Transcript
Page 1: For more information on Ruan’s environmental and ... · RuRRuann hhass aalwlayys sbebliieveevvedd tthahhatt t wewwe aaree mmorore ee thtanan aa ttraansnnsspoortrrtataatioion nn

When the world prof i ts, our cl ients do, too.

For more information on Ruan’s environmental and sustainability initiatives,

please contact us at 866-782-6669, or visit www.ruan.com.

3200 Ruan Center / 666 Grand Avenue / Des Moines, Iowa 50309 / (866) 782-6669

www.ruan.com

© 2011 RUAN25%

Cert no. XXX-XXX-XXX

Page 2: For more information on Ruan’s environmental and ... · RuRRuann hhass aalwlayys sbebliieveevvedd tthahhatt t wewwe aaree mmorore ee thtanan aa ttraansnnsspoortrrtataatioion nn

We are determined to make our trucks — and the industry’s trucks —

cleaner and more efficient. It’s an effort Ruan has been leading since

long before the environment was a front-page topic.

RUAN RECOGNIZES THAT EFFICIENT TERMINALS AND WORK SPACES IMPROVE THE ENVIRONMENT AND THE BOTTOM LINE.SEVERAL OF OUR BUILDINGS ARE CURRENTLY UNDER CONSIDERATION FOR LEADERSHIP IN ENERGY AND ENVIRONMENTALDESIGN (LEED) CERTIFICATION, AND WE WILL CONTINUE TO DEVELOP ENERGY-EFFICIENT LOCATIONS IN THE FUTURE.

A moralimperative.A businessopportunity.

DDDrrriiivvviiinnnggg tttooowwwaaarrrddd aaa cccllleeeaaaannneeerrr wwwooorrrlllddd...

GlGlGlGlGGG obobobobobbalalalalaa w w w wwwwarararararrarmimimimimimimingngngngngngngn ,, , , ozozozozozozozozzononononononone e e e e ee e dededededededeeeplplplplpplpletetetetetetetettioioioiooioooi n,n,n,n,n,n,n,n,nn o o o oo ooooilililililililil s s s ssssspipipipipipipipp llllllllllllllllls s s s s sss ananananananananannd d d d d d d d d ototototototototheheheheheheeheheer rr rr r r hahahahahahahahahhahazazazazazazazazazz rdrdrdrdrdrdrdds s s s ssssss hahhahahahahhahahaveveveveveveveveveve m m mm mmmmmmadadadadadadadadadde e eee ee AmAmAmAmAmAmAmAmAmAmerererererererererricicicicicicicicicananananananananaa s s ss s s ss acacacacacacacacaacututututututututuuteleleleleleleleele y yyy y y y awawawawawawawwawawa ararararararararara e e e e eee ee ofofofofofofofofofof p p p ppp p pototototototottotenenenenenenenenenee titttitititttt alaalalaaalaal d d d d dddananananananaa gegegegegeggeersrsrsrsrsrs...

ThThThThThThThThatatatatata ’s’s’s’ss w w w w whyhyhyhyhyhyhy f f f f f fororororororrwawawawawawawawaw rdrdrdrdrrdrdr -t-t-t-t-t-tthihihihihih nknknknknknknkkininininnnnnng g g g g gggg cocococococococcompmpmpmpmpmppanananananananananananieieieieieies s s s ss lilililililiiliiikekekekekekekekekekeekke R R RRR RRR RRuauauauauauauauuan n n n nn n nn hahahahahahahahahaaavevevevevevevevevev i i i i i i iinvnvnvnvnvnvnvnvnvnvvn esesesesesesessesese teteteteteteteteteed d d d dd d d d sosososososoosoo m m m mmmmmmmucucucucuccucucucuch h h h hhhh hh titititiititittt mememememememememememem , ,, , , momomomomomomomomomoneneneneneneneneney y y yyyy yyyy anananananananananaand d d d d d dddd efefefefefefefefefeffofofofofofofofofofoortrtrtrrtrtrtrtrtrt i i iin nn n n n nn n n susususususususus ststststststttaiaiaiaiaiaiaiaia nanananananananananabibibibibibibbibililillillitytytytytytytytyty i i i iiininininiinininin tititititititittt atatatatatatatativivivivivivvvesesesesesss....

