1
The interactions among DWARF10, auxin and cytokinin 1
underlie lateral bud outgrowth in rice 2
3
Running tile: D10, auxin and cytokinin in rice tillering. 4
5
Shuying Zhang1, 5 , Gang Li1, 5, Jun Fang1, Weiqi Chen2, Haipai Jiang3, 6
Junhuang Zou4, Xue Liu1,5, Xianfeng Zhao1, Xiaobing Li1, Chengcai Chu1, 7
Qi Xie1, Xiangning Jiang2, Lihuang Zhu1* 8
1. State Key Laboratory of Plant Genomics and National Center for 9
Plant Gene Research, Institute of Genetics and Developmental 10
Biology, Chinese Academy of Science, Beijing, 100101, China 11
2. College of Biological Sciences and Biotechnology, Beijing 12
Forestry University, Beijing, 100083, China (W.Q.C., X.N.J.) 13
3. College of Agronomy, Shenyang Agricultural University, Shenyang, 14
110161, China (H.P.J.) 15
4. Department of Ophthalmology, University of Utah, Salt Lake City, 16
UT 84132, USA (J.H.Z.) 17
5. Graduate School of the Chinese Academy of Sciences, Beijing 18
100101, China (S.Y.Z., G.L., X.L.) 19
* For correspondence: Lihuang Zhu 20
Address: State Key Laboratory of Plant Genomics 21
and National Center for Plant Gene Research, 22
Institute of Genetics and Developmental Biology, 23
Chinese Academy of Science, Beijing, 100101, 24
China 25
Phone: (8610)64836196 26
Fax: (8610)64873428 27
Email: [email protected] 28
29
2
Abstract 30
Previous studies have shown that DWARF10 (D10) is a rice ortholog 31
of MAX4/RMS1/DAD1, encoding a carotenoid cleavage dioxygenase and 32
functioning in strigolactones/strigolactone-derivatives (SL) biosynthesis. 33
Here we use D10- RNA interference (RNAi) transgenic plants similar to 34
d10 mutant in phenotypes to investigate the interactions among D10, auxin 35
and cytokinin in regulating rice shoot branching. Auxin levels in node 1 of 36
both decapitated D10-RNAi and wild type plants decreased significantly, 37
showing that decapitation does reduce endogenous auxin concentration, 38
but decapitation has no clear effects on auxin levels in node 2 of the same 39
plants. This implies that node 1 may be the location where a possible 40
interaction between auxin and D10 gene would be detected. D10 41
expression in node 1 is inhibited by decapitation, and this inhibition can be 42
restored by exogenous auxin application, indicating that D10 may play an 43
important role in auxin regulation of SL. The decreased expression of most 44
OsPINs in shoot nodes of D10-RNAi plants may cause the weak auxin 45
transport capacity. Furthermore, effects of auxin treatment of decapitated 46
plants on the expression of cytokinin biosynthetic genes suggest that D10 47
promotes cytokinin biosynthesis by reducing auxin levels. Besides, in 48
D10-RNAi plants, decreased storage cytokinin levels in the shoot node 49
may partly account for the increased active cytokinin contents, resulting in 50
more tillering phenotypes. 51
Introduction 52
The process of axillary meristems resulting in shoot branches is 53
regulated by genetic, developmental and environmental factors (Beveridge 54
et al., 2003; Leyser, 2003; Shimizu-Sato and Mori, 2001). The plant 55
hormones, auxin, cytokinin and SL each play a significant role in the 56
transition between dormancy and outgrowth of axillary buds (Beveridge, 57
2006; Ongaro and Leyser, 2008). SL, the recently identified new hormone, 58
3
was previously known as a novel carotenoid-derived signal that regulated 59
the outgrowth of axillary buds (Beveridge, 2006; Gomez-Roldan et al., 60
2008; Ongaro and Leyser, 2008; Umehara et al., 2008). The more axillary 61
growth mutants (max) in Arabidopsis, the ramous mutants (rms) in pea, the 62
decreased apical dominance mutants (dad) in petunia, and the 63
high-tillering dwarf mutants (d3, htd1 and d10) in rice are all more shoot 64
branching mutants in the SL pathway (Arite et al., 2007; Beveridge et al., 65
1994, 1996; Booker et al., 2004; Ishikawa et al., 2005; Morris et al., 2001; 66
Napoli, 1996; Simons et al., 2007; Snowden et al., 2005; Sorefan et al., 67
2003; Stirnberg et al., 2002; Zou et al., 2005). In Arabidopsis, it was 68
demonstrated that MAX1, MAX3, and MAX4 are required for the 69
synthesis of SL while MAX2 acts in its signal transduction (Booker et al., 70
2005). MAX3 and MAX4 belong to the carotenoid cleavage dioxygenase 71
(CCD) family (Auldridge et al., 2006; Booker et al., 2004; Schwartz et al., 72
2004; Sorefan et al., 2003). Studies have also shown that RMS1, RMS5 and 73
RMS4 in pea are orthologous to MAX4, MAX3, and MAX2, respectively 74
(Foo et al., 2005; Johnson et al., 2006; Sorefan et al., 2003), and that 75
DAD1 in petunia is orthologous to MAX4 (Snowden et al., 2005). This 76
implies that shoot branching genes are conserved across diverse dicot 77
families. 78
Studies on the SL pathway in dicots have rapidly progressed, and a 79
series of more tillering and dwarf mutants in the monocot rice have been 80
identified, such as d3, d10, d14, d17, d27 and htd1 (Arite et al., 2007; 81
Ishikawa et al., 2005; Zou et al., 2005). Ishikawa et al. (2005) first showed 82
that D3 is orthologous to Arabidopsis MAX2. Subsequently, Zou et al. 83
(2006) cloned a HTD1 gene that is an ortholog of Arabidopsis MAX3. 84
Recently, Arite et al. (2007) demonstrated that D10 is OsCCD8b and that 85
D10 is mainly expressed in the vascular tissues of most organs. 86
Interestingly, it is in this study that the existence of apical dominance in 87
rice was first discovered through the decapitation test. Arite et al. (2007) 88
4
also found that D10 expression was induced by exogenous auxin. 89
Moreover, in d10 mutants the auxin levels in shoot apices with a few tiller 90
buds were enhanced as compared to the levels in wild type (Arite et al., 91
2007). These findings indicate a possible interaction between auxin and SL 92
in rice. 93
For the interactions between auxin and SL in controlling shoot 94
branching, some studies were also performed in Arabidopsis and pea. In 95
Arabidopsis, the outgrowth of axillary buds in max4 mutants were partially 96
resistant to apically applied auxin (Sorefan et al., 2003), and the SL 97
pathway of Arabidopsis regulated auxin transport in the stem by 98
modulating PIN-FORMED (PIN) expression (Bennett et al., 2006). In pea, 99
the expression of RMS1 and RMS5 in the stem was inhibited by 100
decapitation, but this inhibition could be restored by exogenous auxin 101
(Ferguson and Beveridge, 2009; Foo et al., 2005; Johnson et al., 2006). 102
Recent studies through application of SL directly to the axillary buds of 103
decapitated wild type pea plants and to the Arabidopsis axr1 (auxin 104
response increased branching 1) mutant plants showed that SL functions 105
downstream of auxin to inhibit the outgrowth of axillary buds (Brewer et 106
al., 2009). 107
As to the interactions between cytokinin and SL in shoot branching 108
regulation, studies in pea have revealed that the SL pathway regulates 109
xylem sap cytokinin (X-CK) levels through a feedback signal (Beveridge 110
et al., 2000; Foo et al., 2005; Morris et al., 2001). In addition, grafting 111
studies in pea between rms1, rms4, rms5 and wild-type also showed that 112
