zoonos.
Pub. Health. 54:260-277.
Sawant, A. A., N. C. Casavant, D. R. Call and T. E.
Besser. 2011. Proximity-dependent inhibition in
Escherichia coli isolates from cattle. Appl. Environ.
Microbiol. 77:2345-2351.
Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe,
M.-A. Widdowson, S. L. Roy, J. L. Jones and P. L.
Griffin. 2011. Foodborne illness acquired in the
United States—major pathogens. Emerg. Infect.
Dis. 17:7-15.
Schamberger, G. P. and F. Diez-Gonzalez. 2002.
Selection of recently isolated colicinogenic Esch-
erichia coli strains inhibitory to Escherichia coli
O157:H7. J. Food Prot. 65:1381-1387.
Schamberger, G. P., R. L. Phillips, J. L. Jacobs and
F. Diez-Gonzalez. 2004. Reduction of Escherichia
coli O157:H7 populations in cattle by addition of
colicin E7-producing E. coli to feed. Appl. Environ.
Microbiol. 70:6053-6060.
Scharff, R. L. 2010. Health-related costs from
foodborne illness in the United States. http://
www.publichealth.lacounty.gov/eh/docs/Report-
Publication/HlthRelatedCostsFromFoodborneIlli-
nessUS.pdf. 3 May, Accessed 2010.
Schmidt, J. W., R. Wang, N. Kalchayanand, T. L.
Wheeler and M. Koohmaraie. 2012. Efficacy of hy-
pobromous acid as a hide-on carcass antimicrobial
intervention. J. Food Prot. 75:955-958.
Schrezenmeir, J. and M. De Vrese. 2001. Probiotics,
prebiotics, and synbiotics-approaching a defini-
tion. Am. J. Clin. Nutr. 73(Suppl.):354s-361s.
Sharma, V. K., E. A. Dean-Nystrom and T. A. Casey.
2011. Evaluation of hha and hha sepB mutant
strains of Escherichia coli O157:H7 as bacterins for
reducing E. coli O157:H7 shedding in cattle. Vac-
cine. 29:5078-5086.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 119
Siragusa, G. R. and S. C. Ricke. 2012. Probiotics as
pathogen control agents for organic meat produc-
tion. In: S. C. Ricke, E. J. Van Loo, M. G. Johnson
and C. A. O’Bryan Ed. Organic meat production
and processing. John Wiley & Sons, Inc., New
York. 331-349.
Smarda, J. and D. Smajs. 1998. Colicins- Exocellular
lethal proteins of Escherichia coli. Folia Microbiol.
43:563-582.
Smith, D. R., R. A. Moxley, T. J. Klopfenstein and G. E.
Erickson. 2009a. A randomized longitudinal trial
to test the effect of regional vaccination within a
cattle feedyard on Escherichia coli O157:H7 rectal
colonization, fecal shedding, and hide contamina-
tion. Foodborne Path. Dis. 6:885-892.
Smith, D. R., R. A. Moxley, R. E. Peterson, T. J. Klop-
fenstein, G. E. Erickson, G. Bretschneider, E. M.
Berberov and S. Clowser. 2009b. A two-dose regi-
men of a vaccine against type III secreted proteins
reduced Escherichia coli O157:H7 colonization of
the terminal rectum in beef cattle in commercial
feedlots. Foodborne Path. Dis. 6:155-161.
Smith, H. W. and R. B. Huggins. 1982. Successful
treatment of experimental E. coli infections in mice
using phage: its general superiority over antibiot-
ics. J. Gen. Microbiol. 128:307-318.
Smith, H. W. and R. B. Huggins. 1983. Effectiveness
of phages in treating experimental Escherichia coli
diarrhoea in calves, piglets and lambs. J. Gen. Mi-
crobiol. 129:2659-2675.
Smith, H. W. and R. B. Huggins. 1987. The control of
experimental E. coli diarrhea in calves by means of
bacteriophage. J. Gen. Microbiol. 133:1111-1126.
Snedeker, K. G., M. Campbell and J. M. Sargeant.
2012. A systematic review of vaccinations to re-
duce the shedding of Escherichia coli O157 in the
faeces of domestic ruminants. Zoono. Pub. Health.
59:126-138.
Stahl, C. H., T. R. Callaway, L. M. Lincoln, S. M. Loner-
gan and K. J. Genovese. 2004. Inhibitory activities
of colicins against Escherichia coli strains respon-
sible for postweaning diarrhea and edema disease
in swine. Antimicrob. Ag. Chemother. 48:3119-
3121.
Stanford, K., T. A. McAllister, Y. D. Niu, T. P. Stephens,
A. Mazzocco, T. E. Waddell and R. P. Johnson.
2010. Oral delivery systems for encapsulated bac-
teriophages targeted Escherichia coli O157: H7 in
feedlot cattle. J. Food Prot. 73:1304-1312.
Stephens, T. P., G. H. Loneragan, L. M. Chichester
and M. M. Brashears. 2007a. Prevalence and enu-
meration of Escherichia coli O157 in steers receiv-
ing various strains of Lactobacillus-based direct-
fed microbials. J. Food Prot. 70:1252-1255.
Stephens, T. P., G. H. Loneragan, E. Karunasena and
M. M. Brashears. 2007b. Reduction of Escherichia
coli O157 and Salmonella in feces and on hides of
feedlot cattle using various doses of a direct-fed
microbial. J. Food Prot. 70:2386-2391.
Stewart, V. J. 1988. Nitrate respiration in relation to
facultative metabolism in enterobacteria. Micro-
biol. Rev. 52:190-232.
Stouthamer, A. H. 1969. A genetical and biochemi-
cal study of chlorate-resistant mutants of Salmo-
nella typhimurium. Antoine van Leeuwenhoek.
35:505-521.
Swyers, K. L., B. A. Carlson, K. K. Nightingale, K. E.
Belk and S. L. Archibeque. 2011. Naturally colo-
nized beef cattle populations fed combinations of
yeast culture and an ionophore in finishing diets
containing dried distiller’s grains with solubles had
similar fecal shedding of Escherichia coli O157:H7.
J. Food Prot. 74:912-918.
Tanji, Y., T. Shimada, H. Fukudomi, K. Miyanaga, Y.
Nakai and H. Unno. 2005. Therapeutic use of
phage cocktail for controlling Escherichia coli
O157:H7 in gastrointestinal tract of mice. J. Biosci.
Bioeng. 100:280-287.
Thomson, D. U., G. H. Loneragan, A. B. Thornton, K.
F. Lechtenberg, D. A. Emery, D. T. Burkhardt and T.
G. Nagaraja. 2009. Use of a siderophore recep-
tor and porin proteins-based vaccine to control
the burden of Escherichia coli O157:H7 in feedlot
cattle. Foodborne Path. Dis. 6:871-877.
Thornton, A. B., D. U. Thomson, G. H. Loneragan, J.
T. Fox, D. T. Burkhardt, D. A. Emery and T. G. Naga-
raja. 2009. Effects of a siderophore receptor and
porin proteins-based vaccination on fecal shed-
ding of Escherichia coli O157:H7 in experimentally
inoculated cattle. J. Food Prot. 72:866-869.
120 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Tournut, J. 1989. Applications of probiotics to ani-
mal husbandry. Rev. Sci. Tech. Off. Int. Epiz. 8:551-
566.
Van Donkersgoed, J., D. Hancock, D. Rogan and A.
A. Potter. 2005. Escherichia coli O157:H7 vaccine
field trial in 9 feedlots in Alberta and Saskatche-
wan. Can. Vet. J. 46:724-728.
Varela, N. P., P. Dick and J. Wilson. 2013. Assess-
ing the existing information on the efficacy of bo-
vine vaccination against Escherichia coli O157: H7
- a systematic review and meta-analysis. Zoonos.
Pub. Health. 60:253-268.
Vilte, D. A., M. Larzábal, U. B. Mayr, S. Garbaccio, M.
Gammella, B. C. Rabinovitz, F. Delgado, V. Meikle,
R. J. C. Cantet, P. Lubitz, W. Lubitz, A. Cataldi and
E. C. Mercado. 2012. A systemic vaccine based
on Escherichia coli O157:H7 bacterial ghosts (BGs)
reduces the excretion of E. coli O157:H7 in calves.
Vet. Immunol. Immunopathol. 146:169-176.
Walker, W. A. and L. C. Duffy. 1998. Diet and bacte-
rial colonization: Role of probiotics and prebiotics.
J. Nutr. Biochem. 9:668-675.
Walle, K. V., D. Vanrompay and E. Cox. 2012. Bovine
innate and adaptive immune responses against
Escherichia coli O157:H7 and vaccination strate-
gies to reduce faecal shedding in ruminants. Vet.
Immunol. Immunopathol. 152:109-120.
Wileman, B. W., D. U. Thomson, K. C. Olson, J. R.
Jaeger, L. A. Pacheco, J. Bolte, D. T. Burkhardt, D.
A. Emery and D. Straub. 2011. Escherichia coli
O157:H7 shedding in vaccinated beef calves born
to cows vaccinated prepartum with Escherichia coli
O157:H7 SRP vaccine. J. Food Prot. 74:1599-1604.
Willard, M. D., R. B. Simpson, N. D. Cohen and J. S.
Clancy. 2000. Effects of dietary fructooligosaccha-
ride on selected bacterial populations in feces of
dogs. Amer. J. Vet. Res. 61:820-825.
Wolin, M. J. 1969. Volatile fatty acids and the in-
hibition of Escherichia coli growth by rumen fluid.
Appl. Microbiol. 17:83-87.
Yekta, M. A., B. M. Goddeeris, D. Vanrompay and E.
Cox. 2011. Immunization of sheep with a combi-
nation of intiminγ, EspA and EspB decreases Esch-
erichia coli O157:H7 shedding. Vet. Immunol. Im-
munopathol. 140:42-46.
Yoon, I. K. and M. D. Stern. 1996. Effects of Saccha-
romyces cerevisiae and Aspergillus oryzae cultures
on ruminal fermentation in dairy cows. J. Dairy Sci.
79:411-417.
Younts-Dahl, S. M., M. L. Galyean, G. H. Loneragan,
N. A. Elam and M. M. Brashears. 2004. Dietary
supplementation with Lactobacillus- and Propioni-
bacterium-based direct-fed microbials and preva-
lence of Escherichia coli O157 in beef feedlot cattle
and on hides at harvest. J. Food Prot. 67:889-893.
Zhang, X. H., K. W. He, P. D. Zhao, Q. Ye, X. T. Luan,
Z. Y. Yu, L. B. Wen, Y. X. Ni, B. Li, X. M. Wang, R.
L. Guo, J. M. Zhou and A. H. Mao. 2012. Intrana-
sal immunisation with Stx2B-Tir-Stx1B-Zot protein
leads to decreased shedding in goats after chal-
lenge with Escherichia coli O157:H7. Vet. Rec.
170:178-186.
Zhao, T., M. P. Doyle, B. G. Harmon, C. A. Brown,
P. O. E. Mueller and A. H. Parks. 1998. Reduc-
tion of carriage of enterohemorrhagic Escherichia
coli O157:H7 in cattle by inoculation with probiotic
bacteria. J. Clin. Microbiol. 36:641-647.
Zhao, T., S. Tkalcic, M. P. Doyle, B. G. Harmon, C. A.
Brown and P. Zhao. 2003. Pathogenicity of entero-
hemorrhagic Escherichia coli in neonatal calves
and evaluation of fecal shedding by treatment with
probiotic Escherichia coli. J. Food Prot. 66:924-
930.
Zopf, D. and S. Roth. 1996. Oligosaccharide anti-
infective agents. The Lancet (North America).
347:1017-1021.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 121
www.afabjournal.comCopyright © 2013
Agriculture, Food and Analytical Bacteriology
ABSTRACT
As the biofuels industry continues to grow and technologies to recover fermentable sugars from feed-
stocks improve, the leftover byproducts are becoming richer in proteins. These byproducts could poten-
tially serve as sources of dietary protein for food animals. However, the uneven quality as well as the poten-
tially large quantities would need the assessment of bioavailability of the amino acid content for the proper
formulation of these for animal diets, which would require in vitro assays that best approximated animal
bioavailability response. Among the in vitro methods, Escherichia coli – based biosensors show promise to
fulfill this need. With the bulk of the work done on lysine and methionine, considerable research has been
conducted on E. coli – based biosensors to optimize culture conditions and improve detection sensitivities.
This review will discuss the current knowledge on E. coli – based biosensors and potential research direc-
tions for the future.
Keywords: Escherichia coli, biosensors, amino acids, biofuels, feedstocks, rapid, bioassay
InTRoduCTIon
In recent years the emergence of cereal crops as
biofuel feedstocks has grown to the extent that for
some cereal grains, such as corn, bioethanol produc-
tion has directly competed with its more traditional
use as food and feed (Wisner and Baumel, 2004;
Mayday, 2007). This competition has generated con-
Correspondence: Ruben Morawicki, [email protected]: +1 -479-575-4923 Fax: +1-479-575-6936
siderable debate on the economics on further devel-
opment of grain crops to generate ethanol (Wisner
and Baumel, 2004; Johnson, 2007; Mayday, 2007;
Buyx and Tait, 2011).
Biofuel economic issues are reflected in not only
the price and availability of the cereal grain sub-
strates but also in the availability and efficiency of
the fermentation (Somma et al., 2010). In addition,
the efficiency of ethanol production by yeasts can
be compromised by the presence of other unde-
sirable microorganisms, which not only compete
REVIEWPotential for Rapid Analysis of
Bioavailable Amino Acids in Biofuel Feed StocksD. E. Luján-Rhenals1,2 and Ruben Morawicki1
1 Food Science Department, 2650 Young Ave., University of Arkansas, Fayetteville, AR
2 Current address: Universidad de Córdoba, sede Berástegui. Km. 12 vía Cereté-Ciénaga de Oro, Córdoba, Colombia
Agric. Food Anal. Bacteriol. 3: 121-128, 2013
122 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
for substrates but potentially inhibit yeasts by pro-
ducing organic acids with antimicrobial properties
(Ricke, 2003; Muthaiyan and Ricke, 2010; Muthaiyan
et al., 2011; Limayen and Ricke, 2012). Some of the
inhibition issues can be resolved with further im-
provements on the genetics of ethanol-producing
microorganisms (Ragauskas et al., 2006; Limayen
and Ricke, 2012). Several opportunities exist for ei-
ther genetically modifying microorganisms to utilize
more diverse carbon substrates or isolating microor-
ganisms with these capabilities (Limayen and Ricke,
2012). However, for ethanolic fermentations, achiev-
ing better carbon/sugar extraction efficiencies is
only part of the solution.
Despite the apparent competing interests be-
tween the biofuel industry and the livestock agri-
cultural sector, the opportunities for a more syner-
gistic relationship are possible. As the development
of more sophisticated biofuel processes continues,
it is anticipated that a more efficient extraction of
carbon for biofuel generation will become more
pronounced, which will leave carbon-poor-protein-
enriched byproducts that are of limited use as bio-
fuel substrates. However, these byproducts offer
proteins that can serve as amino acid sources for
meeting animal nutritional requirements. Besides
the fact that these protein sources may have variable
availability, there are other potential problems in-
cluding non-optimal levels of essential amino acids
and imbalances in amino acid profiles, which can be
problematic when fed to animals as excess dietary
protein. This can result in environmental nitrogen
emission that can not only be an economic waste
but also result in the contamination of surface and
ground water sources from excess animal nitrogen
emissions (Kim et al., 2006; Chalova et al., 2009a;
Hunde et al., 2012). Some of these problems can be
solved via supplementation of the deficient amino
acids identified in the dietary formulation. However,
the key for correct supplementation depends on
both the identification of deficient amino acids and
the quantification of their availability. The remainder
of this review focuses on defining amino acid avail-
ability in general with particular emphasis on lysine,
which is one of the most critical amino acids. To con-
clude, a discussion will cover the emergence of rapid
methods for quantifying amino acids in general, par-
ticularly lysine.
BIoAvAIlABIlITy of AMIno ACIdS
Bioavailability of a particular dietary amino acid is
the fraction of the ingested amino acid that is ab-
sorbed in a chemical form suitable for metabolism or
protein synthesis (Batterham, 1992; Johnson, 1992;
Lewis and Bayley, 1995; Zebrowski and Buraczewski,
1998; Gabert et al., 2001). Traditionally, the gold stan-
dard to estimate amino acid availability has been the
use of in vivo assays (Sauer and Ozimek, 1986; Apple-
gate et al., 2004). Another traditional method uses
a slope-ratio assay to estimate the bioavailability, in
which the response—whole body protein deposition
(Batterham, 1992) or amino acid oxidation (Moehn et
al., 2005)—is correlated with the amino acid intake.
Amino acid availability is determined by comparing
the regression line of the test diet with a reference
protein diet. The ratio of the slope of the test feed
ingredient to the slope of the reference protein rep-
resents the relative bioavailability of the amino acid
in question.
Unfortunately, these animal-based bioavailability
and digestibility methods are expensive, tedious,
and time-consuming (2 to 4 weeks) and do not lend
themselves well to high-throughput analyses that
would be needed for large numbers of samples (Er-
ickson et al., 2002). Additionally, they require special
facilities and large amounts dietary materials. In ad-
dition, these in vivo methods are limited in the num-
ber of feed ingredients that can be compared simul-
taneously and increasing animal welfare concerns
make it more difficult to conduct the trials (Erickson
et al., 2002; Chalova et al., 2009a).
There are no direct in vitro measures of amino
acid bioavailability that duplicate exactly in vivo tests
because of the complexity of the intestinal system
and animal variability (Ravindran and Bryden., 1999;
Erickson et al., 2002; Applegate et al., 2004; Chalova
et al., 2009a, b, 2010). Although chemical separation-
based methods, for instance high performance liq-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 123
uid chromatography (HPLC) or gas chromatography,
are rapid and easily available, the determination of
amino acid concentrations in feed ingredients does
not reflect the actual amounts of amino acids ab-
sorbed under physiological conditions (Kivi, 2000;
Ericksonet al., 2002; Froelich and Ricke, 2005). How-
ever, some of the in vitro methods that are available,
such as amino acid enzyme-based digestibility and
microbiological (biosensor) assays, can approximate
values generated from animal studies (Erickson et
al., 1999a; Chalova et al., 2007, Schasteen et al.,
2007; Stein et al., 2007). Among them, microbiologi-
cal assays for amino acid bioavailability are consid-
ered one of the most effective approaches in terms
of time, cost and variability (Erickson et al., 2002; Fro-
elich and Ricke, 2005; Chalova et al., 2009a,b, 2010).