TrTrTrTrTrTrTrananananananspspspspspppsppporororortatatataaatitititititiionononononononn c c cc c ccomomomomomomompapapapapapapaaanininininininin eseseseseseseses m m m m mmususususususuu tt t t tttt t dedededededdededededevevevevevevevevevevelolololololoooop p p pppp sususususususususss ststststststststsststaiaiaiaiaaaa nananaaanananananablblblblblblblblble e e e e e e eeeee sososososososososoolulululuululuuuuutitititititttt onononononononono s s sss s s ifififififiiiif t t tt ttttheheheheheheheehehey y y y y y yyy arararararaararaarare e ee ee totototototoootoo a a a aa aaaattttttttttttttttttrararararararrarrr ctctctctctcttttt n nn n nn newewewewewewewwewwww c c c c cccccususususususuusussstototottotototott mememememememememersrsrsrsrsrsrsrrss a a aa a a aaaandndndndndndndndndd n n n n nnn newewewewewewewewewwew e e e e e eeee eempmpmpmpmpmmpmpmpplololoolooyeyeyeyeyyeyey esesesesessss,,,,

imimmimimmprprprprprprovovovovovovvvve e e e ee opopopopopopoppperererererrre atatatatatatioioioiooioonsnsnsnsnnnn a a a aaaaaaandndndndndndndn p p p ppprororororororoor vivivivivividededededededee s s s sssssssolololollolllututututututututioioioiioioioioioiionsnsnsnsnsnsnsnsns t t ttt tthahahahahahahahahat t t t t tttt t imimimimimimmmimpapapapapapapaapactctctctctctctctctct ccc c c c ccc cliliilililiiliienenenenenee tststststststststst ’’’ ’ ’ ’’ ’ bubububbubbubb sisisisissineneneneneneenen ssssssssssssssssss esesesessesesee .....

RuRuRuRuRuRuRRuRuananananananannn h h h h h hhasasasasasassass a a a a a aaaaalwlwlwlwlwlwlwl ayayayayayayayayys s s s s s ssss bebebebebebb lililililiiieveveveveveevevededededededdeddd t t t t t ttthahahahahahahahahhhah tt t ttttttt wewewewewwewewewe a a a a aaarererereeeeee m m m m m mmmororororororororrooo e e e e e ee e e ththththththththt ananananananananna a a a aaaa aa t t t t t tttrarararararararaansnsnsnsnsnsnsnsnsnsnnsnspopopopopoopoopopoportrtrtrtrtrtrrtatatatatataata ioioioiooioioiooi n n n nnn cococococococococoompmpmpmmmpmpmppanananananananannany:y:y:y:y::y:yy:y: w w w w w ww w wwwe e e e eeee ararararararararaa e e e e eeeeee papapapapapapapapartrtrtrtrtrtrtrt o o o o ooo oof f f ff fff ff f ththththththththe e eee eee cococococococoococommmmmmmmmmmmmmmmmmunununununununnu itititititttttttieieieieieieieiei s s s s ssssss wewewewewewewwww s s s sssssserererereeeeee vevevevevevevev ...

ThThThThThThThatataatatat’s’s’s’s’s’s w w www wwwwwwhyhyhyhyhyhyhh w w w wwwwe e e e ee eee viviviviiviviiewewewewewewewewewe s s s ss ss susususussssstatatatatatatatataaininininniniii ababababababaaba ililililililitititittty yy y y yy y asasasasasas m m m mmmmmmmorororororororororoo e ee e e eeee thththththththththanananananananann g g gg gggggooooooooooooooooooood d d ddd ddd bububububububububub sisisisissss nenenenenennn ssssssssss; ; ; ; ;; itititititit’s’s’s’s’s’s a a a a aaa m m m m mmororororororrorororrralalalalalalaaa i i i i i impmpmpmpmpmpmpmpm ererereeeererratatatatatatatatta ivivivivivivivivivive.e.e.eee.e.e. W WW W W WWWWWWe e e e ee eeee arararararaa e e e e dededededededededeteteteteteet rmrmrmrmrmmmmininininininninninededededededededd t t t t tt tto o o o ooooo mamamamammamamm kekekekekekeke