the increase in shoot branches was correlated with the reduced X-CK 113
levels, independent of shoot or root genotypes (Foo et al., 2007). However, 114
when a suppressed axillary meristem (sax) mutant was used to suppress 115
axillary branching in an rms4 background, the correlation in the grafted 116
chimaeras between rms4 sax (scion) and wild-type (rootstock) was 117
disrupted (Foo et al., 2007; Rameau et al., 2002a). Cytokinin levels in the 118
5
shoots of rms1, rms4 and rms5 mutants were not clearly different from 119
those of the wild-type (Beveridge et al., 1997b; Morris et al., 2001). 120
Similarly in rice, there were no obvious difference in cytokinin levels of 121
shoot apices between d10 and wild type plants (Arite et al., 2007). Thus, 122
the cytokinin levels in roots and shoots of pea or in shoot apices of rice do 123
not account for the more shoot branching phenotypes in the rms or d10 124
mutants. 125
Based on the above findings, we speculate that interactions among 126
auxin, cytokinin and SL may be local events; if so, the interactions may 127
occur at the relative shoot nodes. Reasons for this speculation are as 128
follows: first, the shoot meristems originate from the shoot nodes (Leyser, 129
2005); second, in pea, it has been demonstrated that auxin inhibition of 130
PsIPT expression negatively regulates local cytokinin biosynthesis in the 131
nodal stem (Ferguson and Beveridge, 2009; Tanaka et al., 2006); and third, 132
HTD1 and D10 in rice were expressed strongly at the shoot nodes (Arite et 133
al., 2007; Zou et al., 2006). 134
To investigate the interactions among auxin, cytokinin and SL in 135
shoot branching regulation, and to further explore the cause of the more 136
tillering phenotype of the rice SL mutants, we produced D10-RNAi 137
transgenic lines with typical d10 phenotypes. In this study, the shoot nodes 138
of these lines and wild type plants were used as our investigative materials. 139
Here, we show that downregulation of D10 results in the decreased 140
expression of cytokinin biosynthetic enzyme genes, which is mediated by 141
auxin, and that the more tillering phenotypes in the D10-RNAi plants may 142
be attributed to high cytokinin levels in the relative shoot nodes. 143
144
6
Results 145
D10-RNAi plants exhibited more tillering and dwarf phenotypes 146
To further assess the function of the D10 gene, we produced 147
D10-RNAi transgenic lines under the background of the wild type rice 148
Kasalath (KA), in which D10 expression levels were significantly 149
decreased (Figure 1A). As compared with wild type plants, the average 150
tillering of the two selected homozygous lines (ki23 and ki25) increased 151
dramatically; however, the average height decreased. (Figure 1A, B). 152
These phenotypes in D10-RNAi plants are similar to the d10 mutant (Arite 153
et al., 2007). In addition, we also examined apical dominance in 154
D10-RNAi lines. In both the wild type and D10-RNAi plants, the axillary 155
buds at node 2 from the top exhibited significant elongation after 156
decapitation and this elongation could be repressed by applying exogenous 157
auxin; but the axillary buds at nodes 1 and 3 did not respond to the same 158
treatments (Figure 1C, D). This implied that a similar apical dominance 159
phenomenon exists between D10-RNAi plants and d10 mutants. Therefore, 160
the ki23 and ki25 plants and the corresponding wild type plants were 161
successively used to investigate the interactions among auxin, cytokinin 162
and SL. 163
Auxin and cytokinin regulate D10 expression in shoot nodes 164
RT-PCR analysis showed that D10 was expressed in all examined 165
tissues of KA plants with higher expression levels in shoot nodes and 166
internodes (Figure 2A). To examine whether D10 transcription in shoot 167
nodes is regulated by exogenous auxin, D10 expression was investigated 168
in KA plants by RT-PCR. OsPIN1 was used as a control for the effects of 169
auxin in the excised shoot nodes in rice (Figure 2B) because it was 170
reported that the expression of PsPIN1 in pea was induced by exogenous 171
auxin in the nodal stem of intact seedlings (Tanaka et al., 2006). Our 172
analysis revealed that D10 expression was significantly induced by 173
7
exogenous auxin in shoot nodes (Figure 2B). 174
To test whether the expression of the D10 gene in shoot nodes is 175
regulated by endogenous auxin, we tried to eliminate endogenous auxin in 176
KA plants by decapitation. The decapitation treatment did decrease the 177
endogenous auxin level in node 1 significantly (Figure 3A). Next, we 178
investigated the D10 expression response to decapitation in node 1 by 179
RT-PCR. D10 expression decreased at 1 hour and was hardly detected at 3, 180
6, 8, and 10 hours after decapitation (Figure 2C). At 10 hours after 181
decapitation applying 10 µM NAA to these excised shoot nodes could 182
completely restore the D10 expression inhibition caused by decapitation 183
(Figure 2D), demonstrating that the suppression of D10 expression was 184
due to the reduction in endogenous auxin. Additionally, in the above 185
experiments, HTD1 expression was also examined, but no obvious 186
response to auxin was observed (Figure 2B, C, D). 187
To investigate the effects of exogenous cytokinin on D10 expression, 188
node 1 of KA plants was incubated in a buffer containing 10 µM 6-BA, 189
and then total RNA was isolated from the incubated node 1 tissues at 190
different time points for RT-PCR analysis. D10 expression decreased 191
apparently at 1 hour, and then to the lowest level 6 hours after treatment. 192
In contrast, HTD1 expression was increased 3 hours after treatment 193
(Figure 2E). 194
Auxin and cytokinin levels in D10-RNAi shoot nodes 195
In d10 mutants, auxin levels in shoot apices with a few tiller buds 196
were higher than those in the wild type (Arite et al., 2007). To further 197
determine if the auxin level variation occurs in the shoot nodes of 198
D10-RNAi plants, endogenous auxin concentrations were measured. After 199
decapitation, auxin levels in node 1 of either KA or ki23 plants were 200
reduced significantly; however, those in node 2 were not obviously 201
changed (Figure 3A). Under normal conditions, the auxin content in node 202
1 of ki23 plants was higher than that in KA plants, but, at 10 hours after 203
8
decapitation, it decreased greatly and was lower than that in the control 204
(Figure 3A). This indicated that the auxin concentration in node 1 of ki23 205
plants more strongly depended on auxin derived from the shoot apices than 206
in KA plants. 207
To examine whether the more tillering phenotype of D10-RNAi 208
plants was associated with the increased cytokinin levels in shoot nodes, 209
endogenous cytokinin concentrations were measured. Cytokinins are 210
derived from adenine, and common natural isoprenoid cytokinins are 211
N6-(∆2-isopentenyl)-adenine (Brown et al.), trans-zeatin (tZ), cis- zeatin 212
(cZ), and dihydrozeatin (DZ) (Sakakibara, 2006). Among these, the major 213
derivatives are generally tZ and iP, as well as their sugar conjugates; 214