MICRoBIAl-BASed AMIno ACId BIo-SenSoRS
Rapid tools with high specificity for food and fer-
mentation analysis, such as new biosensor- based
assays, are continually being developed to detect
and quantify nutritional components, food additives,
and contaminants. Biosensors consist of microor-
ganisms—mainly bacteria due to rapid growth—or
enzymes that can interact either physiologically or
chemically with low concentrations of a compound
of interest (Lei et al., 2006). Biosensors are very spe-
cific, sensitive, and flexible to use, and do not re-
quire large and expensive instrumentation as chemi-
cal analyses do (Chalova et al., 2009a, b). Common
applications of bacterial-based biosensors include
detection of antibiotics, ethanol, metals, phenolic
compounds, sugars, urea and vitamins, as well as
other compounds (Ricke and Zabala-Díaz, 2001; Lei
et al., 2006; Chalova et al., 2009a, b).
A microbial cell-based biosensor, also referred to
as a whole cell sensor, consists of a viable bacterial
cell that has been selected or genetically modified
to quantify a particular metabolite. It is followed by
a detection device that typically uses a colorimetric
enzymatic response, a bioluminescence reaction, or
fluorescence mediated by a green fluorescent pro-
tein (Lei et al., 2006; Chalova et al., 2009a). The abil-
ity of a microorganism to grow on a particular nutri-
ent is the basis for detection and the extent of the
growth provides data for quantification.
Quantification can be done by following the opti-
cal density with a spectrophotometer, the lumines-
cence in cells containing the lux gene, or the fluo-
rescence in cells containing genes that synthesize
green fluorescence proteins (GFP). The levels of
growth are consistently proportional to the external
concentration of the metabolite of interest (Erickson
et al., 2000, 2002; Froelich and Ricke, 2005; Chalo-
va et al., 2007; 2008b, 2009a, b, 2010; Bertels et al.,
2012). More direct biosensor assays are possible by
constructing gene fusions between promoter genes,
which recognize a particular external metabolite,
and a structural gene element responsible for syn-
thesizing lux gene-based proteins or GFP (Lei et al.,
2006; Zabala-Díaz et al., 2007; Chalova et al., 2008a,
2009c).
E. coli-BASed AMIno ACId BIoSen-SoRS
Microbial methods for quantification of amino acid
bioavailability are generally considered user friendly,
relatively precise, specific, and economical (Shock-
man, 1963; Erickson et al., 2002). They include differ-
ent assay microorganisms, which are based on their
nutritive requirements for the respective amino acid
(Shockman, 1963). E. coli has been one of the most
highly investigated microorganisms for amino acid
bioavailability quantification because this bacterium
offers several advantages over other microorganisms
as originally outlined by Payne and Tuffnell (1980).
These advantages include: (1) it has one of the low-
est doubling times (one of the fastest growth rates)
among bacteria; (2) it is relatively easy to growth with
minimal nutritional supplementation of the media;
(3) the genetics are extremely well established and
universally recognized; and (4) it can be easily ma-
nipulated to produce desired phenotypic responses
for each respective nutrient to be assayed, such as
amino acids. Additionally, E. coli is naturally found in
124 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
the majority of animals and human intestine with a
similar absorption of amino acids and peptides, attri-
butes that make E. coli very functional as a biosensor
microorganism for these substances (Ingraham et al.,
1983; Chalova et al., 2009b).
Several studies have been conducted over the
years to develop specific E. coli-based assays for
amino acids (Payne and Tuffnell, 1980; Hitchins et al.,
1989; Erickson et al., 2002; Froelich and Ricke, 2005,
Chalova et al., 2009a, b, 2010; Bertels et al., 2012).
The basis for most of these E. coli sensors is that cell
growth correlates with amino acid concentrations.
However, since all the 20 essential amino acids can
be synthesized by the wild type E. coli in a medium
containing only a carbon source and inorganic salts
(Neidhardt et al., 1990), this wildtype strain can-
not be used directly for amino acid quantification.
Instead, multiple mutants of E. coli have been cre-
ated by genetic manipulation and studied for the
purpose of quantifying amino acid bioavailability
(Payne and Tuffnell, 1980; Hitchins et al., 1989; Erick-
son et al., 2002; Froelich and Ricke, 2005; Bertels et
al., 2012). As a result, the genetically modified E. coli
becomes an auxotroph, for a particular amino acid,
and is consequently incapable of synthesizing that
amino acid. Thus, the cell growth of the auxotroph
is a direct function of the concentration of the amino
acid evaluated (Gavin, 1957; Erickson et al., 2002),
and its quantity can be determined by the extent of
cell growth.
MICRoBIAl BIoSenSoR foR MeThIo-nIne AvAIlABIlITy ASSAyS
Extensive characterization and modification of
microbial biosensors have been conducted for the
essential amino acid methionine (Schwab, 1996;
Webel and Baker, 1999; Boisen et al. 2000; Froelich
and Ricke, 2005; Chalova et al., 2009a, b). Froelich
et al. (2002a) determined that the growth kinetics of
E. coli methionine mutant was not influenced by the
presence of antibiotics or antifungal agents, which
could potentially be used to eliminate interfereing
background microflora during E. coli growth assays.
This was similar to the previous result observed by
Erickson et al. (1999b) for an E. coli lysine auxotroph.
This auxotroph was demonstrated to work as an OD-
based assay for estimating crystalline methionine in
poultry feeds (Zabala Díaz et al., 2004). It was found
that it produced similar growth kinetics with either
methionine or a commercial source of a nutritional
methionine analogue supplement (Froelich et al.,
2002b). Further improvements included adaptation
to a microtiter-based assay and construction of lumi-
nescent and GFP-based strains (Zabala Díaz et al.,
2003; Froelich et al., 2002c, 2005; Bertels et al., 2012).
By deleting genes involved in amino acid biosyn-
thesis, Bertels et al. (2012) developed E. coli biosen-
sors able to quantify eleven amino acids—arginine,
histidine, isoleucine, leucine, lysine, methionine,
phenylalanine, proline, threonine, tryptophan, and
tyrosine—at a sensitive level comparable to HPLC
analysis.
MICRoBIAl BIoSenSoR foR lySIne BIoAvAIlABIlITy ASSAyS
Lysine is nutritionally one of the most important
amino acids and is often the first limiting amino acid
for humans and monogastric animals (Hurrell and
Carpenter, 1981; Jørgensen et al., 1997; Chalova et
al., 2009a). A variety of microorganisms have been
used over the years as lysine biosensors, but E. coli
has been one of the most extensively examined
microbial-based assays for quantification of lysine
bioavailability (Tuffnell and Payne, 1985; Ananthara-
man et al., 1983; Hitchins et al., 1989; Erickson et al.,
2002). Early on, a high correlation (>0.9) between
the microbiological and chemical methods in the
quantification of available lysine was achieved (An-
antharaman et al., 1983); and therefore E. coli esti-
mates appear to be an accurate predictor of lysine
bioavailability in a variety of protein sources (Tuffnell
and Payne, 1985; Hitchins et al., 1989; Erickson et al.
1999a). Several studies were focused on improve-
ments on growth response by modifications of the
growth protocol, including agitation to reduce the
time of incubation, increasing the number of cells in
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 125
the inocula, determining the level of growth inter-
ference by the presence of Maillard-lysine products,
and developing cryopreservation procedures (Li et
al., 1999, 2000; Li and Ricke 2002a,b, 2004). Initially
genetic refinement focused on constructing more
precise lysine auxotrophic E. coli mutants by inser-
tion mutagenesis; but since then more stable de-
letion mutants have been generated (Li and Ricke,
2003a,b,c, Bertels et al., 2012). Increasing detection
sensitivity was originally based on bioluminescent
emitting lysine auxotrophs but due to the require-
ment for multiple reagents later work focused on
using fluorescent dyes and eventually generation of
GFP expressing lysine auxotrophs (Erickson et al.,
2000; Zabala Díaz and Ricke, 2003; Zabala Díaz et al.,
2007; Chalova et al., 2004,2006, 2007, 2008a; Bertels
et al., 2012).
ConCluSIonS
Protein-rich byproducts from the biofuel industry
have the potential to be valuable sources of dietary
protein for food animal feed. However, the uneven
quality of these byproducts as well as their large
quantities generated would require a systematic
evaluation of the amino acids bioavailability almost
on batch-to-batch basis. Unfortunately, animal-
based bioavailability assays would not be able to
accommodate this need, thus requiring the devel-
opment of rapid in vitro assays. The construction of
E. coli whole-cell-biosensors offer an opportunity to
satisfy this need; but, further refinement, such as de-
velopment of solid phase or bead anchored systems,
are still needed to make these biosensors more user
friendly and have a broader application spectrum.
Given the advancements made in other biologi-
cal detection systems, such as those for foodborne
pathogens, the adaptation of these systems to E.
coli could be a fairly straight forward process.
ACknowledgeMenTS
This review was partially supported by the Arkan-
sas Soybean Promotion Board. Deivis Enrique Luján-
Rhenals was supported in part by Colciencias of Co-
lombia and the Universidad de Córdoba (Colombia).
RefeRenCeS
Anantharaman K, C. Parard, B. Decarli, P. Reinhardt,
E. Graf and P. Finot. 1983. The microbiological es-
timation of available lysine in industrial milk prod-
ucts using a lysine- Escherichia coli, M. 26-26. In: J.
V. McLoughlin and B. M. McKenna (eds). Research
in Food Science and Nutrition, Boole Press Ltd.,
Dublin, pp 81-82.
Applegate, T.G., K. Thompson, and W.A. Dudley-
Cash. 2004. Amino acid digestibilities needed for
poultry rations . Feedstuffs 30:15-17.
Batterham, E. S. 1992. Availability and utilization of
AA for growing pigs. Nutr. Res. Rev. 5:1–18.
Bertels, F., H. Merker, and C. Kost. 2012. Design and
characterization of auxotrophy based amino acid
biosensors. PLoS ONE 7: e41349.
Boisen, S., T. Hyelplund, and M.R. Weisbjerg. 2000.
Ideal amino acid profile as a basis for feed protein
evaluation. Livestock Prod. Sci. 64: 239–251.
Buyx, A. and J. Tait, 2011. Ethical framework for bio-
fuels. Science 332:540-541.
Chalova, V.I., C.A. Froelich, Jr., and S.C. Ricke. 2010.
Potential for development of an Escherichia coli–
based biosensor for assessing bioavailable methi-
onine: A review. Sensors 10: 3562-3584.
Chalova, V.I., R.C. Anderson, D.J. Nisbet and S.C.
Ricke 2009a. Chapter 5. Biosensors in the animal
industry - the need for better nutritional manage-
ment in the face of rising corn costs and increased
ethanol demand. In: S. Biswas, N. Kaushik and A.
Pandey. Eds. Bioprocess & Bioproducts - Technol-
ogy Trends & Opportunities. Asiatech Publishers,
Inc., New Delhi India, pp. 66-87.
Chalova, V.I, S.A. Sirsat, C.A. O’Bryan, P.G. Crandall,
and S.C. Ricke. 2009b. Escherichia coli, an intesti-
nal microorganism, as a biosensor for quantifica-
tion of amino acid bioavailability. Sensors 9:7038-
7057.
126 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Chalova, V.I., C.L. Woodward, and S.C. Ricke. 2009c.
CadBA induction of an Escherichia coli lysine auxo-
troph transformed with a plasmid carrying cad-gfp
transcriptional fusion. Antonie van Leeuwenhoek
J. Gen. Mol. Microbiol. 95:305-310.
Chalova, V.I., C.L. Woodward, and S.C. Ricke. 2008a.
Construction of a cad-gfpmut3 plasmid-construct
in Escherichia coli for gene induction-based quan-
tification of lysine in acid hydrolysates of feed-
stuffs. Lett. Appl. Microbiol. 46:107-112.
Chalova, V., I.B. Zabala-Díaz, C.L. Woodward, and
S.C. Ricke. 2008b. Development of a whole cell
sensor - green fluorescent sensor method for ly-
sine quantitification. World J. Microbiol. Biotech-
nol. 24:353-359.
Chalova, V.I., Kim, W.K., Woodward, C.L., Ricke, S.C.
2007. Quantification of total and bioavailable ly-
sine in feed protein sources by a whole-cell green
fluorescent protein growth based Escherichia coli
biosensor. Appl. Microbiol. Biotechnol. 76: 91-99.
Chalova, V., C.L. Woodward, and S.C. Ricke. 2006.
Assessment of an Escherichia coli lysine auxotroph
containing green fluorescent protein for quantify-
ing bioavailable lysine in animal protein samples
under nonsterile and autofluorescence back-
ground. Lett. Appl. Microbiol. 42:625-270.
Chalova, V., C.L. Woodward, and S.C. Ricke. 2004.
Fluorescent DNA binding dye-based approach for
measuring the growth of an Escherichia coli lysine
auxotroph and quantifying lysine. J. Rapid Meth.
Automation Microbiol. 11:313-324.
Erickson, A.M.. X. Li, I.B. Zabala-Diaz, and S.C. Ricke.
2002. Potential for measurement of lysine bioavail-
ability in poultry feeds by microbiological assays-
A Review. J. Rapid Methods Automation Micro-
biol.10:1-8.
Erickson, A.M., Zabala-Diaz, I.B., Kwon, Y.M., Ricke,
S.C. 2000. A bioluminescent Escherichia coli auxo-
troph for use in an in vitro lysine availability assay,
J. Microbiol Methods 40:207-212.
Erickson, A.M., X. Li, C.L. Woodward and S.C. Ricke.
1999a. Optimisation of enzyme treatment for the
degradation of feed proteins for an Escherichia
coli auxotroph lysine availability assay. J. Sci. Food
Agric. 79:1929-1935.
Erickson, A.M., I.B. Zabala Díaz and S.C. Ricke.
1999b. Antibiotic amendment for suppression of
indigenous microflora in feed sources for an Esch-
erichia coli auxotroph lysine assay. J. Appl. Bacte-
riol. 87:125-130.
Froelich Jr., C.A. and S.C. Ricke. 2005. Rapid bac-
terial-based bioassays for quantifying methionine
bioavailability in animal feeds: A review. J. Rapid
Meths. Auto. Microbiol. 13:1-10.
Froelich, Jr., C.A., I.B. Zabala Díaz, V.I. Chalova, W.-K.
Kim, and S.C. Ricke. 2005. Quantifying methionine
with a green fluorescent Escherichia coli methio-
nine auxotroph. J. Rapid Meth. Auto. Microbiol.
13:193-203.
Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002a.
Methionine auxotroph Escherichia coli growth ki-
netics in antibiotic and antifungal amended me-
dia. J. Environ. Sci. Health 37B:485-492.
Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002b.
Potential rapid bioassay for alimet using a methio-
nine Escherichia coli auxotroph. J. Rapid Meth.
Automation Microbiol. 10:161-172.
Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002c.
Construction of a bioluminescent methionine
auxotroph Escherichia coli strain for potential use
in a methionine bioassay. J. Rapid Meth. Automa-
tion Microbiol. 10:69-82.
Gabert, V.M., Jorgensen, H., Nyachoti, C.M. 2001.
Bioavailability of amino acids in feedstuffs for
swine. In: A. J. Lewis and L. L. Southern. Eds. Swine
Nutrition, 2nd ed. CRC Press, New York, NY. p
151–186.
Gavin, J.J. 1957. Analytical microbiology: III. Turbidi-
metric methods. Appl. Microbiol. 5:235-243.
Hitchins, A.D., F.E. McDonough, and P.A. Wells.
1989. The use of Escherichia coli mutants to mea-
sure the bioavailability of essential amino acids in
foods. Plant Foods for Human Nutr. 39:109-120.
Hunde, A.R., P.H. Patterson, S.C. Ricke and W.K. Kim.
2012. Supplementation of poultry feeds with di-
etary zinc and other minerals and compounds to
mitigate nitrogen emissions – A review. Biol. Trace
Element Res. 147:386-394.
Hurrell, R.F. and K.J. Carpenter. 1981. The estima-
tion of available lysine foodstuffs after Maillard
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 127
reactions, Progress in Food & Nutrition Science
5:159-176.
Ingraham, J.L., O. Maaloe, F. C. Neidhardt. 1983.
Growth of the bacterial cell; Sinauer Associates,
Inc. Sunderland, MA, USA.
Johnson, J. 2007. Ethanol—is it worth it? Chem. Eng.
News 85:19–21.
Johnson, R.J. 1992. Principles, problems and appli-
cation of amino acid digestibility in poultry. World’s
Poult. Sci. J. 48:232-246.
Jørgensen H, V.M. Gabert, and B.O. Eggum. 1997,
The nutritional value of high-lysine barley deter-
mined in rats, young pigs and growing pigs, J. Sci.
Food Agric. 73: 287-295.
Kim, W.K., C.A. Froelich, Jr., P.H. Patterson, and S.C.
Ricke. 2006. The potential to reduce poultry nitro-
gen emissions with dietary methionine or methio-
nine analogues supplementation. World’s J. Poult.
Sci. 62: 338-353.
Kivi, J.T. 2000. Amino acids. In: L. M. L. Nollet. Ed.
Food analysis by HPLC. Marcel Dekker Inc., New
York, NY, USA; p. 55.
Lei, Y., W. Chen, and A. Mulchandani. 2006. Micro-
bial biosensors. Anal. Chim. Acta 568:200-210.
Lewis, A. J., and H. S. Bayley. 1995. Amino acid bio-
availability. p 35–65. In: C. B. Ammerman, D. H.
Baker, and A. J. Lewis. Eds. Bioavailability of nutri-
ents for animals, amino acids, minerals, and vita-
mins. Academic Press, New York, NY.
Li, X. and S.C. Ricke. 2003a. A suicide vector for con-
structing a lysA insertion mutation in Escherichia
coli. J. Rapid Meth. Automation Microbiol. 10:281-
290.