ououououour r r r r rr trtrtrtrtrtrrrucucucucucucucucuckksksksksksksksksk —————— ananananananananana d d d d dddd ththththththththhe e e e eee inininininininininni dudududududududdd stststststryryryryryryryry’s’s’s’sss t t t tt trurururururuurur ckckckckckckckckckksssssssss ————— clclclclclccclc eaeaeaeaeaeaaanenenenenenenenn r r rrrr r r anananananannna ddd d d d dd momomomommomomm rerererererereee efefefefefefeffe fifififififfifificicicicicicicccc enenenenenenent.t.t.t.tt I I I IIt’t’t’t’t’t’t s s s ss sss ananananannannan ee e e eeeeeeffffffffffffffforororororororrort t t tt ttt RuRuRuRuRuRuRuRuRuuanananananananan h h h hh hhhhhasasasasassas b b b bb b b bbbeeeeeeeeeeeeeeeen n n nn nnn lelelelelellelleadaadadadadaadininininininininnng g g g g g gg sisisisisisisisincncncncncncn e e e e e lololololool ngngngnggngggggg

bebebebebebebeefofofofofofofofoorerererereereerere t t t tt t t t t tthehehehehehehehehehhhhe e e ee eeeeeenvnvnvnvvnvnvnvnviririririririronononononnnonmememememememeeementntntntntntntnttn w w www wwwwwasasasasas a a a aaaaa aa f f f frorororoorrorororontntntntntntntnttnn -p-p-p-p-p-p-pppagagagagagagaggge e e e eeee tototototoooopipipipippppp c.c.c.c.c.ccc

SiSiSiSiSiSiSiSiSincncncncncncncnnn e e ee e e e thththththththhththe e e e ee eeeee 191919191919191919199980808080808088080s,s,s,s,s,s,s,s,s w w w wwwwwwheheheheheheheheheheen n n n n nn nnn weweweweewewewewewe h h h h hhhheleleleleeleeee pepepepepepepeped d d d ddd dededededededdd veveveveveevev lolololooooop p p p ppppp thththththhhhhe e e e eee fififififf rsrsrsrsrsrsrr t t t t ttt trtrtrtrtrttrtrucucucucucucck k k k kkkkk cacacacacacapapapapapapap blblblblblblbbbb ee e e ee ofofofofofofoff t t t t ttttrarararararrararar vevevevevevelilililingngngngnggnngngng 1 1 1 11 1 m m m m mmmmilililillililililiil onononononononnn m m m mmmmmilililililileseseseseeee w ww w wwititititititthohohohohohohoh ututututututt m m m mmmmmmmajajajajajjajorororororor r r r rrrrrepepepepepepepe aiaiaiaiaiaaiir,r,r,r,r,r,rrr,r,, w w w w ww wwe’e’e’eee’e’eeee veveveveveveevev

cococococococoocontntntntntntntnn ininininnnnninnnueueueueueueueueueueed d d d dd dd tototototototottototo i i i iiinvnvnvnvnvnvnvnvnvnvesesesesesestititititiiitiigagagagaagaagagagateteteteteteteteete e e e ee eeefffffffffffffffff iciciciciciccicccieieieieieeeieeeencncncncnncncncncy y y y yy ananananananaa dd d d d ddd susususususususuuststststststaiaiaiaiaiainananaaanaabibibibbibb lililililll tytytytytytyty i i ii innnnnnnnnnn ovovoovovovovvvatatatatatatatioioioioioioioionsnsnsnsnsss i i i iincncncncncncnn lulululululululuuudididididididdid ngngngngngngnggn c ccc c cccleleleleeleleananananananerererererererr-b-b-b-b-b-b-burururururuu ninininingngngnggngngg f f f ffffffueueueeueeelslslslslslsls, , , , lilililiiighghghghhghghghtwtwtwtwtwtwtwweieieieieee ghghghghghht t t t ttt eqeqeqeqeqeqequiuiuiuiuiuiiuiuipmpmpmpmpmmmpmeneneneneneneeent,t,t,t,tt,