however, there is great variation depending on plant species, tissue, and 215
developmental stage (Sakakibara, 2006). For instance, using shoot nodes 216
of rice as materials, only iP, iP riboside (iPR), trans-zeatin riboside (tZR) 217
and dihydrozeatin riboside (DZR) were detected (Figure 3B). Here we 218
named iP and iPR as iPR-type cytokinin, and tZR and DZR as ZR-type 219
cytokinin. The iPR-type and ZR-type cytokinin contents in node 1 of ki23 220
plants were not obviously different from those of KA plants, but those in 221
node 2 increased significantly (Figure 3B). Along with this difference 222
between node 1 and node 2, the number of axillary buds at node 2 of ki23 223
plants was not different from that of KA plants, and only the axillary bud 224
lengths increased, but axillary buds at node 1 were not detectable in either 225
ki23 or KA plants (Figure 3C). This suggested that more tillering of 226
D10-RNAi plants could have at least partly resulted from the increased 227
cytokinin levels in shoot nodes with initiated axillary buds. In addition, 228
after decapitation, cytokinin contents in node 1 or 2 of either ki23 or KA 229
plants increased significantly, indicating that auxin derived from shoot 230
apices might repress the increase of cytokinin levels in shoot nodes. 231
D10 promotes cytokinin biosynthesis in shoot nodes by reducing auxin 232
levels 233
9
To elucidate the interactions among D10, auxin and cytokinin in 234
shoot branching regulation, the expression levels of OsIPT1 - OsIPT8, 235
which are responsible for cytokinin biosynthesis (Sakamoto et al., 2006), 236
were analyzed in the shoot nodes of rice by RT-PCR. In the rice shoot 237
nodes, expression of OsIPT4, OsIPT5, OsIPT7 and OsIPT8 could be 238
clearly observed, while those of OsIPT1, OsIPT2, OsIPT3 and OsIPT6 239
were not detectable (data not shown). At 10 hours after decapitation, in 240
nodes 1 and 2 of either ki23 or KA plants, OsIPT4, OsIPT5 or OsIPT7 241
expression increased significantly (Figure 4). This indicated that apically 242
derived auxin repressed the expression of these cytokinin biosynthetic 243
enzyme genes in shoot nodes, which could be one of the causes of the 244
increased cytokinin levels in the shoot nodes after decapitation (Figure 3B). 245
The expression of OsIPT4, OsIPT5, OsIPT7 and OsIPT8 in node 1 of ki23 246
plants decreased significantly compared with those of KA plants (Figure 4), 247
which implied that D10 promotes cytokinin biosynthesis. 248
It is also interesting that after decapitation, expression of OsIPT4, 249
OsIPT5 and OsIPT7 in node 1 increased significantly to the same levels 250
between ki23 and KA plants (Figure 4). Further, the auxin level in the 251
same shoot nodes of 10-hour decapitated ki23 and KA plants decreased 252
drastically (Figure 3A). As shown in Figure 4, auxin repressed the 253
expression of cytokinin biosynthetic enzyme genes, we hypothesize that 254
D10 promotes cytokinin biosynthesis in shoot nodes possibly by reducing 255
auxin levels. To test this, we examined whether application of exogenous 256
auxin could decrease the expression of the cytokinin biosynthetic enzyme 257
genes to the same degree between 10-hour decapitated ki23 and KA plants. 258
At 3 hours after incubation in NAA buffer, OsIPT4 and OsIPT5 expression 259
decreased significantly to the same levels between the 10-hour decapitated 260
ki23 and KA plants. At 10 hours, similar trends in the expression of 261
OsIPT7 and OsIPT8 were observed (Figure 4), suggesting that D10 262
promotes cytokinin biosynthesis in shoot nodes by reducing auxin levels. 263
10
D10-RNAi plants showed decreased levels of storage cytokinin in 264
shoot nodes 265
It is known that glycosylation of cytokinin in higher plants converts 266
its active forms into nearly inactive stable storage forms. TZ, cZ and DZ 267
can be reversibly converted to the O- glucoside (ZOG, ZROG) by zeatin 268
O-glucosyltransferase (ZOGT) and β-glucosidase (β-Glc) (Sakakibara, 269
2006). In addtion, iP, tZ, cZ and DZ can be converted to the N-glucosides 270
by cytokinin N- glucosyltransferase (CK-N-GT), i.e., iP is catalyzed to 271
iP7G or iP9G and tZ, cZ and DZ are to Z7G or Z9G (Sakakibara, 2006). 272
To determine whether the increased active cytokinin levels in node 2 of 273
D10-RNAi plants result from a decrease in their storage forms, the 274
contents of different kinds of storage cytokinin were measured. In the 275
shoot nodes of rice, only iP9G, Z9G and ZROG were detected. We named 276
iP9G as IPG-type cytokinin, and Z9G and ZROG as ZG-type cytokinin. 277
Both the IPG-type and ZG-type cytokinin levels in node 1 or 2 of ki23 278
plants decreased significantly as compared with those of KA plants (Figure 279
5), implying that the decreased storage cytokinin contents might partly 280
contribute to the increased active cytokinin levels in node 2 of ki23 plants. 281
Moreover, after decapitation the storage cytokinin levels in the shoot nodes 282
of ki23 and KA plants did not show obvious changes (Figure 5). 283
D10 controls the expression of the OsPIN gene family 284
To determine the auxin transport capacity in D10-RNAi plants, the 285
expression of auxin efflux carrier PIN gene family members (Paponov et 286
al., 2005) in rice were examined by RT-PCR. In ki23 plants, the expression 287
of OsPIN1 in shoot nodes and panicles, OsPIN2 in seedlings, OsPIN9 in 288
leaves and shoot nodes, and OsPIN10a in leaves, shoot nodes and panicles 289
decreased compared with that in KA plants. Furthermore, among the four 290
downregulated genes in different organs and tissues of ki23 plants, the 291
expression of OsPIN1, OsPIN9 and OsPIN10a in shoot nodes decreased 292
11
obviously (Figure 6), indicating that the auxin transport capacity in ki23 293
plants might be weaker than that of KA plants. 294
Discussion 295
Arite et al. (2007) has demonstrated that the D10 gene of rice, an 296
ortholog of MAX4/RMS1/DAD1, encoding a member of the 9-cis 297
epoxycarotenoid dioxygenase family (Tan et al., 2003), is responsible for 298
the synthesis of a novel carotenoid-derived signal molecule that controls 299
shoot branching in rice. In this study, we have also shown that all 300
D10-RNAi lines in the KA background exhibit more tillering and dwarf 301
phenotypes very similar to the d10 plants. Additionally, D10-RNAi plants 302
show the apical dominance similar to that in the d10 mutant. This provides 303
us with a platform for the further study of D10 gene function using these 304
D10-RNAi plants. 305
Auxin may regulate rice tillering partially through upregulation of 306
D10 transcription in shoot nodes 307
Previous studies have demonstrated that exogenous auxin could 308
induce HTD1 expression in rice seedlings (Zou et al., 2006) and D10 309
expression in the shoot apices of 13-day-old seedlings (Arite et al., 2007). 310
We further show that expression of the D10 gene in rice shoot nodes is 311
regulated by auxin. In wild type rice plants, D10 expression in node 1 is 312
greatly induced by exogenous auxin. Furthermore, after removing 313