Li, X. and S.C. Ricke. 2003b. Characterization of Esch-
erichia coli lysA insertion targeted mutant using
phenotype arrays. Bioresource Technol. 89:249-
253.
Li, X. and S.C. Ricke. 2003c.Generation of an Esch-
erichia coli lysA targeted deletion mutant by dou-
ble cross-over recombination for potential use in a
bacterial growth-based lysine assay. Letts. Appl.
Microbiol. 36:458-462.
Li, X. and S.C. Ricke. 2004. Comparison of cryopro-
tectants for Escherichia coli lysine bioavailability
assay culture. J. Food Proc. and Pres. 28:39-50.
Li, X. and S.C. Ricke. 2002a. Influence of soluble ly-
sine Maillard reaction products on Escherichia coli
amino acid lysine auxotroph growth based-assay.
J. Food Sci. 67:2126-2128.
Li, X. and S.C. Ricke. 2002b. Specificity of Escherichia
coli amino acid lysine auxotroph growth kinetics
and lysine assay response to various soluble Mail-
lard reaction products. J. Food Proc. Pres. 26:279-
294.
Li, X., A.M. Erickson, and S.C. Ricke. 2000. Agitation
during incubation reduces the time required for a
lysine microbiological growth assay using an Esch-
erichia coli auxotrophic mutant. J. Rapid Meth. Au-
tomation Microbiol. 8:83-94.
Li, X., A.M. Erickson, and S.C. Ricke. 1999. Compari-
son of minimal media and inoculum concentration
to decrease the lysine growth assay response time
of an Escherichia coli lysine auxotroph mutant. J.
Rapid Methods Automation Microbiol. 7:279-290.
Limayen, A. and S.C. Ricke. 2012. Lignocellulosic
biomass for bioethanol production: Current per-
spectives, potential issues and future prospects.
Prog. Energy Comb. Sci. 38:449-467.
Mayday, J. 2007. Food, feed, or fuel: ethanol boom
reverberates throughout the food system. Meat &
Poultry 53:10–12.
Moehn, S., R. F. P. Bertolo, P. B. Pencharz, and R. O.
Ball. 2005. Development of the indicator AA oxi-
dation technique to determine the availability of
AA from dietary protein in pigs. J. Nutr. 135:2866–
2870.
Muthaiyan, A. and S.C. Ricke. 2010. Current per-
spectives on detection of microbial contamination
in bioethanol fermentors. Bioresource Technol.
101:5033-5042.
Muthaiyan, A., A. Limayen, and S.C. Ricke. 2011.
Antimicrobial strategies for limiting bacterial con-
taminants in fuel bioethanol fermentations. Prog.
Energy Comb. Sci. 37:351-370.
Neidhardt, F.C., Ingraham, J.L.; Schaechter, M. 1990.
Growth of cells and populations. In: F. C. Nei-
dhardt, J. L. Ingraham, M. Schaechter. Eds. Physi-
ology of the bacterial cells: a molecular approach;
Sinauer Associates, Sunderland, UK; p. 197.
Payne, J.W., and J. M. Tuffnell. 1980. Assays for ami-
128 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
no acids, peptides and proteins. In: J. W. Payne.
Ed. Microorganisms and nitrogen sources; John
Wiley & Sons: New York, NY, USA; p. 727.
Ragauskas A.J., C.K. Williams, B. H. Davison, G. Brit-
ovsek, J. Cairney, C. A. Eckert, W.J. Frederick, Jr.,
J.P. Hallett, D.J. Leak, C.L. Liotta, J.R. Mielenz, R.
Murphy, R. Templer and T. Tschaplinski, 2006, The
path forward for biofuels and biomaterials, Sci-
ence 311:484-489.
Ravindran, V. and W. L. Bryden. 1999. Amino acid
availability in poultry-in vitro and in vivo measure-
ments. Aust. J. Agric. Res. 50:889-908.
Ricke, S.C. 2003. Perspectives on the use of organic
acids and short chain fatty acids as antimicrobials.
Poultry Sci. 82:632-639.
Ricke, S.C., and I. B. Zabala-Díaz. 2001. A potential
need for development of rapid microbiological as-
says to quantify folate concentrations in foods. Re-
cent Developments in Nutrition 4 (Research Sign-
post, Trivandrum, India):1-5.
Sauer, W. C., and L. Ozimek. 1986. Digestibility of AA
in swine: Results and their practical applications. A
review. Livest. Prod. Sci. 15:367–388.
Schasteen, C.S., J. Wu, M.G. Schulz, and C.M. Par-
sons. 2007. Correlation of an immobilized diges-
tive enzyme assay with poultry true amino acid di-
gestibility for soybean meal. Poult. Sci. 86:343–348.
Schwab, C.G. 1996. Rumen-protected amino ac-
ids for dairy cattle: Progress toward determining
lysine and methionine requirements. Anim. Feed
Sci.Technol. 59:87–101.
Shockman, D. 1963. Amino acids. In Analytical micro-
biology; F. Kavanagh, Ed.; Academic Press: New
York, NY, USA; p. 567.
Somma, D. H. Lobkowicz, and J.P. Deason. 2010.
Growing America’s fuel: An analysis of corn and
cellulosic ethanol in the United States. Clean
Techn. Environ. Policy 12:373-380.
Stein, H.H., Sève, B. Fuller, M. F., Moughan, P. J. , and
De Lange, C. F. M. 2007. Amino acid bioavailability
and digestibility in pig feed ingredients: terminol-
ogy and applications. J. Anim. Sci. 85:172-180.
Tuffnell, J.M., and Payne, J.W. 1985. A colorimetric
enzyme assay using Escherichia coli to determine
nutritionally available lysine in biological materials.
J. Appl. Bact. 58:333-341.
Webel, D.M. and D.H. Baker. 1999. Cysteine is the
first limiting amino acid for utilization of endog-
enous amino acids in chicks fed a protein free diet.
Nutr. Res. 19:569–577.
Wisner, R. N., and C. P. Baumel. 2004. Ethanol, ex-
ports and livestock: will there be enough corn to
supply future needs? Feedstuffs 30:1-20.
Zabala Díaz, I.B., V.I. Chalova, and S.C. Ricke. 2007.
Generation of a green fluorescent protein gene
chromosomal insertion containing Escherichia
coli strain for gene-induction-based quantification
of bioavailable lysine. Sensing Instrument. Food
Quality Safety 1:55-61.
Zabala Díaz, I.B. and S.C. Ricke. 2003. Quantitative
detection of crystalline lysine supplemented in
poultry feeds using a rapid bacterial biolumines-
cence assay. Appl. Microbiol. Biotechnol. 62:268-
273.
Zabala- Díaz, I., F.O.C. Carreon, W.C. Ellis, and S.C.
Ricke. 2004. Assessment of an Escherichia coli
methionine auxotroph growth assay for quantify-
ing crystalline methionine supplemented in poul-
try feeds. J. Rapid Meth. Automation Microbiol.
12:155-167.
Zabala Díaz, I.B., C.A. Froelich, and S.C. Ricke. 2003.
Adaptation of a methionine auxotroph Escherichia
coli growth assay to microtiter plates for quantitat-
ing methionine. J. Rapid Meth. Automation Micro-
biol. 10:217-229.
Zebrowski, T. and S. Buraczewski. 1998. Methods
for determination of amino acids bioavailability in
pigs – A review. AJAS 11:620-633.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 129
www.afabjournal.comCopyright © 2013
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Methanogenesis is a predominant fermentation reaction in the gut ecosystem of ruminants. A functional
replacement of methanogenesis with acetogenesis in the rumen could potentially decrease energy losses
and increase the efficiency of ruminant production. Hydrogen limited continuous cultures, at pH 6.0, were
used to isolate over 40 potentially acetogenic bacteria from ruminal contents of a fistulated dairy cow. The
dairy cow was at mid-lactation, consuming a 56% hay and 44% corn silage-concentrate diet. Eight bacterial
isolates had the ability to grow on CO2 and H2 as their sole carbon and energy source producing acetate as
the main end product.
Keywords: acetogen, ruminal buffer, acetate production, H2 utilization
InTRoduCTIon
During rumen fermentation, complex carbohy-
drates (e.g., cellulose) are degraded to monomeric
carbohydrates (e.g., glucose and other soluble car-
bohydrates) which are primarily fermented to py-
ruvate via the Embden-Meyerhof-Parnas pathway
(Pinder et al., 2012; Weimer et al., 2009). Pyruvate
Correspondence: J. A. Patterson, [email protected]: +1 -765-494-4826 Fax: +1-765-494-9347
is subsequently metabolized to volatile fatty ac-
ids (VFA; acetate, propionate, and butyrate), CO2,
H2, microbial cells and intermediate endproducts
which can serve as crossfeeding substrates for other
ruminal microorganisms such as Selenomonas rumi-
nantium (Ricke et al., 1996). While fermentation acids
provide 60 to 80% of the daily metabolizable energy
intake of ruminants (Annison and Armstrong, 1970),
microbial cells provide an important source of amino
acids, vitamins, and cofactors (Hungate, 1966).
Interspecies H2 transfer is a syntrophic interac-
Isolation and Initial Characterization of Acetogenic Ruminal Bacteria Resistant to Acidic Conditions
P. Boccazzi1,2 and J. A. Patterson1
1 Department of Animal Sciences, Purdue University. West Lafayette, IN 479072 Current address: Pharyx Inc., 801 Albany st, Ste 112C. Boston, Ma 02140
Agric. Food Anal. Bacteriol. 3: 129-144, 2013
130 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
tion between H2-producing and H2-consuming or-
ganisms, that plays an important role in regulating
fermentation environments (McInerney et al., 2011).
Hydrogen produced by fermentative microorgan-
isms is consumed by H2 utilizing microorganisms
(methanogens, sulfidogens, and acetogens). The
decrease in H2 concentration, due to interspecies
H2 transfer, influences VFA fermentation patterns of
many ruminal microorganisms. When H2 concen-
trations are high, pyruvate is utilized as a reducing
equivalent acceptor and more reduced fermentation
products (e.g., propionate, lactate, and ethanol) are
produced. When H2 concentrations are low, there
is an increase in acetate and ATP production that
could be converted into an increase in overall micro-
bial cell yields.
Since energy lost as methane has been estimated
to be 2.4 to 7.4% of the gross energy intake (Branine
and Johnson 1990) or 10 to 15% of the apparent di-
gestible energy of the diet of ruminants (Blaxter and
Clapperton, 1965), there has been an interest to spe-
cifically inhibit methanogenesis to enhance animal
productivity. Direct inhibition of methanogenesis,
however, also results in loss of energy in the form of
H2, and reduced microbial proteins (Chalupa, 1980).
Maintaining the beneficial effects of interspecies
H2 transfer while minimizing loss of energy as meth-
ane could enhance energy provided to ruminants by
22% (Schaefer, D., personal communication; Thauer,
et al., 1977). However, an alternative electron sink is
required to trap electrons into a form utilizable by
the animal if methanogens are to be directly inhib-
ited. Historically, the major method used to ma-
nipulate rumen fermentation and influence ruminant
animal production has been the use of ionophore
antibiotics such as monensin and lasalocid (Raun et
al., 1976; Richardson et al., 1976; Berger et al., 1981;
Ricke et al., 1984; Newbold et al., 2013). These com-
pounds improve the efficiency of animal production
by decreasing methane production and increasing
ruminal propionate concentration by 15%. Methane
production decreases primarily because monensin
inhibits H2-producing microorganisms, therefore
decreasing the amount of H2 available for methano-
genesis.
Acetogenesis has been demonstrated to be the
predominant fate of H2 in some humans, swine, xy-
lophagus termites, cockroaches and rats (Breznak
and Blum, 1991; Ljoie et al., 1988). Replacing metha-
nogenesis with acetogenesis in the rumen may have
potential in decreasing energy losses in ruminants.
Blautia producta (Peptostreptococcus productus,
Bryant et al., 1958), Eubacterium limosum (Sharak-
Genthner, 1981), and Acetitomaculum ruminis
(Greening and Leedle, 1989) are chemolithoauto-
trophic acetogenic bacteria that have been isolated
from the bovine rumen. However they are not con-
sidered the primary H2 consuming organisms in this
environment, since their numbers are consistently
lower than methanogens.
Factors dictating whether acetogenesis or metha-
nogenesis will predominate in anaerobic environ-
ments are not well understood. Breznak and Kane
(1990) suggested several possible factors that may
influence the competitiveness of acetogens with
methanogens. One factor is that methanogenesis
has a higher energy yield than acetogenesis (Breznak
and Blum, 1991).
Another important factor is that methanogens
have a higher affinity for H2 than acetogens. The
normal rumen H2 concentration is between 10-5 and
10-6 atm (Robinson et al., 1981). Ruminal methano-
gens have an affinity for H2 between 1 and 4x10-6 atm
(Greening et al., 1989). Different acetogenic isolates
have been shown to have affinities for H2 between
10-4 and 10-5 atm (Greening et al., 1989; LeVan et al.,
1998). In general, methanogens have been found
to have H2 thresholds 10 to 40 fold lower than ace-
togens (Greening et al., 1989; Breznak and Blum,
1991). However, in our laboratory, acetogens with
H2 thresholds only 2 to 4 fold higher than those of
methnogens were isolated from ruminal contents
(Boccazzi and Patterson, 2011). Finally, tolerance of
bacteria to lower pH levels can also be a key factor
in determining competitiveness in gastrointestinal
environments including the rumen (Ricke, 2003; Rus-
sell, 1992). The objective of this study was to isolate
chemolithoautotrophic acetogenic bacteria from
ruminal contents of a dairy cow at low pH (5.5 to 6.0)
and under H2-limiting conditions in order to select
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 131
for bacterial strains with low H2 thresholds resistant
to acidic environments.
MATeRIAlS And MeThodS
Source of Organisms
Acetobacterium woodii (ATCC 29683) was ob-
tained from the American Type Culture Collection
(Rockville, MD). Acetogenic bacterial strains A10
and 3H (previously referred to as H3HH) were iso-
lated and characterized previously in our laboratory
(Boccazzi and Patterson, 2011; Pinder and Patterson,
2011, 2012, 2013; Jiang et al., 2012). This research
was conducted prior to IACUC protocols being re-
quired for farm animal research. However animals
were treated in accordance with currently approved
IACUC protocols.
Media and Growth Conditions
Growth and H2 threshold experiments were con-
ducted with a basal rumen fluid based acetogen
medium or with Mac-20 medium containing casein
hydrolysate and no rumen fluid (Table 1). Both me-
dia were prepared as described in Table 1 with the
anaerobic techniques of Hungate (1966) as modified
by Bryant (1972) and Balch and Wolfe (1976). The
prepared medium was dispensed anaerobically into
60 mL or 120 mL serum bottles (West Company,
Phoenixville, PA) or 20 mL serum tubes (Bellco Inc.,
Vineland, NJ) in an anaerobic glove box (Coy Labo-
ratories, Ann Arbor, MI) containing a H2:CO2 (5:95)
gas phase. Serum tubes and bottles were sealed
with butyl rubber serum stoppers and aluminum
seals (Bellco Inc., Vineland, NJ).
All stock solutions utilized to formulate media
were prepared anaerobically by boiling and cooling
distilled water under CO2 and sterilized either by au-
toclaving or by injecting the solution through a 0.2
μm filter (Nalgene, Nalge Company, Rochster, NY).
For chemolithoautotrophic growth in broth me-
dium, bacterial cultures were grown in serum bottles
closed with butyl rubber stoppers and aluminum
seals. The bottles were first flushed for 30 sec with
an appropriate gas mixture by inserting both a gas-
sing and a release needle through the serum stop-
pers and then they were pressurized to 200 kPa by
removing the release needle. Oxygen traces were
removed from gas mixtures by passing the gas
through a reduced copper column. Pressurized
bottles, unless otherwise specified, were incubated
on their side on a rotatory shaker (New Brunswick
Scientific Co. Inc., Model M52) operating at 200 rpm.
For growth on solid medium, plates were incubated
in an anaerobic growth vessel (made by the Agricul-
tural and Biological Systems Department. Purdue
University, IN) able to withstand high gas pressures.
Prior to incubation the container was flushed for 2
min and then pressurized to 16 psi with gas mixtures
specified in the text for each experiment.
Isolation of Acetogenic Bacteria
Determination of buffer capacity: MES versus ci-
trate plus phosphate
A batch culture experiment was performed to de-
termine the best buffer system to use for isolating
acetogenic bacteria at a pH range between 5.5 to
6.0. The experiment was conducted with the ace-
togen A10 (Boccazzi and Patterson, 2011). The four
duplicate treatments were control plus 2-(N-morpho-
lino)ethanesulfonic acid (MES), control plus citrate,
A10 plus MES and A10 plus citrate. Serum bottles
(60 mL) were anaerobically filled with 0.35 g alfalfa, 6
ml acetogen medium, 4 mL ruminal contents, 4 mL
of A10 culture, or 4 mL of acetogen medium (con-
trol). MES was added to give a final concentration
of 40 mM, citrate and KH2PO4 were added to a fi-
nal concentration of 20 and 40 mM, respectively and
2-bromoethanesulfonic acid (BES) was added, to in-
hibit methanogens, to a final concentration of 5 mM.
The alfalfa was dried at 60°C and ground through a
1 mm screen. Ruminal contents were collected an-
aerobically from a Holstein Friesian dairy cow prior
to morning feeding and set on ice during transport-
132 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
a All components, except Na2CO3 and Cysteine.HCl, were added to distilled water and brought to a volume of 1,000 mL. The resulting solution was mixed thoroughly and the pH adjusted to 7.0 with 1 M NaOH then gently heated and brought to a boil. Boiling was continued for 1 min., Na2CO3 added and cooled rapidly to 25°C under 100% CO2. Finally, cysteine.HCl was added, mixed thoroughly and autoclaved anaerobically for 12 min at 121°C and 15 psi.
b Modification of AC-19 medium by Breznak et al. (1988)
c Mineral 1 (g/liter): 6.00 K2HPO4
d Mineral 2 (g/liter): 12.00 NaCl, 6.00 K2HPO4, 6.00(NH4)2SO4, 2.45 MgSO4.7H20, 1.60 CaCl2.2H2O
e Additional Trace Mineral Solution (g/Liter): 0.10 NiCl2.6H2O, 0.01 H2SeO3
f Wolfe’s Trace Mineral Solution (g/liter): 3.00 Mg SO4.7H20, 1.00 NaCl, 0.50 MnSO4.H20, 0.10 CoCl2.6H20, 0.10 FeSO4.7H20, 0.10 CaCl2.2H20, 0.18 CoSO4.6H20, 0.19 ZnSO4.7H20, 0.02 AlK(SO4)2.12H20, 0.01 CuSO4.5H20, 0.01Na2MoO4.2H20
g Vitamin Solution (g/liter): 0.10 pyridoxine.HCl, 0.056 ascorbic acid, 0.05 choline chloride, 0.05 thiamine.HCl, 0.05 D,L-6,8-thioctic acid, 0.05b riboflavin, 0.05 D-calcium panthotenic acid, 0.05 p-amino benzoic acid, 0.05 niacinamide, 0.05 nicotinic acid, 0.05 pyridoxal.HCl, 0.05 pyridoxamine, 0.05 myo-inositol, 0.02 biotin, 0.02 folic acid, 0.001 cynocobalamin.
