Transcript
Page 1: The first PCR cycle: The sequence between the two primers will be amplified
Page 2: The first PCR cycle: The sequence between the two primers will be amplified

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

Page 3: The first PCR cycle: The sequence between the two primers will be amplified

The first PCR cycle:The sequence between the two primers will be

amplified

Page 4: The first PCR cycle: The sequence between the two primers will be amplified

Four cycles of PCR

Page 5: The first PCR cycle: The sequence between the two primers will be amplified

Copy number of the sequence between the primers increases exponentially

Page 6: The first PCR cycle: The sequence between the two primers will be amplified

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Page 7: The first PCR cycle: The sequence between the two primers will be amplified

Structure of dideoxynucleotide triphosphates

Page 8: The first PCR cycle: The sequence between the two primers will be amplified

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

Page 9: The first PCR cycle: The sequence between the two primers will be amplified
Page 10: The first PCR cycle: The sequence between the two primers will be amplified

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Page 11: The first PCR cycle: The sequence between the two primers will be amplified

Automated DNA Sequencing

Page 12: The first PCR cycle: The sequence between the two primers will be amplified

Reação de seqüênciamentoReação de seqüênciamento

Page 13: The first PCR cycle: The sequence between the two primers will be amplified

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Page 14: The first PCR cycle: The sequence between the two primers will be amplified

Typical output of an automated sequencer

Page 15: The first PCR cycle: The sequence between the two primers will be amplified

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Page 16: The first PCR cycle: The sequence between the two primers will be amplified
Page 17: The first PCR cycle: The sequence between the two primers will be amplified

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Page 18: The first PCR cycle: The sequence between the two primers will be amplified
Page 19: The first PCR cycle: The sequence between the two primers will be amplified
Page 20: The first PCR cycle: The sequence between the two primers will be amplified

Seqüenciador automáticoSeqüenciador automático

Page 21: The first PCR cycle: The sequence between the two primers will be amplified
Page 22: The first PCR cycle: The sequence between the two primers will be amplified
Page 23: The first PCR cycle: The sequence between the two primers will be amplified
Page 24: The first PCR cycle: The sequence between the two primers will be amplified
Page 25: The first PCR cycle: The sequence between the two primers will be amplified
Page 26: The first PCR cycle: The sequence between the two primers will be amplified
Page 27: The first PCR cycle: The sequence between the two primers will be amplified
Page 28: The first PCR cycle: The sequence between the two primers will be amplified
Page 29: The first PCR cycle: The sequence between the two primers will be amplified

Conjunto

de

16 capilares

Page 30: The first PCR cycle: The sequence between the two primers will be amplified
Page 31: The first PCR cycle: The sequence between the two primers will be amplified
Page 32: The first PCR cycle: The sequence between the two primers will be amplified
Page 33: The first PCR cycle: The sequence between the two primers will be amplified
Page 34: The first PCR cycle: The sequence between the two primers will be amplified

Panorama no momento da corrida

Page 35: The first PCR cycle: The sequence between the two primers will be amplified

Análise preliminar pós corrida

Page 36: The first PCR cycle: The sequence between the two primers will be amplified

ELETROFEROGRAMAS


Recommended