endogenous auxin by decapitation, the expression of D10 in node 1 is 314
significantly inhibited, but this inhibition can be rescued by applying 315
exogenous auxin. Therefore, auxin may regulate rice tillering partially 316
through upregulation of D10 transcription to enhance the production of SL 317
in rice shoot nodes. This corresponds to the previous findings that SL acts 318
downstream of auxin to control axillary bud outgrowth in pea and 319
Arabidopsis (Brewer et al., 2009). Additionally, change in HTD1 320
expression is not observed in the same experiments, which in turn 321
12
indicates that D10 plays an important role in the SL pathway in rice. 322
However, the expression of RMS5 (the ortholog of HTD1) in pea nodes, 323
unlike HTD1, was clearly regulated by auxin (Ferguson and Beveridge, 324
2009; Foo et al., 2005; Johnson et al., 2006). This may be attributed to 325
variations in the regulatory networks of the SL pathway between monocots 326
and dicots. 327
Auxin regulation of D10 expression in rice shoot nodes is similar to 328
that of RMS1 in pea, but different from that of MAX4 in Arabidopsis. In 329
pea, exogenous auxin stimulated the expression of RMS1 in the separated 330
stem segments, and the decrease in endogenous auxin content inhibited 331
RMS1 expression in the stem, but this inhibition could be prevented by 332
exogenous auxin application (Ferguson and Beveridge, 2009; Foo et al., 333
2005; Johnson et al., 2006). However, in Arabidopsis, the expression of 334
the MAX4 promoter–reporter GUS fusion in the roots and hypocotyls was 335
upregulated by exogenous auxin, but this upregulation was not necessary 336
for the inhibition of shoot branching (Bainbridge et al., 2005). 337
Effects of auxin levels and transport on rice tillering 338
It has been reported that in d10 plants the auxin levels in shoot apices 339
were higher than those in wild type (Arite et al., 2007). Our data also 340
showed that the auxin content in node 1 of D10-RNAi plants increased 341
significantly, whereas that in node 2 was not changed compared to wild 342
type. The different auxin distribution between nodes 1 and 2 does not seem 343
to coincide with the growth rates of axillary buds at these shoot nodes: the 344
axillary buds at node 1 of either D10-RNAi or wild type plants could not 345
be observed by eye, while the axillary buds at node 2 of D10-RNAi plants 346
were visually longer than those of wild type. This could suggest that auxin 347
may indirectly regulate the growth of axillary buds at the upper shoot 348
nodes and that the variation in auxin levels in the shoot nodes might not 349
directly result in the more tillering phenotype of D10-RNAi plants. 350
Our data also showed that the expression of auxin efflux carrier genes 351
13
OsPIN1, OsPIN9 and OsPIN10a in shoot nodes of D10-RNAi plants 352
decreased significantly in comparison with those of wild type. Thus, 353
reduced accumulation of auxin efflux carriers in shoot nodes of D10-RNAi 354
plants may result in weak auxin transport, which would cause the more 355
tillering phenotype. This proposed situation in rice is similar to that 356
observed in other plants: in Phaseolus vulgaris and Pharbitis nil, the 357
repression of auxin transport in wild-type plants was followed by bud 358
growth (Prasad et al., 1989; Tamas et al., 1989); in the Arabidopsis 359
transport inhibitor response3 (tir3) mutant,auxin transport was weak, but 360
lateral branching increased (Ruegger et al., 1997). However, in 361
Arabidopsis, there were also the cases where the elevated auxin transport 362
in max mutants caused the increased branching phenotype (Bennett et al., 363
2006; Chatfield et al., 2000). Thus, these may also lead to two new 364
hypotheses: first, a threshold value exists in the regulation of shoot 365
branching by auxin transport - within this threshold shoot branching is 366
normal, while above or below this threshold more shoot branching occurs; 367
second, auxin or its transport itself does not directly control shoot 368
branching, but regulates this process by a second messenger. The latter 369
was supported by the recent findings that SL may serve as a second 370
messenger for auxin-mediated bud inhibition (Brewer et al., 2009). 371
More tillering phenotypes of D10-RNAi plants may result from the 372
increased active cytokinin levels in shoot nodes 373
In most rms mutants of pea and four max mutants of Arabidopsis, 374
X-CK from roots decreased dramatically in comparison with wild-type 375
plants (Beveridge et al., 1996; Beveridge et al., 1997b; Foo et al., 2007; 376
Morris et al., 2001). However, cytokinin levels in the shoots of most rms 377
mutants were not obviously different from those of wild type (Foo et al., 378
2007). In the rice d10 mutant, the cytokinin levels in shoot apices was 379
similar to those in wild type plants (Arite et al., 2007). These previous 380
14
studies concluded that more shoot branching phenotypes of the pea rms, 381
Arabidopsis max and rice d10 mutants could be attributed to cytokinin 382
levels neither in roots nor in shoots. In this study, the shoot nodes of 383
D10-RNAi plants and the wild type counterparts were used for examining 384
the relationship between cytokinin contents and the more tillering 385
phenotype. Both IPR-type and ZR-type cytokinin levels in node 1 of 386
D10-RNAi plants were not different from those of wild type, but those in 387
node 2 of D10-RNAi plants were much higher than those of wild type. 388
Consistent with these results, no axillary buds in node 1 of either 389
D10-RNAi or wild type plants could be observed; however, axillary buds 390
in node 2 of D10-RNAi plants were longer than those of wild type. This 391
suggests that the more tillering phenotype of D10-RNAi plants may be 392
partly attributed to the elevated cytokinin levels in the shoot nodes 393
following the initiation of axillary buds. It is worthwhile for further study 394
to see whether this phenomenon exists in Arabidopsis or in pea. In addition, 395
our studies also show that both the IPG-type and ZG-type storage 396
cytokinin levels in node 2 of D10-RNAi plants may partly contribute to the 397
increased active cytokinin content in the same shoot nodes. 398
Auxin and D10 regulate the expression of cytokinin biosynthesis genes 399
in rice shoot nodes 400
In pea, it was reported that auxin inhibited the transcription of 401
cytokinin biosynthesis genes, which in turn caused reduced cytokinin 402
biosynthesis in the stem (Ferguson and Beveridge, 2009; Tanaka et al., 403
2006). Here, we also showed that in node 1 or 2 of the decapitated 404
D10-RNAi or wild type plants, the expression of cytokinin biosynthesis 405
genes OsIPT4, OsIPT5 and OsIPT7 increased significantly. This suggests 406
that apically derived auxin may inhibit the expression of cytokinin 407
biosynthesis genes in the shoot nodes of rice. Thus, in shoot nodes of the 408
decapitated plants, increased expression levels of the cytokinin 409
biosynthesis genes that resulted from the reduced auxin levels after 410
15