eneneneneneneenenerererererererererergygygygygygygygggyyg c c cccc c ccccccconononononononononono seseseseseseeeservrvrvrvrvvatatatatattatatata ioioioioooioioion n n nnn nnnn ananananananananananand d dd d ddddd momomomoomomomomom rererererrereeer .... WeWeWeWeWeeeWeeee a a a aaaaaarererereererere l l l l l lleaeaeaeaeaeaeaeadididididididdd ngngngnggngngng t t t tttttheheheheheheee t t t t trararararaaansnsnsnsnsnsn popopopopoportrtrtrtrtrtatatatatatattatioioioioioioioi n n n n n n inininininininindududududududustststststststryryryryryryry i i i iiintntntntntntnto o o o o o oo a a a a aaaa nenenenenennnew w w w w ww w ererererererre a a a aaaa ofofofofofof e ee e eenvnvnvnvvvviriririrrririronononononoononmemememememememmem ntntntntntntnttn alalalalalalaaa r r r rrrrrrreseseseseseeespopopopopopoponsnsnsnsnsnnnnnsn ibibibibibbbbbbililillilililillittititittitititty.y.y.y.yyy.yy.yy

Page 3: For more information on Ruan’s environmental and ... · RuRRuann hhass aalwlayys sbebliieveevvedd tthahhatt t wewwe aaree mmorore ee thtanan aa ttraansnnsspoortrrtataatioion nn
Page 4: For more information on Ruan’s environmental and ... · RuRRuann hhass aalwlayys sbebliieveevvedd tthahhatt t wewwe aaree mmorore ee thtanan aa ttraansnnsspoortrrtataatioion nn

HHHeeelllpppiiinnnggg aaattt hhhhooommmmeee... HHHeeelllpppiiinnnggg iiinnn ttthhheee wwwooorrrlllddd...

AtAtAtAtAtAt RR R R R Ruauauauauauauan,n,n,n,n,nnnn w w www w wwe e e e eeeee arararararaarara e e e e ee eee cocococococcoooooooommmmmmmmmmmmmmmmmititititititititittteteteteteteteteet dd d d d d d tototototototo t t t tttthehehehehehee e e e ee eeeeenvnvnvnvnvnvvnvnvnviriririrririrrrronononononnmememememememmmmmemmementntntntntntntt a a a aaas ss sssss s wewewewewwewewellllllllllll a a a a a aaaas s sss ss thththththt e e e ee cococococococ mmmmmmmmmmmmmmm unununununitititititititii ieieieieiiiei s s s s ss wiwiwiwiwiwwwwwww ththththththththhtt inininininii o o oo ooooourururururururur ee e eeenvnvnvnvnvnvnvnvnvn iriririrrirrononononono memememememeeentntntntntnttt. . .. . . OuOuOuOuOuuOuuuOuur r r r rrrrr dedededededededdedididididdicacacacacac tititititititit onononononon t t t t tto oo o o o

ththththtthhhhesesesesesesesesesesee e e e e eee eee prprprprprprprinininininnii cicicicicicccc plplplpplplp esesesesesesessss w w w wwwwwwasasasassasasa r r r rr rrrecececececeeeeee eneneneneneeenentltltltltltt y y y y y yyy dededededeeeemomomomomomomomooonsnsnsnsnsnsnsn trtrtrtrtrtrt atatatatattttedededededededededde t t t t t ttttthrhrhrhrhrhrhhh ouououououuououghghghghghghghghghgh o o o oooooourururururrur r r rr rrresesesesesesesesse popopopopopopopooponsnsnsnsnsnsnse e ee eee totototototottotoo t t t tttthehehehehehehh h h h h hururuurururrururu ririririririrrr cacacacacaacacaccaccaneneneneneeenen s s ss sssss inininininininiii ttt ttt tthehehehehehehehe G G G GGG GGGGulululululuuuu f f f f fffffff rerererererrer gigigigigigionononononononon, , , ,, ououououououououououour rr r rrrr rererererererr spspspspsppppononononononnnseseseseseseseseseseses t t t t ttt tttooooooooo

