Pseudomonas flourescens: Sequencing of Strain L5.1-96 Clone PF003-D08

Acknowledgments We would like to acknowledge Bellevue College, Washington State

University, the National Science Foundation and the United States

Department of Agriculture for the opportunity to participate.

RK Razumovich and Eric Carpenter

Biology 211 Spring 2013 Abstract

The purpose of the ComGen project was to sequence the

genome of the L5.1-96 strain of Psuedomas fluorescens in

order to find the genes that account for its supercolonizing

ability, and what genes it shares in common with other

strains of P. fluorescens and other species of

Psuedomonas. This was done by purifying the plasmid DNA

of Escherichia coli (first culturing it), in which a plasmid had

been added that contained part of the genome from P.

fluorescens L5.1-96. The DNA was then sequenced using

PCR, then the DNA sequence analyzed and input into a

program called BLAST, which determined from the NCBI

database what proteins the sequence may possibly code

for.

Methods Bacteria Culture - Our first step is to Inoculate our Luria Broth. We put our clone,

PF003-D08, into the broth. The broth contains Kanamycin which

we use to kill cells that do not have our Plasmid’s resistance

gene. Our Plasmid contains the Pseudomonas fluorescens

gene insert and resistance to Kanamycin.

Plasmid Purification - With our broth inoculated we need to purify our plasmid in order

to study it. To do this we followed our Qiagen procedure

provided to us and a centrifuge to isolate our DNA from proteins

and other substrates.

Checking DNA Quality -

Our next step was to use a technique with Gel Electrophoresis,

a process used to check DNA quality and approximate length, to

determine if we have enough DNA to perform a Polymerase

Chain Reaction.

Sequencing Reaction –

Amplify the DNA fragments into different sized strands that can

be read by the sequencer. We are going to use two different

primers, SL1 and SR2, as well as Deoxynucleotides and

Dideoxynucleotides, and Big dye Terminator. These primers are

short pieces of DNA made in a lab and are necessary for DNA

Polymerase to attach to

Sequencing Reaction Clean-up –

With our DNA fragments amplified our next step was to clean up

the reaction so that our sequence can be read without

interference. Big Dye X Terminators act like a sponge, trapping

unreacted nucleotides, enzymes, and small fragments.

Bioinformatics –

With our sequence in hand, we utilize Blast (Basic Local

Alignment Search Tool) to compare to other known sequences

in the NCBI Database. We use the information we obtained from

this program to learn what our sequence codes for.

These Images Show the Difference Between Healthy

and Diseased Wheat Roots

Discussion

Blast Analysis from NCBI Database

SL1: For SL1 we blasted with a query length of 719

nucleotide bases. Our top results code for a

Glycine/Betaine Catabolism Protein with 98% Query

Coverage, 99% Max Identity and an E-value of 2e^-

171. Accession Number ( YP 004354986.1). This

transport protein is an enzyme called

Oxidoreductase that catalyzes the oxidation of one

compound with the reduction of another and can be

found in the complete genomes of Pseudomonas

brassicacearum subsp. brassicacearum NFM421 and

Pseudomonas fluorescens F113.

SR2: For SR2 we blasted with a query length of 415

nucleotide bases. Our tope results code for a

Phenylacetic Acid Degradation-Like Protein with 98%

Query Coverage, 99% Max Identity and an E-value of

4e^-94. Accession Number (YP 005207507.1) This

protein is responsible for Phenylacetic Acid

degradation in bacteria and can be found in the

complete genomes of Pseudomonas brassicacearum

subsp. brassicacearum NFM421 and Pseudomonas

fluorescens F113.

References

Bangera, M. G. Take-all, Wheat, and the Genetics of Pseudomonas

fluorescens. PDF Presented April 2013.

https://bc.instructure.com/courses/814475/files/24715009?module_ite

m_id=5231716

BLAST: Basic Local Alignment Search Tool. Used April-May 2013 via

National Center for Biotechnology Information

http://www.ncbi.nlm.nih.gov

Introduction

The ComGen project addresses the issue of take-all disease,

a fungus (Gaeumannomyces Graminis var. tritici), that

grows into and binds to the rhizosphere of the wheat

(Triticum aestivum) root, and chokes off the water and

nutrient supply, causing the plant to die. Take-all is able to

thrive in Eastern Washington because of the prevalent

moisture. There have been many different techniques

attempted to control the disease, most unsuccessful.