decapitation may account for the elevated cytokinin contents. Therefore, 411
we propose that auxin indirectly inhibits rice tillering by suppressing the 412
expression of the cytokinin biosynthesis genes. 413
In addition, we found that the expression of OsIPT4, OsIPT5, OsIPT7 414
and OsIPT8 in node 1 of D10-RNAi plants was greatly reduced in 415
comparison with that of wild type, implying that D10 enhances the 416
expressions of cytokinin biosynthesis genes in shoot nodes. On the 417
contrary, auxin inhibits them. In the current study, we also investigated the 418
relationship between the two opposing modes of regulation of cytokinin 419
biosynthesis gene expression. After decapitation, the respective expression 420
of OsIPT4, OsIPT5 and OsIPT7 in node 1 increased significantly and 421
nearly to the same degree between the D10-RNAi and wild type plants. 422
Interestingly, after incubation of node 1 of the decapitated plants in the 423
exogenous auxin buffer, the expression of these genes in the same shoot 424
nodes of the D10-RNAi and wild type plants decreased greatly and nearly 425
to the same degree. These results strongly suggest that the D10-enhanced 426
expression of cytokinin biosynthesis genes is caused by axuin depletion. In 427
addition, we found that this regulation of auxin is more obvious in the 428
upper shoot nodes (e.g. node 1), corresponding to the observation that the 429
auxin levels in these shoot nodes of D10-RNAi plants were dramatically 430
higher than those of wild type plants. Nevertheless, in the shoot nodes of 431
D10-RNAi plants, the stronger inhibition of the expression of cytokinin 432
biosynthesis genes by auxin should lead to a decrease of active cytokinin 433
levels, which would cause a reduced tillering phenotype; in fact, the 434
D10-RNAi plants showed the more tillering phenotype. Therefore, the 435
SL-inhibited shoot branching in rice may be independent of the 436
auxin-inhibited expression of cytokinin biosynthesis genes. 437
A model of the interactions among D10, auxin and cytokinin in 438
regulating rice axillary bud outgrowth 439
Based on the above results and discussions, we propose a hypothesis 440
16
for D10, auxin and cytokinin actions in regulating rice axillary bud 441
outgrowth (Figure 7). In both nodes 1 and 2, D10 prompts an increase in 442
storage cytokinin, which leads to a decrease in active cytokinin levels. In 443
contrast, auxin inhibits OsIPT expression, which results in an increase in 444
active cytokinins. Auxin levels in node 1 of D10-RNAi plants were clearly 445
higher than those of wild type plants, which would strongly suppress 446
OsIPT expression and possibly reduce the active cytokinin content greatly. 447
But this reduction may be counteracted by the increase in active cytokinin 448
levels due to the decrease of storage cytokinin levels in the same nodes, 449
therefore leading to no obvious difference in the final active cytokinin 450
concentrations in node 1 between the D10-RNAi and wild type plants. 451
However, in node 2 of the D10-RNAi plants, the weakly lower OsIPT 452
expression and the significant decrease in storage cytokinin content would 453
cause an increase in active cytokinin levels, and potentially make axillary 454
buds grow faster, resulting in the more tillering phenotype of these plants. 455
Overall, the elevated active cytokinin levels in shoot nodes, responsible for 456
the more tillering phenotype of the D10-RNAi plants, may not be 457
attributed to the elevated OsIPT expression, but mainly to the reduced 458
storage cytokinin content. This is different from the previous finding in 459
pea, where the elevated expression of IPT1 and IPT2 after decapitation or 460
stem girdling was always related to the bud outgrowth (Tanaka et al. 2006; 461
Ferguson and Beveridge 2009). In addition, the auxin-induced D10 462
expression and, in turn, the D10-repressed auxin levels in node 1 indicate 463
that the interaction between D10 and auxin mainly occurs in node 1 before 464
the bud initiation. 465
Materials and Methods 466
Plant materials and growth conditions 467
Rice plants KA and the transgenic lines were used for this study. The 468
plants were grown in a field or in a greenhouse at 30℃ (Ruegger et al.) 469
17
and 25℃ (night). For the analysis of D10 induction expression by 470
exogenous auxin or cytokinin, total RNA was extracted from node 1 of KA 471
plants at 0, 1, 3, 6, 8 and 10 h after incubating in 10uM naphthylacetic acid 472
(NAA) or 6-Benzylaminopurine (6-BA) buffer. To study the effects of 473
endogenous auxin on D10 expression, node 1 of KA plants was 474
accumulated at 0, 1, 3, 6, 8 and 10 h after decapitation. For the analysis of 475
the D10 expression pattern, total RNA was isolated from seedlings, roots, 476
leaves, internodes, nodes and panicles of KA plants. To analyze the 477
expression of cytokinin biosynthesis genes, total RNA used in Reverse 478
transcriptase–polymerase chain reaction (RT-PCR) was derived from 479
nodes 1 or 2 of KA or ki23 plants 0 h and 10 h after decapitation 480
respectively, and to further study the effects of endogenous auxin on 481
cytokinin biosynthesis genes expression, node 1 of the decapitated KA or 482
ki23 plants was incubated in 10uM NAA buffer, and total RNA was 483
isolated from each at 0, 3 and 10 h after incubation. In addition, for the 484
analysis of OsPIN genes, total RNA was extracted from seedlings, leaves, 485
internodes, nodes and panicles of KA and ki23 plants. 486
Plasmid construction and generation of transgenic plants 487
To generate D10-RNAi transgenic plants, forward (F) 5′- 488
CCGGTACCACTAGTAGCTGGCGACCCTCTTCT-3′ and reverse (R) 5′- 489
CCGGATCCGAGCTCCAGTAGCGGAGCGGCATC-3′ primers were 490
used to amplify a partial D10 cDNA fragment. This fragment was then 491
cloned into the 2 flanking specific multiple clone sites (MCSs) of 492
pTCK303 binary vector (Wang et al., 2004) in a reverse direction under 493
the transcriptional control of the maize ubiquitin promoter and the 494
nopaline synthase (Nos) terminator. Transgenic plants were generated by 495
Agrobacterium tumefaciens–mediated transformation (Hiei et al., 1994) 496
and transformed lines were screened on hygromycin (50 mg L-1). 497
Decapitation experiments 498
18
Decapitation experiments were performed according to the previously 499
described method (Arite et al., 2007). 500
Auxin Extraction, Purification, and LC-ESI-MS/MS analysis 501
For quantitative analysis of auxin, frozen tissue samples (about 500 502
mg FW) were homogenized in liquid nitrogen then soaked in 5 ml of 503
extraction solvent (80% v/v methanol containing 20 mg/L sodium 504
diethyldithiocar bamatre, cupral). As the internal standard, 50 ng stable 505
isotope auxin ([Phenyl-13C6]-indole-3-acetic acid, Andover, MA, USA) 506
was added to the extract, and then extracted by shaking gently overnight at 507
4�. The extracts were centrifuged at 10000 g for 20 minutes. The 508
supernatants were reduced to the aqueous phase in vacuo at 40�, and then 509
extracted three times with ethyl acetate (EtOAc, 2 ml × 3). The combined 510