ththththththththe e e e eeeee CaCaCaaCaCaaCaCaaaalililililililifofofofofofofofofornrnrnrnrnrnnnrnrniaiaiaiaiaiaiaaa w www w wwwwililililiii dfdfdfdfdfdfdfdfdddfiriririririresesesesesesesesee a a a aa aaandndndndndndddnd oo o ooooooururururuuuuu a a a aaaasssssssssssssss isisisisisisisisiistatatatatatatatataancncncncncnnnncnn e e e e ee ee wiwiwiwiwiwwiwww thththththt t t t tttttthehehehehehehehehh t t t ttttororororororororornanananananannanan dododododododododooesesesessss a a a aaaandndndndndndddd f ff fffflololololololoododododododoo inininininnnnininni g g g g g g thththththththtthatatatatatatata d d d dddddddevevevevevevevevve asasasasasassaa tatatatatataaatetetetetetetetett d d d d dd dddd thtththththttt e e e e eee MiMiMiMiMMMM dwdwdwdwdwdwdwwdd esesesesesesst.t.t.t.tt.t.t. I III IIIn n n n n ththththththtthththeseseseseseese e e e eeeee

ininininninststststststststtstanananananananannancececececececececececccc s,s,s,s,sss,ss, R R RR R RRRRuauauauauauau n nnn n n n prprprprprprprprprprovovovovovovovovididididdididdddedededededededded f f f fff ffooooooooooooo d,d,d,d,dddd a a a aaaaaidididididdiddd, , , ,, , clclccclclclclcc ototototooo hihihihihhihhh ngngngngngngngnn a a aaa aandndndndndndndnddn r r r rrr rr refefefefefeffffriririririririgegegegegegegeg rarararaaraateteteteteteted d d d d sstststststorororororo agagagagagagagge e e e e e anananananananaa d d d d dd cocococococoooololololoooo ininininnininng g g g ggg ststststststststatatatatatatatioioioioioioionsnsnsnsnsnsnsn ....

WiWiWiWWiWiWiWiWW thththththththththh t t t t tttt tttheheheheheeheeehe W W W WWWWWWWWWWorororororrorrldldldldldldd F FF F FFFFFooooooooooooooooo d d ddd d d PrPrPrPrPPrPrPPrP izizzizizizizze,e,e,e,e,e w ww w wwwwee e e e eeee exexexexexexeeextetetetetetetendndndndnn o o o oooooourururururuuruu c c c ccccomomomommmommmumumumumumumunininininnnn tytytytytyyy c c c ccccomomomomomomommmmmimmimimimmm tmtmtmmtmmenenenenenenennt t t tt t totototototototot t t t tttheheheheheeheeheh w w w wwwwwwororororoo ldldldldddld. . . ThThThThThThThe e e e e eee WoWoWoWoWooWoorlrlrlrlrld d d dd dddd FoFoFoFoFoFoFooodododododd P P P P PPPririririrrrr zezezezezeeze i i i iiis s s s s ththththhththe e e e eee ee fofofofofofofooorererererererererremomomomomomomommom ststststststsssst

inininininninini teteteteteteteeeternrnrnrnrrnrnrnrnrnrr atatatataatatatatatioioioioioioiooioionananananannanaalll lll awawawawawawawwwwwarararararararararrdd dd d d ddd rerererereeereerecocococococococogngngngnngnggngg izizzizizzininininiinnining g g g g gg gggg exexexexexexexexcececececececeecc lllllllllll enenenenenenenenenncececececececece a a a a a aaaaandndndndddd p p p p p p pprorororororogrgrgrgrgrgg esesesesesesss s s s sss inininininnin o o o ooooveveveveveveveveercrcrcrcrccccomomomomomomomoo inininininini g g g g g ggg glglglglglglglgg obobobobobobobobalalalal f f f ffffoooooooooooooood d d d ddd prprprprprprodododododododucucucucucucccctititititititit ononononononononoon a a a aandndndndndndndnnd d d d d d d ddisisisisisistrtrtrrtrrribibibibibbibbbututututututuuuu ioioioioioioioioioon nnnn n n nnn nn

chchchchchchchchchchhalalalalalaalalalalla leleleleleleleleelelengngngngngngngngngnggesesesesesesesseseses.. .. ItItttItItttt w w w wwwwwwasasasasasasasaa c c c c c ccrererererererereereatatatatatatatataaa ededededeedededed i i i ii i iin n nn nnnnn 191919191191919191 86868686866868 b b b b bbb b by y y y y y y y yy NoNoNoNoNoNoNoNoobebebebebebeeb l l l l l LaLaLaLaLaLaLLL urururururururureaeaeaeaeaaeae tetetetetetetee D D D DDDDDr.r.r.r.rr N N N NNNNorororororrrorormamamamamamam n n n n BoBoBBoBoBoBoBorlrlrlrlrrlrlauauauauauauaug,g,g,g,g,g,g,g a a a aaandndndndndndndnd i i i i iitstststsstss $ $ $ $$$$$2525252525252250,0,0,0,0,0 00000000000000 0 0 0 0 000 ananananananaannunununununualalalalalalal p p p ppppririririririiizezezezezeeze h h h h hhhhononononnnononnoroorororororororors s ssss s ss thththththththththhtht e e eeeeeeee