Table 1. Media compositiona
Acetogen Medium
(amounts per liter)
MAC-19 Mediumb
(amounts per liter)
Rumen Fluid 50.0 mL ---
Mineral 1c 40.0 mL 40.0 mL
Mineral 2d 40.0 mL 40.0 mL
Additional Trace Min. Sol.e 10.0 mL 10.0 mL
Wolfe’s Trace Min. Sol.f 10.0 mL 10.0 mL
Vitamin Solutiong 10.0 mL 10.0 mL
Na2CO3 4.0000 g 4.0000 g
Yeast Extract 0.5400 g 2.0000 g
Casein Hydrolysate --- 1.0000 g
Betaine --- 1.0000 g
NH4Cl 0.5400 g 0.5400 g
Cysteine.HCl 0.5000 g 0.5000 g
Resazurin solution 0.0010 g 0.0010 g
Hemin solution 0.0001 g 0.0001 g
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 133
ing to the lab. Serum bottles were incubated on a
rotatory shaker at 37°C. Strain A10 was grown in se-
rum bottles (120 mL) filled with 50 mL of acetogen
medium plus 10 mM glucose (0.5% inoculum) under
200 kPa of a H2:CO2:N2 (1:24:75:) gas mixture for 72
h. Measurements were final pH, headspace gas vol-
ume, and H2 and CH4 concentrations at 0 and 72 h of
incubation.
Isolation of acetogenic bacteria from bovine ruminal contents using a continu-ous culture at pH 6.0
The continuous culture system used to isolate
acetogenic bacteria is shown in Figure 1. The con-
tinuous culture system included two 20 L reservoirs
filled with 16 L of sterile medium, four 500 mL growth
vessels (450 mL working volume), a Plexiglas water
bath, a water heater/circulator (Vankel Heater/Circu-
lator Bench SaverTM- Series VK 650A, Edison, NJ), a
four channel peristaltic pump (Gilson Medical Elec-
tronics Inc., Middleton, WI), a magnet system oper-
ated by an electrical motor was used to turn stirrers
in growth vessels and four 3.8 L plastic containers
were used to collect culture effluent.
The isolation medium was the acetogen medium
(Table 1) modified by the addition of 40 mM MES (fi-
nal concentration), 2.5 % (v/v), instead of 5% of clari-
fied ruminal contents (Greening and Leedle, 1989)
and 5 mM BES (final concentration). The pH of the
medium was adjusted to 6.0 with 1 M HCl. Monensin
was also added to two of the four growth vessels to
a final concentration of 5 μM. Monensin and BES
Figure 1. Continuous culture system utilized to isolate acetogenic bacteria, at low pH, from ruminal contents and to study the possibility to functionally replace methanogenesis with reduc-tive acetogenesis in the rumen.
134 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
were added to the medium reservoirs as anaerobic
sterile stock solutions. The medium in each reser-
voir was continuously stirred and gassed with a 100%
CO2 gas.
Two different dilution rates (D) were used to simu-
late ruminal dilution rates of animals on a high forage
diet (D=0.06 h-1) or a high concentrate diet (D=0.28
h-1). The four isolation treatments utilized are sum-
marized in Figure 2.
Ruminal contents utilized as inoculum were col-
lected prior to the morning feeding from a Holstein
Friesian dairy cow producing a daily average of 55
lb of milk and eating a 56:44 concentrate:forage
diet. Ruminal contents were collected anaerobically
from 3 sites in the rumen and immersed in ice dur-
ing transporting to the lab. In the lab, ruminal con-
tents were blended for 1 min and filtered through
a double layer of cheesecloth under CO2. Each
growth vessel, already containing 200 ml of reduced
isolation medium, received 250 mL of ruminal con-
tents as inoculum. Each growth vessel was continu-
ously stirred and gassed with limited H2:CO2 (80:20)
through stainless steel needles.
After 8 turnovers, 1 mL of fermentation fluid was
Figure 2. Continuous culture system utilized for the isolation of acetogenic bacteria from bovine ruminal contents.
R 1= reservoir 1 with acetogen medium and 5 mM BES
R 2= reservoir 2 with acetogen medium, 5 mM BES and 5 μM monensin
GV 1 and GV 3= growth vessels 1 and 3 at dilution rate = 0.28 h-1
GV 2 and GV 4= growth vessels 2 and 4 at dilution rate = 0.06 h-1
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 135
withdrawn with a sterile syringe, from each growth
vessel and then serially diluted to 10-8 with anaerobic
dilution solution (ADS, Table 2). From each dilution
tube, 250 μL were plated on solid isolation medium
in triplicate 60 mm petri plates. The solid medium
was the same as the isolation medium plus 2% of
washed agar (Leedle and Hespell, 1980). Plates were
incubated in an anaerobic growth vessel, pressur-
ized to 16 psi with a H2:CO2 (80:20) gas mixture, at
37°C for 5 days.
Approximately ten single colonies for each treat-
ment were anaerobically transferred into serum
bottles (120 mL) containing 10 mL acetogen medium
plus 5 mM BES (final concentration). The bottles
were pressurized to 200 kPa with a H2:CO2 (80:20)
gas mixture and incubated on a rotatory shaker for
5 days at 37°C.
Initial screening of newly isolated po-tential acetogenic bacteria
Potential acetogen isolates G1.4b, G1.5a, G1.5c,
G1.5d, G1.5e, G2.4a, G3.2a, G4.4a, acetogenic bac-
teria Acetobacterium woodii, Sporomusa termitida,
and strains A10 and 3H were grown in duplicate se-
rum bottles (60 or 120 mL) containing 10 mL of ace-
togen medium (Table 1), and pressurized to 200 kPa
with a H2:CO2 (80:20) or N2:CO2 (80:20) gas mixtures.
The inoculum was 10% of a third transfer of each
bacterium grown for 48 h in acetogen medium under
200 kPa of H2:CO2 (80:20) at 37°C. After 72 h incuba-
tion, 3 mL of culture from each bottle was transferred
to 5 mL glass tubes and growth was determined by
optical density (660 nm). Potential acetogenic iso-
lates were identified by difference in growth under
H2 and N2.
Hydrogen threshold concentrations were mea-
sured in a separate experiment. To increase cell
mass, cultures (2% inoculum) were grown initially for
12 h at 37°C, in duplicate serum bottles (60 mL), in
acetogen medium (5ml) containing 2.5 mM glucose
under 200 kPa of a H2:CO2 (80:20) gas mixture. Bot-
tles were then brought inside the glove box where 5
ml of fresh acetogen medium, without glucose, was
added to each bottle. Serum bottles were then re-
sealed with sterile butyl rubber stoppers and alumi-
num seals, pressurized to 200 kPa with a H2:CO2:N2
(1:24:75) gas mixture and incubated at 37°C on a ro-
tatory shaker for 7 days. At the end of this period,
Table 2. Anaerobic dilution solution (ADS) compositiona
a All components, except Cysteine.HCl, were added to distilled water and brought to a volume of
1,000 mL. These components were mixed thoroughly and the pH adjusted to 7.0 with 1 M NaOH
followed by gently heating and brought to a boil. Boiling was continued for 1 min., Cysteine.HCl was
added under 100% CO2, mixed thoroughly and autoclaved anaerobically for 12 min at 121°C and 15
psi. Leedle and Hespell, 1980.b Mineral 1 (g/liter): 6.00 K2HPO4c Mineral 2 (g/liter): 12.00 NaCl, 6.00 K2HPO4, 6.00(NH4)2SO4, 2.45 MgSO4.7H20, 1.60 CaCl2.2H2O
Component (amounts per liter)
Mineral 1b 75.0 mL
Mineral 2c 75.0 mL
Cysteine.HCl 0.5000 g
Resazurin solution 0.0010 g
136 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
headspace gas volume and gas composition in each
bottle was measured as described previously (Boc-
cazzi and Patterson, 2011).
Potential acetogenic isolates G1.5a, G1.5c,
G1.5d, G1.5e, G2.4a, G3.2a, and acetogenic bacte-
ria A.woodii and strain 3H were further screened for
acetate production. Bacterial cultures were grown
in single serum bottles (60 mL) containing 10 mL
acetogen medium, modified by the addition of 0.75
g/L instead of 0.5 g/L (w/v) of yeast extract, under
200 kPa of a H2:CO2 (80:20) or a N2:CO2 (80:20) gas
mixture. Serum bottles were incubated at 37°C on a
rotatory shaker for 3 days. Growth was measured by
optical density (660 nm) and acetate concentrations
were measured enzymatically (Boeringer Mannheim,
Indianapolis, IN). Growth and acetate production
values of the N2:CO2 incubations were subtracted
from the values of the H2:CO2 incubations of the
same strain.
Growth curves of newly isolated acetogenic bac-
teria G1.4b, G2.4a and G3.2a were obtained by
growing the bacteria in duplicate serum bottles (275
mL, Bellco Inc., Vineland, NJ) modified by the addi-
tion of a side arm for optical density measurements.
Bacteria were grown in 20 mL acetogen medium,
modified by the addition of 0.75 g/L (w/v) of yeast
extract, plus or minus 2.5 mM of glucose under 200
kPa of a H2:CO2 (80:20) gas mixture. Serum bottles
were incubated vertically in a water bath (Precision
Scientific Company, Model 50, Chicago, IL) shaking
at 80 rpm at 37°C. Growth was measured by optical
density (660 nm) at 0, 1, 2, 3, 4, 5.5, 7.5, 9.0, 11, 20, 22,
24, 27, 32, and 48 h after inoculation.
Analytical Methods
Bacterial growth: optical density was measured
Figure 3. Comparison of buffering capacity between citrate (20 mM) and MES (40 mM) in ruminal contents in presence or absence (C) of the acetogen strain A10. Methanogens were inhibited by 5 mM BES.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 137
Figure 4. The effect of citrate (20 mM) and MES (40 mM) on initial H2 concentration (0 h) and on H2 uptake by ruminal contents in the presence or absence of the acetogen strain A10. Methano-gens were inhibited by 5 mM BES.
at 660nm using a Spectronic 70 spectrophotometer
(Bausch and Lomb, Rochster, NY). VFA analysis:
volatile fatty acid concentrations were measured by
gas-liquid chromatography (GLC; Holdeman et al.,
1977). At sampling time, samples were acidified
by adding 20% (v/v) of meta-phosphoric acid (25%
w/v) and then frozen. Samples to be analyzed were
thawed, centrifuged at 15,000 rpm for 5 min, and
the supernatant was analyzed. A 3 foot long column,
packed with SP1220 (Supelco, Bellefonte, PA, USA),
was used in a Hewlett Packard 5890 GLC equipped
with a flame ionization detector. Oven temperature
was 130°C (isothermal), injector temperature was
170°C, detector temperature was 180°C, the carrier
gas was N2 flowing at a rate of 30 mL per minute.
Gas Analysis
For the measurements of H2 and methane concen-
trations, gas samples were analyzed using a Varian
3700 Gas Chromatograph equipped with a thermal
conductivity detector, and a 6 feet silica gel column
(Supelco). Temperatures of the injector, oven, and
detector were room temperature, 130°C, and 120°C
respectively. The carrier gas was N2 flowing at a rate
of 30 mL per minute. The volume of gas injected
for standards and samples was 0.5 mL. The GC was
standardized with 5 different concentrations of H2
(400 to 25,000 ppm) and CH4 (900 to 32,000 ppm). A
regression line was obtained from the output values
of the standard concentrations. The regression line
was then utilized to calculate H2 and CH4 concentra-
tions in experimental samples. All gas mixtures were
purchased from Airco (Indianapolis, IN).
138 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
ReSulTS
Isolation of Acetogenic Bacteria
A batch culture experiment with ruminal contents
was performed to determine which buffer system
to use for the isolation of acetogenic bacteria from
ruminal contents at pH 6.0. After 72 h of incuba-
tion, both control and strain A10 treatments that
were buffered with citrate had higher pH values than
the same treatments buffered with MES (Figure 3).
Hydrogen concentrations were also lower for the ci-
trate buffered treatments than for the MES buffered
treatments (Figure 4).
The isolation of acetogenic bacteria from bovine
ruminal contents at pH 6.0 was performed with a
continuous culture system. The experiment resulted
in the isolation of 40 potential acetogenic bacteria.
Eight new isolates and 3 known acetogens grew at
least 3 times to a higher yield under a H2:CO2 than a
N2:CO2 atmosphere, indicating capability of chemo-
lithoautotrophic growth (Table 3). Strains G1.4b,
G1.5a, G1.5c, G1.5d, and G1.5e were isolated from
growth vessel (GV) 1 that received acetogen medi-
um plus BES with a dilution rate (D)= 0.28 h-1. Strain
G2.4a was isolated from GV 2 that received acetogen
medium plus BES with a D= 0.06 h-1. Strain G3.2a
was isolated from GV 3 that received acetogen me-
dium plus BES and monensin with a D= 0.28 h-1.
Table 3. Growtha and H2 utilizationb of potential and known acetogenic bacteria grown in aceto-gen medium under 200 kPa of a H2:CO2 (80:20) or N2:CO2 (80:20) gas mixture
a Growth was measured after 72 h of incubation at 37°C by optical density (OD 660 nm): Ranges of OD values
are given to indicate relative amounts of growth. b H2 utilization was determined in a different experiment where bacteria were incubated in acetogen medium
under 200 Kpa of a H2:CO2:N2 (1:24:74) gas mixturec Uninoculated acetogen mediumd Not determined
Strain H2:CO2 N2:CO2 ppm H 2 SD
Controlc >0.1 – <0.2 <0.1 8085.5 85.6
G1.4b >0.4 <0.1 1062.0 120.2
G1.5a >0.4 <0.1 800.5 19.1
G1.5c >0.4 >0.1 – <0.2 NDd ND
G1.5d >0.4 >0.1 – <0.2 ND ND
G1.5e >0.4 >0.1 – <0.2 635.0 186.7
G2.4a >0.4 <0.1 908.5 44.5
G3.2a >0.4 <0.1 960.5 184.6
G4.4a >0.2 - < 0.4 >0.1 – <0.2 ND ND
Acetobacterium woodii >0.4 >0.1 – <0.2 1007.0 17.0
Sporomusa termitida >0.4 >0.2 - < 0.4 643.5 6.4
strain 3H >0.4 >0.1 – <0.2 951.5 94.0
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 139
Strain G4.4a was isolated from GV 4 that received
acetogen medium plus BES and monensin with a D=
0.06 h-1. In a subsequent batch culture study, with
8 of the new acetogen isolates, strain G1.5e had
the lowest H2 threshold at 635 ppm, while the other
isolates had H2 thresholds ranging from 800 to 1062
ppm (Table 3).
Initial screening of newly isolated ace-togenic bacteria
Growth and acetate production of 6 new and
two known acetogenic bacteria was determined in
a batch culture experiment. Isolate G3.2a had the
highest yield of acetate per OD unit (Yacetate= mM ac-
etate per OD= 1) of 206.2 mM. Strains G1.5e, G1.5a,
G1.5d, G2.4a and G1.5c had a Yacetate of 137.4, 114.9,
95.1, 88.2 and 67.6 mM, respectively (Figure 5). The
two known acetogens A. woodii and strain 3H had a
Yacetate of 77.7 and 146.6 mM, respectively (Figure 5).
The acetogenic strains G1.4b, G2.4a, and G3.2a
were considered to be the most promising of the
new acetogen isolates. Strains G1.4b, G2.4a, and
G3.2a had growth rates (μ) of 0.094, 0.029 and 0.025
h-1, respectively, growing on H2:CO2 alone and of
0.86, 0.37 and 0.35 h-1, respectively, growing on glu-
cose plus H2:CO2 (Figures 6 through 8).
Figure 5. Growth (OD 660 nm) and acetate production of six new potential acetogen isolates and of the acetogens Acetobacterium woodii and 3H. Bacteria were grown in single serum bottles for 72 h in acetogen medium under 200 kPa of a H2:CO2:N2 (1:24:75) gas mixture. Values for the same bacteria growing in acetogen medium under 200 kPa of a N2:CO2 gas mixture were sub-tracted from the data.
140 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Figure 6. Growth of acetogen isolate G1.4b in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (circles) or minus (squares) 2.5 mM glucose.
Figure 7. Growth of acetogen isolate G2.4a in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (triangles) or minus (squares) 2.5 mM glucose.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 141
dISCuSSIon
A preliminary batch culture experiment demon-
strated that citrate plus phosphate was a better buf-
fer system than MES for the isolation of acetogenic
bacteria from ruminal contents. However, when the
citrate plus phosphate was used as buffer in continu-
ous culture, citrate utilizing bacteria were selected
(data not reported). Therefore, MES was utilized as
the buffer system for isolation of acetogenic bacteria
in continuous culture.
In many beef operations, monensin is used to ma-
nipulate rumen fermentations; therefore, monensin
was included in the medium used to isolate aceto-
gens. A preliminary study was performed to deter-
mine the minimum inhibitory concentration (MIC)
of monensin on acetogenic bacteria that had been
previously isolated by our lab. Both gram positive
acetogens, strain A10 and strain 3H, were insens-
tive to the highest concentration of monensin tested
(60 μM). This concentration of monensin is higher
than the concentration (3 to 5 μM) normally found in
the rumen (Russell and Strobel, 1989). Our results,
thus indicated that monensin may not inhibit some
acetogens.