EtOAc layer was dried in vacuo, and subsequently dissolved in 5 ml 0.1 M 511
acetic acid (Dobrev and Kaminek, 2002). The solution was purified 512
through a 600 mg C18 Sep-Pak cartridge (Waters, Http://www.waters.com). 513
Auxin was eluted with 6 ml of 40% methanol (methanol /0.1 M acetic acid, 514
v/v). The eluate was evaporated in vacuo and resuspended in 50 μl of 10% 515
methanol aq., and then the solution was filtered. 516
A 10 μl portion of extract was subjected to an LC-ESI-MS/MS 517
analysis. A Thermo FINNIGAN Surveyor HPLC system coupled to a 518
Thermo FINNIGAN LCQ DECA XP MAX ion-trap mass spectrometer 519
equipped with an electron-spray-ionization interface was used for the 520
analysis. A ZORBAX Eclipse XDB-C18 column (150×2.1 mm i.d., 5 μm 521
particle size, Agilent Technologies) was eluted with a mixture of methanol 522
and water containing 0.01% acetic acid (gradient from 10:90 to 85:15 in 523
30 minutes) at a flow rate of 0.165 ml/min at 28�. MS was conducted 524
under the following conditions: Capillary Voltage, +4.5kV; temperature, 525
280�; Sheath gas, 40 abi; Aux gas, 10 abi (Ross, 1998). For quantification, 526
the following pairs of characteristic ions were monitored: 176>130 for 527
auxin, 182>136 for [Phenyl-13C6]-indole-3-acetic acid. 528
19
Cytokinin Extraction, Purification, and LC-ESI-MSn analysis 529
For measurements of cytokinin, frozen plant materials (about 500mg 530
FW) were homogenized in liquid nitrogen and submerged in 5 ml cold 531
extraction mixture (methanol:water:formic acid, 15:4:1) containing 20 532
mg/L cupral. As the internal standard, 2 ng of [2H5]tZ, [2H5]tZR, [2H5]tZ9G, 533
[2H5]Z7G, [2H6]iP7G, [2H3]DHZR, [2H3]DHZ9G, [2H6]iP, [2H6]iPR, 534
[2H6]iP9G, [2H5]tZOG, [2H5]tZROG were added to the extract. After 535
overnight extraction at -20�, the extracts were centrifuged at 10000 g for 536
30 minutes, the supernatants were accumulated and passed through 537
Sep-Pak Plus +C18 cartridges (Waters, Http://www.waters.com) (Turnbull 538
et al., 1997), and then evaporated to dryness under vacuum. 539
Immunopurification of cytokinin was largely performed (Faiss et al., 540
1997). 541
A 10 µl portion of extract was subjected to an LC-ESI-MSn analysis. 542
A Thermo FINNIGAN Surveyor HPLC system coupled to a Thermo 543
FINNIGAN LCQ DECA XP MAX ion-trap mass spectrometer equipped 544
with an electron-spray-ionization interface was used for the analysis. A 545
ZORBAX Eclipse XDB-C18 column (150×2.1 mm i.d., 3.5 μm particle 546
size, Agilent Technologies) was eluted at a flow rate of 0.165 ml/min at 547
28� using linear gradient of acetonitrile (B) in 0.001% acetic acid in water 548
(A): 7% B for 14 min, increased to 8% B and to 8.5% B in 16 min, then to 549
13% in 6 min and maintained for 2 min, and to 27% in 28 min. MS data 550
were collected in positive MS/MS/MS product ion mode for quantification 551
under the following conditions: Capillary Voltage, +4.5kV; Capillary 552
temperature, 280�; Sheath gas, 40 abi; Aux gas, 10 abi. Endogenous 553
natural cytokinins were determined by the same HPLC-MSn method using 554
internal standard calibration and the corresponding deuterated cytokinins 555
(Prinsen et al., 1995). 556
Gene Expression Analysis by RT-PCR 557
Total RNA was extracted from plant material using Trizol reagent 558
20
according to manufacturer’s manual (Invitrogen, Carlsbad, CA, USA). The 559
isolated RNA was treated with DNaseI to eliminate genomic DNA 560
contamination. First-strand synthesis of cDNA was performed on 1 μg 561
total RNA using a reverse transcription system (catalog number A3500, 562
Promega, Madison, WI, USA). All F and R primers used for RT-PCR 563
amplification of the target genes were as follows: for D10 (F 564
5′–GGTAGCAACGAGAGGCAGTT–3′ and R 565
5′–TCGACCTTGGTGAGCGTGTT–3′), for HTD1 (F 566
5′–GAGGATGGTGGCTATGTTCTTCT–3′ and R 567
5′–AGTAGTTATTTGGTTCCCCTGAT–3′), for OsIPT4 (F 568
5′–TGGATGTGGTGACGAACAAGGTGAC–3′ and R 569
5′–GATCTACGTCGACCCAGAGGAAGCA–3′), for OsIPT5 (F 570
5′–AGGTGATCAACGCCGACAAGCTGCA–3′ and R 571
5′–TCGACGAGCTCCTCGATGTAGGAGT–3′), for OsIPT7 (F 572
5′–TGGACGACATGGTGGACGCTGGCAT–3′ and R 573
5′–GCTTTGATGTCGTCGATCGCCTCGG–3′), for OsIPT8 (F 574
5′–GTCGACGACGATGTTCTCGACGAAT–3′ and R 575
5′–TGTTGGCCTTGATCTCGTCTATCGC–3′), for OsPIN1 (F 576
5′–TCTCGCTCGGACATCTACTCCC–3′ and R 577
5′–AGTCCTCCCTGTCCTTCGCTC–3′), for OsPIN2 (F 578
5′–GCAATGGCAGTGAGGTTCTTGACTG–3′ and R 579
5′–GCTCTGGTAGTTCTTCAGGTCTTC–3′), for OsPIN5a (F 580
5′–GCTGCATGCTGATGTGCTCAG–3′ and R 581
5′–GGCTCTGCGTCTACCTAATTAGCTC–3′), for OsPIN9 (F 582
5′–GGATACAAGATAGCGTCGTTCTCCATG–3′ and R 583
5′–GCACATCAGCACACATGCAAC–3′), for OsPIN10a (F 584
5′–CATAATGGTGTGGCGCAAGCTCATC–3′ and R 585
5′–GGCACAATCCCTTGTGGTAG–3′), for Actin (F 586
5′–AGCAACTGGGATGATATGGA–3′ and R 587
5′–CAGGGCGATGTAGGAAAGC–3′). 588
21
Acknowledgements 589
We thank prof. Qian Qian for providing d10 mutant. We thank Dr. 590
David Zaitlin and graduate researcher Ara Stephaniam for revising of the 591
manuscript. This work was supported by the National Natural Science 592
Foundation of China (30623011). 593
References 594
Arite T, Iwata H, Ohshima K, Maekawa M, Nakajima M, Kojima M, 595
Sakakibara H, Kyozuka J. (2007). DWARF10, an RMS1/MAX4/DAD1 596
ortholog, controls lateral bud outgrowth in rice. Plant J. 51, 1019-1029. 597
Auldridge ME, McCarty DR, Klee HJ. (2006). Plant carotenoid 598
cleavage oxygenases and their apocarotenoid products. Curr Opin Plant 599
Biol. 9, 315-321. 600
Bainbridge K, Sorefan K, Ward S, Leyser O. (2005). Hormonally 601
controlled expression of the Arabidopsis MAX4 shoot branching 602
regulatory gene. Plant J. 44, 569-580. 603
Bennett T, Sieberer T, Willett B, Booker J, Luschnig C, Leyser O. 604
(2006). The Arabidopsis MAX pathway controls shoot branching by 605
regulating auxin transport. Curr Biol. 16, 553-563. 606
Beveridge CA, Ross JJ, Murfet IC. (1994). Branching Mutant rms-2 in 607
Pisum sativum (Grafting Studies and Endogenous Indole-3-Acetic Acid 608
Levels). Plant Physiol. 104, 953-959. 609
Beveridge CA, Ross JJ, Murfet IC. (1996). Branching in Pea (Action of 610
Genes Rms3 and Rms4). Plant Physiol. 110, 859-865. 611
Beveridge CA, Symons GM, Murfet IC, Ross JJ, Rameau C. (1997b). 612
The rms1 mutant of pea has elevated indole-3-acetic acid levels and 613
reduced root-sap zeatin riboside content but increased branching controlled 614
by graft-transmissible signals. Plant Physiol. 115, 1251-1258. 615
Beveridge CA, Symons GM, Turnbull CG. (2000). Auxin inhibition of 616
22
decapitation-induced branching is dependent on graft-transmissible signals 617
regulated by genes Rms1 and Rms2. Plant Physiol. 123, 689-698. 618
Beveridge CA, Weller JL, Singer SR, Hofer JM. (2003). Axillary 619
meristem development. Budding relationships between networks 620
controlling flowering, branching, and photoperiod responsiveness. Plant 621
Physiol. 131, 927-934. 622
Beveridge CA. (2006). Axillary bud outgrowth: sending a message. Curr 623
Opin Plant Biol. 9, 35-40. 624
Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O. (2004). 625
MAX3/CCD7 is a carotenoid cleavage dioxygenase required for the 626