lilililiililililiil fefefefeefefefefettitttititititimememememememememe a a a aa aaaaaachchchchchchchchchcc ieieieieeieeieeveveveveveveveevevememememememememenntntntntntntntn s s s s sssss ofofofofofofoffoff i i i iii iindndndndndndnddndndn ivivivivvvvvvidididididuauauauauauauaalslslslsllslsls w w w w wwwhohohohohohohoho h hhh hhhavavavavavave e e e e eee adadadadadadadvavavavavavavav ncncncncncncncnn edededededdeded h h hhh hhhumumumumumumumananananananana d d d d dddddevevevevevevvelelelelelelele opopopopopopoppmmemememememmem ntntntntntnt b b b bbbby yy yy y imimimimmmimprprprprprrprrovovovovovovovooo ininininnnnng g g g g gg thththththththhe e e eeeee quququququququalalalalalalala ititititititity,y,y,y,yy q q q qqquauauauauauauantntntntntnttitititittititittty y y y y y yyy y ororororrororororooo

avavavavavavavavaavaiaiaiaiaaiaiaa lalallalalalalalalal bibbibibibbibbb lilililililil tytytytytytytytyy o o o oo oooof f f f f f fofofofofofofofofooodododododododood i i i iiiiiiin n n n nnnnnn ththththththtthhe e e e eeeeeee wowowowowowoworlrlrlrlrlrlrlrlrld.d.dd.d.ddd

JooJoJoJoJoJoJoJoJohnhnhnhnhnhnhnhnhnhnnn R R R RRRRRRRRuauauauauuauaaauan nn n nnnnnn asasasasaaasasaaa susususususususs mememememememememed d d ddddd d spspspspspspspsponononononononono sosososososos rsrsrsrsrssshihihihiiiiiipp p p p ppppp ofofofofofof T T TTTTTThehehehehehehehhee P P P PP PPrirriririrrizezezezezezezeze i i i ii i nn n n nnnn 19191919191919199090909090909000 a a a a a ftftftftftterererererereeeee t t t t tttthehehehehehehe o o o o oriririririgigigigigigiginanananaaaaall l l spspspspspsppppppononononononsosososoososor r r r rrrr wiwiwiwiwwww thththththththdrdrdrdrddd ewewewewewwewwe s ss ssssupupupupupupuuuu popopopopopopop rtrtrtrtrtrtrt, , , , ananananannd d d d d laalalalaateteteteeteteer r r r rr r pepepepepepepep rmrmrmrmrmrmrmrmrmmmmananananananaaaaa eneneneneneneeenentltltltlttttttltlyyyyyyyyyyy

eneneneneneeee dodododdododododooooodd wewewewewewewewweed d d d dddd dd ititititttitititit w w ww w w wwwwititititititititth h h h hhhhh $$$$$$$$$$1111111110 0 0 00 000 mimimimimimimimmm lllllllllllllioioioiooioioion n n n nnnn tototototootototoo e e e eeeensnsnsnsnsnsnsururururuuuu e e e ee ee itititititititi s s s s sss tetetetetetetetenununununununun rerererererere i i i iiiin n nnn nnn DeDeDeDeDeDeDes s s s ss MoMoMoMoMoMoMoM ininininninnnneseseseseseses, , , ,, IAIAIAIAIAIAI .. . . WiWiWiWiWiWiWW ththththththh DD D D D D Dr.r.r.rrr.r B B B B BB BBorororororororoorlalalalalalalal ugugugugugugug,, , , ,, hehehehehehee c c c cccrererererereeatatatatata ededededeededede a a a a a a aandndndndndndnd s ss s ssupupupupupupupuppopopopopopopoppop rtrtrtrtrtrttedededeeddededdded t t t ttttt tthehehehehehhhh

