Transcript
Page 1: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Decoding our

bacterial overlords

Dr Torsten Seemann

Page 2: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

A bacterium

Page 3: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Bacteria are diverse

Page 4: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

5,000,000,000,000,000,000,000,000,000,000,000

000,000,000,000,000,000,000,000,000,000,000,

000,000,000,000,000,000,000,000.

Bacteria run the show

100,000,000,000,000

1,000,000

90% microbial

Page 5: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Help digest

our food

Essential for human life

Immune systemSynthesize

vitamins

Page 6: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

“Good” E.coli “Bad”

(colon) (bladder)

Bacteria are not malicious

Page 7: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

6,000,000,000

letters

The blueprint of life

GenomeA T G C

4,000,000

letters

Page 8: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Extract

the DNA

Reading the genome

Chop it into

small piecesRead DNA of each piece

Page 9: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

We had a bunch of nice long DNA(each 4 million letters long)

We got back millions of short DNA (each only 200 letters long)

We want our nice long DNA back!(please)

Can’t always get what you want

Page 10: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Reconstruct the DNA of the chromosome(s)

Genome assembly

Page 11: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

● No box

● Millions of pieces

● Missing and duplicate pieces

● Broken pieces

● No corner or edge pieces

→ Usually end up with ~200 sequences

Like a jigsaw puzzle, but ...

Page 12: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Contains ~4,000 genes

Each gene is ~800 letters long

Genes start and end with special triplets

Finding genes

←ATGCATGATTAGCTTTTAGTCTTATAATGTCTTATATATCGCATTTAAGCCCTGATTCTATGAATG→

Genome is ~4,000,000 letters long

Page 13: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

● Identify new species

● Find resistance genes

● Understand evolution

● Trace outbreak origin

Applications

Page 14: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

2000 finished genomes

10,000 assembled draft genomes

200,000 downloadable genomes

2,000,000 sitting on USB disks?

Genome assembly is different

- RAM more useful than CPU

Computational challenge

Page 15: Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014