Transcript
Page 1: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

The M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine

Sonal Shree1, Abhishek Kumar Singh2, Richa Saxena3, Harish Kumar2, Aparna Agarwal1, Vijay Kumar Sharma1, Kanchan Srivastava3, Kishore Kumar Srivastava3, Sabyasachi

Sanyal2 and Ravishankar Ramachandran1*

Supplementary Data

Table S1: Relative activity of MtSerB2 and M. avium SerB on phosphorylated peptides

Substrates Relative activity (%)

MtSerB2

Relative activity (%)

M. avium SerB

serine phosphopeptide

RRApSVA

100 ± 0.005774 100± 0.017321

threonine phosphopeptide

RRApTVA

15 ± 0.1253 20 ± 0.215484

tyrosine phosphopeptide

RRAEpYAARG

0.07 ± 0.001155 0.05 ± 0.007211

Page 2: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Table S2: Oligonucleotide sequences for Quantative Real Time PCR. All sequences are in 5'

to 3' orientation.

Gene name Forward Reverse

ARP2/3 GTCTGACTTCCTCAAGGTGC TCCAGTAGCAAGTGTTCCAGC

Cdc42 TGGAGTGTTCTGCACTTACACA GGCTCTTCTTCGGTTCTGG

ROCK TGCATTCCAAGATGATCGTTA AAGATCTCCACCAGGCATGTA

PAK TTCTGCTGCTTTTAGGGACAA TCAGGTAGGATAAAATGTTCCATGT

MAPK p38 GGGACCTCCTTATAGATGAGTGG GGACTCCATCTCTTCTTGGTCA

ACTN1 CGTGGAGATTAGGTCCAAGC CTGGCGAAGGCTGCTACT

VCL GGAGGTGATTAACCAGCCAAT AATGATGTCATTGCCCTTGC

LIMK CACCTGGAGGGAAGAACGTA GGCCATCATAGATCCTCTGG

RAC ATGTAGTTCTCAGATGCGTAAAGC GAGTTCAATGGCAACGCTTC

Page 3: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S1: Bead based His tagged pull down assay to probe interactions of MtSerB2 with

host proteins

(A) Pull down assay of MtSerB2, its ACT domain (G18A, G108A) mutants, PSP domain

(S273A, D341N/D345N) mutants with host proteins. Mycobacterium avium SerB protein also

shows interaction with host proteins. (B) MtSerB2 specifically interacts with HSPs 90, 70 and

27 but fails to interact with other HSP’s and HSP-like proteins. In the first lane whole cell

extracts of THP-1 macrophages was run as a positive control for expression of HSP’s and other

HSP binding proteins.

Page 4: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S2: Physical and functional interaction of GST MtSerB2 with pure host cofilin

protein

(A) GST pull down of GST - MtSerB2 with pure cofilin protein of host, Lane 1 is protein

marker, Lane 2 and 3 represent input protein GST MtSerB2 and His cofilin, Lane 4 is pull down

and Lane 5 is control to see interaction of GST only with host cofilin protein. (B) Pull down

samples was immunoblotted to probe the interacting proteins. Anti cofilin and GST antibody was

used to probe the cofilin and GST MtSerB2 respectively. (C) In vitro dephosphorylation

experiment of cofilin was done by immobilizing about 100 µg His cofilin on Ni- NTA resin and

incubating it with crude THP-1 lysate supplemented with ATP and phosphatase & protease

inhibitor. Bead was washed thoroughly and phosphatases assay was performed using 100nM of

MtSerB2 and liberated inorganic phosphate was monitored using malachite green reagent and

absorbance was taken at 630 nm. Additional control used was null mutant MtSerB2-

D341N/D345N and MtSerB2 incubated with 5µM of CFZ to determine that there was no

unspecific liberation of phosphate. Phosphorylation and dephosphorylation level of cofilin after

incubation with crude lysate and MtSerB2 was also determined by western immunoblotting

using phospho cofilin antibody and cofilin protein antibody.

(A) (B)

Page 5: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

(C)

Page 6: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S3: Physical and functional interaction of GST MtSerB2 with pure host MAPK p38

protein

(A) GST pull down of GST - MtSerB2 with pure MAPK p38 protein of host, Lane 1 is protein

marker, Lane 2 and 3 represent input protein GST MtSerB2 and His MAPK p38, Lane 4 is pull

down and Lane 5 is control to see interaction of GST only with host MAPK p38 protein. (B) Pull

down samples was immunoblotted to probe the interacting proteins. Anti MAPK p38and GST

antibody was used to probe the MAPK p38 and GST MtSerB2 respectively. (C) In vitro

dephosphorylation experiment of MAPK p38 was done by immobilizing about 100 µg His

MAPK p38 on Ni- NTA resin and incubating it with crude THP-1 lysate supplemented with ATP

and phosphatase & protease inhibitor. Bead was washed thoroughly and phosphatases assay was

performed using 100nM of MtSerB2 and liberated inorganic phosphate was monitored using

malachite green reagent and absorbance was taken at 630 nm. Additional control used was null

mutant MtSerB2- D341N/D345N and MtSerB2 incubated with 5µM of CFZ to determine that

there was no unspecific liberation of phosphate. Phosphorylation and dephosphorylation level of

MAPK p38 after incubation with crude lysate and MtSerB2 was also determined by western

immunoblotting using phospho MAPK p38 antibody and MAPK p38 protein antibody. (D)