The second experiment on the isolation of aceto-
genic bacteria resulted in the isolation of ten poten-
tial acetogenic strains from each of the four growth
vessels utilized. Post-isolation studies were conduct-
ed to determine the ability of these strains to grow
on a H2:CO2 gas mixture and to produce acetate. A
total of eight isolates were identified as acetogenic
bacteria. After further studies comparing growth
and acetate production on H2:CO2 versus N2:CO2 gas
mixtures, three of the eight isolates were selected for
further study because of their greater H2 utilization
and acetate production. The three isolates chosen
were strains G1.4b, from growth vessel one; G2.4a,
from growth vessel 2; G3.2a, from growth vessel 3.
Of these three isolates, G3.2a had higher growth and
produced more acetate than the other two.
Figure 8. Growth of acetogen isolate G3.2a in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (triangles) or minus (circles) 2.5 mM glucose.
142 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
BES was used to inhibit methanogenesis, since
the results of batch culture experiments indicated
that BES was a more effective inhibitor than 9,10-an-
thraquinone, or lumazine. Also, due to the results
obtained in batch culture experiments, the inoculum
of acetogenic bacteria at each turnover was set to
give a final concentration of 5x108 CFU/mL in the
first experiment, and 3x108 CFU/mL in the second
experiment. While in the first experiment, aceto-
gens were grown on glucose plus H2:CO2, in the
second experiment the acetogens were grown only
on H2:CO2. This change in growth conditions was
made so that acetogenic cultures were growing to-
tally chemolithoautotrophicly. The dilution rate was
set to 0.084 h-1 in the first experiment and 0.06 h-1 in
the second. The change in the second experiment
was made, because in the first experiment the con-
trol culture did not produce CH4 as expected. This
could have been an indication that methanogens
were not able to reproduce fast enough, and were
washed out of the system when no acetogen was
added. The amount of CH4 produced by the other
four growth vessels that received BES was minimal or
zero. In these treatments, the H2 concentration was
lower in the control culture that did not receive ace-
togens than in the cultures that received acetogens.
This was also unexpected, since in batch culture ex-
periments cultures that received the acetogen strain
A10 had lower H2 concentrations than did the con-
trol cultures. The treatment that received a mixture
of the acetogens strains A10 and G3.2a had a higher
H2 concentration than the control and A10 treat-
ments, but not significantly different. The growth
vessel that received the acetogen strain G3.2a had
the highest H2 concentration. The pH averages over
seven turnovers for each growth vessel ranged from
6.26 to 6.61, with no significant difference among the
six growth vessels. Acetate production was not sig-
nificantly different among the six treatments. How-
ever, the control which received BES and no aceto-
gen had the lowest concentration of acetate, and
propionate and highest concentration of butyrate.
In conclusion, a total of 8 isolates were identified
as acetogenic bacteria. Among these strain G3.2a,
isolated with a dilution rate of 0.28 h-1 in the presence
of monensin had the highest acetate production per
unit of OD growing with H2/CO2. In batch culture
studies acetogen bacteria G1.5a, G2.4a, G3.2a, A10
and 3H could effectively reduce H2 concentrations in
ruminal contents in the presence of BES as the meth-
anogenesis inhibitor.
ACknowledgeMenTS
We would like to thank the College of Agriculture
and Department of Animal Sciences for financial
support for this project.
RefeRenCeS
Annison, E.F., and D.G. Armstrong. 1970. Volatile
fatty acids metabolism and energy supply. In: A. T.
Phillipson (eds). Physiology of digestion and me-
tabolism in the ruminant. Oriel Press, Newcastle,
England, pp 422-437.
Balch, W.E. and R.S. Wolfe. 1976. A new approach to
the cultivation of methanogenic bacteria: 2-mer-
captoethanesulfonic acid (HS-CoM)-dependent
growth of Methanobacterium ruminantium in a
pressurized atmosphere. Appl. Environ. Microbiol.
32: 781-791.
Berger, L.L., S.C. Ricke and G.C. Fahey, Jr. 1981.
Comparison of two forms and two levels of lasalo-
cid with monensin of feedlot cattle performance.
J. Anim. Sci. 53:1440-1445.
Blaxter, K.L. and J.L. Clapperton. 1965. Prediction
of the amount of methane produced by ruminants.
Br. J. Nutr. 19: 511-522.
Boccazzi, P. and J.A. Patterson. 2011. Using hydro-
gen limited anaerobic continuous culture to iso-
late low hydrogen threshold ruminal acetogenic
bacteria. Agric. Food Anal Bacteriol. 1: 33-44.
Branine, M.E. and D.E. Johnso. 1990. Level of intake
effects on ruminant methane loss across a wide
range of diets. J. Anim. Sci. 68 (Suppl.1):509.
Breznak, J.A., J.M. Switzer, and H.-J. Seitz. 1988.
Sporomusa termitida sp.nov., an H2/CO2-utilizing
acetogen isolated from termites. Arch. Microbiol.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 143
150:282-288.
Breznak, J.A. and M.D. Kane. 1990. Microbial H2/CO2
acetogenesis in animal guts: nature and nutritional
significance. FEMS Microbiol. Rev. 87:309-314.
Breznak, J.A. and J.S. Blum. 1991. Mixotrophy in the
termite gut acetogen, Sporomusa termitida. Arch.
Microbiol. 156:105-110.
Bryant, M.P. 1972. Commentary on the Hungate
technique for culture of anaerobic bacteria. Amer.
J. Clin. Nutr. 25: 1324-1328.
Chalupa, W. 1980. Chemical control of rumen mi-
crobial metabolism. In: Y. Ruckebusch, P. Thivend.
(eds). Digestive Physiology and Metabolism in Ru-
minants. MTP Press, Lancaster, England.Green-
ing, R.C., and J.A.Z. Leedle. 1989. Enrichment and
isolation of Acetitomaculum ruminis, gen. nov., sp.
nov.: acetogenic bacteria from the bovine rumen.
Arch. Microbiol. 151:399-406.
Hungate, R.E. 1966. The rumen and its microbes.
Academic Press, New York, NY.
Jiang, W.H., J.A. Patterson, and L.R. Steenson. 1995.
Isolation and characterization of a temperate bac-
teriophage from a ruminal acetogen. Current Mi-
crobiology. 32:336-339.
Jiang, W., R.S., Pinder, and J.A. Patterson. 2012. In-
fluence on growth conditions and sugar substrate
on sugar phosphorylation activity in acetogenic
bacteria. Agric. Food Anal. Bacteriol. 2:94-102.
Lajoie, S.F., S. Bank, T.L. Miller, and M.J. Wolin.
1988. Acetate production from hydrogen and [14]
carbon dioxide by the microflora of human feces.
Appl. Environ. Microbiol. 54: 2723-2737.
Leedle, J.A.Z. and R.B. Hespell. 1980. Differential
carbohydrate media and anaerobic replica plating
techniques in delineating carbohydrate-utilizing
subgroups in rumen bacterial populations. Appl.
Environ. Microbiol. 39:709-719.
LeVan, T.D., J.A. Robinson, J. Ralph, R.C. Greening,
W.J. Smolenski, J.A.Z. Leedle, and D.M. Schaefer.
1998. Assessment of reductive acetogenesis with
indigenous ruminal bacterium populations and
Acetitomaculum ruminis. Appl. Microbiol. Biotech-
nol. 64: 3429-3436.
McInerney, M.J., J.R. Sieber, and R.P. Gunsalus. 2011.
Microbial syntrophy: Ecosytem-level biochemical
cooperation. Microbe 6:479-485.
Newbold, C.J., R.J. Wallace, and N.D. Walker-Bax.
2013. Potentiation by metal ions of the efficacy of
the ionophores, monensin and tetronasin, towards
four species of ruminal bacteria. FEMS Microbiol
Lett 338:161-167.
Pinder, R.S. and J.A. Patterson. 2011. Isolation and
initial characterization of plasmids in an acetogen-
ic ruminal isolate. Agric. Food Anal. Bacteriol. 1:
186-192.
Pinder, R.S. and J.A. Patterson. 2012. Glucose and
hydrogen utilization by an acetogenic bacterium
isolated from ruminal contents. Agric. Food Anal.
Bacteriol. 2:253-274.
Pinder, R.S. and J.A. Patterson. 2013. Growth of
acetogenic bacteria in response to varying pH or
carbohydrate concentration. Agric. Food Anal.
Bacteriol. 3:6-16.
Pinder, R.S., J.A. Patterson, C.A. O’Bryan, P.G.
Crandall, and S.C. Ricke. 2012. Dietary fiber con-
tent influences soluble carbohydrate levels in
ruminal fluids. J. Environ. Health Sci. Part B 47:710-
717.
Raun, A.P., C.O. Cooley,, E.L. Potter, R.P. Rathmacher,
and L.F. Richardson. 1976. Effect of monensin on
feed efficiency of feedlot cattle. J. Anim. Sci. 43:
670-677.
Richardson, L.F., A.P. Raun, E.L. Potter, C.O. Cooley,
and R.P. Rathmacher. 1976. Effect of monensin on
rumen fermentation in vitro and in vivo. J. Anim.
Sci. 43:657-664.
Ricke, S.C. 2003. Perspectives on the use of organic
acids and short chain fatty acids as antimicrobials.
Poultry Sci. 82:632-639.
Ricke, S.C., S.A.Martin, and D.J. Nisbet, D.J. 1996.
Ecology, metabolism, and genetics of ruminal
selenomonads. Crit Rev Microbiol. 22: 7-56.
Ricke, S.C., L.L. Berger, P.J. van der Aar and G.C. Fa-
hey, Jr. 1984. Effects of lasalocid and monensin on
nutrient digestion, metabolism and rumen charac-
teristics of sheep. J. Anim. Sci. 58:194-202.
Robinson, J.A., J.M. Strayer, and J.M. Tiedje. 1981.
Method for measuring dissolved hydrogen in an-
aerobic ecosystems: application to the rumen.
Appl. Environ. Microbiol. 41:545-548.
144 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Russell, J. B. 1992. Another explanation for the tox-
icity of fermentation acids at low pH: anion accu-
mulation versus uncoupling. J. Appl. Microbiol.
73:363-370.
Russell, J.B. and H.J. Strobel. 1989. Effect on iono-
phores on ruminal fermentation. Appl. Environ.
Microbiol. 55:1-6.
Sharak-Genthner, B.R., C.L. Davies, and M.P. Bry-
ant. 1981. Features of rumen and sewage sludge
strains of Eubacterium limosum, a methanol and
H2-CO2-utilizing species. Appl. Environ. Microbiol.
42:12-19.
Thauer, R.K., K. Jungermann, and K. Decker. 1977.
Energy conservation in chemotrophic bacteria.
Bacteriol. Rev. 41:100-180.
Weimer, P.J., J.B. Russell, and R.E. Muck. 2009. Les-
sons from the cow: What the ruminant animal can
teach us about consolidated bioprocessing of cel-
lulosic biomass. Bioresour. Technol. 100:5323-5331.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 145
www.afabjournal.comCopyright © 2013
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Linoleic acid isomerase (LAI) is responsible for converting linoleic acid conjugated linoleic acids (LAs),
which are believed to lower cancer risk and enhance immunity. In this study, the Bifidobacterium LAI gene
was cloned into Escherichia coli BL21 (DE3) using pET24a(+) as the expression vector while Propionibac-
terium acnes LAI gene fused with pSSBm97 derivatives was expressed in Bacillus species. The protein
expressed by Bifidobacterium LAI was found in E. coli, but no activity was detectable. By changing cys-
teine residues to alanine, P. acnes LAI activity was present in B. megaterium YYBm1 but activity was not
improved. Prepropeptide B. subtilis amyE fused with P. acnes LAI at N-terminus resulted in unstable pro-
teins. By transferring plasmids carrying prepropeptide Staphylococcus hyicus lipase and prepropeptide B.
subtilis amyE fused with P. acnes LAI into B. licheniformis NRRLB-14212, LAI was not found due to possible
proteolytic degradation.
Keywords: Bacillus, Bifidobacterium, heterologous expression, linoleic acid isomerase,
conjugated linoleic acid
InTRoduCTIon
Conjugated linoleic acids (CLA) are a family of iso-
mers of linoleic acid (LA) found mainly in the meat
and dairy products derived from ruminants (Banni,
2002). Therefore, CLA is found in foods such as
beef and lamb, as well as dairy foods derived from
these ruminant sources (Chin et al., 1992; Griinari et
Correspondence: Suwat Saengkerdsub, [email protected]
al., 2000; Ma et al., 1999). As the name implies, the
double bonds of CLAs are conjugated, with only one
single bond between them. The three-dimensional
stereo-isomeric configuration of CLA may be in
combinations of cis and/or trans configurations. The
predominant geometric isomer in foods is the cis-
9, trans-11-CLA isomer, also known as rumenic acid
(Fritsche et al., 1999; Kramer et al., 1998, Ma et al.,
1999), followed by trans-7,cis-9-CLA, cis-11,trans-13-
CLA, cis-8, trans-10-CLA, and trans-10, cis-12-CLA
(Fritsche et al., 1999).
Linoleic Acid Isomerase Expression in Escherichia coli BL21 (DE3) and Bacillus spp
S. Saengkerdsub
1 Center for Poultry Excellence, University of Arkansas, Fayetteville, AR 72701
Agric. Food Anal. Bacteriol. 3: 145-158, 2013
146 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Numerous health benefits have been attributed to
CLAs. Several studies have demonstrated that CLA
changes body composition, especially by reducing
the accumulation of adipose tissue in mice, rats,
pigs, and humans, (Dugan et al., 1999, Park et al.,
1997, Sisk et al 2001; Smedman and Vessby, 2001).
The role of CLA as an aid in the management of type
2 diabetes in humans was examined by Belury (2002),
who found that those receiving a CLA supplement
(6.0 g CLA/day) had significantly decreased fasting
blood glucose, plasma leptin, body mass index, and
weight (Belury, 2002). Dietary CLA has also been
shown to inhibit numerous cancer models in experi-
mental animals, particularly skin tumor initiation and
neoplasias in the forestomach (Ha et al., 1987, 1990),
as well as mammary and colon tumorigenesis (Belury
et al., 1996; Ip et al., 1991; Liew et al., 1995). There
is also evidence that CLA reduces atherosclerotic
plaque formation in experimental animals, including
rabbits (Lee et al., 1994) and hamsters (Nicolosi et
al., 1996).
However, concerns have emerged that the use of
CLA supplements by the morbidly obese may tend
to cause or to aggravate insulin resistance, which may
increase their risk of developing diabetes (Risérus et
al., 2002). CLA is currently marketed as a dietary sup-
plement, and these commercially available supple-
ments contain equal mixtures of two CLA isomers:
the cis-9, trans-11 isomer as well as the trans-10,
cis-12 isomer. It is the trans-10, cis-12 isomer that is
linked to this and other adverse side effects (Poirier
et al., 2006). The CLA dietary supplements are pro-
duced by alkaline isomerization of linoleic acid (LA)
or vegetable oils containing triglyceride esters of LA
(Peng et al., 2007); however, chemical synthesis pro-
duces a mixture of CLA (Reaney et al., 1999; Sehat et
al., 1998) and the processes required to separate the
respective single isomers are expensive (Berdeaux
et al., 1998; Chen et al., 1999; Hass et al., 1999).
In contrast to chemical processes, biological pro-
cesses originating from microorganisms can provide
production of a single isomer of CLA (Deng et al.,
2007). The LA C12 isomerase has been detected in
a variety of bacteria (Coakley et al., 2003; Peng et
al., 2007; Rosson et al., 2001; Verhulst et al., 1985).
Biotransformation of LA using microbial cells and
enzyme extracts has been explored for the produc-
tion of cis-9, trans-11 CLA (Ando et al., 2004; Rainio
et al., 2001). Propionibacterium acnes was reported
to contain an LA C9 isomerase for converting LA to
trans-10, cis-12 CLA (Deng et al., 2007). There is an
interest in developing commercial processes for the
production of single isomers of CLA by biotrans-
formation of LA using microbial cells and enzymes
(Ando et al., 2004; Kim et al., 2000; Rainio et al.,
2001). However, the evaluation of these strains sug-
gested that growth and linoleic acid isomerase (LAI)
production levels by these anaerobes are insufficient
to support economic commercial production of sin-
gle CLA isomers (Peng et al., 2007). A better alterna-
tive would be to clone the LAI gene and generate
new production strains using recombinant technol-
ogy. The aim of this study was to clone the linoleate
isomerase gene from Bifidobacterium species and
Propionibacterium acnes into E. coli BL21 (DE3) and
Bacillus species.
MATeRIAlS And MeThodS
Bacterial strains
The bacterial strains used in this study are de-
scribed in Table 1. All Bifidobacterium strains were
grown in anaerobic jars (BD Diagnostics, Franklin
Lake, NJ) with anaerobic generator (GasPak en-
velope, BD Diagnostics, Franklin Lake, NJ) in de
Man Rogosa Sharp (MRS) broth (EMD Chemicals,
Gibbstown, NJ) supplemented with 0.05% (w/v) L-
cysteine (98% pure; Sigma, St. Louis, MO) and incu-
bated at 37°C overnight.
DNA preparation
Genomic DNA was prepared from Bifidobacte-
rium strains by using a QIAamp DNA Stool Mini Kit.
Oligonucleotide primers were synthesized by Inte-
grated DNA Technologies (Coralville, IA).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 147
Table 1. Bacterial strains used in this study
Bacterial strain Description Source
E. coli BL21 (DE3)
This strain lacks the lon and opmT proteases and contains a copy of RNA the T7 RNA polymerase gene under the control of the lacUV5 promoter. These modifications en-able stable expression of proteins using T7 promoter driven constructs
Novagen, Darmstadt, Germany
Bifidobacteria
B. longum ATCC15700
Wild type Center for Food Safety, University of Arkansas
B. breve ATCC15700 Wild type ATCC, Manassas, VA
B. adolescentis ATCC15703
Wild type ATCC, Manassas, VA
B. infantis ATCC25962
Wild type ATCC, Manassas, VA
Bacillus spp
B. subtilis Wild typeCenter for Food Safety, University of Arkansas
B. licheniformis NRRLB-14212
Wild type Center for Food Safety, University of Arkansas
B. megaterium YYBm1
This strain is deficient in the major extracel-lular protease NprM and xylose metabolism XylA.