synthesis of a novel plant signaling molecule. Curr Biol. 14, 1232-1238. 627
Booker J, Sieberer T, Wright W, Williamson L, Willett B, Stirnberg P, 628
Turnbull C, Srinivasan M, Goddard P, Leyser O. (2005). MAX1 629
encodes a cytochrome P450 family member that acts downstream of 630
MAX3/4 to produce a carotenoid-derived branch-inhibiting hormone. Dev 631
Cell. 8, 443-449. 632
Brewer PB, Dun EA, Ferguson BJ, Rameau C, Beveridge CA. (2009). 633
Strigolactone acts Downstream of Auxin to Regulate Bud Outgrowth in 634
Pea and Arabidopsis. Plant Physiol. 635
Brown BT, Foster C, Phillips JN, Rattigann BM. (1979). The indirect 636
role of 2,4-D in the maintenance of apical dominance in decapitated 637
sunflower seedlings (Helianthus annuus L.). Planta. 146, 475-480. 638
Chatfield SP, Stirnberg P, Forde BG, Leyser O. (2000). The hormonal 639
regulation of axillary bud growth in Arabidopsis. Plant J. 24, 159-169. 640
Dobrev PI, Kaminek M. (2002). Fast and efficient separation of 641
cytokinins from auxin and abscisic acid and their purification using 642
mixed-mode solid-phase extraction. J Chromatogr A. 950, 21-29. 643
Faiss M, Zalubilova J, Strnad M, Schmulling T. (1997). Conditional 644
transgenic expression of the ipt gene indicates a function for cytokinins in 645
paracrine signaling in whole tobacco plants. Plant J. 12, 401-415. 646
23
Ferguson BJ, Beveridge CA. (2009). Roles for auxin, cytokinin, and 647
strigolactone in regulating shoot branching. Plant Physiol. 149, 648
1929-1944. 649
Foo E, Bullier E, Goussot M, Foucher F, Rameau C, Beveridge CA. 650
(2005). The branching gene RAMOSUS1 mediates interactions among 651
two novel signals and auxin in pea. Plant Cell. 17, 464-474. 652
Foo E, Morris SE, Parmenter K, Young N, Wang H, Jones A, Rameau 653
C, Turnbull CG, Beveridge CA. (2007). Feedback regulation of xylem 654
cytokinin content is conserved in pea and Arabidopsis. Plant Physiol. 143, 655
1418-1428. 656
Gomez-Roldan V, Fermas S, Brewer PB, Puech-Pages V, Dun EA, 657
Pillot JP, Letisse F, Matusova R, Danoun S, Portais JC, Bouwmeester 658
H, Becard G, Beveridge CA, Rameau C, Rochange SF. (2008). 659
Strigolactone inhibition of shoot branching. Nature. 455, 189-194. 660
Hiei Y, Ohta S, Komari T, Kumashiro T. (1994). Efficient 661
transformation of rice (Oryza sativa L.) mediated by Agrobacterium and 662
sequence analysis of the boundaries of the T-DNA. Plant J. 6, 271-282. 663
Ishikawa S, Maekawa M, Arite T, Onishi K, Takamure I, Kyozuka J. 664
(2005). Suppression of tiller bud activity in tillering dwarf mutants of rice. 665
Plant Cell Physiol. 46, 79-86. 666
Johnson X, Brcich T, Dun EA, Goussot M, Haurogne K, Beveridge CA, 667
Rameau C. (2006). Branching genes are conserved across species. Genes 668
controlling a novel signal in pea are coregulated by other long-distance 669
signals. Plant Physiol. 142, 1014-1026. 670
Leyser O. (2003). Regulation of shoot branching by auxin. Trends Plant 671
Sci. 8, 541-545. 672
Leyser O. (2005). The fall and rise of apical dominance. Curr Opin Genet 673
Dev. 15, 468-471. 674
Morris SE, Turnbull CG, Murfet IC, Beveridge CA. (2001). Mutational 675
analysis of branching in pea. Evidence that Rms1 and Rms5 regulate the 676
24
same novel signal. Plant Physiol. 126, 1205-1213. 677
Napoli C. (1996). Highly Branched Phenotype of the Petunia dad1-1 678
Mutant Is Reversed by Grafting. Plant Physiol. 111, 27-37. 679
Ongaro V, Leyser O. (2008). Hormonal control of shoot branching. J Exp 680
Bot. 59, 67-74. 681
Paponov IA, Teale WD, Trebar M, Blilou I, Palme K. (2005). The PIN 682
auxin efflux facilitators: evolutionary and functional perspectives. Trends 683
Plant Sci. 10, 170-177. 684
Prasad TK, Hosokawa Z, and Cline MG. (1989). Effects of auxin, 685
auxin-transport inhibition and mineral nutrients on apical dominance in 686
Pharbitis nil. J. Plant Physiol. 135, 472-477. 687
Prinsen E, Redig P, Strnad M, Galis I, Van Dongen W, Van Onckelen 688
H. (1995). Quantifying phytohormones in transformed plants. Methods 689
Mol Biol. 44, 245-262. 690
Rameau C, Bellec Y, Grillot P, Parmenter KS, Beveridge CA, Turnbull 691
CGN. (2002a). Mutations at several loci suppress vegetative axillary 692
meristem initiation in pea. Pisum Genet. 34, 15-19. 693
Ross JJ. (1998). Effects of auxin transport inhibitors on gibberellins in pea. 694
J. Plant Growth Regul. 17, 141-146. 695
Ruegger M, Dewey E, Hobbie L, Brown D, Bernasconi P, Turner J, 696
Muday G, Estelle M. (1997). Reduced naphthylphthalamic acid binding in 697
the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin 698
transport and diverse morphological defects. Plant Cell. 9, 745-757. 699
Sakakibara H. (2006). Cytokinins: activity, biosynthesis, and 700
translocation. Annu Rev Plant Biol. 57, 431-449. 701
Sakamoto T, Sakakibara H, Kojima M, Yamamoto Y, Nagasaki H, 702
Inukai Y, Sato Y, Matsuoka M. (2006). Ectopic expression of 703
KNOTTED1-like homeobox protein induces expression of cytokinin 704
biosynthesis genes in rice. Plant Physiol. 142, 54-62. 705
Schwartz SH, Qin X, Loewen MC. (2004). The biochemical 706
25
characterization of two carotenoid cleavage enzymes from Arabidopsis 707
indicates that a carotenoid-derived compound inhibits lateral branching. J 708
Biol Chem. 279, 46940-46945. 709
Shimizu-Sato S, Mori H. (2001). Control of outgrowth and dormancy in 710
axillary buds. Plant Physiol. 127, 1405-1413. 711
Simons JL, Napoli CA, Janssen BJ, Plummer KM, Snowden KC. 712
(2007). Analysis of the DECREASED APICAL DOMINANCE genes of 713
petunia in the control of axillary branching. Plant Physiol. 143, 697-706. 714
Snowden KC, Simkin AJ, Janssen BJ, Templeton KR, Loucas HM, 715
Simons JL, Karunairetnam S, Gleave AP, Clark DG, Klee HJ. (2005). 716
The Decreased apical dominance1/Petunia hybrida CAROTENOID 717
CLEAVAGE DIOXYGENASE8 gene affects branch production and plays 718
a role in leaf senescence, root growth, and flower development. Plant Cell. 719
17, 746-759. 720
Sorefan K, Booker J, Haurogne K, Goussot M, Bainbridge K, Foo E, 721
Chatfield S, Ward S, Beveridge C, Rameau C, Leyser O. (2003). 722
MAX4 and RMS1 are orthologous dioxygenase-like genes that regulate 723
shoot branching in Arabidopsis and pea. Genes Dev. 17, 1469-1474. 724
Stirnberg P, van De Sande K, Leyser HM. (2002). MAX1 and MAX2 725
control shoot lateral branching in Arabidopsis. Development. 129, 726
1131-1141. 727
Tamas IA, Schlossberg-Jacobs J, Lim R, Friedman L, and Barone C. 728
(1989). Effect of plant growth substances on the growth of axillary buds in 729
cultured stem segments of Phaseolus vulgaris. J. Plant Growth Regul. 8, 730
165-183. 731
Tan BC, Joseph LM, Deng WT, Liu L, Li QB, Cline K, McCarty DR. 732
(2003). Molecular characterization of the Arabidopsis 9-cis 733
epoxycarotenoid dioxygenase gene family. Plant J. 35, 44-56. 734
Tanaka M, Takei K, Kojima M, Sakakibara H, Mori H. (2006). Auxin 735
controls local cytokinin biosynthesis in the nodal stem in apical dominance. 736
26
Plant J. 45, 1028-1036. 737
Turnbull CGN, Myriam AA, Raymond ICD, Morris DSE. (1997). 738