Phosphatases assay was also done using MAPK p38 alpha (PROSPEC, pka-217) phosphorylated

in vitro with the MKK6 kinase and found that indeed MtSerB2 dephosphorylates MAPK p38 in

vitro. Phosphatase activity of MtSerB2 using 50 µM of L- phosphoserine as substrate was

assumed as 100% relative activity as maximum substrate concentration available for

phosphorylated MAPK p38 alpha was 20 µM. Concentration of MtSerB2 used for assay was 100

nM. Additional control used was null mutant MtSerB2- D341N/D345N and MtSerB2 incubated

with 5µM of CFZ to determine that there was no unspecific liberation of phosphate

Page 7: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

(A) (B)

(C)

Page 8: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

(D)

Page 9: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S4: Effect of MtSerB2 on phosphorylation pattern of JNK and ERK

Phosphorylation and dephosphorylation pattern of JNK and ERK protein was determined by

treating THP-1 with MtSerB2 protein for 0 min, 30 min and 2 hour. After treatment, cells were

lysed and whole cell protein extract was run on 12% SDS gel and blotted on nitrocellulose

membrane to probe for levels of phospho JNK, JNK protein and phospho ERK and ERK protein

Page 10: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S5: MtSerB2 specifically dephosphorylates NF-kB p65 protein at Ser-536 residue

MtSerB2 does not dephosphorylate Ser-276 and Ser-468 residue, for this purpose THP-1

macrophages were stimulated with TNF-α at the concentration of 5ng/ml for 30 min followed by

addition of MtSerB2 and its mutant for 2 hour, cells were then lysed and immunoblotted for

indicated antibodies.

Page 11: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S6: Physical and functional interaction of His MtSerB2 with pure NF-kB p65 host

protein

(A) His pull down of His - MtSerB2 with pure NF-kB p65 protein of host, Lane 1 is protein

marker, Lane 2 and 3 represent input protein His MtSerB2 and NF-kB p65, Lane 4 is pull down

and Lane 5 is control to see interaction of NF-kB p65 with His tag. (B) Pull down samples was

immunoblotted to probe the interacting proteins. Anti NF-kB p65 and His antibody was used to

probe the NF-kB p65 and His MtSerB2 respectively. (C) In vitro dephosphorylation experiment

of NF-kB p65 was done by immobilizing about 100 µg myc- NF-kB p65 on Protein A beads

(GE health care) with the help of Myc antibody and incubating it with crude THP-1 lysate

supplemented with ATP and phosphatase & protease inhibitor. Bead was washed thoroughly and

phosphatases assay was performed using 100nM of MtSerB2 and liberated inorganic phosphate

was monitored using malachite green reagent and absorbance was taken at 630 nm. Additional

control used was null mutant MtSerB2- D341N/D345N and MtSerB2 incubated with 5µM of

CFZ to determine that there was no unspecific liberation of phosphate. Phosphorylation and

dephosphorylation level of Ser – 536 residue of NF-kB p65 protein after incubation with crude

lysate and MtSerB2 was also determined by western immunoblotting using phospho Ser- 536

NF-kB p65 antibody and NF-kB p65 protein antibody.

(A) (B)

Page 12: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

(C)

Page 13: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S7: Competitive inhibition of MtSerB2 with respect to ʟ- phosphoserine by the CFZ

(A) Activity of MtSerB2 measured in the presence of rising concentrations of CFZ (0-10 µM)

and ʟ- phosphoserine (0 – 1250 µM). (B) The double reciprocal plot clearly indicates

competitive binding between ʟ- phosphoserine and CFZ

(A)

(B)

10 µM

2.5 µM

0.5 µM0.1 µM0 µM

7.5µM

1.0 µM

5.0 µM

Page 14: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S8: Effect of Clofazimine (CFZ) on M.avium SerB phosphatase activity and other

phosphatases

(A) Relative activity of M.avium SerB in the presence of increasing concentration of CFZ (B)

Comparative inhibition of other phosphatases such as Human phosphoserine phosphatases

(HPSP), Tyrosine phosphatases (PTPase) such as PtpA and PtpB of Mycobacterium tuberculosis

with CFZ and found that there was no inhibition in phosphatases activity of these enzyme even at

high concentration of CFZ (100 µM)

(A)

(B)

Page 15: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S9: The PSP-domain as well as ACT domains of MtSerB2 interacts with Hsp 90.

Disruption of interactions involving only the PSP domain still presumably allows for interactions

through the ACT domains.

Page 16: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S10: M. avium SerB fails to elicits cytoskeletal rearrangement in THP-1 cells in the

presence of CFZ

Confocal microscopy experiment to visualize cytoskeletal rearrangements in THP-1

macrophages on exogenous addition of M. avium SerB in presence and absence of Clofazimine

at 2 hour time point

.

Page 17: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

Figure S11: Purification of MtSerB2 and its mutants

(A) His- MtSerB2 protein purification- Lane 1 is Un induced MtSerB2 C41 transformants, Lane

2 is induced MtSerB2 C41 transformants, Lane 3 is load (supernatant after sonication), Lane 4 is

flow through from Ni NTA Agarose beads, Lane 5-6 Washing with 50mM imidazole buffer,

Lane 7 is MtSerB2 elution and Lane 8 is MtSerB2 after size exclusion chromatography (B) His-

MtSerB2 mutant protein purification - Lane L is load (supernatant after sonication), Lane F is

Flow through and W1 & W2 represents washing with 50 mM imidazole. E1,E2, E3, E4 and E5

corresponds to elution fraction of MtSerB2- G18A, G108A, D341N/D345N , S273A and M.

avium SerB (C) GST- MtSerB2 protein purification – Lane 1 is load(supernatant after

sonication), Lane 2 is Flow through, Lane 3-5 represents washes with lysis buffer, Lane 6 is

Elution and Lane 7 is GST MtSerB2 after size exclusion chromatography.

(A)

Page 18: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek

(B)

(C)

(C)


Recommended