Transposable Element Lab Report
Isabella RoigBIO 356-001H4 March 2015
Dr. Walters-Conte & Hongmei MaPartners: Jordyn Giannone and Meaghan Cuddy
Abstract:An experiment was conducted to determine the use of CanSINEs as identification
markers to distinguish species and by extension create phylogenetic maps. Transposable
Elements are sequences of DNA that have the ability to move to new sites in the genome and are
used as identification markers of species. SINEs are a subclass of retrotransposon and are found
in most Eukaryotic organisms. CanSINEs at eight loci were examined for 24 breeds of dogs.
Primers were designed for each locus and tested using control DNA, Boxer DNA, and Poodle
DNA. Each SINE at a particular locus was identified as being either Boxer+/ Poodle- or Boxer-/
Poodle+. Successfully tested primers were used to test the 24 unknown dog breed DNAs. The
results were inconclusive. CanSINEs can be used to connected dogs to their breeds and find
similarities between breeds, but cannot be used to identify breeds.
Introduction:Transposable Elements are often described as “jumping genes” because they are
sequences of DNA that have the ability to move to new sites in the genome. Transposable
Elements move about the genome in two ways: transposon method, which is a cut and paste
method without a RNA intermediate, and a retrotransposons method, which is transcription from
DNA to RNA and reverse transcribed to DNA and inserted into a new position (Kramerov and
Vassetzsky, 2011).
Retrotransposons have a few subclasses, one of which is Short Interspersed Elements
(SINEs). SINEs are distinguished from other Transposable Elements because they are
transcribed by RNA polymerase III and contain a polymerase III promoter in their sequence.
SINEs are found in most eukaryotic organisms and their size ranges from 100 to 600bp. The
genomes can contains many hundreds of thousands copies of SINEs (Kramerov and Vassetzsky,
2011). SINEs are connected with unequal recombination and genetic diseases and known to be
revealing evolutionary markers over genomes of species (Walters-Conte and Johnson, et all,
2011).
Certain types of Transposable Elements can be seen across different species linking them
together. All primates, including humans, have “Alu” sequences, a type of Transposable
Element. Alu sequences make up 10% of the human genome (Wang and Kirkness, 2005). Alu
sequences that are found in homologous regions of the genome are used to demonstrate how
species are related. It is possible to draw this connection because Transposable Elements either
remain in the same region or are inserted elsewhere on the genome. Insertions that persist can
define a certain population and be used to identify them. This identity can be compared to other
species with the same Transposable Elements at homologous or non-homologous regions to
determine their evolutionary relationship.
CanSINEs are a family of SINEs only found in Carnivora. The recent publication of the
entire genome of the domestic dog and cat has revealed much more evolutionary insight by
looking at CanSINEs. Because the genome of the domestic dog is available, DNA extraction is
easy, and they are more evolutionarily developed than the rat or the fruit fly, dogs are
particularly useful for genetic studies. Entire genome sequences are useful references for
analytical comparison. Because of this knowledge of CanSINE location in coding and noncoding
regions that are specific to population, lineage, or species, CanSINEs can be used to determine
domestic breeds of dogs, in addition to species, genus, familial, and suborder relationship to
other members of Carnivora (Walters-Conte and Johnson, et all, 2011).
In 2005, Wang and Kirkness performed an experiment after which ours in modeled. They
noted the evolutionary mapping possibility based on identifying and mapping SINEs,
Specifically they looked the CanSINEs in Boxers and Poodles to determine their linkage and the
identification of other unknowns as Boxer or Poodle. (Wang and Kirkness, 2005) In this
experiment, CanSINEs were observed to determine if they could be used to identify breeds. Both
the Poodle and Boxer genome has been published in their entirety. Primers were made to
observed SINEs that were either only available in the poodle or in the boxer. These two genomes
were our control and test to see which breeds were related to the poodle or the boxer. Based on
the results of the final primer test on an agarose gel, the SINEs should determine the breed and
then the breed will be reveal after the gel is visualized to determine if the experiment was
successful or not. First, PCR primers were designed for the regions of interest. Primers were
designed by using NCBI and the UCSC genome browser. DNA was extracted from buccal swabs
collected from dogs belonging to faculty of the Biology Department at American University. The
primers were designed to amplify loci that contained or did not contain SINE insertion in the
genome of the domestic dog. The designed primers were tested on control DNA to determine
their ability to work at standard conditions. If the primers were successful, they were used on an
agarose gel the next week with the DNA of the unknown dogs of the faculty. If CanSINEs are
evolutionary markers, then dogs of the same breed will have SINEs at certain homologous loci
and therefore SINEs can be used to identify breed.