GlGlGlGlGlGGlGlGG obobobobobobobooo alalalalaalalall YoYoYoYoYoYoYoYoYoYoY ututututututtttuth h h h hhhhh InInInInInInInInnstststststststststs itititititttititutututututtutute e e e e eee tototototototototo h h h hh hhhelelelelelelellp p p p ppp pp spspspspspspspsppurururururururr a a a a a a andndndndndndnd e e e ee e encncncncncncncououououououourarararararar gegegegegegegeg t t t ttttthehehehehehehehhh n n n nn nexexexexexexexxxxt t t ttttt gegegegegegegenenenenenenenenerararararararatititititittt onononononononon o o o oooo oof f f f fff scscscscscccieieieieieiei ntntntnntntntn isisisisssisstststststststs a a a aaaaandndndndndndnd a a a aaaagrgrgrgrgrgrgrggricicicicicicculululululululu tututututututuuurararararararal l l l l l leleleleeeeadadadadadadadererererererrs.s.s.s.sss.s H H H HHHH HHisisisisisisisisiss

sosososooosos n,n,n,nn,nnn J J J J JJJJJohohohohohohohohohhnnnnnnnnnn RuRuRuRuRuRuRuRRR ananananannaan I I I I IIIIIIIIIII, , , , hahahahahahahahaass s s ss cocococococococontntntntntntntntntininininininnnueueueueueueueu d d d d ddd hihihihhihh s s s ss fafafafaaaathththththhththererererererer’s’s’s’s’ss p p ppp p pasasasasasaassisisisiisiononononononon. ... ThThThThhThThThe e e e eee NoNoNoNoNoNoNoNN rmrmrmrmrmmmmmanananananana E E E EEEEE.. . BoBoBoBoBoBoBoBoorlrlrlrlrlrlrlr auauauauuauuauug g g g g g g WoWoWooWoWoWWoW rlrlrlrlrlrlrr d d d d ddd FoFoFoFoFoFooodododododododo P P P P PPPPPririririiririzezezezezezz H H H HHH HHHHHalalalaaall lll lll ofofofofofoo

LaLaLaaLaaaururururururururu eaeaeaeaeaaeatetetetetetet ssssssss ————————— spspspspspspspss eaeaeaaaeaeaaarhhrhrhrhrhrhrhheaeaeaeaeaaaae dedededededeeed d d d d dd dd bybybybybybybybb J J J J J JJJohohohohohohoho n n n n n n n RuRuRuRuRuRuRuR ananananananananaa I I I IIIIIIIIIIIIIIIIIII aaa aaaaaandndndnndnn t t t t ttttheheheheheheheee C C C C C Citititititity y y y yyy y ofofofofofofof D D DDDD DDeseseseseseses M M M MMMMMoioioioioioioio nenenenenenenessssssss ———————— isisisisississ eee e e e eexpxpxpxpxxpxpxpececececececectetetetetedd d d d dddd totototototo b b b b b b e e e e eee cocococococococ mpmpmpmpmpmpmppleleleeleeeteteteteteteteteed d d d d d d d ininininininin 2 2 2 2220000000001111111111 1 1 1 1 ananananananaana d dd dd ddd

wiwiwiwiwwww lllllllllllll s s s s ss sserererererereereee vevevevevevvvve a a a aaaaas s s s ss ththththththttt e e e e eeee pepepepepepepepeermrmrmrrmrmrmrmrr ananananannnnenenenenenent t t ttt hohohohohoomemememememememm o o o o o o of f ffff f ththththththththhe e e e e ee WoWoWoWoWoWoWoWW rlrlrlrlrlrlrld dd d d dd FoFoFoFoFoFoFoFF ododododdodd P P PPP PPPririrririr zezezezezezze...

Ruan employees volunteer to build sustainable communities. Amb. Kenneth M. Quinn, Hon. George McGovern, Hon. Robert Dole and Ruan Chairman & CEO John Ruan III

A globalcommitment

to sustainability.

PhoPhPhoPhoPhohooPhoPhooto to toto totot byby byby by by TodTodTododTodToddTo d Pd PPd Pdd PPd osoosososttttt//////tttttt BreBreBreBreBreBreBr ad ad aad dad ad d forforforforforforfor th th th ththt e We We We We We WWWororlorlrlorlorlorldddddddd///////////


Recommended