John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
1
Algorithms and Complexity2: Complexity Notation
John [email protected]
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
2
Last time
• What’s an algorithm then?– Intro and brief history– Sample use of algorithms– Sample algorithm - room count
• Course overview– Lectures, practical, labs/tuts, the exam
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
3
The travelling seller• Mary, a computer seller, needs to visit 3 shops in a day (starting and finishing at the office): what’s the shortest route?
• What if there’s 12 shops?
5km
3km
2km
8km
12km
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
4
Today
• Size matters
• Complexity notation
• Calculating complexities
2
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
5
Download time from internet
• Say it takes 2s to establish a link and then we download at 5K/s, then if n is size of file in K:– time to download is
n/5 + 2
– a linear function
– dominant element as data size grows is n, so using big-oh notation = O(n)
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
6
String Search
• Problem:– Find a string t in a longer string s
• Simple approach i=0; found = false;
while (!found) & (i<s.length)
j = 0; oksofar = true;
while (oksofar) & (j<t.length())
if (s.charAt(i+j)!=t.charAt(j)) oksofar = false;
j++
found = oksofar; i++;
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
7
Rules for big-oh notation
• Only record the highest, dominant, factor
• Ignore constants and multipliers
• Kind of like rounding• 1,000,001 is roughly 1,000,000• so you say O(n2) and not O(12n2)
• 4n3 + 3n2 + 1000n + 2000000 = O(n3)
• 3n3 + 5 = O(n3)
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
8
Common classes of Big-Oh
• In increasing complexity roughly:- logarithmic O(log n)
- linear O(n)
- lin-log O(n log n)
- quadratic O(n2)
- polynomial O(nk), k > 1
- exponential O(an), n > 1
- factorial O(n!), n > 1
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
9
Common classes of Big-Oh
0
100
200
300
400
500
600
700
800
900
1000
0 20 40 60 80 100 120
number
time
log n
n
n log n
n*n
2*n*n
n!
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
10
Tyranny of complexity
• 1000 items per sec plus 10 secs startupn O(log n) O(n) O(n2) O(n3) O(n!) 1 10 sec 10 sec 10 sec 10 sec 10 sec 2 10 sec 10 sec 10 sec 10 sec 10 sec 4 10 sec 10 sec 10 sec 10 sec 10 sec 8 10 sec 10 sec 10 sec 11 sec 50 sec
16 10 sec 10 sec 10 sec 14 sec 663 years 32 10 sec 10 sec 11 sec 43 sec 8.34E+24 years 64 10 sec 10 sec 14 sec 5 min 4.02E+78 years
128 10 sec 10 sec 26 sec 35 min 1.22E+205 years 256 10 sec 10 sec 1 min 5 hours 512 10 sec 11 sec 5 min 37 hours
1,024 10 sec 11 sec 18 min 12 days 2,048 10 sec 12 sec 1 hours 3 months 4,096 10 sec 14 sec 5 hours 2 years 8,192 10 sec 18 sec 19 hours 17 years
16,384 10 sec 26 sec 3 days 139 years 32,768 10 sec 43 sec 12 days 1113 years 65,536 10 sec 1 min 2 months 8901 years
131,072 10 sec 2 min 6 months 71209 years 262,144 10 sec 5 min 2 years 569672 years 524,288 10 sec 9 min 9 years 4557377 years
1,048,576 10 sec 18 min 35 years 36,459,013 yrs
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
11
<= = >=
• Big-Oh says “as the numbers grow the dominant factor will be no worse (<=) than given”– e.g. an O(n log n) function grows no faster
than another t = n log n
• Big-Oh is used for the worst case - we will mostly talk worst, sometimes expected but never best nor average
• Also Ω(n) and θ(n) for >= and =
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
12
Simple String Search
Peter Piper picked a peck of pickled pepper; A peck of pickled pepper Peter Piper picked. If Peter Piper picked a peck of pickled pepper, Where’s the peck of pickled pepper Peter Piper picked?
• Find pepper - lots of false starts
• Can you do better?
• Simple complexity is O(nm)
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
13
Better string search• Start search at end and keep a tablepeter_piper picked a peck of pickled pepper
pepperpiper_picked a peck of pickled pepper
peter pepperpicked a peck of pickled pepper
peter piper pepper a peck of pickled pepper
peter piper pickedpepperk of pickled pepper
peter piper picked a pecpepperickled pepper
peter piper picked a peck pepperkled pepper
peter piper picked a peck of picpepperepper
peter piper picked a peck of picklpepperper
peter piper picked a peck of pickledpepperr
peter piper picked a peck of pickled pepppeppeerr
10 steps instead of 50 (I think)
what about longer text?
what about fewer letters - e.g. DNA coding?
AGCCCGAACATTTACGCCGCTGGCGACTGCACCG
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
14
String search
• Basic algorithm is O(nm)
• Best algorithm is O(n)– BUT is much more complex
• Have to think of when it matters– is data big enough for more complex soln– watch constants and multipliers
John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/
15
Summary
• Size matters
• Complexity notation
• Calculating complexities
• Next time: start searching & sorting
• Ask the class quiz