Materials & Methods:
For Boxer+/Poodle – Regions:On the genome tab of the UCSC genome browser, change the group to mammal, genome
to dog, and assembly to July 2004. In the search bar, enter the coordinates of the putative SINE
region and press submit. Click “Browser” on the highest match. Look at the “Repeating
Elements by Repeat Masker” track. Confirm that there is a bar in the SINE category. Click on
the SINE bar. Click on the link that says “View DNA for this feature (canFam1/Dog)”. In the
options, add 100 extra base pairs to each side. Also check the “Mask Repeats” box with the “to
lower case” option set. Then press “get DNA”.
For Poodle+/Boxer- Regions:Use the GenBank accession number on the nucleotide database in NCBI to get the
GenBank record for that region. At the bottom of the page is the entire sequence entry. On the
genome tab of the UCSC genome browser and change the group to mammal, genome to dog, and
assembly to July 2005. Enter the sequence retrieved from NCBI in the BLAT tab. Get the results
for the highest match. Click the PCR tab on the ucsc genome browser. Paste sequences into the
boxes for the forward and reverse primers. Once hitting submit, only one result should appear,
meaning the primers are good and specific.
DNA Extraction: Sterile tweezers were used to transfer the buccal swab to the 1.5ml tube containing 500µl
of 10% Chelex solution and squish it into the solution. The tube was vortexed to completely
suspend the cells in the Chelex solution. The cell sample was heated for 20 minutes on a heat
block at 95°C. Sterile tweezers were used to remove and discard the swab from the tube. The
tube was spun in the microcentrifuge for 1 minute. The supernatant was transferred to a new
1.5ml tube using a 200µl pipette. The DNA in the sample was measured using the Nanovue
spectrophotometer. 2µl of the sample was put on the Nanovue. After the sample is read, the rest
of the sample was stored in the freezer until the next week.
Two weeks later, a PCR was run to test the designed primers to see if they work at
standard conditions. Primers were pre-diluted to 10µM stocks. In each of the ready-bead PCR
tubes, 2µL of the primer (both forward and reverse primers) were added, as well as 2µL of DNA
and 21µL of sterile H2O. 1% agarose gels were pre-made by the lab instructor. 10µL of the PCR
product was added to a microtiter plate that contained loading dye and mixed up and down using
a pipette. 10µL of the PCR product was added to the appropriate well in the gel. The gel was run
for minutes at 100mV and then visualized under a UV box.
The following week, PCR was run using the designed primers. The designed primers
were used on the sample DNA that was extracted a few weeks ago. Load 10µl of each PCR
product into an agarose gel. 10µl was pipetted into the microtiter plate that contained 1µl of the
loading dye in each well. The PCR product and the loading dye was pipetted up and down to mix
it. The mixture was pipetted into a well on the gel. The gel was run at 80V for 40 minutes. The
gel was then visualized under a UV light box. The data was analyzed to determine which loci
were SINE positive or SINE negative.
Results:
Table 1: List of Primer Sequences of Designed Primer
Primer Name Primer Sequence B2 F CCATAGTGTCTACATATCAAGAATACTACCACCGB2 R AAGAGTCAACCAGAAAGAGATGAAGGGG
Table 1 presents the primers that were designed to amplify SINEs at the B2 locus. The SINE is
Boxer - and Poodle +. The table shows the sequence of the forward and reverse primers used to
amplify the SINE.
Figure 1: Visualization of Agarose Gel of Designed Primer Test of Controls
Figure 1 shows the visualization of the gel that was run with primers testing the control DNA.
The primers that we designed were run in Wells 5, 6, and 7. There is a band in Well 5 and Well 6
and no band in Well 7.
Table 2: Data of Designed Primer Test of Controls
Primer
Name
Well Numbe
rSample Clean Product
ProducedExpected Size
B2 5 Control Yes- strong band 312bp
B2 6 Poodle Yes- strong band 312bp
B2 7 Boxer No 107bpTable 2 displays what primer and sample were run in which well of the agarose gel. The control
and poodle DNA both displayed a band at the same bp region. The poodle DNA did display a
band at all.
Table 3: Data of Primer Test Using Unknown Dog Breed Identities
Primer Name Order Sample
SINE Status
B2 1 1 -B2 2 5 +B2 3 6 +B2 4 7 +B2 5 8 UnknownB2 6 9 -B2 7 10 +
Table 3 presents the outcome of the designed primers with the unknown dog DNA at the B2
locus and whether or not the sample was positive or negative for the SINE at the locus. Samples
5, 6, 7, and 10 were SINE+ at the B2 locus. Samples 1 and 6 were SINE – at the B2 locus.