Stammnen et al. (2010)
148 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Cloning of LA gene into pET24a(+)
The linoleic acid isomerase (LAI) gene from B.
breve (accession number AX647943) and two fin-
ished genome sequences, B. longum NC004307
(accession number AE014295) and B. adolescentis
ATCC15703 (accession number AP009256), were
aligned by using T-coffee (Notredame et al., 2000).
Primers (Table 2) were designed according to the po-
tential linoleic acid (LA) sequences. The PCR condi-
tions (30 cycles) were: initial denaturation 95°C, 120
sec; denaturation, 95°C, 30 sec, annealing, 45°C, 30
sec, extension 72°C, 120 sec, final extension, 72°C, 7
min. PCR conditions were identical for all primer sets,
except the annealing temperature (40°C) for primers
Bifido1F and Bifido1RHis. The 1990-bp PCR prod-
ucts were confirmed by agarose gel electrophore-
sis. PCR products were digested with XhoI and NdeI
and were ligated to vector pET24a(+). Recombinant
plasmids pET2 to pETH5 (Table 3) were transformed
into E. coli BL21 (DE3) by electroporation. Individual
colonies from LB agar plates containing 50 μg/mL of
kanamycin were selected.
Table 2. Oligonucleotides used in this study
Primer name Sequence Application
Bifido1F5’-CAG ACA TAT GTA CTA CAG CGG CAA YTA T-3’
Forward primer containing an NdeI site for cloning LA from B. breve ATCC 15700
Bifido1R
5’-CTA TCT CGA GTC AGA TYA CRY GGT ATY CGC GTA-3’
Reverse primer containing an XhoI site for cloning LA from B. breve ATCC 15700
Bifido R1His5’- CTA TCT CGA GGA TYA CRY GGT ATY CGC GTA-3’
Reverse primer containing an XhoI site for cloning LA from B. breve ATCC 15700 with a C-terminal His6-tag
longumF15’-CAGA CAT ATG TAC TAC AGC AGC GGC AAT-3’
Forward primer containing an NdeI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962
longumR15’-CTAT CTC GAG TCA GAT TAC GCG GTA TTC GCG-3’
Reverse primer containing an XhoI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962
longumR1His5’-CTAT CTC GAG GAT TAC GCG GTA TTC GCG-3’
Reverse primer containing an XhoI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962 with a C-terminal His6-tag
adolesF15’-CAGA CAT ATG TAC TAT TCC AAC GGC AAT-3’
Forward primer containing an NdeI site for cloning LA from B. adolescentis ATCC 15703
adolesR15’-CTAT CTC GAG TCA GAT CAC GCC GTA TTC CTT-3’
Reverse primer containing an XhoI site for cloning LA from B. adolescentis ATCC 15703
adolesR1His5’-CTAT CTC GAG GAT CAC GCC GTA TTC CTT-3’
Reverse primer containing an XhoI site for cloning LA from B. adolescentis ATCC 15703 with a C-terminal His6-tag
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 149
Table 3. Plasmids used in this study
plasmid Description Source
pCR® 4-TOPO® Cloning vector for PCR products, Ampr, Kanr Invitrogen
pET24a(+) Expression vector with an N-terminal His6-tag, Kanr Novagen
pET2 pET24a(+) with NdeI-XhoI LA gene from B.longum ATCC 15707 This work
pETH2pET24a(+) with NdeI-XhoI LA gene with His6-tag from B.longum ATCC 15707
This work
pET3 pET24a(+) with NdeI-XhoI LA gene from B. breve ATCC 15700 This work
pETH3pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. breve ATCC 15700
This work
pET4pET24a(+) with NdeI-XhoI LA gene from B. adolescentis ATCC 15703
This work
pETH4pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. ado-lescentis ATCC 15703
This work
pET5 pET24a(+) with NdeI-XhoI LA gene from B. infantis ATCC 25962 This work
pETH5pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. infantis ATCC 25962
This work
pLPPLP. acnes linoleate isomerase inserted into SpeI and EagI sites of pPPlip; PxylA-(-35+ rbs+)-prepeptidelipA-propeptidelipA- LAI P. acnes
This work
pA1 pLPPL derivative, C46A This work
pA2 pLPPL derivative, C154A This work
pA3 pLPPL derivative, C286A This work
pA4 pLPPL derivative, C344A This work
pA5 pLPPL derivative, C412A This work
pA6 pLPPL derivative, C46A, C154A, C286A, C344A, C412A This work
pE0Prepropeptide B. subtilis amyE inserted into BsrGI and SpeI sites of pLPPL; PxylA-(-35+ rbs+)-prepeptideamyE-propeptideamyE-LAI P. acnes
This work
pE1 pE0 derivative, C46A This work
pE2 p E0 derivative, C154A This work
pE3 p E0 derivative, C286A This work
pE4 pE0 derivative, C344A This work
pE5 pE0 derivative, C412A This work
pE6 pE0 derivative, C46A, C154A, C286A, C344A, C412A This work
150 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
For Propionibacterium acnes LAI, the new DNA
sequence was designed by JCat software (http://
www.jcat.de/) (Grote et al., 2005) and was synthe-
sized by Integrated DNA Technologies, Coralville,
IA. The P. acnes LAI was used as the template and
primers LF to A5F were used to change from 5 cys-
teine positions to alanine (Table 4). The PCR prod-
ucts were flanked by SpeI-EagI restriction sites, were
digested with these enzymes, and subsequently in-
serted into pLPPL after SpeI-EagI digestion, creating
the plasmids pA1, pA2, pA3, pA4, pA5, and pA6.
For prepropeptide B. subtilis amyE fused with P.
acnes LAI, PCR product was amplified by using prim-
ers amyEF and amyER (amyEF: 5’tat atg taca ATG
TTT GCA AAA CGA TTC AAA ACC TC -3’; AmyER:
5’ tat aag atc tac tagt CTC ATT CGA TTT GTT CGC
CGT-3’). The PCR products were flanked by BsrGI-
SpeI restriction sites, were digested with these en-
zymes, and subsequently inserted into pLPPL, pA1,
pA2, pA3, pA4, pA5, pA6 after BsrGI-SpeI digestion,
creating the plasmids pE0, pE1, pE2, pE3, pE4, pE5,
pE6.
Protoplast B. megaterium YYBm1 cells were trans-
formed with the appropriate expression plasmids
using a polyethylene glycol-mediated procedure
described by Christie et al. (2008) while plasmids
were transferred into B. licheniformis NRRLB-14212
by electroporation as described in Xue et al. (1999).
Enzymatic activity measurements
For E. coli BL21 (DE3), 50 mL of Luria-Bertani (LB)
broth containing 50 μg/mL kanamycin (Sigma, St.
Louis, MO) was inoculated (1:100 v/v) with a freshly
grown overnight culture of strains hosting an isom-
erase expression plasmid. After growing at 37°C for
3 hr, cultures were induced with 1 mM isopropylthio-
β-D-galactoside (IPTG) for 2 hr at 26°C.
Cultures were harvested by centrifugation at
10,000 x g for 10 min at 4°C. Cells were suspended
in BugBuster (Novagen, Darmstadt, Germany). The
subcellular localization of heterologous protein pro-
duction was separated following the protocol de-
scribed in pET System Manual 11th edition (Novagen,
Darmstadt, Germany) and the protein samples were
analyzed by SDS-PAGE.
All Bacillus plasmid strains were grown in baffled
shake flasks at 30°C in LB medium at 200 rpm. Re-
combinant expression of genes under transcrip-
tional control of the xylose-inducible promoter was
induced by the addition of 0.5% (w/v) xylose when
OD578 reached 0.4. The secreted proteins were sepa-
rated from cells by centrifugation at 10,000 x g at 4°C
for 10 min. After separation by SDS-PAGE, proteins
were transferred to a nitrocellulose membrane and
detected with 6X his tag antibody (Abcam, Cam-
bridge, MA) and horseradish peroxidase–anti-rabbit
immunoglobulin G conjugates.
Determination of linoleate isomerase activity
Determination of linoleate isomerase activity was
carried out as described by Peng et al. (2007). Briefly,
appropriate dilutions were made in 0.1M Tris, pH 7.5
(total volume of 2 mL) in glass tubes (15×100 mm)
with screw caps. Linoleic acid was added to 140μM
and tubes were shaken for 1 h at 200 rpm at room
temperature. Changes in LA and CLA concentra-
tions were determined by GC analysis. reactions
were extracted with 1ml of hexane and analyzed on
a HP 8452A diode array spectrophotometer. The ab-
sorbance spectrum was between 200 and 400 nm.
Preparation of fatty acid methyl esters
The preparation of fatty acid methyl esters (FAME)
was described in Lewis et al. (2000). Briefly Cells were
weighed into clean, 10 mL screw capped tubes and
a fresh solution of transesterification reaction mix
(methanol:hydrochloric acid:chloroform (10:1:1 v/v/v,
3 mL)) was added. Cells were suspended by vortex
mixing and immediately placed at 90°C for 60 min
for transesterification. Tubes were removed from the
heat and cooled; water (1 mL) was added and the
FAME extracted with a hexane/chloroform mix (4:1,
v/v). Samples were diluted with chloroform contain-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 151
ing a known concentration of tridecanoic acid as an
internal standard. Chromatography was performed
with a Shimadzu GC2010 chromatography system
(Shimadzu Scientific Instruments, Columbia, MA,
USA) equipped with a flame ionization detector. He-
lium was used as carrier and make-up gas. The in-
jection volume was 1 μL which was used with a split
ratio of 1:50. The injection port and detector tem-
peratures were 240 and 250°C, respectively. The col-
umn temperature program was as follows: tempera-
ture was held at 30°C for 2 min, increased to 180°C
at 20°C/min, held at 180°C for 2 min, increased to
207°C at 4 °C/min, held at 207°C for 3 min, increased
to 220°C at 2°C/min, held at 220°C for 2 min, and
then increased to 240°C at 2°C/min before finally be-
ing held at 240°C for 2 min.
Table 4. Oligonucleotides used for LAI engineering in this study
Primer Sequence 5’ to 3’
LF tat aag atc t act agt ATGTCTATTTCTAAAGATTCTCG
LR tat aag atc t CGG CCG TTA GTG ATG GTG
A1R GAG AGT GAG CTT TAC CAC CTA CGT GAT CTG TAC G
A1F GGT GGT AAA GCT CAC TCT CCA AAC TAC CAC G
A2R CAG CTT CAG CAC CGT TTA AAG CTA AGA ATT CAT CGA A
A2F TTA AAC GGT GCT GAA GCT GCT CGT GAT TTA TG
A3R TTA CTA AAG CAG CAT CTA CCA TGT ATT GTT GGT
A3F GTA GAT GCT GCT TTA GTA AAA GAA TAC CCA ACA ATT TCT GG
A4R TTT GAC GAG CTT CTT CTT GTG TTT TAT CAG CGT AAT C
A4F AAG AAG AAG CTC GTC AAA TGG TAT TAG ATG ATA TGG AAA
A5R AGT AGT GAG CTA CTT CAT CGA AGT TAC CGA AAG AC
A5F ATG AAG TAG CTC ACT ACT CTA AAG ATT TAG TAA CAC GTT
152 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Matrix-Assisted Laser Desorption Ion-ization Time-of-Flight Mass Spectrometry (MALDI-TOF-MS)
After Sephadex LH-20 cleanup, the extract was
mixed with a 1 M solution of dihydroxybenzoic acid
(DHB) in 90% methanol in a 1:1 ratio, and 1 μL of
the mixture was spotted onto a ground stainless
steel MALDI target for MALDI analysis using the dry
droplet method. A Bruker Reflex III MALDI-TOF-MS
(Billerica, MA) equipped with a N2 laser (337 nm) was
used in the MALDI analysis, and all the data were
obtained in positive ion reflectron TOF mode.
ReSulTS And dISCuSSIon
LA expression in E. coli BL21 (DE3) as the host
In this study, E. coli BL21 (DE3) was chosen as the
host. Among expression systems, E. coli is consid-
ered to be the first choice since numerous vectors,
readily available engineered strains, and minimal
technical requirements are already in place. In ad-
dition, this system is rapid due to short doubling
times of approximately 20 minutes per generation
(Brondyk, 2009). In this system it was suggested
that the target protein would be synthesized to an
Figure 1. Total cell protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LA gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag
Figure 2. Soluble cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 153
Figure 4. Soluble (S) and insoluble (I) cytoplasmic protein fraction from E. coli clones contain-ing LAI gene originated from Bifidobacterium strains after adding IPTG 4 hours at 25°C incuba-tion. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.
Figure 3. Soluble cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.
equivalent of more than 50% of the total cell pro-
tein within a few hours after induction (pET system
manual 11th edition, 2006). By using SDS-PAGE, our
results showed that the expression of LAI in E. coli
was tightly controlled by IPTG (Figure 1). The sol-
uble cytoplasm proteins in E. coli carrying plasmids
were collected and detected by SDS-PAGE (Figure 2
and 3). The results demonstrated that these proteins
were unstable in the cytoplasm and some strains,
particularly strains H3 and H5, did not produce sol-
uble cytoplasm proteins. The soluble and insoluble
cytoplasm proteins were collected to identify the
localization of proteins (Figure 4). The results dem-
onstrated that the 6X His tag adversely affected the
solubility of LAI, particularly LAI originating from B.
longum ATCC15707 (clones 2 versus H2, Figure 4).
Since expressed proteins were sequestered in inclu-
sion bodies, the lower temperature incubation might
have enhanced enzymatic folding. At an incubation
temperature of 21.5°C, the results from SDS-PAGE
did not show improved folding of the enzyme (Figure
5). Deng et al. (2007) reported that the folding of P.
acnes LAI expressed in E. coli was interfered with by
the C-terminal 6X His tag. The activities of LAI from
these clones were undetectable due to possible im-
proper folding of the enzyme or very low enzyme ac-
tivities. Deng et al. (2007) reported that the activity
of P. acnes LAI expressed in E. coli BL21 (DE3) was
only 1 nmol/min/mL. The primary method for mini-
mizing inclusion body formation and maximizing the
154 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
formation of soluble, properly folded proteins in the
cytoplasm is lowering the incubation temperature to
15 to 30°C during the expression period because the
reduced temperature reduces the rate of transcrip-
tion, translation, refolding and thus increases proper
folding (Brondyk, 2009). In this study, the incubation
temperature was reduced to 21.5°C; however, this
method did not enhance enzymatic activity. In ad-
dition, protein accumulated in inclusion bodies as
observed in this study is one of the disadvantages of
protein expression in E. coli (Terpe, 2006).
LA expression in B. megaterium YYBm1 and B. licheniformis NRRLB-14212 as the host
Because of these known limitations of E. coli, oth-
er hosts, such as Bacillus spp, have gained interest
(Schmidt, 2004; Wong, 1995;). Bacillus megaterium
is known for its high protein secretion potential, and
strains have the advantage of highly stable, freely
replicating plasmids and the lack of alkaline proteas-
es (Vary, 1994). The plasmidless B. megaterium strain
MS941 was generated from the wild-type strain
DSM319 by directed gene deletion, then the xylA
gene for xylose metabolism was inactivated leading
to the strain YYBm1, which does not metabolize the
inducer of gene activation (Stammen et al., 2010). B.
licheniformis was chosen due to its ability to secrete
large quantities of extracellular enzymes (Schallmey
et al., 2004).
B. megaterium YYBm1 carrying pLPPL secreted
P. acnes LAI; however, no activity was detectable.
Based on P. acnes LAI amino acid sequence, there
are 5 cysteine residues (Figure 6). All five cysteine
residues were changed to alanine by using primers
LF to A5F (Table 4) with P. acnes LAI as the template
but no activity in B. megaterium YYBm1 carrying pA1
to pA6 was detectable. Liu and Escher (1999) report-
ed that the bioluminescence activity of the secreted
Renilla luciferase could be improved after selective
removal of sulfhydryl groups by substitution of cys-
teine residues. Since wild type Renilla luciferase pro-
tein contains an odd number of cysteine residues in
its amino acid sequence, they proposed that a free
cysteine residue and/or unfavorable disulfide bond
in secreted Renilla luciferase could affect its biolu-
minescence activity and alanine, an amino acid con-
sidered to be one of the most neutral, was used for
this purpose.
Based on matrix-assisted laser desorption ioniza-
tion–time of flight mass spectrometry (MALDI-TOF
MS), propeptide S. hyicus lipase was still attached to
Figure 5. Soluble (S) and insoluble (I) cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains after adding IPTG 4 hours at 21.5°C incubation. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene origi-nated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 155
Figure 6. P. acnes LAI amino acid sequence. The underlines show the positions of cysteine
M S I S K D S R I A I I G A G P A G L A A G M Y L E Q A G F H D Y T I L E R T D H V G G
K C H S P N Y H G R R Y E M G A I M G V P S Y D T I Q E I M D R T G D K V D G P K L R
R E F L H E D G E I Y V P E K D P V R G P Q V M A A V Q K L G Q L L A T K Y Q G Y D A
N G H Y N K V H E D L M L P F D E F L A L N G C E A A R D L W I N P F T A F G Y G H F
D N V P A A Y V L K Y L D F V T M M S F A K G D L W T W A D G T Q A M F E H L N A T
L E H P A E R N V D I T R I T R E D G K V H I H T T D W D R E S D V L V L T V P L E K F L
D Y S D A D D D E R E Y F S K I I H Q Q Y M V D A C L V K E Y P T I S G Y V P D N M R P
E R L G H V M V Y Y H R W A D D P H Q I I T T Y L L R N H P D Y A D K T Q E E C R Q M
V L D D M E T F G H P V E K I I E E Q T W Y Y F P H V S S E D Y K A G W Y E K V E G M
Q G R R N T F Y A G E I M S F G N F D E V C H Y S K D L V T R F F V
the P. acnes LAI and might impede enzymatic activ-
ity. In the next step, propeptide B. subtilis amplase
(amyE) was chosen since this propeptide enhanced
the secreted human interferon-α in B. subtilis as the
host. In addition, the propeptide B. subtilis amyE is
only 8 amino acids in length, as compared to 207
amino acids in length for propeptide S. hyicus li-
pase. The plasmids pE0 to pE6 were transferred
into B. megaterium YYBm1. Based on Western blot
detected with 6X his tag antibody, no secreted pro-
teins were found in these strains. The results dem-
onstrated that the protein fused with propeptide B.
subtilis amyE was unstable in B. megaterium YYBm1
as the host (data not shown), compared to human
interferon-α in B. subtilis.