Pesticides and chemicals are unsuccessful and cause

pollution, burning causes pollution, crop rotation is not

economically viable, growing resistant varieties has been

unsuccessful, and tilling leads to soil erosion. The most

effective method is biological control, which is using an

organism or its products to remove undesirable organisms.

Suppressive soils which contain very high levels of the

bacteria Pseudomonas fluorescens are effective in treating

take-all disease and causing take-all decline. This is

because of 2,4-diacetylphloroglucinol, or DAPG, an

antibiotic that P. fluorescens produces. One strain of P.

fluorescens, L5.1-96, seems to fare better than any other

strain previously isolated. It grows very aggressively, is a

super colonizer (rapidly and readily colonizes the

rhizosphere of wheat roots), and is very hardy. It survives

longer in the rhizosphere than any other strain of P.

fluorescens.

Results

SL1AGCTTGATTCGTTCTCACCGGTCATTGGCGGGCAGACCCTCTTCCGCTGCTACACCCTG

TCGTCCTCCCCGACCCGGCCCTTTGCGTTTTCCATTACCGTCAAACGTGTGCCGGGGGGCGCG

GTATCGAACTGGCTGCATGACCACCTCAAGCCCGGCGACAGCCTGAAGGCGTCCGGTCCGGC

GGGCAGCTTTACACCGGTCGGCCATCCTGCGACCAAGTTGTTGTACCTGTCGGCCGGCTCGGG

TGTAACGCCCCTGATGTCGATGACCCGGGCCGCCTGCGACATGGCCGGCAACCTCGACATTGT

CTTCGTACACAGCGCGCGTACTCCTGCCGATATCATCTTCCACGCAGAATTGACGCGCATGCAG

GCCGCCATGTCGGGACTGCGGGTCATCAGTGTGTGCGAAGGACTTGGCGACACCGCTCAATG

GCAGCAACCGATAGGCCGGCTCGATTTGCCGTTGCTGAGCCAGCAAGTGCCGGACTACAAGG

AACGGGAAATCTTTACCTGTGGTCCCCAGGGCTACATGGAAGCGGTCAAGTCGCTGCTCAGGG

AAGCGGCGTTCGATTTCGCCCACTATCATCAGGAAAGCTTCGACATCAGCGCACTGAACGAGG

AACCGTTGCTCGAGCAAGCCCCTTCCCTCGATCAGCAGGAGGTGTTCACGGTAACCTTGTCGC

GCTCGGGGAAGACGTTCAGCATGCCGGGCAAT

SR2GTTGGCCCGTCCGCTTTCAGCAATATGGCCTGCCAGATGGCACCGTATTTCGGCACCAT

CAACCCGGAAATTTCTGTGTTGACCCCCGGTCGCGGTGAAGTGAAGGTGCCGTTTCGCAAGGA

AATCACCAATCACCTGGCGTCCGTTCACGCGATCGCGTTGTGCAACGCGGCAGAACTGGCGGG

TGGGATGATGACCGAGGTGTCCATCCCCAGCGGCGCGCGCTGGATTCCCAAAGGCATGACCGT

CGAGTACTTGGCCAAGGCCAAGACCTCCATCCATGCGATTGCCGACGGTAGCGAAATCGACTG

GCAGACTTCGGGCGACAAGATTGTCCCGGTCGAGATCTTCGACGAGGCTGGGGTGAAGGTCTT

CACGGCGCGCATCACCATGAATGTGAAAATCGGCTAGGTCG

Our Gel Electrophoresis Results

Example of Glycine/Betaine Protein (Left) and

Phenylacetic Acid Degradation Protein (Right)