Table 4: Testing for SINE+ or SINE- of Each Dog Breed and Every Loci
Wed PM
Thurs AM
Thurs Noon
Thurs PM
Name BreedTube ID B2 P1 P2 B3 P5 P6 B4 B8
Nellie Boxer 1 -/- np np np np np np npDexter Lee Boxer 2 -/- -/- -/- smea
r np ? +/+
MidgeStandard Poodle 3 -/- +/+ -/- np +/+ ? np
OrionMinitaure Poddle 4 +/-
KoKo Toy Poodle 5 +/+ np np np +/+ np -/- +/-
SamBasset Hound/ Beagle 6 +/+ np np +/+ np np -/- -/-
AmicusFlat-Coated Retriever 7 +/+ np np np np np -/- np
Tilly Schnauzer Mix 8smea
r np np np np +/+ np np
TuckerHound/Beagle Mix 9 -/- np np np +/+ np np np
TikiriDoberman Pinscher 10 +/+ np np np +/+ np np np
Phoebe Labradoodle 11 np np np np +/+ np -/- +/+Zoey Labradoodle 12 np np np np np np -/- +/+Bailey Catahoula 13 np np np np +/+ np -/- +/-
Leopard
Googli
Wheaton Terrier Dachsund 14
npnp
np np +/+np -/- +/+
Saluki Beagle Shepard 15 np
ApolloHusky Shepard Mix 16 np
SamsonHound Retriver Mix 17 np np np np -/- np np np
Que
Am. Staf Ter/Bulldog Mix 18 np -/- np -/- np
Cockapoo Cockapoo 19 +/-Lucky Boxer Mix 20 np np np np +/+ +/+ -/- +/-
ZoeyGerman Shepard 21
ZarGerman Shepard 22 np np np np +/- +/+ -/- +/-
SnickersLab Mix Mystery 23 np np np +/+ +/+ +/+ -/- +/+
Carlini Dog Mix 24 np np np np +/- +/+ -/- +/-
SINE - size 107 bp
~120 bp
~125 bp 80bp 90bp
~200 bp 83bp
~75 bp
SINE + size 321 bp
404 bp
374 bp
300 bp
~350 bp
683 bp
~340 bp
304 bp
Table 4 presents the data collected from each class of each sample test for SINE+ or SINE- at
each locus. Np denotes no product, or no amplification. +/+ signifies SINE is present on both
chromosomes. -/- signifies SINE is absent on both chromosomes. +/- SINE is heterozygous,
which means it is present on one of the two diploid chromosomes and absent on the other. An
empty box denotes a sample that was not tested. For most breeds, P1, P2, and P6 showed no
product. P1 was Boxer – and Poodle+. P2 and B2 appear to be negative for both the boxer and
the poodle. Heterozygous SINE products are seen in multiple breeds at the B8 locus.
Figure 2: Visualization of Agarose Gel of Sample at Locus B8 Using Designed Primers.
Figure 2 shows an example gel of how the banding pattern could have looked at locus B8 for the
samples. This gel does not correlate with specific data of this experiment, but it is to show how
the gel turned out for the rest of the samples at the eight loci.
Discussion:The purpose of this experiment was to investigate the SINEs at different loci of different
breeds of dog against the known breeds who are either SINE+ or SINE- at that particular loci to
determine if CanSINEs can be used to identify domestic dog breeds. Boxer and poodle genomes
were used as controls. Eight different locus were tested: B2, P1, P2, B3, P5, P6, B4, and B8. 24
different dogs were tested. Two of which were boxers and 3 were poodles of different sizes.
Our group tested the B2 locus. Other loci data was collected from other groups and other
lab classes and compiled to create the data in Table 4. The primers that were designed are noted
in Table 1. As seen in Figure 1, the designed primers were successful because the SINE at locus
B2 is positive (present) in poodles and negative (absent) in boxers. Well 5 is the designed
primers run with a control DNA. Well 6 is the designed primers run with Boxer DNA. Both Well
5 and 6 show a strong band around 312bp which is the size expected for SINE+. Well 7 is the
designed primers run with Poodle DNA. Well78 did not show a band, signifying there was
nothing to be amplified at that location, meaning it was SINE-. Because the testing of the
designed primers was successful, they could be used to test the unknown dog breed DNAs.