Since attempts with B. megaterium YYBm1 were
unsuccessful, B. licheniformis NRRLB-14212 was ex-
amined as a possible expression host. The plasmids
pLPPL and pE0 were transferred into B. licheniformis
NRRLB-14212 by electroporation. The plasmid pE0
constructed in E. coli could not be successfully trans-
ferred into the expression strain B. licheniformis, in-
dicating a lethal effect. This result agrees with Brock-
meier et al. (2006) that 25 of 173 prepeptides could
not be transferred into B. subtilis TEB1030. The
secreted protein in B. licheniformis NRRLB-14212
carrying pLPPL could not be detected by West-
ern blot (data not shown). Possibly, B. licheniformis
NRRLB-14212, a wild type strain, has extracellular
proteases or propeptide S. hyicus lipase was unable
to protect P. acnes LAI from proteolytic degradation.
ConCluSIonS
Bifidobacterium LAI expressed in E. coli BL21
(DE3) did not function due to insoluble formation in
inclusion bodies. Amino acid modification of P. acnes
LAI expressed in B. megatreium YYBm1 did not im-
prove the activity. Also, the propeptide of B. subti-
lis amyE and both propeptides could not protect P.
acnes LAI from proteolytic degradation in B. mega-
156 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
terium YYBm1 and B. licheniformis NRRLB-14212 as
the hosts, respectively.
ACknowledgeMenTS
Author Saengkerdsub was supported by an Ar-
kansas Biosciences Institute Grant. I would like to
thank Simon Stammen, Rebekka Biedendieck, and
Dieter Jahn of Institute of Microbiology, Technische
Universitat Braunschweig for providing plasmids and
B. megterium YYBm1. I appreciate Robert Preston
Story Jr. at the Center for Food Safety in the Depart-
ment of Food Science, the University of Arkansas
for providing Bidifobacterium longum ATCC15707,
Bacillus subtilis, Bacillus licheniformis NRRL B-14212.
RefeRenCeS
Ando, A., J. Ogawa, S. Kishino, and S. Shimizu. 2004.
Conjugated linoleic acid production from castor
oil by LactoBacillus plantarum JCM 1551. Enzyme
Microb. Technol. 35:40-45.
Banni, S. 2002. Conjugated linoleic acid metabolism.
Curr. Opin. Lipidol. 13:261-266.
Belury, M. A. 2002. Dietary conjugated linoleic acid
in health: physiological effects and mechanisms of
action. Annu. Rev. Nutr. 22:505-531.
Belury, M. A., K. P. Nickel, C. E. Bird, and Y. Wu. 1996.
Dietary conjugated linoleic acid modulation of
phorbol ester skin tumor promotion. Nutr. Cancer.
26:149-57.
Berdeaux, O., L. Voinot, E. Angioni, P. Juaneda, and
J. L. Sebedio. 1998. A simple method of prepa-
ration of methyl trans-10,cis-12- and cis-9,trans-
11-octadecadienoates from methyl linoleate. J.
Am. Oil Chem. Soc. 75:1749-1755.
Brockmeier, U., M. Caspers, R. Freudl, A. Jockwer,
T. Noll, and T. Eggert. 2006. Systematic screening
of all signal peptides from Bacillus subtilis: a pow-
erful strategy in optimizing heterologous protein
secretion in Gram-positive bacteria. J. Mol. Biol.
362:393-402.
Brondyk, W. H. 2009. Selecting an appropriate meth-
od for expressing a recombinant protein. Methods
Enzymol. 463:131-147.
Chen, C.-A., W. Lu, and C. Sih. 1999. Synthesis of
9Z,11E-octadecadienoic and 10E,12Z-octadecadi-
enoic acids, the major components of conjugated
linoleic acid. Lipids 34:879-884.
Chin, S. F., W. Liu, J. M. Storkson, Y. L. Ha, and M.
W. Pariza. 1992. Dietary sources of conjugated di-
enoic isomers of linoleic acid, a newly recognized
class of anticarcinogens. J. Food Compost. Anal.
5:185-197.
Christie, G., M. Lazarevska, and C. R. Lowe. 2008.
Functional consequences of amino acid substitu-
tions to GerVB, a component of the Bacillus mega-
terium spore germinant receptor. J. Bacteriol.
190:2014-2022.
Coakley, M., R. P. Ross, M. Nordgren, G. Fitzgerald,
R. Devery, and C. Stanton. 2003. Conjugated lin-
oleic acid biosynthesis by human-derived Bifido-
bacterium species. J. Appl. Microbiol. 94:138-145.
Deng, M. D., A. D. Grund, K. J. Schneider, K. M.
Langley, S. L. Wassink, S. S. Peng, and R. A. Ros-
son. 2007. Linoleic acid isomerase from Propioni-
bacterium acnes: purification, characterization,
molecular cloning, and heterologous expression.
Appl. Biochem. Biotechnol. 143:199-211.
Dugan, M. E. R., J. L. Aalhus, L. E. Jeremiah, J. K.
G. Kramer, and A. L. Schaefer. 1999. The effects of
feeding conjugated linoleic acid on subsequent
pork quality. . Can. J. Anim. Sci. 79:45-51.
Fritsche, J., R. Rickert, and H. Steinhart. 1999. For-
mation, contents, and estimation of daily intake of
conjugated linoleic acid isomers and trans-fatty ac-
ids in foods., In: M. P. Yurawecz, M. M. Mossobo, J.
K. G. Kramer, M. W. Pariza, and G. J. Nelson. Eds.
Advances in Conjugated Linoleic Acid Research.
AOCS, Champaign, IL. p. 378-396.
Griinari, J. M., B. A. Cori, S. H. Lacy, P. Y. Chouinard,
K. V. V. Nurmela, and D. E. Bauman. 2000. Conju-
gated linoleic acid is synthesized endogenously in
lactating dairy cows by delta(9)-desaturase. J. Nutr.
130:2285-2291.
Grote, A., K. Hiller, M. Scheer, R. Münch , B. Nörte-
mann, D. C. Hempel, and D. Jahn. 2005. JCat: a
novel tool to adapt codon usage of a target gene
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 157
to its potential expression host. Nucleic Acids
Res.33:W526-W531.
Ha, Y. L., N. K. Grimm, and M. W. Pariza. 1987. Anti-
carcinogens from fried ground beef: heat-altered
derivatives of linoleic acid. Carcinogenesis 8:1881-
1887.
Ha, Y. L., J. Storkson, and M. W. Pariza. 1990. Inhibi-
tion of benzo(a)pyrene-induced mouse forestom-
ach neoplasia by conjugated dienoic derivatives
oflinoleic acid. Cancer Res. 50:1097-1101.
Haas, M., J. Kramer, G. McNeill, K. Scott, T. Foglia, N.
Sehat, J. Fritsche, M. Mossoba, and M. Yurawecz.
1999. Lipase-catalyzed fractionation of conjugated
linoleic acid isomers. Lipids 34:979-987.
Ip, C., S. F. Chin, J. A. Scimeca, and M. W. Pariza.
1991. Mammary cancer prevention by conjugated
dienoic derivative of linoleic acid. Cancer Res.
51:6118-6124.
Kim, Y. J., R. H. Liu, D. R. Bond, and J. B. Russell. 2000.
Effect of linoleic acid concentration on conjugated
linoleic acid production by Butyrivibrio fibrisolvens
A38. Appl. Environ. Microbiol. 66:5226-5230.
Kramer, J. K., P. W. Parodi, R. G. Jensen, M. M. Mos-
soba, M. P. Yurawecz, and R. O. Adlof. 1998. Ru-
menic acid: a proposed common name for the ma-
jor conjugated linoleic acid isomer found in natural
products. Lipids. 33:835.
Lee, K. N., D. Kritchevsky, and M. W. Pariza. 1994.
Conjugated linoleic acid and atherosclerosis in
rabbits. Atherosclerosis. 108:19-25.
Lewis, T., P. D. Nichols, and T. A. McMeekin. 2000.
Evaluation of extraction methods for recovery
of fatty acids from lipid-producing microhetero-
trophs. J. Microbiol. Methods. 43:107-116.
Liew, C., H. A. Schut, S. F. Chin, M. W. Pariza, and R.
H. Dashwood. 1995. Protection of conjugated lin-
oleic acids against 2-amino-3- methylimidazo[4,5-
f]quinoline-induced colon carcinogenesis in the
F344 rat: a study of inhibitory mechanisms. Carci-
nogenesis. 16:3037-3043.
Liu, J., and A. Escher. 1999. Improved assay sensi-
tivity of an engineered secreted Renilla luciferase.
Gene. 237:153-159.
Ma, D. W., A. A. Wierzbicki, C. J. Field, and M. T.
Clandinin. 1999. Conjugated linoleic acid in ca-
nadian dairy and beef products. J. Agric. Food
Chem. 47:1956-1960.
Nicolosi, R. J., E. J. Rogers, D. Kritchevsky, J. A.
Scimeca, and P. J. Huth. 1997. Dietary conjugat-
ed linoleic acid reduces plasma lipoproteins and
early aortic atherosclerosis inhypercholesterolemic
hamsters. Artery. 22:266-277.
Notredame, C., D. G. Higgins, and J. Heringa.
2000. T-Coffee: A novel method for fast and ac-
curate multiple sequence alignment. J. Mol. Biol.
302:205-217.
Pariza, M. W. 2004. Perspective on the safety and ef-
fectiveness of conjugated linoleic acid. Am. J. Clin.
Nutr. 79:1132S-1136S.
Pariza, M. W., Y. Park, and M. E. Cook. 2001. The bio-
logically active isomers of conjugated linoleic acid.
Prog. Lipid Res. 40:283-298.
Park, Y., K. J. Albright, W. Liu, J. M. Storkson, M. E.
Cook, and M. W. Pariza. 1997. Effect of conjugated
linoleic acid on body composition in mice. Lipids.
32:853-858.
Peng, S. S., M.-D. Deng, A. D. Grund, and R. A. Ros-
son. 2007. Purification and characterization of a
membrane-bound linoleic acid isomerase from
Clostridium sporogenes. Enzyme Microb. Technol.
40:831-839.
Poirier, H., J. S. Shapiro, R. J. Kim, and M. A. Lazar.
2006. Nutritional supplementation with trans-10,
cis-12-conjugated linoleic acid induces inflamma-
tion of whiteadipose tissue. Diabetes. 55:1634-
1641.
Rainio, A., M. Vahvaselkä, T. Suomalainen, and S.
Laakso. 2001. Reduction of linoleic acid inhibition
in production of conjugated linoleic acid by Propi-
onibacterium freudenreichii ssp. shermanii. Can. J.
Microbiol. 47:735-740.
Reaney, M. J. T., L. Ya-Dong, and N. D. Westcott.
1999. Commercial production of conjugated lin-
oleic acid. Adv. Conjugat. Linoleic Acid Res. 1:39-
54.
Risérus, U., S. Basu, S. Jovinge, G. N. Fredrikson, J.
Arnlöv, and B. Vessby. 2002. Supplementation with
conjugated linoleic acid causes isomer-dependent
oxidative stress and elevated C-reactive protein:
a potential link to fatty acid-induced insulin resis-
158 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
tance. Circulation. 106:1925-1929.
Rosson, R. A., M.-D. Deng, A. D. Grund, and S. S.
Peng. 2001. Linoleate isomerase. PCT Patent #
WO0100846-A.
Schallmey, M., A. Singh, and O. P. Ward. 2004. Devel-
opments in the use of Bacillus species for industrial
production. Can. J. Microbiol. 50:1 - 17.
Schmidt, F. R. 2004. Recombinant expression sys-
tems in the pharmaceutical industry. Appl. Micro-
biol. Biotechnol. 65:363-372.
Sehat, N., M. P. Yurawecz, J. A. Roach, M. M. Mos-
soba, J. K. Kramer, and Y. Ku. 1998. Silver-ion high-
performance liquid chromatographic separation
and identification of conjugated linoleic acid iso-
mers. Lipids 33:217-221.
Sisk, M. B., D. B. Hausman, R. J. Martin, and M. J.
Azain. 2001. Dietary conjugated linoleic acid re-
duces adiposity in lean but not obese Zucker rats.
J. Nutr. 131:1668-1674.
Smedman, A., and B. Vessby. 2001. Conjugated lin-
oleic acid supplementation in humans-metabolic
effects. Lipids. 36:773-781.
Stammen, S., B. K. Müller, C. Korneli, R. Biedendi-
eck, M. Gamer, E. Franco-Lara, and D. Jahn. 2010.
High-yield intra- and extracellular protein produc-
tion using Bacillus megaterium. Appl. Environ. Mi-
crobiol. 76:4037-4046.
Terpe, K. 2006. Overview of bacterial expression
systems for heterologous protein production:
from molecular and biochemical fundamentals to
commercial systems. Appl. Microbiol. Biotechnol.
72:211-222.
Vary, P. S. 1994. Prime time for Bacillus rnegateriurn.
Microbiology. 140:1001-1013.
Verhulst, A., G. Semjen, U. Meerts, G. Janssen, G.
Parmentier, S. Asselberghs, H. Vanhespen, and H.
Evssen. 1985. Biohydrogenation of linoleic acid by
Clostridium sporogenes, Clostridium bifermen-
tans, Clostridium sordellii and Bacteroides sp.
FEMS Microbiol. Ecol. 31:255-259.
Wong, S. L. 1995. Advances in the use of Bacillus
subtilis for the expression and secretion of heterol-
ogous proteins. Curr. Opin. Biotechnol. 6:517-522.
Xue, G. P., J. S. Johnson, and B. P. Dalrymple. 1999.
High osmolarity improves the electro-transforma-
tion efficiency of the gram-positive bacteria Bacil-
lus subtilis and Bacillus licheniformis. J. Microbiol.
Methods. 34:183-191.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 159
160 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 161
Shiga Toxin-Producing Escherichia coli (STEC) Ecology in Cattle and Management Based Options for Reducing Fecal Shedding T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, D. J. Nisbet
39
Can Salmonella Reside in the Human Oral Cavity?S. A. Sirsat
30
Growth of Acetogenic Bacteria In Response to Varying pH, Acetate Or Carbohydrate Concentration
R. S. Pinder, and J. A. Patterson
6
Independent Poultry Processing in Georgia: Survey of Producers’ PerspectiveE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, S. C. Ricke
70
ARTICLES
Greenhouse Gas Emissions from Livestock and PoultryC. S. Dunkley and K. D. Dunkley
17
REVIEW
Instructions for Authors79
Introduction to Authors
The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.
VOLUME 3 ISSUE 1
162 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
MAnuSCRIPT SuBMISSIon
Authors must submit their papers electronically
([email protected]). According to instruc-
tions provided online at our site: www.afabjournal.
com. Authors who are unable to submit electroni-
cally should contact the editorial office for assistance
by email at [email protected].
INSTRUCTIONS TO AUTHORS
• Aerobic microbiology
• Aerobiology
• Anaerobic microbiology
• Analytical microbiology
• Animal microbiology
• Antibiotics
• Antimicrobials
• Bacteriophage
• Bioremediation
• Biotechnology
• Detection
• Environmental microbiology
• Feed microbiology
• Fermentation
• Food bacteriology
• Food control
• Food microbiology
• Food quality
• Food Safety
• Foodborne pathogens
• Gastrointestinal microbiology
• Microbial education
• Microbial genetics
• Microbial physiology
• Modeling and microbial kinetics
• Natural products
• Phytoceuticals
• Quantitative microbiology
• Plant microbiology
• Plant pathogens
• Prebiotics
• Probiotics
• Rumen microbiology
• Rapid methods
• Toxins
• Veterinary microbiology
• Waste microbiology
• Water microbiology
ConTenT of MAnuSCRIPT
We invite you to consider submitting your re-
search and review manuscripts to AFAB. The jour-
nal serves as a peer reviewed scientific forum for to
the latest advancements in bacteriology research
on Agricultural and Food Systems which includes
the following fields:
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 163
With an open access publication model of this
journal, all interested readers around the world can
freely access articles online. AFAB publishes origi-
nal papers including, but not limited to the types
of manuscripts described in the following sections.
Papers that have been, or are scheduled to be, pub-
lished elsewhere should not be submitted and will
not be reviewed. Opinions or views expressed in pa-
pers published by AFAB are those of the author(s)
and do not necessarily represent the opinion of the
AFAB or the editorial board.
MAnuSCRIPT TyPeS
Full-Length Research Manuscripts
AFAB accepts full-length research articles con-
taining four (4) figures and/or tables or more. AFAB
emphasizes the importance of sound scientific ex-
perimentation on any of the topics listed in the focus
areas followed by clear concise writing that describes
the research in its entirety. The results of experi-
ments published in AFAB must be replicated, with
appropriate statistical assessment of experimental
variation and assignment of significant difference.
Major headings to include are: Abstract, Introduc-tion, Materials and Methods, Results, Discussion (or Results and Discussion), Conclusion, Acknowl-edgements (optional), Appendix for abbreviations (optional), and References.
Manuscripts clearly lacking in language will be re-
turned to author without review, with a suggestion
that English editing be sought before the paper is
reconsidered. AFAB offers a fee based language
service upon request. Please contact [email protected] for more information about our fees
and services.
Rapid Communications
Under normal circumstances, AFAB aims for re-
ceipt-to-decision times of approximately one month or less. Accepted papers will have priority for publi-
cation in the next available issue of AFAB. However,
if an author chooses or requires a much more rapid
peer review, the journal editorial office has the capa-
bility to shorten the review timing to one week or less.
Any type of manuscript whether it be a full length
manuscript, brief communication or review paper can
be submitted as a rapid communication. There will be
additional costs for processing and page charges will
be double the normal rate. Authors who choose this
option must select Rapid Communications as the pa-
per type when submitting the paper and the editors
will judge whether a rapid review is possible and let
the author know immediately.