Rapid increases in cytokinin concentration in lateral buds of chickpea 739
(Cicer arietinum L.) during release of apical dominance. Planta. 202, 740
271-276. 741
Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, 742
Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu K, Yoneyama K, 743
Kyozuka J, Yamaguchi S. (2008). Inhibition of shoot branching by new 744
terpenoid plant hormones. Nature. 455, 195-200. 745
Wang Z, Chen C, Xu Y, Jiang R, Han Y, Xu Z, Chong K. (2004). A 746
Practical Vector for Efficient Knockdown of Gene Expression in Rice 747
(Oryza sativa L.). Plant Mol Biol Rep. 22, 409-417. 748
Zou J, Chen Z, Zhang S, Zhang W, Jiang G, Zhao X, Zhai W, Pan X, 749
Zhu L. (2005). Characterizations and fine mapping of a mutant gene for 750
high tillering and dwarf in rice (Oryza sativa L.). Planta. 222, 604-612. 751
Zou J, Zhang S, Zhang W, Li G, Chen Z, Zhai W, Zhao X, Pan X, Xie 752
Q, Zhu L. (2006). The rice HIGH-TILLERING DWARF1 encoding an 753
ortholog of Arabidopsis MAX3 is required for negative regulation of the 754
outgrowth of axillary buds. Plant J. 48, 687-698. 755
756
757
758
27
Figure Legends 759
Figure 1. Phenotypes of D10 downregulated plants. 760
(A) Phenotypes and RT-PCR analysis in D10-RNAi plants (ki23 and ki25). 761
RT-PCR was repeated three times, and representative results are shown. 762
(B) Growth curves of tillers in wild type (WT) and D10-RNAi plants (ki23 763
and ki25). Data are means ± SE (n = 4). 764
(C) and (D) Elongation of tillers in KA plants (C) and in D10-RNAi plants 765
(D). Elongation Lengthes of axillary buds at nodes 1, 2 and 3 (counted 766
from top) were measured at 7 days after decapitation with or without 767
application of exogenous auxin NAA to the cut surface. Data are means ± 768
SE (n = 6). 769
Figure 2. Effects of auxin and cytokinin on D10 and HTD1 expression. 770
(A) D10 gene expression in different organs of KA plants. S, seedlings; R, 771
roots; L, leaves; IN, internodes; N, nodes; P, panicles. 772
(B) Effects of NAA on D10 and HTD1 expression. Node 1 from intact KA 773
plants was incubated in 10uM NAA buffer, from which total RNAs were 774
isolated for RT-PCR analysis. 775
(C) D10 and HTD1 expression after decapitation. Node 1, after 776
decapitation 1 cm above node 1 of KA plants, was collected at the 777
indicated times (hours). Total RNAs were isolated from these nodes for 778
RT-PCR analysis. 779
(D) Effects of NAA on D10 and HTD1 expression after decapitation. Node 780
1 was excised from the 10-hour decapitated KA plants, and then incubated 781
in 10uM NAA buffer. These nodes were collected at the indicated times 782
(hours) after incubation, from which total RNAs were isolated for RT-PCR 783
analysis. 784
(E) Effects of cytokinin on D10 and HTD1 expression. Node 1 from KA 785
plants was incubated with 10uM 6-BA buffer, from which total RNAs 786
were isolated for RT-PCR analysis. The numbers above each lane indicate 787
28
the incubated or decapitated time (hours) in (B), (C), (D) and (E). RT-PCR 788
was repeated three times and the rice Actin gene was amplified as a control 789
in(A), (B), (C), (D) and (E). 790
Figure 3. Auxin and Cytokinin content in D10-RNAi plants. 791
(A) Auxin content. Node 1 (WT-n1 from KA and ki23-n1 from ki23 plants) 792
and node 2 (WT-n2 from KA and ki23-n2 from ki23 plants) derived from 793
intact plants (normal) and 10-hour decapitated plants (decapitation), were 794
respectively collected for measurements of auxin contents. Data are means 795
± SE (n = 3). 796
(B) Cytokinin content. The excised shoot nodes (about 1 g) were 797
separately collected in intact and 10-hour decapitated plants. Cytokinin 798
content was analyzed as described in Experimental Procedures. Mean 799
value and SD were calculated from three replicate samples. WT-n1, 800
ki23-n1, DWT-n1 and Dki23-n1, node 1 excised respectively from the 801
intact KA, the intact ki23, the decapitated KA and the decapitated ki23 802
plants; WT-n2, ki23-n2, DWT-n2 and Dki23-n2, node 2 excised 803
respectively from the intact KA, the intact ki23, the decapitated KA and 804
the decapitated ki23 plants. Data are means ± SE (n = 3). 805
(C) Length of axillary buds at nodes 1 and 2 of D10-RNAi plants. axillary 806
buds at node 1 were not observed in KA (WT) and D10-RNAi plants (ki23 807
and ki25); Length of axillary buds at node 2 is respectively the average of 808
10 independent plants in KA (WT) and D10-RNAi plants (ki23 and ki25). 809
Data are means ± SE (n = 10). 810
Figure 4. OsIPT genes expression in shoot nodes of the D10-RNAi plants. 811
Nodes 1 and 2 of KA (WT) and ki23 plants were respectively collected at 812
0 hour (DC0) and 10 hours (DC10) after decapitation. Total RNAs were 813
isolated from these nodes for RT-PCR analysis (left). 814
Node 1 from 10-hour decapitated KA (WT) or ki23 plants was respectively 815
incubated in 10uM NAA buffer, and then respectively collected at 0 hour 816
(DC10+A0), 3 hours (DC10+A3) and 10 hours (DC10+A10) after 817
29
incubation, from which total RNAs were isolated for RT-PCR analysis 818
(Booker et al.). RT-PCR was repeated three times, and representative 819
results are shown. The bottom panel (Actin) was amplified as a control. 820
Figure 5. Storage cytokinin content in the excised shoot nodes of 821
D10-RNAi plants. 822
The excised shoot nodes (about 1 g) were separately collected in intact and 823
10-hour decapitated plants. The storage cytokinin content was analyzed as 824
described in Experimental Procedures. Mean value and SD were calculated 825
from three replicate samples. WT-n1, ki23-n1, DWT-n1 and Dki23-n1, 826
node 1 excised respectively from the intact KA, the intact ki23, the 827
decapitated KA and the decapitated ki23 plants; WT-n2, ki23-n2, DWT-n2 828
and Dki23-n2, node 2 excised respectively from the intact KA, the intact 829
ki23, the decapitated KA and the decapitated ki23 plants. Data are means ± 830
SE (n = 3). 831
Figure 6. The expression of OsPIN family in D10-RNAi plants. 832
OsPIN1, OsPIN2, OsPIN5a, OsPIN9 and OsPIN10a expression in 833
different organs of both WT and ki23 plants: S, seedlings; L leaves; IN, 834
internodes; N, nodes; P, panicles. RT-PCR was repeated three times, and 835
representative results are shown. The bottom panel (Actin) was amplified 836
as a control. 837
Figure 7. Model for D10, auxin and cytokinin action in regulating axillary 838
bud outgrowth in rice shoot nodes. 839
Arrows represent promotion, while flat-ended lines represent inhibition. In 840
nodes 1 and 2, D10 prompts the increased storage cytokinin levels which 841
cause the decreased active cytokinin levels, and auxin inhibit OsIPT gene 842
expression resulting in the increased active cytokinin contents. D10 843
inhibits axillary bud outgrowth possibly by reducing the final active 844
cytokinin contents in node 2. Auxin induces D10 expression and D10 845
represses auxin levels, which mainly occurs before axillary bud initiation 846
(in node 1).847
30
Tables and Figures 848
Figure 1 849
850
851
Figure 2 852
853
31
Figure 3 854
855
856
Figure 4 857
858
32
Figure 5 859
860
861
Figure 6 862
863
864
Figure 7 865
866