For the next part of the experiment, the designed primers were used to test the DNA
collected from the dogs of the faculty. In Figure 2, an example gel is shown of how the gel
would have looked for the all the samples at the loci they tested for.
Table 3 identifies which samples were tested with our group’s primers for the B2 locus.
Samples 5, 6, 7, and 10 were SINE+ at the B2 locus. Samples 1 and 6 were SINE – at the B2
locus. Using Table 4, the breed of each sample can be identified to determine the success of the
findings displayed in Table 3. Sample 1 was SINE- and a boxer breed, which is the expected
outcome. Based on the control test of the primers, Boxers are SINE+ at locus B2. Sample 5 was
SINE+ and a poodle breed, which is in line with the expected outcome. Based on the control test
of the primers, Poodles are SINE+ at locus B2. There was a smear on sample 8, so the results
could not be read. Sample 6 was a Basset Hound/Beagle mix and sample 7 was a Flat-Coated
Retriever. Both breeds are SINE+ at the B2 locus. This can indicate that samples 6 and 7 are
more closely related to poodles than to boxers.
Looking at Table 4, there are many loci that had no product for many of the samples.
This can indicate that the primers were not exact enough and testing was not successful. Looking
at the lack of amplification seen across all the data, the data from this experiment is inconclusive.
From the data in Table 4 that was collected from other groups, being SINE+ or SINE – is
independent of breed. No conclusions can be drawn at either P1 or P2 loci because too many
samples had no product or no amplification seen. P6 and B4 appear to be random in that there is
no pattern to which breeds are SINE+ or SINE- at either of the two loci. B8 is the most telling of
the loci. At the B8 locus, SINE-, SINE+, and SINE +/- are seen. Because all three genotype are
seen, it is possible to draw conclusions about the evolutionary path of these breeds and the
closeness of relation to one another. No definite conclusions, however, can be draw because it is
only one locus and there needs to be other parts of the genome tested to compare and contrast to
make assumptions on identity and evolutionary paths. P5 appears to be sorted by breed. All
samples that are a poodle breed or poodle mix are SINE+. The B3 locus data is interesting
because no product was found for hardly any breeds except for sample 6, a Basset Hound/Beagle
mix, and sample 23, a Labrador mix mystery, where both were both SINE+ on at least one
chromosome. A possible conclusion draw from this data of this locus is that these breeds are
more related to each other than to any other of the tested breeds of the is experiment.
Overall the data from this experiment is very inconclusive. The conclusion that can be
made from this experiment is that CanSINEs are not well enough understood in function and
significance to identify breeds by their absence or presence. CanSINEs can be used to support
speciation from other breeds and find correlations between breeds. CanSINEs are useful but
cannot be used at determinants in identification of breeds or definite factors when building
phylogenetic trees. CanSINEs are a subclass of SINEs. The usefulness of SINEs was not tested
in this experiment, it was CanSINEs. The information stated in the introduction is not negated by
the findings of this experiment. SINEs are still hereditary and can be used as identification
markers between species. SINEs are informative genetic markers.
Discrepancies in the data and what was expected can be attributed to bad primers and
possible bad buccal swabs. The primers could not be exact enough and therefore not amplify the
SINE correctly. The DNA extraction from the buccal swabs of the dogs could have been done
incorrectly, or not enough DNA was extracted. To determine if CanSINEs can be used as
identification markers or not indefinitely, the experiment should be repeated. As an initial test of
the usefulness of CanSINEs, mixed breeds should not be used because their pedigree cannot be
surely identified. Repeated this experiment would ensure the conclusion of the usefulness of
CanSINEs is determining identity and evolutionary relationships.
References:
Walters-Conte, K., Salcedo, T. Transposable Element Dog Laboratory 2, 2.5, 5, & 6 Handouts. (2015)
Kramerov, D. A., & Vassetzky, N. S. (2011). Origin and evolution of SINEs in eukaryotic genomes. Heredity, 107(6), 487–495. doi:10.1038/hdy.2011.43
Walters-Conte, K. B., Johnson, D. L. E., Allard, M. W., & Pecon-Slattery, J. (2011). Carnivore-Specific SINEs (Can-SINEs): Distribution, Evolution, and Genomic Impact. Journal of Heredity, 102(Suppl 1), S2–S10. doi:10.1093/jhered/esr051
Wang, W., & Kirkness, E. F. (2005). Short interspersed elements (SINEs) are a major source of canine genomic diversity. Genome Research, 15(12), 1798–1808. doi:10.1101/gr.3765505