Brief Communications
Brief communications are short research notes giv-
ing the results of complete experiments but are con-
sidered less comprehensive than full-length articles
with three (3) figures and/or tables or less. Manuscripts
should be prepared with the same subheadings as full
length research papers. The running head above the
title of the paper is “Brief Communications.”
Unsolicited Review Papers
Review papers are welcome on any topic listed in
the focus section and have no page limits. Reviews
are assessed the same pages charges as all other
manuscripts. All AFAB guidelines for style and form
apply. Major headings to include are: Abstract, In-troduction, Main discussion topics and appropri-ate subheadings, Conclusions, Acknowledgements (optional) and References. Review papers shorter
than 20 pages of double spaced text and references
will be considered mini-reviews with the subhead-
ing above the title on the first page. The running
head above the title of the paper is either “Review”
or “Mini-review”.
Solicited Review Papers
Solicited reviews will have no page limits. The
editor-in-chief will send invitations to the authors
and then review these contributions when they are
submitted. Nominations or suggestions for potential
timely reviews are welcomed by the editors or edito-
164 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
rial board members and should be sent to submit@
afabjournal.com. There will be no page charges for
solicited review papers but the solicitation must origi-
nate from the editor-in-chief or one of the editors. Re-
quests from authors will automatically be classified as
unsolicited review papers. The running head above
the title of the paper will be “Invited Review.”
Conference and Special Issues Reviews
AFAB welcomes opportunities to publish papers
from symposia, scientific conference, and/or meet-
ings in their entirety. Conference organizers need
simply to contact AFAB at [email protected]
and a rapid decision is guaranteed. If in agreement,
the conference organizers must guarantee delivery
of a set number of peer reviewed manuscripts within
a specified time and submitted in the same format
as that described for unsolicited review papers. Con-
ference papers must be prepared in accordance with
the guidelines for review articles and are subject to
peer review. The conference chair must decide
whether or not they wish to serve as Special Issue
Editor and conduct the editorial review process. If
the conference chair/organizer chooses to serve as
special issue editor, this will involve review of the pa-
pers and, if necessary, returning them to the authors
for revision. The conference organizer then submits
the revised manuscripts to the journal editorial of-
fice for further editorial examination. Final revisions
by the author and recommendations for acceptance
or rejection by the chair must be completed by a
mutually agreed upon date between the editor and
the conference organizer. Manuscripts not meeting
this deadline will not be included in the published
symposium proceedings but if submitted later can
still be considered as unsolicited review papers. Al-
though offprints and costs of pages are the same
as for all other papers, the symposium chair may be
asked to guarantee an agreed upon number of hard
copies to be purchased by conference attendees. If
the decision is not to publish the symposium as a
special issue, the individual authors retain the right
to submit their papers for consideration for the jour-
nal as ordinary unsolicited review manuscripts.
Book Reviews
AFAB publishes reviews of books considered to
be of interest to the readers. The editor-in-chief ordi-
narily solicits reviews. Book reviews shall be prepared
in accordance to the style and form requirements of
the journal, and they are subject to editorial revision.
No page charges will be assessed solicited reviews
while unsolicited book reviews will be assigned the
regular page charge rate.
Opinions and Current Viewpoints
The purpose of this section will be to discuss, cri-
tique, or expand on scientific points made in articles
recently published in AFAB. Drafts must be received
within 6 months of an article’s publication. Opinions
and current perspectives do not have page limits.
They shall have a title followed by the body of the
text and references. Author name(s) and affiliation(s)
shall be placed between the end of the text and list
of references. If this document pertains to a par-
ticular manuscript then the author(s) of the original
paper(s) will be provided a copy of the letter and of-
fered the opportunity to submit for consideration a
reply within 30 days. Responses will have the same
page restrictions and format as the original opinion
and current viewpoint, and the titles shall end with
“Opinions.” They will be published together. Letters
and replies shall follow appropriate AFAB format
and may be edited by the editor-in-chief and a tech-
nical editor. If multiple letters on the same topic are
received, a representative set of opinions concern-
ing a specific article will be published. A disclaimer
will be added by the editorial staff that the opinion
expressed in this viewpoint is the authors alone and
does not necessarily represent the opinion of AFAB
or the editorial board.
CoPyRIghT AgReeMenT
The copyright form is published in AFAB as space
permits and is available online (www.afabjournal.com).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 165
AFAB grants to the author the right of re-publication
in any book of which he or she is the author or edi-
tor, subject only to giving proper credit to the original
journal publication of the article by AFAB. AFAB re-
tains the copyright to all materials accepted for pub-
lication in the journal. If an author desires to reprint
a table or figure published from a non-AFAB source,
written evidence of copyright permission from an au-
thority representing that source must be obtained by
the author and forwarded to the AFAB editorial office.
PeeR RevIew PRoCeSS
Authors will be requested to provide the names
and complete addresses including emails of five (5) potential reviewers who have expertise in the research
area and no conflict of interest with any of the authors.
Except for manuscripts designated as Rapid Commu-
nication each reviewer has two (2) weeks to review
the manuscript, and submit comments electronically
to the editorial office. Authors have three (3) weeks
to complete the revision, which shall be returned to
the editorial office within six (6) weeks after which the
authors risk having their manuscript removed from
AFAB files if they fail to ask the editorial office for
an extension by email. Deleted manuscripts will be
reconsidered, but they will have to be processed as
new manuscripts with an additional processing fee as-
sessed upon submission. Once reviewed, the author
will be notified of the outcome and advised accord-
ingly. Editors handle all initial correspondence with
authors during the review process. The editor-in chief
will notify the author of the final decision to accept or
reject. Rejected manuscripts can be resubmitted only
with an invitation from the editor or editor-in chief. Re-
vised versions of previously rejected manuscripts are
treated as new submissions.
PRoduCTIon of PRoofS
Accepted manuscripts are forwarded to the edito-
rial office for technical editing and layout. The manu-
script is then formatted, figures are reproduced, and
author proofs are prepared as PDFs. Author proofs
of all manuscripts will be provided to the correspond-
ing author. Author proofs should be read carefully and
checked against the typed manuscript, because the
responsibility for proofreading is with the author(s).
Corrections must be returned by e-mail. Changes
sent by e-mail to the technical editor must indicate
page, column, and line numbers for each correction
to be made on the proof. Corrections can also be
marked using “track changes” in Microsoft Word or
using e-annotation tools for electronic proof correc-
tion in Adobe Acrobat to indicate necessary chang-
es. Author alterations to proofs exceeding 5% of the
original proof content will be charged to the author. All
correspondence of proofs must be agreed to by the
editorial office and the author within 48 hours or proof
will be published as is and AFAB will assume no re-
sponsibility for errors that result in the final publication.
PuBlICATIon ChARgeS
AFAB has two publication charge options: conven-
tional page charges and rapid communication. The
current charge for conventional publication is $25 per printed page in the journal. There is no additional
charge for the publication of pages containing color
images, micrographs or pictures. For authors who
wish to have their papers processed as a rapid com-
munication, authors will pay the rapid communication
fee when proofs are returned to the editorial office
in addition to twice the conventional page charges.
Charges for rapid communications are $1000 per manuscript for guaranteed peer review within one
week and $100 per journal page.
hARd CoPy offPRInTS
If you are wishing to obtain a physical hard copy of
the AFAB journal, offprints are available in any quan-
tity at an additional charge: $100/page for black-white
and $150/page for color prints. You may order your
offprints at any time after publication on our website.
Scientific conference organizers may be expected to
agree to a set number of offprints as a part of their
agreement with AFAB.
166 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
MAnuSCRIPT ConTenT RequIReMenTS
Preparing the Manuscript File
Manuscripts must be written in grammatically
correct English. AFAB offers a fee based language
service upon request ([email protected]).
Manuscripts should be typed double-spaced, with
lines and pages numbered consecutively. All docu-
ments must be submitted in Microsoft Word (.doc or
.docx, PC or Mac). All special characters (e.g., Greek,
math, symbols) should be inserted using the sym-
bols palette available in this font. Tables and figures
should be placed in separate sections at the end of
the manuscript (not placed in the text). Failure to fol-
low these instructions will cause delays of the pro-
cessing and review of the manuscript.
Title Page
At the very top of the title page, include a title of
not more than 100 characters. Format the title with
the first letter of each word capitalized. No abbre-
viations should be used. Under the title, the authors
names are listed. Use the author’s initials for both first
and middle names with a period (full-stop) between
initials (e.g., W. A. Afab). Underneath the authors, a
list affiliations must be listed. Please use numerical
superscripts after the author’s names to designate
affiliation. If an authors address has changed since
the research was completed, this new information
must be designated as “Current address:”. The cor-
responding author should be indicated with an aster-
isk e.g., * Corresponding author. The title page shall
include the name and full address of the correspond-
ing author. Telephone and e-mail address must also
be provided for the corresponding author, and email-addresses must be provided for all authors.
Editing
Author-derived abbreviations should be defined
at first use in the abstract and again in the body of
the manuscript. If abbreviations are extensive au-
thors may need to provide a list of abbreviations
at the beginning of the manuscript. In vivo, in vitro
and bacterial names must be italicized (obligatory).
Authors must avoid single sentence paragraphs and
merge such paragraphs appropriately. Authors must
not begin sentences with “Figure or Table shows…”
as these are inanimate objects and cannot “show”
anything. When number are reported in text or in ta-
bles, always put a zero in front of decimal numbers:
“0.10” instead of “.10”.
MAnuSCRIPT SeCTIonS
Abstract
The abstract provides an abridged version of the
manuscript. Please submit your abstract on a sepa-
rate page after the title page. The abstract should
provide a justification of your work, objectives, meth-
ods, results, discussion and implications of study or
review findings . Your abstract must consist of com-
plete sentences without references to other work or
footnotes and must not exceed 250 words. On the
same page as your abstract, please provide at least ten (10) keywords to be used for linking and index-
ing. Ideally, these keywords should include signifi-
cant words from the title.
Introduction
The introduction should clearly present the foun-
dation of the manuscript topic and what makes the
research or the review unique. The introduction
should validate why this topic is important based on
previously published literature, and the relevance of
the current research. Overall goals and project ob-
jectives must be clearly stated in the final sentence
of the last paragraphs of the introduction.
Materials and Methods
Information on equipment and chemicals used
must include the full company name, city, and state
(country if outside the United States or Province if
in Canada) [i.e., (Model 123, ACME Inc., Afab, AR)].
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 167
Variability, Replication, and Statistical Analysis
To properly assess biological systems indepen-
dent replication of experiments and quantification
of variation among replicates is required by AFAB.
Reviewers and/or editors may request additional
statistical analysis depending on the nature of the
data and it will be the responsibility of the authors
to respond appropriately. Statistical methods com-
monly used in the bacteriology do not need to be
described in detail, but an adequate description
and/or appropriate references should be provided.
The statistical model and experimental unit must
be designated when appropriate. The experimen-
tal unit is the smallest unit to which an individual
treatment is imposed. For bacterial growth stud-
ies, the average of replicate tubes per single study
per treatment is the experimental unit; therefore,
individual studies must be replicated. Repeated
time analyses of the same sample usually do not
constitute independent experimental units. Mea-
surements on the same experimental unit over time
are also not independent and must not be consid-
ered as independent experimental units. For analy-
sis of time effects, assess as a rate of change over
time. Standard deviation refers to the variability
in the biological response being measured and is
presented as standard deviation or standard error
according to the definitions described in statistical
references or textbooks.
Results
Results represent the presentation of data in
words and all data should be described in same
fashion. No discussion of literature is included in
the results section.
Discussion
The discussion section involves comparing the
current data outcomes with previously published
work in this area without repeating the text in the
results section. Critical and in-depth dialogue is
encouraged.
Results and Discussion
Results and discussion can be under combined or
separate headings.
Conclusions
State conclusions (not a summary) briefly in one
paragraph.
Acknowledgments
Acknowledgments of individuals should include
institution, city, and state; city and country if not U.S.;
and City or Province if in Canada. Copies being re-
viewed shall have authors’ institutions omitted to re-
tain anonymity.
References
a) Citing References In Text
Authors of cited papers in the text are to be pre-
sented as follows: Adams and Harry (1992) or Smith
and Jones (1990, 1992). If more than two authors of
one article, the first author’s name is followed by the
abbreviation et al. in italics. If the sentence structure
requires that the authors’ names be included in pa-
rentheses, the proper format is (Adams and Harry,
1982; Harry, 1988a,b; Harry et al., 1993). Citations to a
group of references should be listed first alphabeti-
cally then chronologically. Work that has not been
submitted or accepted for publication shall be listed
in the text as: “G.C. Jay (institution, city, and state,
personal communication).” The author’s own un-
published work should be listed in the text as “(J.
Adams, unpublished data).” Personal communica-
tions and unsubmitted unpublished data must not
be included in the References section. Two or more
publications by the same authors in the same year
must be made distinct with lowercase letters after
the year (2010a,b). Likewise when multiple author ci-
tations designated by et al. in the text have the same
first author, then even if the other authors are differ-
ent these references in the text and the references
section must be identified by a letter. For example
168 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013
“(James et al., 2010a,b)” in text, refers to “James,
Smith, and Elliot. 2010a” and “James, West, and Ad-
ams. 2010b” in the reference section.
b) Citing References In Reference Section
In the References section, references are listed in
alphabetical order by authors’ last names, and then
chronologically. List only those references cited in the
text. Manuscripts submitted for publication, accepted
for publication or in press can be given in the refer-
ence section followed by the designation: “(submit-
ted)”, “(accepted)’, or “(In Press), respectively. If the
DOI number of unpublished references is available,
you must give the number. The year of publication fol-
lows the authors’ names. All authors’ names must be
included in the citation in the Reference section. Jour-
nals must be abbreviated. First and last page num-
bers must be provided. Sample references are given
below. Consult recent issues of AFAB for examples
not included in the following section.
Journal manuscript:
Examples:
Chase, G., and L. Erlandsen. 1976. Evidence for a
complex life cycle and endospore formation in the
attached, filamentous, segmented bacterium from
murine ileum. J. Bacteriol. 127:572-583.
Jiang, B., A.-M. Henstra, L. Paulo, M. Balk, W. van
Doesburg, and A. J. M. Stams. 2009. A typical
one-carbon metabolism of an acetogenic and
hydrogenogenic Moorella thermioacetica strain.
Arch. Microbiol. 191:123-131.
Book:
Examples:
Hungate, R. E. 1966. The rumen and its microbes
Academic Press, Inc., New York, NY. 533 p.
Book Chapter:
Examples:
O’Bryan, C. A., P. G. Crandall, and C. Bruhn. 2010.
Assessing consumer concerns and perceptions
of food safety risks and practices: Methodologies
and outcomes. In: S. C. Ricke and F. T. Jones. Eds.
Perspectives on Food Safety Issues of Food Animal
Derived Foods. Univ. Arkansas Press, Fayetteville,
AR. p 273-288.
dissertation and thesis:
Maciorowski, K. G. 2000. Rapid detection of Salmo-
nella spp. and indicators of fecal contamination
in animal feed. Ph.D. Diss. Texas A&M University,
College Station, TX.
Donalson, L. M. 2005. The in vivo and in vitro effect
of a fructooligosacharide prebiotic combined with
alfalfa molt diets on egg production and Salmo-
nella in laying hens. M.S. thesis. Texas A&M Uni-
versity, College Station, TX.
Van Loo, E. 2009. Consumer perception of ready-to-
eat deli foods and organic meat. M.S. thesis. Uni-
versity of Arkansas, Fayetteville, AR. 202 p.
web sites, patents:
Examples:
Davis, C. 2010. Salmonella. Medicinenet.com.
http://www.medicinenet.com/salmonella /article.
htm. Accessed July, 2010.
Afab, F. 2010, Development of a novel process. U.S.
Patent #_____
Author(s). Year. Article title. Journal title [abbreviated].
Volume number:inclusive pages.
Author(s) [or editor(s)]. Year. Title. Edition or volume (if
relevant). Publisher name, Place of publication. Number
of pages.
Author(s) of the chapter. Year. Title of the chapter. In:
author(s) or editor(s). Title of the book. Edition or vol-
ume, if relevant. Publisher name, Place of publication.
Inclusive pages of chapter.
Author. Date of degree. Title. Type of publication, such
as Ph.D. Diss or M.S. thesis. Institution, Place of institu-
tion. Total number of pages.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 169
Abstracts and Symposia Proceedings:
Fischer, J. R. 2007. Building a prosperous future in
which agriculture uses and produces energy effi-
ciently and effectively. NABC report 19, Agricultural
Biofuels: Tech., Sustainability, and Profitability. p.27
Musgrove, M. T., and M. E. Berrang. 2008. Presence
of aerobic microorganisms, Enterobacteriaceae and
Salmonella in the shell egg processing environment.
IAFP 95th Annual Meeting. p. 47 (Abstr. #T6-10)
Vianna, M. E., H. P. Horz, and G. Conrads. 2006. Op-
tions and risks by using diagnostic gene chips. Pro-
gram and abstracts book , The 8th Biennieal Con-
gress of the Anaerobe Society of the Americas. p.
86 (Abstr.)
Data Presentation in Tables and Figures
Figures and tables to be published in AFAB must
be constructed in such a fashion that they are able
to “stand alone” in the published manuscript. This
means that the reader should be able to look at
the figure or table independently of the rest of the
manuscript and be able to comprehend the experi-
mental approach sufficiently to interpret the data.
Consequently, all statistical analyses should be very
carefully presented along with variation estimates
and what constitutes an independent replication
and the number of replicates used to calculate the
averages presented in the table or figure.
Each table and figure must be on a separate
page in the submitted paper. In addition, you will
need to submit all data for charts, tables and
figures in native format when possible (e.g., Mi-
crosoft excel, Powerpoint). Photographs should
be submitted as high-resolution (600 dpi) .jpg or
tif. files. All figures should be clearly presented with
well defined axis and units of measurement. Sym-
bols, lines, and bars must be made distinct as “stand
alone” black and white presentations. Stippling,
dashed lines etc. are encouraged for multiple com-
parison but shades of gray are discouraged. Color
images, micrographs, pictures are recommended
and there is no additional fee for their submission.
AFAB Online Edition is Now Available!
www.AFABjournal.com
• Free Access
• Print PDFs
• Flip Through Issues
• Search Article Archives
• Order Reprints
• Submit a Paper
Online Publication: www.AFABjournal.com